Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRDM16	63976	broad.mit.edu	37	1	3006479	3006480	+	Intron	INS	-	TCATTCAT	TCATTCAT	rs145476557	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3006479_3006480insTCATTCAT	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
C1orf174	339448	broad.mit.edu	37	1	3806283	3806286	+	3'UTR	DEL	AAAG	-	-	rs59405380		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3806283_3806286delAAAG	uc001alf.2	-	4					C1orf174_uc009vls.2_RNA	NM_207356	NP_997239			hypothetical protein LOC339448												0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	4376828	4376829	+	IGR	INS	-	A	A	rs144370157	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4376828_4376829insA								LOC100133612 (542951 upstream) : LOC284661 (95282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4711420	4711421	+	IGR	DEL	GT	-	-	rs34352274		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4711420_4711421delGT								LOC284661 (226676 upstream) : AJAP1 (3684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4994298	4994299	+	IGR	DEL	AA	-	-	rs111673433		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4994298_4994299delAA								AJAP1 (150448 upstream) : NPHP4 (928571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5090780	5090783	+	IGR	DEL	ATAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5090780_5090783delATAG								AJAP1 (246930 upstream) : NPHP4 (832087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5324372	5324372	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5324372delA								AJAP1 (480522 upstream) : NPHP4 (598498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5369274	5369274	+	IGR	DEL	T	-	-	rs35337495		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5369274delT								AJAP1 (525424 upstream) : NPHP4 (553596 downstream)																																			---	---	---	---
CHD5	26038	broad.mit.edu	37	1	6235320	6235321	+	Intron	INS	-	TGGA	TGGA	rs150588853	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6235320_6235321insTGGA	uc001amb.1	-							NM_015557	NP_056372			chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	6993513	6993513	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6993513delT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7036162	7036162	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7036162delC	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7751808	7751809	+	Intron	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7751808_7751809delGA	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	8296482	8296483	+	IGR	DEL	CT	-	-	rs113674583		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8296482_8296483delCT								ERRFI1 (210089 upstream) : SLC45A1 (87907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	9976916	9976919	+	IGR	DEL	AGAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9976916_9976919delAGAG								CTNNBIP1 (6600 upstream) : LZIC (12859 downstream)																																			---	---	---	---
KIF1B	23095	broad.mit.edu	37	1	10406432	10406433	+	Intron	INS	-	T	T	rs149252885	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10406432_10406433insT	uc001aqx.3	+						KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889			kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10443590	10443591	+	IGR	INS	-	C	C	rs144151559	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10443590_10443591insC								KIF1B (1931 upstream) : PGD (15494 downstream)																																			---	---	---	---
DFFA	1676	broad.mit.edu	37	1	10527572	10527572	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10527572delT	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392			DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10901001	10901001	+	IGR	DEL	T	-	-	rs35154018		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10901001delT								CASZ1 (44294 upstream) : C1orf127 (105532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11038766	11038767	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11038766_11038767insA								C1orf127 (14508 upstream) : TARDBP (33912 downstream)																																			---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11311217	11311218	+	Intron	INS	-	C	C	rs143609799	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11311217_11311218insC	uc001asd.2	-							NM_004958	NP_004949			FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	11607674	11607675	+	IGR	DEL	AG	-	-	rs34399641		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11607674_11607675delAG								PTCHD2 (10035 upstream) : FBXO2 (100775 downstream)																																			---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12564003	12564003	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12564003delG	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron|VPS13D_uc010obd.1_Intron	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	14620170	14620170	+	IGR	DEL	A	-	-	rs33988852		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14620170delA								PRDM2 (468598 upstream) : KAZ (305043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14809853	14809853	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14809853delC								PRDM2 (658281 upstream) : KAZ (115360 downstream)																																			---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15070326	15070326	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15070326delG	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15172056	15172059	+	Intron	DEL	TGGA	-	-	rs141248774	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15172056_15172059delTGGA	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	15996049	15996049	+	IGR	DEL	G	-	-	rs34920556		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15996049delG								RSC1A1 (7833 upstream) : PLEKHM2 (14778 downstream)																																			---	---	---	---
ARHGEF19	128272	broad.mit.edu	37	1	16529684	16529686	+	Intron	DEL	GGG	-	-	rs141788184		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16529684_16529686delGGG	uc001ayc.1	-						ARHGEF19_uc009voo.1_Intron|ARHGEF19_uc001ayb.1_Intron	NM_153213	NP_694945			Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16953247	16953248	+	5'Flank	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16953247_16953248delCT	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	17732305	17732308	+	IGR	DEL	GAAA	-	-	rs140538553		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17732305_17732308delGAAA								PADI6 (4110 upstream) : RCC2 (944 downstream)																																			---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18533042	18533043	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18533042_18533043insA	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	18813276	18813277	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18813276_18813277insA								KLHDC7A (737 upstream) : PAX7 (144223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	20180207	20180208	+	IGR	INS	-	A	A	rs139616044	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20180207_20180208insA								RNF186 (38436 upstream) : OTUD3 (28680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	20780183	20780183	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20780183delA								VWA5B1 (98796 upstream) : CAMK2N1 (28702 downstream)																																			---	---	---	---
MUL1	79594	broad.mit.edu	37	1	20830368	20830368	+	Intron	DEL	T	-	-	rs111696728		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20830368delT	uc001bdi.3	-							NM_024544	NP_078820			mitochondrial ubiquitin ligase activator of NFKB						activation of caspase activity|activation of JUN kinase activity|induction of apoptosis|mitochondrial fission|mitochondrion localization|negative regulation of cell growth|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to mitochondrial outer membrane|nucleus|peroxisome	identical protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20851900	20851900	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20851900delG								MUL1 (17226 upstream) : FAM43B (27032 downstream)																																			---	---	---	---
KIF17	57576	broad.mit.edu	37	1	21036592	21036593	+	Intron	DEL	TA	-	-	rs143736659		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21036592_21036593delTA	uc001bdr.3	-						KIF17_uc001bds.3_Intron	NM_020816	NP_065867			kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22221624	22221624	+	Intron	DEL	G	-	-	rs5772969		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22221624delG	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron|HSPG2_uc009vqe.1_Intron	NM_005529	NP_005520			heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22235083	22235083	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22235083delA	uc001bfj.2	-						HSPG2_uc009vqd.2_Intron	NM_005529	NP_005520			heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
EPHB2	2048	broad.mit.edu	37	1	23070264	23070264	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23070264delC	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145			ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)										Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	1	23986408	23986410	+	IGR	DEL	TTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23986408_23986410delTTT								MDS2 (19352 upstream) : RPL11 (31884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	24169064	24169064	+	IGR	DEL	A	-	-	rs112962968		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24169064delA								HMGCL (3954 upstream) : FUCA1 (2510 downstream)																																			---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24435886	24435886	+	Intron	DEL	C	-	-	rs5773068		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24435886delC	uc001bin.3	-						MYOM3_uc001bio.2_Intron|MYOM3_uc001bip.1_5'Flank	NM_152372	NP_689585			myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
MAN1C1	57134	broad.mit.edu	37	1	25957438	25957439	+	Intron	INS	-	TTTG	TTTG	rs146519636	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25957438_25957439insTTTG	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron	NM_020379	NP_065112			mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)														---	---	---	---
C1orf135	79000	broad.mit.edu	37	1	26182855	26182855	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26182855delA	uc001bkw.1	-							NM_024037	NP_076942			aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27404139	27404140	+	IGR	INS	-	A	A	rs79433951		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27404139_27404140insA								FAM46B (64806 upstream) : SLC9A1 (21161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	28471051	28471051	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28471051delA								LOC653566 (47982 upstream) : PTAFR (4813 downstream)																																			---	---	---	---
DNAJC8	22826	broad.mit.edu	37	1	28558231	28558231	+	Intron	DEL	A	-	-	rs113876916		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28558231delA	uc001bpn.2	-						DNAJC8_uc001bpo.2_Intron	NM_014280	NP_055095			DnaJ (Hsp40) homolog, subfamily C, member 8						nuclear mRNA splicing, via spliceosome|protein folding	nucleoplasm	heat shock protein binding|unfolded protein binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
OPRD1	4985	broad.mit.edu	37	1	29139385	29139386	+	Intron	INS	-	CTTGCTT	CTTGCTT	rs142483128	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29139385_29139386insCTTGCTT	uc001brf.1	+							NM_000911	NP_000902			opioid receptor, delta 1						immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	30481767	30481768	+	IGR	INS	-	TT	TT	rs140099102	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30481767_30481768insTT								PTPRU (828452 upstream) : MATN1 (702358 downstream)																																			---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34081846	34081846	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34081846delT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxo.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	37023346	37023347	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37023346_37023347delTG								CSF3R (74837 upstream) : GRIK3 (237781 downstream)																																			---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37400941	37400941	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37400941delC	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	37568434	37568435	+	IGR	INS	-	AGA	AGA	rs72154778		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568434_37568435insAGA								GRIK3 (68590 upstream) : ZC3H12A (371684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37932501	37932501	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37932501delA								GRIK3 (432657 upstream) : ZC3H12A (7618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	38625419	38625419	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38625419delG								POU3F1 (112969 upstream) : RRAGC (679596 downstream)																																			---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42256793	42256794	+	Intron	DEL	AC	-	-	rs112437801		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42256793_42256794delAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	42522518	42522519	+	IGR	DEL	CA	-	-	rs150862474		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42522518_42522519delCA								HIVEP3 (20922 upstream) : GUCA2B (96573 downstream)																																			---	---	---	---
ST3GAL3	6487	broad.mit.edu	37	1	44209930	44209930	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44209930delT	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270			sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)																---	---	---	---
ZSWIM5	57643	broad.mit.edu	37	1	45636099	45636099	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45636099delT	uc001cnd.2	-							NM_020883	NP_065934			zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
NSUN4	387338	broad.mit.edu	37	1	46810951	46810951	+	Intron	DEL	T	-	-	rs146311377		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46810951delT	uc001cpr.1	+						NSUN4_uc010omc.1_Intron|NSUN4_uc009vyf.1_Intron|NSUN4_uc009vyg.1_Intron|NSUN4_uc001cpt.1_Intron|NSUN4_uc001cps.1_Intron	NM_199044	NP_950245			NOL1/NOP2/Sun domain family 4 protein								methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
FAAH	2166	broad.mit.edu	37	1	46860611	46860611	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46860611delT	uc001cpu.2	+							NM_001441	NP_001432			fatty acid amide hydrolase						fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	47791629	47791629	+	IGR	DEL	G	-	-	rs66929207		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47791629delG								TAL1 (11810 upstream) : CMPK1 (7840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	47848450	47848453	+	IGR	DEL	TTTC	-	-	rs146954008		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47848450_47848453delTTTC								CMPK1 (3940 upstream) : FOXE3 (33291 downstream)																																			---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49177389	49177420	+	Intron	DEL	CTCCCTCTCTCCCTTCCCTTTCCCCATAATTT	-	-	rs142566223		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49177389_49177420delCTCCCTCTCTCCCTTCCCTTTCCCCATAATTT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50546089	50546090	+	Intron	DEL	CA	-	-	rs71751816		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50546089_50546090delCA	uc001cry.3	+							NM_001144777	NP_001138249			ELAV-like 4 isoform 5						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
FAF1	11124	broad.mit.edu	37	1	51138928	51138929	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51138928_51138929insA	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982			FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)														---	---	---	---
EPS15	2060	broad.mit.edu	37	1	51834695	51834696	+	Intron	INS	-	CTTTTCTCTGT	CTTTTCTCTGT	rs147937689	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51834695_51834696insCTTTTCTCTGT	uc001csq.1	-						EPS15_uc009vyz.1_Intron|EPS15_uc001csp.3_Intron	NM_001981	NP_001972			epidermal growth factor receptor pathway						cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2								T	MLL	ALL								---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52645306	52645306	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52645306delA	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54019832	54019832	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54019832delA	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
C1orf83	127428	broad.mit.edu	37	1	54542673	54542674	+	Intron	INS	-	AGG	AGG	rs138400473	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54542673_54542674insAGG	uc001cwt.1	+						C1orf83_uc001cwu.1_Intron	NM_153035	NP_694580			hypothetical protein LOC127428						transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
C1orf83	127428	broad.mit.edu	37	1	54547352	54547354	+	Intron	DEL	GTC	-	-	rs142072366		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54547352_54547354delGTC	uc001cwt.1	+						C1orf83_uc001cwu.1_Intron	NM_153035	NP_694580			hypothetical protein LOC127428						transcription, DNA-dependent	nucleus	DNA binding				0																OREG0013495	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54768956	54768957	+	Intron	INS	-	C	C	rs139480911	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54768956_54768957insC	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	60433990	60433991	+	IGR	INS	-	CT	CT	rs149277011	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60433990_60433991insCT								CYP2J2 (41567 upstream) : C1orf87 (20833 downstream)																																			---	---	---	---
TM2D1	83941	broad.mit.edu	37	1	62172507	62172510	+	Intron	DEL	AAAG	-	-	rs112695394		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62172507_62172510delAAAG	uc001czz.1	-							NM_032027	NP_114416			beta-amyloid binding protein precursor						apoptosis					ovary(1)	1																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62483401	62483402	+	Intron	INS	-	AA	AA	rs79432881		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62483401_62483402insAA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62484915	62484915	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62484915delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62602334	62602337	+	Intron	DEL	TGTC	-	-	rs71792781	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62602334_62602337delTGTC	uc001dab.2	+						INADL_uc001dac.2_Intron|INADL_uc009wag.2_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	63685383	63685383	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63685383delT	uc001daw.1	-											Homo sapiens cDNA clone IMAGE:4838722.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	63763281	63763281	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63763281delG	uc001daw.1	-											Homo sapiens cDNA clone IMAGE:4838722.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	65548839	65548840	+	IGR	DEL	CA	-	-	rs112300722		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65548839_65548840delCA								MIR101-1 (24648 upstream) : AK3L1 (64392 downstream)																																			---	---	---	---
AK3L1	205	broad.mit.edu	37	1	65649334	65649337	+	Intron	DEL	GTGT	-	-	rs143040959		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65649334_65649337delGTGT	uc001dby.2	+						AK3L1_uc009wan.2_Intron|AK3L1_uc001dbz.2_Intron|AK3L1_uc001dca.2_Intron	NM_203464	NP_982289			adenylate kinase 3-like 1 isoform 7							mitochondrial matrix	adenylate kinase activity|ATP binding|GTP binding				0																		---	---	---	---
LEPR	3953	broad.mit.edu	37	1	65984696	65984697	+	Intron	INS	-	TT	TT	rs150252469	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65984696_65984697insTT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294			leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)														---	---	---	---
LEPR	3953	broad.mit.edu	37	1	66060860	66060861	+	Intron	INS	-	T	T	rs148248255	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66060860_66060861insT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294			leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)														---	---	---	---
PDE4B	5142	broad.mit.edu	37	1	66369103	66369104	+	Intron	DEL	CA	-	-	rs67594381		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66369103_66369104delCA	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron	NM_001037341	NP_001032418			phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)													---	---	---	---
WLS	79971	broad.mit.edu	37	1	68677001	68677001	+	Intron	DEL	A	-	-	rs150555513		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68677001delA	uc001def.1	-						WLS_uc001dee.2_Intron|WLS_uc001deg.1_Intron|WLS_uc001deh.1_Intron	NM_024911	NP_079187			G protein-coupled receptor 177 isoform 1						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0																		---	---	---	---
DEPDC1	55635	broad.mit.edu	37	1	68956069	68956070	+	Intron	INS	-	TTAG	TTAG	rs148743576	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68956069_68956070insTTAG	uc001dem.3	-						DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592			DEP domain containing 1 isoform a						intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)														---	---	---	---
ANKRD13C	81573	broad.mit.edu	37	1	70808422	70808423	+	Intron	INS	-	AC	AC	rs113562667		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70808422_70808423insAC	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443			ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	71648173	71648173	+	Intron	DEL	T	-	-	rs76799657		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71648173delT	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																														---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	71893801	71893801	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71893801delG	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75103597	75103598	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75103597_75103598delAA	uc001dgg.2	-							NM_001002912	NP_001002912			hypothetical protein LOC127254											ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	75429111	75429111	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75429111delA								TYW3 (196753 upstream) : LHX8 (165008 downstream)																																			---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75880010	75880011	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75880010_75880011delAC	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	76081102	76081103	+	Intron	DEL	AC	-	-	rs112574817		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76081102_76081103delAC	uc010oqz.1	-						SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_001130058	NP_001123530			solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76803584	76803584	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76803584delC	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	77019040	77019041	+	Intron	INS	-	A	A	rs143141892	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77019040_77019041insA	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	77215931	77215931	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77215931delA								ST6GALNAC3 (119262 upstream) : ST6GALNAC5 (117255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79013529	79013529	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79013529delT								PTGFR (7144 upstream) : IFI44L (72559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	80539539	80539539	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80539539delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	80711235	80711235	+	IGR	DEL	T	-	-	rs143221280		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80711235delT								None (None upstream) : None (None downstream)																																			---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82411553	82411554	+	Intron	DEL	TC	-	-	rs3838455		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82411553_82411554delTC	uc001dit.3	+						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Intron|LPHN2_uc001div.2_Intron|LPHN2_uc009wcd.2_Intron	NM_012302	NP_036434			latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	82653634	82653634	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82653634delC								LPHN2 (195528 upstream) : None (None downstream)																																			---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85800199	85800199	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85800199delG	uc001dlb.2	-						DDAH1_uc001dlc.2_Intron|uc001dla.1_Intron|DDAH1_uc010osb.1_Intron|DDAH1_uc009wco.2_Intron	NM_012137	NP_036269			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	86063274	86063283	+	IGR	DEL	CACACACACA	-	-	rs67834648		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86063274_86063283delCACACACACA								CYR61 (13628 upstream) : ZNHIT6 (55209 downstream)																																			---	---	---	---
LOC339524	339524	broad.mit.edu	37	1	87588283	87588284	+	Intron	INS	-	ACTC	ACTC	rs139923266	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87588283_87588284insACTC	uc001dme.1	+							NM_001134492	NP_001127964			heparan sulfate 2-O-sulfotransferase 1 isoform												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	88211647	88211647	+	IGR	DEL	T	-	-	rs5775953		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88211647delT								LMO4 (397044 upstream) : PKN2 (938275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88823722	88823722	+	IGR	DEL	A	-	-	rs5775982		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88823722delA								None (None upstream) : PKN2 (326200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88985029	88985029	+	IGR	DEL	T	-	-	rs137916190		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88985029delT								None (None upstream) : PKN2 (164893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89044956	89044956	+	IGR	DEL	A	-	-	rs111380274		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89044956delA								None (None upstream) : PKN2 (104966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89467164	89467164	+	IGR	DEL	T	-	-	rs4656074		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89467164delT								CCBL2 (8521 upstream) : GBP3 (5203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89714541	89714541	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89714541delC								GBP4 (49908 upstream) : GBP5 (10095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91354293	91354293	+	IGR	DEL	T	-	-	rs67402557		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91354293delT								BARHL2 (171499 upstream) : ZNF644 (26567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91626915	91626916	+	IGR	INS	-	C	C	rs142104102	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91626915_91626916insC								ZNF644 (139244 upstream) : HFM1 (99408 downstream)																																			---	---	---	---
HFM1	164045	broad.mit.edu	37	1	91776816	91776816	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91776816delG	uc001doa.3	-						HFM1_uc009wdb.2_Intron|HFM1_uc010osu.1_Intron|HFM1_uc001dob.3_Intron|HFM1_uc010osv.1_Intron	NM_001017975	NP_001017975			HFM1 protein								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	92081839	92081839	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92081839delC								CDC7 (90519 upstream) : HSP90B3P (18729 downstream)																																			---	---	---	---
TGFBR3	7049	broad.mit.edu	37	1	92342457	92342457	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92342457delA	uc001doh.2	-						TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234			transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)														---	---	---	---
BTBD8	284697	broad.mit.edu	37	1	92592063	92592064	+	Intron	INS	-	GT	GT	rs148177634	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92592063_92592064insGT	uc001doo.2	+						BTBD8_uc010otc.1_Intron	NM_183242	NP_899065			BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)														---	---	---	---
C1orf146	388649	broad.mit.edu	37	1	92684040	92684041	+	Intron	INS	-	A	A	rs143763620	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92684040_92684041insA	uc001doq.2	+						C1orf146_uc010ote.1_Intron	NM_001012425	NP_001012425			hypothetical protein LOC388649											ovary(1)	1		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)														---	---	---	---
RPAP2	79871	broad.mit.edu	37	1	92814528	92814533	+	Intron	DEL	ATAAAG	-	-	rs67169831		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92814528_92814533delATAAAG	uc001dot.2	+						RPAP2_uc009wdh.2_Intron	NM_024813	NP_079089			RNA polymerase II associated protein 2							integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)														---	---	---	---
FAM69A	388650	broad.mit.edu	37	1	93365868	93365869	+	Intron	INS	-	T	T	rs145605905	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93365868_93365869insT	uc001dpg.2	-						FAM69A_uc001dpc.2_Intron	NM_001006605	NP_001006606			family with sequence similarity 69, member A							endoplasmic reticulum membrane|integral to membrane					0		all_lung(203;0.00265)|Lung NSC(277;0.00562)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000563)|all cancers(265;0.000751)|Epithelial(280;0.127)														---	---	---	---
ARHGAP29	9411	broad.mit.edu	37	1	94739458	94739458	+	Intron	DEL	A	-	-	rs146481028		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94739458delA	uc009wdq.1	-							NM_004815				PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95542540	95542540	+	IGR	DEL	T	-	-	rs139928000		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95542540delT								ALG14 (4033 upstream) : TMEM56 (40354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	97079060	97079060	+	IGR	DEL	G	-	-	rs76198541		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97079060delG								None (None upstream) : PTBP2 (108115 downstream)																																			---	---	---	---
DPYD	1806	broad.mit.edu	37	1	97942292	97942292	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97942292delA	uc001drv.2	-							NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	99099858	99099859	+	IGR	INS	-	AC	AC	rs146779485	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99099858_99099859insAC								MIR137 (588131 upstream) : SNX7 (27377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	99235613	99235614	+	IGR	INS	-	A	A	rs143955471	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99235613_99235614insA								SNX7 (9559 upstream) : LPPR5 (120189 downstream)																																			---	---	---	---
LRRC39	127495	broad.mit.edu	37	1	100626775	100626776	+	Intron	DEL	AT	-	-	rs66615807		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100626775_100626776delAT	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221			leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	102505051	102505052	+	IGR	DEL	AT	-	-	rs71739164		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102505051_102505052delAT								OLFM3 (42261 upstream) : COL11A1 (836972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102955386	102955386	+	IGR	DEL	A	-	-	rs34779570		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102955386delA								OLFM3 (492596 upstream) : COL11A1 (386638 downstream)																																			---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103547330	103547330	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103547330delT	uc001dul.2	-						COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	106544402	106544402	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106544402delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	107115706	107115706	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107115706delC								None (None upstream) : PRMT6 (483561 downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107838621	107838621	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107838621delC	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
AKNAD1	254268	broad.mit.edu	37	1	109395586	109395586	+	Intron	DEL	A	-	-	rs114787340	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109395586delA	uc001dwa.2	-						AKNAD1_uc010ovb.1_Intron|AKNAD1_uc001dwb.2_Intron	NM_152763	NP_689976			hypothetical protein LOC254268											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	109990276	109990276	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109990276delA								PSMA5 (21239 upstream) : SYPL2 (18824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	111125992	111125992	+	IGR	DEL	C	-	-	rs35860905		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111125992delC								KCNA10 (64195 upstream) : KCNA2 (10211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	111597886	111597886	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111597886delT								C1orf103 (91320 upstream) : DRAM2 (62069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	113607033	113607039	+	Intron	DEL	GCAGGAG	-	-	rs72036287		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113607033_113607039delGCAGGAG	uc001ede.1	-											Homo sapiens cDNA clone IMAGE:4798439.																														---	---	---	---
SYT6	148281	broad.mit.edu	37	1	114679535	114679536	+	Intron	DEL	AT	-	-	rs143079939		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114679535_114679536delAT	uc001eev.2	-							NM_205848	NP_995320			synaptotagmin VI						acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	114764323	114764324	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114764323_114764324insA								SYT6 (67851 upstream) : TRIM33 (171077 downstream)																																			---	---	---	---
BCAS2	10286	broad.mit.edu	37	1	115119847	115119848	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115119847_115119848delTG	uc001efa.2	-						DENND2C_uc001eez.2_Intron	NM_005872	NP_005863			breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
NGF	4803	broad.mit.edu	37	1	115846799	115846799	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115846799delT	uc001efu.1	-							NM_002506	NP_002497			nerve growth factor, beta polypeptide precursor						activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	117023575	117023576	+	IGR	INS	-	GTGTGTAT	GTGTGTAT	rs143045551	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117023575_117023576insGTGTGTAT								C1orf203 (62331 upstream) : CD58 (33581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119179409	119179411	+	IGR	DEL	TTA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119179409_119179411delTTA								SPAG17 (451561 upstream) : TBX15 (246255 downstream)																																			---	---	---	---
HSD3B2	3284	broad.mit.edu	37	1	119984697	119984697	+	Intron	DEL	T	-	-	rs72329136		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119984697delT	uc001ehu.2	+											RecName: Full=3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; AltName: Full=3-beta-HSD II; Includes:   RecName: Full=3-beta-hydroxy-Delta(5)-steroid dehydrogenase;            EC=1.1.1.145;   AltName: Full=3-beta-hydroxy-5-ene steroid dehydrogenase;   AltName: Full=Progesterone reductase; Includes:   RecName: Full=Steroid Delta-isomerase;            EC=5.3.3.1;   AltName: Full=Delta-5-3-ketosteroid isomerase;						androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)													---	---	---	---
NBPF7	343505	broad.mit.edu	37	1	120381686	120381687	+	Intron	INS	-	TGTGAGTCA	TGTGAGTCA	rs144031576	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120381686_120381687insTGTGAGTCA	uc010oxk.1	-							NM_001047980	NP_001041445			hypothetical protein LOC343505							cytoplasm				ovary(1)|skin(1)	2	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;3.66e-05)|Lung NSC(69;0.000192)|all_epithelial(167;0.0347)		Lung(183;0.0103)|LUSC - Lung squamous cell carcinoma(189;0.0544)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120602929	120602932	+	Intron	DEL	GAGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120602929_120602932delGAGA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	142551474	142551475	+	IGR	DEL	TA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142551474_142551475delTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142566261	142566264	+	IGR	DEL	AATA	-	-	rs4241005		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142566261_142566264delAATA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142863341	142863342	+	Intron	INS	-	A	A	rs144184380		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142863341_142863342insA	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143177107	143177109	+	Intron	DEL	TTA	-	-	rs112652052		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143177107_143177109delTTA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143411083	143411084	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143411083_143411084insA								None (None upstream) : LOC100286793 (236555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143504763	143504764	+	IGR	INS	-	A	A	rs150986294	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143504763_143504764insA								None (None upstream) : LOC100286793 (142875 downstream)																																			---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144864861	144864861	+	Intron	DEL	C	-	-	rs113926963		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144864861delC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron|PDE4DIP_uc001ema.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144888047	144888048	+	Intron	INS	-	C	C	rs149107166		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144888047_144888048insC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145199593	145199594	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145199593_145199594delAC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145278747	145278748	+	Intron	INS	-	TCTT	TCTT	rs9286826		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145278747_145278748insTCTT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145376758	145376759	+	Intron	INS	-	AC	AC	rs138893347	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145376758_145376759insAC	uc001emp.3	+						uc001eng.1_5'Flank|uc001enh.1_5'Flank	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145611594	145611594	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145611594delT	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron|POLR3C_uc001eog.2_5'Flank|POLR3C_uc001eoh.2_5'Flank|POLR3C_uc001eoi.2_5'Flank|POLR3C_uc009wix.2_5'Flank	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
FMO5	2330	broad.mit.edu	37	1	146670429	146670430	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146670429_146670430insA	uc001epi.2	-						FMO5_uc001eph.3_Intron|FMO5_uc001epj.2_Intron	NM_001461	NP_001452			flavin containing monooxygenase 5 isoform 1							integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	146706734	146706735	+	IGR	DEL	TG	-	-	rs72059521		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146706734_146706735delTG								FMO5 (9504 upstream) : CHD1L (7556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149224233	149224234	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149224233_149224234insT								LOC645166 (271179 upstream) : LOC388692 (55242 downstream)																																			---	---	---	---
OTUD7B	56957	broad.mit.edu	37	1	149957683	149957683	+	Intron	DEL	A	-	-	rs141800132		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149957683delA	uc001etn.2	-							NM_020205	NP_064590			zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
VPS45	11311	broad.mit.edu	37	1	150073373	150073373	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150073373delA	uc001etp.2	+						VPS45_uc010pbp.1_Intron|VPS45_uc010pbq.1_Intron|VPS45_uc010pbs.1_Intron|VPS45_uc001etq.2_Intron	NM_007259	NP_009190			vacuolar protein sorting 45A						blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
PSMD4	5710	broad.mit.edu	37	1	151237087	151237087	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151237087delA	uc001exl.2	+						PSMD4_uc001exn.2_Intron	NM_002810	NP_002801			proteasome 26S non-ATPase subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
TDRKH	11022	broad.mit.edu	37	1	151742560	151742588	+	3'UTR	DEL	GGAGAGGGAGACCATGGGGAGACGGAGAC	-	-	rs140076465	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151742560_151742588delGGAGAGGGAGACCATGGGGAGACGGAGAC	uc001eyy.2	-	14										SubName: Full=cDNA FLJ54003, highly similar to Tudor and KH domain-containing protein;								RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152445289	152445289	+	IGR	DEL	G	-	-	rs150520768	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152445289delG								CRNN (58539 upstream) : LCE5A (38031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	155585136	155585136	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155585136delA	uc001fle.1	-											full-length cDNA clone CS0CAP008YC15 of Thymus of Homo sapiens (human).																														---	---	---	---
SEMA4A	64218	broad.mit.edu	37	1	156126537	156126538	+	Intron	DEL	TT	-	-	rs34913247		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156126537_156126538delTT	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762			semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	156150400	156150401	+	IGR	INS	-	T	T	rs11377288		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156150400_156150401insT								SEMA4A (2866 upstream) : SLC25A44 (13329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157845772	157845772	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157845772delT								CD5L (34138 upstream) : KIRREL (117291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158894107	158894116	+	IGR	DEL	CACACACACA	-	-	rs72434450		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158894107_158894116delCACACACACA								MNDA (74837 upstream) : PYHIN1 (7226 downstream)																																			---	---	---	---
CADM3	57863	broad.mit.edu	37	1	159162835	159162836	+	Intron	DEL	TA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159162835_159162836delTA	uc001ftl.2	+						CADM3_uc009wsx.1_Intron|CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Intron	NM_001127173	NP_001120645			cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	159974359	159974360	+	IGR	INS	-	T	T	rs146824445		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159974359_159974360insT								SLAMF9 (50315 upstream) : PIGM (23102 downstream)																																			---	---	---	---
LY9	4063	broad.mit.edu	37	1	160770165	160770168	+	Intron	DEL	CTAT	-	-	rs141577639		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160770165_160770168delCTAT	uc001fwu.2	+						LY9_uc001fwt.2_Intron|LY9_uc010pjs.1_Intron|LY9_uc001fwv.2_Intron|LY9_uc001fww.2_Intron|LY9_uc001fwx.2_Intron|LY9_uc001fwy.1_Intron	NM_002348	NP_002339			lymphocyte antigen 9 isoform a						cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
B4GALT3	8703	broad.mit.edu	37	1	161142473	161142474	+	Intron	INS	-	TTAG	TTAG	rs151295583	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161142473_161142474insTTAG	uc001fyq.1	-						PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Intron|B4GALT3_uc001fyo.1_Intron|B4GALT3_uc001fyp.1_Intron|B4GALT3_uc001fyr.1_Intron|B4GALT3_uc001fys.1_Intron	NM_003779	NP_003770			UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|metal ion binding|N-acetyllactosamine synthase activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	162399815	162399816	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162399815_162399816insA								SH2D1B (17887 upstream) : UHMK1 (67148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163678665	163678665	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163678665delT								NUF2 (353112 upstream) : PBX1 (850137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164194822	164194824	+	IGR	DEL	TTG	-	-	rs72388009		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164194822_164194824delTTG								NUF2 (869269 upstream) : PBX1 (333978 downstream)																																			---	---	---	---
ALDH9A1	223	broad.mit.edu	37	1	165639666	165639666	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165639666delT	uc001gdh.1	-						ALDH9A1_uc010pky.1_Intron|ALDH9A1_uc010pkz.1_Intron|ALDH9A1_uc010pla.1_Intron	NM_000696	NP_000687			aldehyde dehydrogenase 9A1						carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)													---	---	---	---
TMCO1	54499	broad.mit.edu	37	1	165720942	165720942	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165720942delA	uc001gdj.3	-						TMCO1_uc001gdl.3_Intron|TMCO1_uc001gdm.3_Intron|TMCO1_uc001gdk.3_Intron|TMCO1_uc001gdn.3_Intron	NM_019026	NP_061899			transmembrane and coiled-coil domains 1							endoplasmic reticulum membrane|Golgi membrane|integral to membrane				central_nervous_system(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167281474	167281475	+	Intron	INS	-	T	T	rs74510479		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167281474_167281475insT	uc001gec.2	+						POU2F1_uc010plg.1_Intron|POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167365924	167365925	+	Intron	DEL	AC	-	-	rs34119749		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167365924_167365925delAC	uc001gec.2	+						POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Intron|POU2F1_uc001geg.2_Intron|POU2F1_uc009wvg.1_5'Flank	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	168527181	168527198	+	IGR	DEL	GTGTGTGTGTGTGTGTGT	-	-	rs66493757		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168527181_168527198delGTGTGTGTGTGTGTGTGT								XCL2 (13946 upstream) : XCL1 (18658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168638139	168638139	+	IGR	DEL	T	-	-	rs71855349		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168638139delT								XCL1 (86824 upstream) : DPT (26568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170259450	170259450	+	IGR	DEL	A	-	-	rs72318504		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170259450delA								LOC284688 (6101 upstream) : GORAB (241813 downstream)																																			---	---	---	---
C1orf129	80133	broad.mit.edu	37	1	170902653	170902654	+	5'Flank	INS	-	GAAG	GAAG	rs143214493	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170902653_170902654insGAAG	uc001ghg.2	+						C1orf129_uc009wvy.2_5'Flank|C1orf129_uc010plz.1_5'Flank	NM_025063	NP_079339			hypothetical protein LOC80133 isoform 2								binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
FMO4	2329	broad.mit.edu	37	1	171283477	171283478	+	5'Flank	INS	-	A	A	rs149013294	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171283477_171283478insA	uc001gho.2	+							NM_002022	NP_002013			flavin containing monooxygenase 4						xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			kidney(2)|skin(1)	3	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	172439739	172439739	+	IGR	DEL	A	-	-	rs111703114		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172439739delA								C1orf105 (1774 upstream) : C1orf9 (62521 downstream)																																			---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174164978	174164978	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174164978delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174210077	174210078	+	Intron	DEL	TG	-	-	rs71958106		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174210077_174210078delTG	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174305992	174305993	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174305992_174305993delTG	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174759905	174759906	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174759905_174759906delGT	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	175171506	175171507	+	IGR	DEL	AA	-	-	rs34229359		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175171506_175171507delAA								KIAA0040 (9277 upstream) : TNR (120428 downstream)																																			---	---	---	---
TNR	7143	broad.mit.edu	37	1	175479507	175479507	+	Intron	DEL	A	-	-	rs145752590		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175479507delA	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276			tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	175765739	175765739	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175765739delA								TNR (52987 upstream) : RFWD2 (148228 downstream)																																			---	---	---	---
ABL2	27	broad.mit.edu	37	1	179103846	179103851	+	Intron	DEL	CCTCTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179103846_179103851delCCTCTC	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron|ABL2_uc001gmg.3_Intron|ABL2_uc001gmi.3_Intron|ABL2_uc001gmh.3_Intron|ABL2_uc010pne.1_Intron|ABL2_uc009wxf.1_Intron|ABL2_uc001gmk.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
FAM163A	148753	broad.mit.edu	37	1	179784240	179784249	+	3'UTR	DEL	GCGCGCACAG	-	-	rs71571091		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179784240_179784249delGCGCGCACAG	uc009wxj.2	+	6					FAM163A_uc001gnj.2_3'UTR|FAM163A_uc009wxk.2_3'UTR	NM_173509	NP_775780			hypothetical protein LOC148753							integral to membrane				ovary(1)	1																OREG0014016	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	180512309	180512315	+	IGR	DEL	GGGGAGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180512309_180512315delGGGGAGA								ACBD6 (40287 upstream) : XPR1 (88831 downstream)																																			---	---	---	---
CACNA1E	777	broad.mit.edu	37	1	181470299	181470299	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181470299delA	uc001gow.2	+							NM_000721	NP_000712			calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	182261926	182261926	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182261926delG								ZNF648 (231079 upstream) : GLUL (89743 downstream)																																			---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183056953	183056953	+	Intron	DEL	T	-	-	rs111291713		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183056953delT	uc001gpy.3	+						LAMC1_uc001gpx.2_Intron	NM_002293	NP_002284			laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	184054125	184054125	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184054125delT								TSEN15 (10784 upstream) : C1orf21 (302025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	184160890	184160890	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184160890delT								TSEN15 (117549 upstream) : C1orf21 (195260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	184746348	184746349	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184746348_184746349delTG								EDEM3 (22307 upstream) : FAM129A (13818 downstream)																																			---	---	---	---
C1orf27	54953	broad.mit.edu	37	1	186385207	186385207	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186385207delT	uc001grw.2	+						C1orf27_uc010poq.1_Intron|C1orf27_uc010por.1_Intron	NM_017847	NP_060317			odorant response abnormal 4 isoform 1							integral to membrane	oxidoreductase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	190762188	190762188	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190762188delC								FAM5C (315429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191643751	191643751	+	IGR	DEL	G	-	-	rs36050501		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191643751delG								None (None upstream) : RGS18 (483841 downstream)																																			---	---	---	---
TROVE2	6738	broad.mit.edu	37	1	193058095	193058095	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193058095delC	uc009wyq.2	+						TROVE2_uc001gsw.2_Intron|TROVE2_uc009wyp.2_Intron|TROVE2_uc001gsy.2_RNA	NM_004600	NP_004591			TROVE domain family, member 2 isoform 2						transcription from RNA polymerase III promoter	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|RNA binding				0																		---	---	---	---
CDC73	79577	broad.mit.edu	37	1	193116492	193116493	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193116492_193116493insT	uc001gtb.2	+							NM_024529	NP_078805			parafibromin						cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49														Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	195112287	195112288	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195112287_195112288delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195822344	195822345	+	IGR	INS	-	C	C	rs139901535	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195822344_195822345insC								None (None upstream) : KCNT2 (372568 downstream)																																			---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196517542	196517542	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196517542delC	uc001gtd.1	-						KCNT2_uc001gte.1_Intron|KCNT2_uc001gtf.1_Intron|KCNT2_uc001gtg.1_Intron|KCNT2_uc009wyu.2_Intron|KCNT2_uc009wyv.1_Intron	NM_198503	NP_940905			potassium channel, subfamily T, member 2							voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
TMEM9	252839	broad.mit.edu	37	1	201131663	201131664	+	Intron	INS	-	AA	AA	rs34818227		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201131663_201131664insAA	uc001gwa.2	-							NM_016456	NP_057540			transmembrane protein 9 precursor						transport	integral to membrane|late endosome membrane|lysosomal membrane					0		Breast(1374;0.000301)																---	---	---	---
PHLDA3	23612	broad.mit.edu	37	1	201439777	201439778	+	5'Flank	INS	-	AC	AC	rs140156185	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201439777_201439778insAC	uc001gwq.2	-						PHLDA3_uc009wzx.2_5'Flank	NM_012396	NP_036528			pleckstrin homology-like domain, family A,						anatomical structure morphogenesis|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of protein kinase B signaling cascade	cytoplasm|intracellular membrane-bounded organelle|plasma membrane	identical protein binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-5-phosphate binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	202967560	202967561	+	IGR	INS	-	C	C	rs141461974	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202967560_202967561insC								CYB5R1 (31156 upstream) : TMEM183A (8973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	203985917	203985917	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203985917delT								SNRPE (145639 upstream) : C1orf157 (15658 downstream)																																			---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204841826	204841826	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204841826delG	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_Intron	NM_001005388	NP_001005388			neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
RASSF5	83593	broad.mit.edu	37	1	206677879	206677880	+	5'Flank	INS	-	GT	GT	rs140403880	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206677879_206677880insGT	uc001hed.2	+						RASSF5_uc001hec.1_5'Flank|RASSF5_uc001hee.2_5'Flank	NM_182663	NP_872604			Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	206957406	206957406	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206957406delA								IL10 (11372 upstream) : IL19 (14809 downstream)																																			---	---	---	---
IL20	50604	broad.mit.edu	37	1	207041138	207041139	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207041138_207041139delCA	uc001her.2	+						IL20_uc010pry.1_Intron|IL20_uc009xby.2_Intron	NM_018724	NP_061194			interleukin 20 precursor						positive regulation of keratinocyte differentiation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of inflammatory response	extracellular space	cytokine activity|interleukin-20 receptor binding				0	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	209401632	209401633	+	IGR	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209401632_209401633delAT								PLXNA2 (983967 upstream) : LOC642587 (200535 downstream)																																			---	---	---	---
RCOR3	55758	broad.mit.edu	37	1	211464036	211464036	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211464036delT	uc001hig.2	+						RCOR3_uc010psv.1_Intron|RCOR3_uc001hie.2_Intron|RCOR3_uc010psw.1_Intron|RCOR3_uc001hif.2_Intron	NM_018254	NP_060724			REST corepressor 3 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212070952	212070952	+	IGR	DEL	A	-	-	rs140457503		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212070952delA								LPGAT1 (66838 upstream) : INTS7 (43746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213562466	213562467	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213562466_213562467insT								RPS6KC1 (115659 upstream) : PROX1 (598819 downstream)																																			---	---	---	---
PROX1	5629	broad.mit.edu	37	1	214204378	214204379	+	Intron	DEL	GT	-	-	rs34640999		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214204378_214204379delGT	uc001hkh.2	+							NM_002763	NP_002754			prospero homeobox 1						aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	214527836	214527836	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214527836delT								SMYD2 (17359 upstream) : PTPN14 (3175 downstream)																																			---	---	---	---
PTPN14	5784	broad.mit.edu	37	1	214632492	214632493	+	Intron	INS	-	T	T	rs112432798		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214632492_214632493insT	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392			protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---
PTPN14	5784	broad.mit.edu	37	1	214655923	214655923	+	Intron	DEL	A	-	-	rs71556609		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214655923delA	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392			protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---
KCTD3	51133	broad.mit.edu	37	1	215764630	215764633	+	Intron	DEL	TTCC	-	-	rs10592000		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215764630_215764633delTTCC	uc001hks.2	+						KCTD3_uc001hkt.2_Intron|KCTD3_uc010pub.1_Intron|KCTD3_uc009xdn.2_Intron	NM_016121	NP_057205			potassium channel tetramerisation domain							voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(3)	3				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)														---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216902021	216902022	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216902021_216902022delAA	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217992858	217992858	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217992858delT	uc001hlh.1	+						SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219037953	219037954	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219037953_219037954insC								TGFB2 (419994 upstream) : LYPLAL1 (309238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219702762	219702764	+	IGR	DEL	AGC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219702762_219702764delAGC								LYPLAL1 (316556 upstream) : SLC30A10 (156005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221099900	221099900	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221099900delA								HLX (41502 upstream) : LOC400804 (403370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221175252	221175253	+	IGR	INS	-	GTATGTATGTATGTAT	GTATGTATGTATGTAT	rs59882862		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221175252_221175253insGTATGTATGTATGTAT								HLX (116854 upstream) : LOC400804 (328017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221194759	221194759	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221194759delG								HLX (136361 upstream) : LOC400804 (308511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221542493	221542494	+	IGR	INS	-	T	T	rs141018706	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221542493_221542494insT								LOC400804 (32855 upstream) : DUSP10 (332272 downstream)																																			---	---	---	---
DUSP10	11221	broad.mit.edu	37	1	221890903	221890904	+	Intron	INS	-	T	T	rs147581266	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221890903_221890904insT	uc001hmy.1	-						DUSP10_uc001hmx.1_Intron|DUSP10_uc001hmz.1_Intron	NM_007207	NP_009138			dual specificity phosphatase 10 isoform a						inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	221924509	221924510	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221924509_221924510delAA								DUSP10 (9048 upstream) : HHIPL2 (771092 downstream)																																			---	---	---	---
CAPN2	824	broad.mit.edu	37	1	223937711	223937712	+	Intron	INS	-	A	A	rs77721191		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223937711_223937712insA	uc001hob.3	+						CAPN2_uc010puy.1_Intron	NM_001748	NP_001739			calpain 2 isoform 1						proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	224287874	224287879	+	IGR	DEL	CTCCCT	-	-	rs111480174		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224287874_224287879delCTCCCT								TP53BP2 (254200 upstream) : FBXO28 (13912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	225092171	225092172	+	IGR	DEL	TT	-	-	rs112498546		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225092171_225092172delTT								CNIH3 (163922 upstream) : DNAH14 (25184 downstream)																																			---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225241706	225241706	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225241706delG	uc001how.2	+							NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
SRP9	6726	broad.mit.edu	37	1	225974548	225974548	+	Intron	DEL	T	-	-	rs35339210		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225974548delT	uc001hpg.2	+						SRP9_uc001hpf.3_Intron|SRP9_uc001hph.2_Intron|SRP9_uc001hpi.3_Intron|SRP9_uc001hpj.1_Intron	NM_003133	NP_003124			signal recognition particle 9kDa isoform 2						negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0																		---	---	---	---
TMEM63A	9725	broad.mit.edu	37	1	226058052	226058053	+	Intron	INS	-	A	A	rs145495521		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226058052_226058053insA	uc001hpm.1	-						TMEM63A_uc010pvi.1_Intron	NM_014698	NP_055513			transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	226165886	226165886	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226165886delA								LEFTY2 (36966 upstream) : C1orf55 (4518 downstream)																																			---	---	---	---
C1orf55	163859	broad.mit.edu	37	1	226180816	226180817	+	Intron	INS	-	T	T	rs66975923		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180816_226180817insT	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821			hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)																	---	---	---	---
ACBD3	64746	broad.mit.edu	37	1	226351202	226351202	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226351202delA	uc001hpy.2	-							NM_022735	NP_073572			acyl-Coenzyme A binding domain containing 3						steroid biosynthetic process|transport	Golgi membrane|integral to membrane|mitochondrion	fatty-acyl-CoA binding|protein binding				0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	226504564	226504565	+	IGR	INS	-	AAAC	AAAC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226504564_226504565insAAAC								LIN9 (6994 upstream) : PARP1 (43828 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227217347	227217347	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227217347delA	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Intron|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron|CDC42BPA_uc001hqt.2_Intron|CDC42BPA_uc001hqu.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227479259	227479268	+	Intron	DEL	AAACAAAAAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227479259_227479268delAAACAAAAAC	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227501337	227501340	+	Intron	DEL	ATTA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227501337_227501340delATTA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	227621536	227621537	+	IGR	INS	-	GAGAGAG	GAGAGAG	rs142913097	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227621536_227621537insGAGAGAG								CDC42BPA (115710 upstream) : ZNF678 (129707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	227713765	227713765	+	IGR	DEL	T	-	-	rs35638380		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227713765delT								CDC42BPA (207939 upstream) : ZNF678 (37479 downstream)																																			---	---	---	---
ZNF678	339500	broad.mit.edu	37	1	227762646	227762648	+	Intron	DEL	TTG	-	-	rs111349596		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227762646_227762648delTTG	uc001hqw.1	+						ZNF678_uc009xet.1_Intron|ZNF678_uc009xeu.1_Intron	NM_178549	NP_848644			zinc finger protein 678						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	228178551	228178552	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228178551_228178552insA								WNT9A (42875 upstream) : WNT3A (16200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	228623976	228623977	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228623976_228623977insA								HIST3H3 (10950 upstream) : HIST3H2A (21089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	228684288	228684291	+	IGR	DEL	ATTT	-	-	rs78937840		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228684288_228684291delATTT								RNF187 (400 upstream) : DUSP5P (96366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	228742864	228742867	+	IGR	DEL	GTGC	-	-	rs66803435		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228742864_228742867delGTGC								RNF187 (58976 upstream) : DUSP5P (37790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231596985	231596985	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231596985delG								EGLN1 (36195 upstream) : TSNAX-DISC1 (67414 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231637429	231637429	+	IGR	DEL	A	-	-	rs71567090		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231637429delA								EGLN1 (76639 upstream) : TSNAX-DISC1 (26970 downstream)																																			---	---	---	---
TSNAX-DISC1	100303453	broad.mit.edu	37	1	231722907	231722908	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231722907_231722908insA	uc010pwg.1	+						TSNAX-DISC1_uc010pwe.1_Intron|TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron	NM_001012959	NP_001012977			disrupted in schizophrenia 1 isoform S												0																		---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234458397	234458400	+	Intron	DEL	GTGT	-	-	rs71576415		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234458397_234458400delGTGT	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
C1orf31	388753	broad.mit.edu	37	1	234512011	234512011	+	Intron	DEL	C	-	-	rs11285466		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234512011delC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003			hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234970084	234970086	+	IGR	DEL	TTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234970084_234970086delTTC								IRF2BP2 (224813 upstream) : TOMM20 (302574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	235025207	235025208	+	IGR	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235025207_235025208delAT								IRF2BP2 (279936 upstream) : TOMM20 (247452 downstream)																																			---	---	---	---
ERO1LB	56605	broad.mit.edu	37	1	236424315	236424318	+	Intron	DEL	AATC	-	-	rs55899123		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236424315_236424318delAATC	uc001hxt.2	-						ERO1LB_uc010pxt.1_Intron	NM_019891	NP_063944			endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	238491894	238491895	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238491894_238491895insT								LOC100130331 (400277 upstream) : LOC339535 (151791 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240348474	240348474	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240348474delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240356141	240356141	+	Intron	DEL	T	-	-	rs34381897		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240356141delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240626499	240626500	+	Intron	INS	-	T	T	rs145535017	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240626499_240626500insT	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron|FMN2_uc001hyr.2_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	240651235	240651236	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240651235_240651236insG								FMN2 (12752 upstream) : GREM2 (1639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	240922023	240922023	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240922023delA								GREM2 (146561 upstream) : RGS7 (9532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	241642412	241642413	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241642412_241642413insA								RGS7 (121934 upstream) : FH (18493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	241807272	241807273	+	IGR	INS	-	CAA	CAA	rs143320114	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241807272_241807273insCAA								OPN3 (3571 upstream) : WDR64 (8307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242224611	242224611	+	IGR	DEL	C	-	-	rs146281572		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242224611delC								MAP1LC3C (62226 upstream) : PLD5 (27661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242897492	242897492	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242897492delC								PLD5 (209494 upstream) : CEP170 (390239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244976186	244976187	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244976186_244976187insA								PPPDE1 (103854 upstream) : FAM36A (22452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	247576152	247576152	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247576152delT								ZNF496 (80990 upstream) : NLRP3 (3306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	248570553	248570554	+	IGR	INS	-	GTTAT	GTTAT	rs146850247	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570553_248570554insGTTAT								OR2T1 (149 upstream) : OR2T2 (45545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	319176	319177	+	IGR	INS	-	TG	TG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:319176_319177insTG								FAM150B (30868 upstream) : TMEM18 (348798 downstream)																																			---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1285186	1285187	+	Intron	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1285186_1285187insG	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1632127	1632127	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1632127delT								TPO (85629 upstream) : PXDN (3533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2719650	2719650	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2719650delC								MYT1L (384605 upstream) : TSSC1 (473091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2824197	2824198	+	IGR	INS	-	GAAGGGAA	GAAGGGAA	rs74164586		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2824197_2824198insGAAGGGAA								MYT1L (489152 upstream) : TSSC1 (368543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3812051	3812051	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3812051delG								ALLC (61793 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3902245	3902246	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3902245_3902246insG								ALLC (151987 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4625665	4625665	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4625665delT								ALLC (875407 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4644445	4644446	+	IGR	INS	-	AT	AT	rs149448144	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4644445_4644446insAT								ALLC (894187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5257053	5257054	+	IGR	INS	-	A	A	rs11287674		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5257053_5257054insA								None (None upstream) : SOX11 (575745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5875943	5875944	+	IGR	INS	-	G	G	rs141545140	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5875943_5875944insG								SOX11 (34427 upstream) : LOC150622 (196875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6373724	6373724	+	IGR	DEL	T	-	-	rs139373057		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6373724delT								LOC400940 (245360 upstream) : CMPK2 (606779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7276487	7276487	+	IGR	DEL	T	-	-	rs112065397		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7276487delT								RNF144A (92180 upstream) : LOC339788 (786071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7290542	7290543	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7290542_7290543insT								RNF144A (106235 upstream) : LOC339788 (772015 downstream)																																			---	---	---	---
MBOAT2	129642	broad.mit.edu	37	2	9009131	9009131	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9009131delT	uc002qzg.1	-						MBOAT2_uc010yix.1_Intron	NM_138799	NP_620154			O-acyltransferase (membrane bound) domain						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	9338043	9338044	+	IGR	INS	-	A	A	rs138549635	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9338043_9338044insA								MBOAT2 (194167 upstream) : ASAP2 (8850 downstream)																																			---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9396547	9396547	+	Intron	DEL	A	-	-	rs5829204		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9396547delA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10550908	10550909	+	Intron	INS	-	T	T	rs147755099	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10550908_10550909insT	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron|HPCAL1_uc010exf.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	11073288	11073289	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11073288_11073289delTG								KCNF1 (18938 upstream) : C2orf50 (199890 downstream)																																			---	---	---	---
ROCK2	9475	broad.mit.edu	37	2	11378335	11378336	+	Intron	INS	-	GTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGT	rs6146630		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11378335_11378336insGTGTGTGTGTGTGTGT	uc002rbd.1	-							NM_004850	NP_004841			Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12777743	12777744	+	IGR	INS	-	T	T	rs141162829	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12777743_12777744insT								LPIN1 (810212 upstream) : TRIB2 (79254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	12852139	12852139	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12852139delG								LPIN1 (884608 upstream) : TRIB2 (4859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13037760	13037760	+	IGR	DEL	T	-	-	rs5829390		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13037760delT								TRIB2 (154904 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13049822	13049822	+	IGR	DEL	T	-	-	rs11326620		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13049822delT								TRIB2 (166966 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14009122	14009123	+	IGR	INS	-	TC	TC	rs148789201	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14009122_14009123insTC								None (None upstream) : FAM84A (763733 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15074521	15074522	+	IGR	INS	-	TT	TT	rs150970803	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15074521_15074522insTT								FAM84A (283588 upstream) : NBAS (232510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15863640	15863640	+	IGR	DEL	T	-	-	rs112582513		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15863640delT								DDX1 (92416 upstream) : MYCNOS (216380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	17840312	17840312	+	IGR	DEL	G	-	-	rs34358308		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17840312delG								VSNL1 (2607 upstream) : SMC6 (4768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20620820	20620821	+	IGR	INS	-	G	G	rs11436042		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20620820_20620821insG								PUM2 (70357 upstream) : RHOB (26014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21123511	21123512	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21123511_21123512delGA								C2orf43 (100684 upstream) : APOB (100790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21556685	21556686	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21556685_21556686insT								APOB (289740 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21688017	21688017	+	IGR	DEL	A	-	-	rs111707647		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21688017delA								APOB (421072 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23166602	23166603	+	IGR	DEL	CT	-	-	rs67972941		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23166602_23166603delCT								None (None upstream) : KLHL29 (588852 downstream)																																			---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25097131	25097131	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25097131delC	uc002rfs.3	-						ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027			adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)																	---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25798392	25798392	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25798392delA	uc002rgh.2	-						DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	25936130	25936132	+	IGR	DEL	AAG	-	-	rs111347501		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25936130_25936132delAAG								DTNB (39627 upstream) : ASXL2 (26121 downstream)																																			---	---	---	---
RAB10	10890	broad.mit.edu	37	2	26345494	26345495	+	Intron	INS	-	A	A	rs79163160		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26345494_26345495insA	uc002rgv.2	+							NM_016131	NP_057215			ras-related GTP-binding protein RAB10						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
DPYSL5	56896	broad.mit.edu	37	2	27160610	27160611	+	Intron	INS	-	TTTG	TTTG	rs146183999	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27160610_27160611insTTTG	uc002rhu.3	+						DPYSL5_uc002rhv.3_Intron	NM_020134	NP_064519			dihydropyrimidinase-like 5						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
EIF2B4	8890	broad.mit.edu	37	2	27588905	27588906	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27588905_27588906delGT	uc002rkb.2	-						EIF2B4_uc002rjz.2_Intron|EIF2B4_uc002rka.2_Intron|EIF2B4_uc002rkc.2_Intron|EIF2B4_uc002rkd.2_Intron|EIF2B4_uc002rke.2_Intron	NM_001034116	NP_001029288			eukaryotic translation initiation factor 2B,						myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28922379	28922379	+	IGR	DEL	T	-	-	rs151080189		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28922379delT								PLB1 (55766 upstream) : PPP1CB (52233 downstream)																																			---	---	---	---
LCLAT1	253558	broad.mit.edu	37	2	30704331	30704332	+	Intron	INS	-	G	G	rs148862796	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30704331_30704332insG	uc002rnj.2	+						LCLAT1_uc010ymp.1_Intron|LCLAT1_uc002rnk.1_Intron|LCLAT1_uc002rnl.2_Intron|LCLAT1_uc010ymq.1_Intron	NM_182551	NP_872357			lysocardiolipin acyltransferase 1 isoform 1						multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2																		---	---	---	---
CAPN13	92291	broad.mit.edu	37	2	30981830	30981831	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30981830_30981831delTC	uc002rnn.2	-						CAPN13_uc002rnp.1_Intron	NM_144575	NP_653176			calpain 13						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CAPN14	440854	broad.mit.edu	37	2	31423977	31423978	+	Intron	DEL	GC	-	-	rs2365553	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31423977_31423978delGC	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594			calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
SRD5A2	6716	broad.mit.edu	37	2	31775468	31775468	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31775468delA	uc002rnw.1	-							NM_000348	NP_000339			3-oxo-5 alpha-steroid 4-dehydrogenase 2						androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)													---	---	---	---
BIRC6	57448	broad.mit.edu	37	2	32646181	32646181	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32646181delT	uc010ezu.2	+							NM_016252	NP_057336			baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	33834749	33834750	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33834749_33834750delAC								FAM98A (10387 upstream) : MYADML (116382 downstream)																																			---	---	---	---
MYADML	151325	broad.mit.edu	37	2	33951855	33951858	+	3'UTR	DEL	AGAG	-	-	rs3217585		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33951855_33951858delAGAG	uc002rpb.2	-	1						NR_003143				RecName: Full=Myeloid-associated differentiation marker-like protein.;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	34335077	34335078	+	IGR	INS	-	T	T	rs113727762		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34335077_34335078insT								MYADML (381793 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34637895	34637896	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34637895_34637896delGT								MYADML (684611 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35956341	35956341	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35956341delC								None (None upstream) : CRIM1 (627056 downstream)																																			---	---	---	---
EIF2AK2	5610	broad.mit.edu	37	2	37380268	37380268	+	Intron	DEL	T	-	-	rs76641313		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37380268delT	uc010ynh.1	-						EIF2AK2_uc010fac.2_Intron|EIF2AK2_uc010fad.2_Intron	NM_002759	NP_002750			eukaryotic translation initiation factor 2-alpha						evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)																---	---	---	---
EIF2AK2	5610	broad.mit.edu	37	2	37382081	37382082	+	Intron	DEL	TT	-	-	rs143886500		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37382081_37382082delTT	uc010ynh.1	-						EIF2AK2_uc010fac.2_Intron|EIF2AK2_uc010fad.2_Intron	NM_002759	NP_002750			eukaryotic translation initiation factor 2-alpha						evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	37714615	37714617	+	IGR	DEL	GTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37714615_37714617delGTT								QPCT (114151 upstream) : CDC42EP3 (156126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37934263	37934263	+	IGR	DEL	T	-	-	rs11342057		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37934263delT								CDC42EP3 (34937 upstream) : FAM82A1 (218199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37991918	37991924	+	IGR	DEL	TCATTGG	-	-	rs114890206	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37991918_37991924delTCATTGG								CDC42EP3 (92592 upstream) : FAM82A1 (160538 downstream)																																			---	---	---	---
C2orf58	285154	broad.mit.edu	37	2	38389533	38389533	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38389533delG	uc010faj.1	+							NR_027252				Homo sapiens chromosome 2 open reading frame 58, mRNA (cDNA clone IMAGE:5197672).												0																		---	---	---	---
THUMPD2	80745	broad.mit.edu	37	2	39976125	39976126	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39976125_39976126insA	uc002rru.2	-						THUMPD2_uc002rrv.2_Intron|THUMPD2_uc010ynt.1_Intron	NM_025264	NP_079540			THUMP domain containing 2								methyltransferase activity			skin(1)	1		all_hematologic(82;0.248)																---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40343805	40343805	+	Intron	DEL	A	-	-	rs79672152		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40343805delA	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	40818303	40818303	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40818303delA								SLC8A1 (78728 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42215639	42215639	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42215639delC								None (None upstream) : PKDCC (59522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	43420492	43420493	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43420492_43420493delTG								HAAO (400741 upstream) : ZFP36L2 (29049 downstream)																																			---	---	---	---
THADA	63892	broad.mit.edu	37	2	43552438	43552438	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43552438delT	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron	NM_001083953	NP_001077422			thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)																---	---	---	---
PPM1B	5495	broad.mit.edu	37	2	44421242	44421242	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44421242delT	uc002rtt.2	+						PPM1B_uc002rts.2_Intron|PPM1B_uc002rtu.2_Intron|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Intron|PPM1B_uc002rtx.2_Intron	NM_002706	NP_002697			protein phosphatase 1B isoform 1						protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44675160	44675160	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44675160delT	uc002rum.2	+						C2orf34_uc002rul.2_Intron	NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	45350116	45350116	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45350116delA								SIX2 (113573 upstream) : SRBD1 (265704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45506968	45506969	+	IGR	DEL	CA	-	-	rs71394822		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45506968_45506969delCA								SIX2 (270425 upstream) : SRBD1 (108851 downstream)																																			---	---	---	---
ATP6V1E2	90423	broad.mit.edu	37	2	46749546	46749546	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46749546delA	uc002ruy.2	-						ATP6V1E2_uc002ruz.2_Intron	NM_080653	NP_542384			ATPase, H+ transporting, lysosomal 31kDa, V1						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain	proton-transporting ATPase activity, rotational mechanism			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
MSH2	4436	broad.mit.edu	37	2	47686097	47686098	+	Intron	INS	-	A	A	rs35139333		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47686097_47686098insA	uc002rvy.1	+						MSH2_uc010yoh.1_Intron|MSH2_uc002rvz.2_Intron|MSH2_uc010fbg.2_Intron|MSH2_uc010fbh.1_Intron|MSH2_uc010fbi.1_Intron	NM_000251	NP_000242			mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	p.?(1)		large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)					D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	48201870	48201870	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48201870delA								FBXO11 (69056 upstream) : FOXN2 (339925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	49187209	49187210	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49187209_49187210delGT								LHCGR (204329 upstream) : FSHR (2443 downstream)																																			---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49245973	49245974	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49245973_49245974delCA	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50211153	50211154	+	Intron	INS	-	G	G	rs140514065	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50211153_50211154insG	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50219941	50219941	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50219941delA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50825280	50825280	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50825280delA	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51499747	51499747	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51499747delT								NRXN1 (240073 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53451793	53451794	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53451793_53451794insT								None (None upstream) : ASB3 (445324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53894047	53894048	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53894047_53894048insA								None (None upstream) : ASB3 (3070 downstream)																																			---	---	---	---
ACYP2	98	broad.mit.edu	37	2	54374404	54374404	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54374404delG	uc002rxq.3	+							NM_138448	NP_612457			acylphosphatase 2						phosphate metabolic process		acylphosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	54899435	54899436	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54899435_54899436delTT								SPTBN1 (853 upstream) : EML6 (52713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	55376670	55376671	+	IGR	INS	-	AC	AC	rs142857525	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55376670_55376671insAC								RTN4 (98936 upstream) : C2orf63 (23016 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57832513	57832514	+	IGR	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57832513_57832514delAT								None (None upstream) : VRK2 (302272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57903483	57903483	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57903483delA								None (None upstream) : VRK2 (231303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59153232	59153232	+	Intron	DEL	T	-	-	rs34257082		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59153232delT	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	59475026	59475026	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59475026delA								None (None upstream) : None (None downstream)																																			---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62330981	62330981	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62330981delT	uc002sbp.2	+						uc002sbr.2_Intron	NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	62954426	62954426	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62954426delT	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc010fcq.1_Intron|EHBP1_uc002sbx.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron|EHBP1_uc002sca.2_Intron	NM_015252	NP_056067			EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)											Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	2	64059564	64059564	+	IGR	DEL	G	-	-	rs72891012	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64059564delG								LOC388955 (209405 upstream) : UGP2 (8534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	64893259	64893259	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64893259delA								SERTAD2 (12213 upstream) : SLC1A4 (322320 downstream)																																			---	---	---	---
ANXA4	307	broad.mit.edu	37	2	69989522	69989522	+	Intron	DEL	A	-	-	rs58550873		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69989522delA	uc002sfr.3	+						ANXA4_uc010yqn.1_Intron|ANXA4_uc002sfs.3_Intron|ANXA4_uc010yqo.1_Intron	NM_001153	NP_001144			annexin IV						anti-apoptosis|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity				0																		---	---	---	---
ADD2	119	broad.mit.edu	37	2	70870706	70870706	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70870706delC	uc010fds.1	-							NM_001617				adducin 2 isoform a						actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71845644	71845645	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845644_71845645delGT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72451635	72451635	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72451635delG	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	73851205	73851207	+	IGR	DEL	TCC	-	-	rs112833082		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73851205_73851207delTCC								ALMS1 (14159 upstream) : NAT8 (16643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	74968135	74968135	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74968135delT								SEMA4F (58950 upstream) : HK2 (91647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76086888	76086888	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76086888delC								C2orf3 (148777 upstream) : LRRTM4 (887970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76153460	76153460	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76153460delT								C2orf3 (215349 upstream) : LRRTM4 (821398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76172400	76172400	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76172400delT								C2orf3 (234289 upstream) : LRRTM4 (802458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76596161	76596161	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76596161delA								C2orf3 (658050 upstream) : LRRTM4 (378697 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80598182	80598183	+	Intron	INS	-	A	A	rs140584372	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80598182_80598183insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80859403	80859404	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80859403_80859404delAC	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron|CTNNA2_uc010ysj.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82379891	82379891	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82379891delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82738378	82738379	+	IGR	INS	-	T	T	rs35787369		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82738378_82738379insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83314544	83314547	+	IGR	DEL	CACA	-	-	rs112144135		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83314544_83314547delCACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83897141	83897142	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83897141_83897142insT								None (None upstream) : FUNDC2P2 (620664 downstream)																																			---	---	---	---
TCF7L1	83439	broad.mit.edu	37	2	85454562	85454562	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85454562delT	uc002soy.2	+							NM_031283	NP_112573			HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
POLR1A	25885	broad.mit.edu	37	2	86303383	86303384	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86303383_86303384delAC	uc002sqs.2	-							NM_015425	NP_056240			DNA-directed RNA polymerase I A						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88544244	88544244	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88544244delC								THNSL2 (58099 upstream) : FOXI3 (203482 downstream)																																			---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89095906	89095908	+	Intron	DEL	AGA	-	-	rs144893551		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89095906_89095908delAGA	uc010fhg.2	+						FLJ40330_uc010fhh.2_Intron	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89235803	89235803	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89235803delT	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	89842137	89842138	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89842137_89842138insA								FLJ40330 (736012 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	89886311	89886311	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89886311delT								FLJ40330 (780186 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91645012	91645028	+	IGR	DEL	ATTGCGGCAGTATTCAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91645012_91645028delATTGCGGCAGTATTCAG								None (None upstream) : LOC654342 (160164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91768879	91768879	+	IGR	DEL	T	-	-	rs71250098		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91768879delT								None (None upstream) : LOC654342 (36313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91898268	91898268	+	IGR	DEL	A	-	-	rs59457891		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91898268delA								LOC654342 (50293 upstream) : GGT8P (65100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317206	92317206	+	IGR	DEL	T	-	-	rs140640503		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317206delT								FKSG73 (186712 upstream) : None (None downstream)																																			---	---	---	---
LOC729234	729234	broad.mit.edu	37	2	96673773	96673773	+	5'Flank	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96673773delG	uc010fht.2	+							NR_003698				Homo sapiens fumarylacetoacetate hydrolase domain containing 2 pseudogene (LOC729234), non-coding RNA.												0																		---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97597594	97597594	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97597594delT	uc002sxl.3	-						FAM178B_uc002sxk.3_Intron	NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	97732822	97732823	+	IGR	INS	-	TAAA	TAAA	rs3028097		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97732822_97732823insTAAA								FAM178B (80521 upstream) : FAHD2B (16501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	99053620	99053620	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99053620delA								CNGA3 (38563 upstream) : INPP4A (7701 downstream)																																			---	---	---	---
MRPL30	51263	broad.mit.edu	37	2	99781483	99781486	+	Intron	DEL	ACAC	-	-	rs67818601		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99781483_99781486delACAC	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214			SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100302328	100302328	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100302328delG	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100320107	100320108	+	Intron	INS	-	T	T	rs35535652		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100320107_100320108insT	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	101121177	101121178	+	IGR	INS	-	ATG	ATG	rs143138560	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101121177_101121178insATG								NMS (21435 upstream) : PDCL3 (58240 downstream)																																			---	---	---	---
PDCL3	79031	broad.mit.edu	37	2	101190133	101190134	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101190133_101190134insA	uc002tao.2	+							NM_024065	NP_076970			phosducin-like 3						apoptosis|interspecies interaction between organisms	cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	101338641	101338642	+	IGR	INS	-	GAGGAGA	GAGGAGA	rs150824107	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101338641_101338642insGAGGAGA								PDCL3 (145440 upstream) : NPAS2 (97971 downstream)																																			---	---	---	---
IL1RL2	8808	broad.mit.edu	37	2	102840450	102840450	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102840450delT	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845			interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	103881513	103881513	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103881513delT								TMEM182 (447377 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104856011	104856012	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104856011_104856012insA								None (None upstream) : LOC150568 (194793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107609102	107609102	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107609102delA								ST6GAL2 (105539 upstream) : LOC729121 (830418 downstream)																																			---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	109775599	109775600	+	Intron	INS	-	A	A	rs140482373	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109775599_109775600insA	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	112493836	112493836	+	IGR	DEL	T	-	-	rs77856773		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112493836delT								LOC541471 (241144 upstream) : ANAPC1 (32805 downstream)																																			---	---	---	---
ANAPC1	64682	broad.mit.edu	37	2	112610565	112610565	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112610565delA	uc002thi.2	-							NM_022662	NP_073153			anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113103847	113103848	+	IGR	INS	-	CAT	CAT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103847_113103848insCAT								ZC3H6 (6207 upstream) : RGPD8 (22118 downstream)																																			---	---	---	---
PAX8	7849	broad.mit.edu	37	2	114007942	114007942	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114007942delA	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron|LOC654433_uc002tjs.3_5'Flank	NM_003466	NP_003457			paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2								T	PPARG	follicular thyroid		Thyroid dysgenesis 						---	---	---	---
Unknown	0	broad.mit.edu	37	2	117905024	117905024	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117905024delG								None (None upstream) : DDX18 (667231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119223709	119223709	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119223709delA								INSIG2 (356113 upstream) : EN1 (376039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119423611	119423611	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119423611delT								INSIG2 (556015 upstream) : EN1 (176137 downstream)																																			---	---	---	---
C2orf76	130355	broad.mit.edu	37	2	120084175	120084175	+	Intron	DEL	A	-	-	rs35908652		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120084175delA	uc002tls.2	-						C2orf76_uc010flf.1_Intron|C2orf76_uc010yyg.1_Intron|C2orf76_uc002tlt.2_Intron|C2orf76_uc002tlu.2_Intron	NM_001017927	NP_001017927			hypothetical protein LOC130355												0																		---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120461483	120461483	+	RNA	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120461483delA	uc002tme.2	+	13		c.1505delA								Homo sapiens cDNA FLJ32751 fis, clone TESTI2001621.							integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	120964694	120964694	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120964694delA								EPB41L5 (28000 upstream) : TMEM185B (14160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121131381	121131381	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121131381delA								INHBB (21998 upstream) : LOC84931 (90530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	122506545	122506547	+	IGR	DEL	AGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122506545_122506547delAGA								MKI67IP (12042 upstream) : TSN (6574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124684081	124684081	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124684081delA								None (None upstream) : CNTNAP5 (98783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126503572	126503576	+	IGR	DEL	TTTTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126503572_126503576delTTTTG								CNTNAP5 (830711 upstream) : GYPC (910108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129358530	129358531	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129358530_129358531delCA								HS6ST1 (282359 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129550157	129550158	+	IGR	INS	-	AA	AA	rs150111646		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129550157_129550158insAA								HS6ST1 (473986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	131620438	131620438	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131620438delA	uc002try.1	+											Homo sapiens cDNA FLJ45181 fis, clone BRAWH3047644, highly  similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133117293	133117294	+	IGR	INS	-	A	A	rs149418880	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133117293_133117294insA								NCRNA00164 (101751 upstream) : GPR39 (56853 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133838619	133838620	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133838619_133838620insA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134357915	134357917	+	IGR	DEL	GAG	-	-	rs76144343		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134357915_134357917delGAG								NCKAP5 (31884 upstream) : MGAT5 (653913 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138280504	138280504	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138280504delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	143268048	143268048	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143268048delC								LRP1B (378778 upstream) : KYNU (367147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143462802	143462803	+	IGR	INS	-	TGTGTG	TGTGTG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143462802_143462803insTGTGTG								LRP1B (573532 upstream) : KYNU (172392 downstream)																																			---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144750655	144750655	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144750655delT	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron	NM_001006636	NP_001006637			glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	145872611	145872612	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145872611_145872612delGT	uc002twd.2	+						uc002twe.2_Intron					Homo sapiens, clone IMAGE:5538654, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	147044306	147044306	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147044306delT								None (None upstream) : PABPC1P2 (300319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	147423929	147423929	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147423929delA								PABPC1P2 (75372 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151480866	151480867	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151480866_151480867delAC								RND3 (136686 upstream) : RBM43 (623862 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152543474	152543474	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152543474delA	uc010fnx.2	-							NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
PRPF40A	55660	broad.mit.edu	37	2	153550992	153550993	+	Intron	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153550992_153550993delAT	uc002tyi.2	-						PRPF40A_uc002tyh.3_Intron|PRPF40A_uc010zcd.1_Intron|PRPF40A_uc002tyj.2_Intron|PRPF40A_uc002tyl.1_Intron	NM_017892	NP_060362			formin binding protein 3						mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0																		---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154766580	154766581	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154766580_154766581insT	uc002tyr.3	+							NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	155017082	155017083	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155017082_155017083insA	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	157197084	157197084	+	RNA	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157197084delA	uc002tzb.1	-	1		c.1089delT								Homo sapiens cDNA FLJ46875 fis, clone UTERU3014446.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	157547465	157547465	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157547465delC								GPD2 (77218 upstream) : GALNT5 (566875 downstream)																																			---	---	---	---
PKP4	8502	broad.mit.edu	37	2	159327665	159327665	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159327665delT	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron	NM_003628	NP_003619			plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7															HNSCC(62;0.18)			---	---	---	---
TANC1	85461	broad.mit.edu	37	2	160041397	160041397	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160041397delT	uc002uag.2	+						TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160176646	160176646	+	3'UTR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160176646delT	uc002uao.2	-	37					BAZ2B_uc002uap.2_3'UTR	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160479558	160479560	+	Intron	DEL	AAG	-	-	rs113453234		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160479558_160479560delAAG	uc002uau.1	-											SubName: Full=Putative uncharacterized protein DKFZp686H10114;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	161869090	161869091	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161869090_161869091insA								RBMS1 (518772 upstream) : TANK (124375 downstream)																																			---	---	---	---
SCN3A	6328	broad.mit.edu	37	2	166054097	166054097	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166054097delT	uc002ucx.2	-						SCN3A_uc002ucy.2_Intron|SCN3A_uc002ucz.2_Intron	NM_006922	NP_008853			sodium channel, voltage-gated, type III, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)													---	---	---	---
SCN1A	6323	broad.mit.edu	37	2	166868923	166868923	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166868923delT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851			sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	168145049	168145050	+	IGR	DEL	AC	-	-	rs111560339		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168145049_168145050delAC								XIRP2 (28790 upstream) : B3GALT1 (530132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	169249034	169249035	+	IGR	INS	-	T	T	rs143098710		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169249034_169249035insT								STK39 (144929 upstream) : LASS6 (63800 downstream)																																			---	---	---	---
GAD1	2571	broad.mit.edu	37	2	171705006	171705007	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171705006_171705007insA	uc002ugi.2	+						GAD1_uc010fqc.2_5'Flank	NM_000817	NP_000808			glutamate decarboxylase 1 isoform GAD67						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
RAPGEF4	11069	broad.mit.edu	37	2	173898364	173898364	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173898364delT	uc002uhv.3	+						RAPGEF4_uc002uhw.3_Intron	NM_007023	NP_008954			Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)															---	---	---	---
ZAK	51776	broad.mit.edu	37	2	173944618	173944619	+	Intron	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173944618_173944619insTT	uc002uhz.2	+						ZAK_uc002uhx.2_Intron|ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	174656022	174656025	+	IGR	DEL	TGTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174656022_174656025delTGTG								CDCA7 (422304 upstream) : SP3 (117234 downstream)																																			---	---	---	---
OLA1	29789	broad.mit.edu	37	2	174967912	174967920	+	Intron	DEL	CATGTGTAT	-	-	rs137870369		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174967912_174967920delCATGTGTAT	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473			Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2																		---	---	---	---
GPR155	151556	broad.mit.edu	37	2	175306452	175306453	+	Intron	DEL	TG	-	-	rs138458295		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175306452_175306453delTG	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217			G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	177920708	177920709	+	IGR	INS	-	AACAAC	AACAAC	rs140275829	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177920708_177920709insAACAAC								MIR1246 (454928 upstream) : HNRNPA3 (156713 downstream)																																			---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179244060	179244063	+	Intron	DEL	AGGG	-	-	rs55763420		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179244060_179244063delAGGG	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
PRKRA	8575	broad.mit.edu	37	2	179296382	179296385	+	3'UTR	DEL	CAAT	-	-	rs72223867		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179296382_179296385delCAAT	uc002umf.2	-	8					PRKRA_uc002umc.2_3'UTR|PRKRA_uc002umd.2_3'UTR|PRKRA_uc002ume.2_3'UTR|PRKRA_uc002umg.2_3'UTR|uc002umb.1_Intron|PRKRA_uc002umh.1_RNA	NM_003690	NP_003681			protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	179926217	179926217	+	IGR	DEL	T	-	-	rs35345290		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179926217delT								CCDC141 (11431 upstream) : SESTD1 (40204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	180198592	180198592	+	IGR	DEL	T	-	-	rs72291502		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180198592delT								SESTD1 (69242 upstream) : ZNF385B (108128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	180279189	180279191	+	IGR	DEL	CAA	-	-	rs34322082		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180279189_180279191delCAA								SESTD1 (149839 upstream) : ZNF385B (27529 downstream)																																			---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182344708	182344708	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182344708delT	uc002unu.2	+						ITGA4_uc010zfl.1_Intron	NM_000885	NP_000876			integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185602766	185602766	+	Intron	DEL	T	-	-	rs34461606		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185602766delT	uc002uph.2	+							NM_194250	NP_919226			zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	186770522	186770522	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186770522delA								ZNF804A (966310 upstream) : ZC3H15 (580363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	190805153	190805154	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190805153_190805154insG								PMS1 (62799 upstream) : MSTN (115273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	196081560	196081560	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196081560delT								None (None upstream) : SLC39A10 (439972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	199539896	199539897	+	IGR	DEL	GT	-	-	rs140839652		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199539896_199539897delGT								PLCL1 (525290 upstream) : SATB2 (594327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	199845954	199845955	+	IGR	INS	-	A	A	rs150907153	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199845954_199845955insA								PLCL1 (831348 upstream) : SATB2 (288269 downstream)																																			---	---	---	---
MPP4	58538	broad.mit.edu	37	2	202548475	202548475	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202548475delA	uc002uyk.3	-						MPP4_uc010ftj.2_Intron|MPP4_uc010zhq.1_Intron|MPP4_uc010zhr.1_Intron|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_Intron|MPP4_uc010ftk.2_Intron|MPP4_uc002uym.1_Intron|MPP4_uc002uyn.2_Intron	NM_033066	NP_149055			membrane protein, palmitoylated 4							cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	202848120	202848121	+	IGR	INS	-	GCATATG	GCATATG	rs149978556	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202848120_202848121insGCATATG								CDK15 (89857 upstream) : FZD7 (51189 downstream)																																			---	---	---	---
SUMO1	7341	broad.mit.edu	37	2	203075996	203075996	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203075996delA	uc002uyz.1	-						SUMO1_uc002uza.1_Intron	NM_001005781	NP_001005781			SMT3 suppressor of mif two 3 homolog 1 isoform a						DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0																		---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205824673	205824674	+	Intron	INS	-	T	T	rs139495166	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205824673_205824674insT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PLEKHM3	389072	broad.mit.edu	37	2	208754526	208754526	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208754526delT	uc002vcl.2	-							NM_001080475	NP_001073944			pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1																		---	---	---	---
PLEKHM3	389072	broad.mit.edu	37	2	208767684	208767684	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208767684delA	uc002vcl.2	-						PLEKHM3_uc002vcm.2_Intron	NM_001080475	NP_001073944			pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1																		---	---	---	---
PTH2R	5746	broad.mit.edu	37	2	209398128	209398128	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209398128delA	uc010fuo.1	+											Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	209780113	209780113	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209780113delA								PTH2R (75295 upstream) : MAP2 (508658 downstream)																																			---	---	---	---
LANCL1	10314	broad.mit.edu	37	2	211324574	211324574	+	Intron	DEL	T	-	-	rs75708908		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211324574delT	uc010zjh.1	-						LANCL1_uc002ved.2_Intron|LANCL1_uc010fuq.2_Intron	NM_001136574	NP_001130046			lanthionine synthetase C-like protein 1							cytoplasm|integral to plasma membrane|microtubule cytoskeleton|nucleus	catalytic activity|G-protein coupled receptor activity|glutathione binding|low-density lipoprotein particle receptor binding|SH3 domain binding|zinc ion binding				0				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)														---	---	---	---
IKZF2	22807	broad.mit.edu	37	2	213954690	213954690	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213954690delA	uc002vem.2	-						IKZF2_uc010fuu.2_Intron|IKZF2_uc002vej.2_Intron|IKZF2_uc002vek.2_Intron|IKZF2_uc010fuv.2_Intron|IKZF2_uc002vel.2_Intron|IKZF2_uc010fuw.2_Intron|IKZF2_uc010fux.2_Intron|IKZF2_uc010fuy.2_Intron|IKZF2_uc002ven.2_Intron	NM_016260	NP_057344			helios isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)														---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214448906	214448907	+	Intron	INS	-	T	T	rs111594918	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214448906_214448907insT	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215398274	215398274	+	Intron	DEL	A	-	-	rs68122455		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215398274delA	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	215708601	215708601	+	IGR	DEL	C	-	-	rs35076037		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215708601delC								BARD1 (34173 upstream) : ABCA12 (87666 downstream)																																			---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215912699	215912700	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215912699_215912700delAA	uc002vew.2	-						ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099			ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
MARCH4	57574	broad.mit.edu	37	2	217171702	217171703	+	Intron	DEL	CA	-	-	rs111859991		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217171702_217171703delCA	uc002vgb.2	-							NM_020814	NP_065865			membrane-associated ring finger (C3HC4) 4							Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)														---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218196051	218196051	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218196051delG	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
SLC23A3	151295	broad.mit.edu	37	2	220026326	220026326	+	3'UTR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220026326delC	uc010zks.1	-	12					NHEJ1_uc002vjp.3_5'Flank|NHEJ1_uc002vjq.3_Intron|SLC23A3_uc010zkr.1_3'UTR|SLC23A3_uc010fwb.2_3'UTR	NM_001144889	NP_001138361			solute carrier family 23 (nucleobase						transmembrane transport	integral to membrane	protein binding|transporter activity				0		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	221995804	221995804	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221995804delC								None (None upstream) : EPHA4 (286945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222483934	222483935	+	IGR	INS	-	ACAAA	ACAAA	rs144507833	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222483934_222483935insACAAA								EPHA4 (45012 upstream) : PAX3 (580672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222946016	222946016	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222946016delA								EPHA4 (507094 upstream) : PAX3 (118591 downstream)																																			---	---	---	---
SGPP2	130367	broad.mit.edu	37	2	223288456	223288456	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223288456delA	uc010zlo.1	+						SGPP2_uc010zlp.1_5'Flank	NM_152386	NP_689599			sphingosine-1-phosphate phosphotase 2						sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225197688	225197691	+	IGR	DEL	ACAC	-	-	rs71798250		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225197688_225197691delACAC								SERPINE2 (293652 upstream) : FAM124B (45725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229101861	229101861	+	IGR	DEL	T	-	-	rs72005595		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229101861delT								SPHKAP (55500 upstream) : PID1 (786829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	231548452	231548453	+	IGR	INS	-	A	A	rs144216614	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231548452_231548453insA								SP100 (138135 upstream) : CAB39 (29104 downstream)																																			---	---	---	---
DIS3L2	129563	broad.mit.edu	37	2	233049742	233049742	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233049742delC	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_Intron	NM_152383	NP_689596			DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235632833	235632833	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235632833delC								ARL4C (227140 upstream) : SH3BP4 (227795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237047335	237047336	+	IGR	INS	-	T	T	rs66723844		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237047335_237047336insT								AGAP1 (13221 upstream) : GBX2 (26971 downstream)																																			---	---	---	---
IQCA1	79781	broad.mit.edu	37	2	237362478	237362478	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237362478delT	uc002vvz.1	-						IQCA1_uc002vwb.2_Intron|IQCA1_uc002vwa.1_Intron|IQCA1_uc010zni.1_Intron	NM_024726	NP_079002			IQ motif containing with AAA domain 1								ATP binding			ovary(1)	1																		---	---	---	---
MLPH	79083	broad.mit.edu	37	2	238406764	238406764	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238406764delT	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron	NM_024101	NP_077006			melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239464729	239464730	+	5'Flank	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239464729_239464730delTG	uc002vyi.1	-											Homo sapiens cDNA FLJ32814 fis, clone TESTI2002806.																														---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240274707	240274707	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240274707delT	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	583552	583552	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:583552delT	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	1558682	1558683	+	IGR	DEL	TC	-	-	rs113826794		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1558682_1558683delTC								CNTN6 (113405 upstream) : CNTN4 (581867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	2111091	2111092	+	IGR	INS	-	A	A	rs111989708		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2111091_2111092insA								CNTN6 (665814 upstream) : CNTN4 (29458 downstream)																																			---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2474331	2474332	+	Intron	DEL	TA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2474331_2474332delTA	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
TRNT1	51095	broad.mit.edu	37	3	3167324	3167325	+	5'Flank	DEL	AG	-	-	rs66769052		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3167324_3167325delAG	uc003bpp.3	+						TRNT1_uc003bpk.2_5'Flank|TRNT1_uc010hbv.2_5'Flank|TRNT1_uc003bpm.2_5'Flank|TRNT1_uc003bpn.1_5'Flank	NM_182916	NP_886552			tRNA nucleotidyl transferase, CCA-adding, 1						protein targeting to mitochondrion|tRNA 3'-end processing	mitochondrion	ATP binding|tRNA adenylyltransferase activity|tRNA binding				0				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)														---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4020465	4020468	+	Intron	DEL	TTTG	-	-	rs112022240		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4020465_4020468delTTTG	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	5324590	5324591	+	IGR	INS	-	T	T	rs146253554	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5324590_5324591insT								EDEM1 (62941 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	5335278	5335281	+	IGR	DEL	CTGG	-	-	rs78782479		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5335278_5335281delCTGG								EDEM1 (73629 upstream) : None (None downstream)																																			---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7671999	7671999	+	Intron	DEL	T	-	-	rs3838617		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7671999delT	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron|GRM7_uc010hch.1_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
C3orf32	51066	broad.mit.edu	37	3	8711559	8711560	+	Intron	INS	-	A	A	rs142728931		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8711559_8711560insA	uc003bqz.2	-						C3orf32_uc003bqx.2_Intron|C3orf32_uc003bqy.2_Intron	NM_015931	NP_057015			hypothetical protein LOC51066											skin(1)	1																		---	---	---	---
OXTR	5021	broad.mit.edu	37	3	8793927	8793928	+	3'UTR	DEL	GT	-	-	rs57804882		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8793927_8793928delGT	uc003brc.2	-	4						NM_000916	NP_000907			oxytocin receptor						female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)													---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9227222	9227222	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9227222delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9253350	9253353	+	Intron	DEL	TTTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9253350_9253353delTTTT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
SETD5	55209	broad.mit.edu	37	3	9480985	9480986	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9480985_9480986insT	uc003brt.2	+						SETD5_uc003brs.1_Intron|SETD5_uc003bru.2_Intron|SETD5_uc003brv.2_Intron|SETD5_uc010hck.2_5'Flank	NM_001080517	NP_001073986			SET domain containing 5											ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)														---	---	---	---
CPNE9	151835	broad.mit.edu	37	3	9757583	9757597	+	Intron	DEL	CCTATGGGCCTCACT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9757583_9757597delCCTATGGGCCTCACT	uc003bsd.2	+							NM_153635	NP_705899			copine-like protein											ovary(2)	2	Medulloblastoma(99;0.227)															OREG0015381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10086773	10086773	+	Intron	DEL	T	-	-	rs63152163		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10086773delT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron	NM_033084	NP_149075			Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10117412	10117413	+	Intron	INS	-	T	T	rs149752743		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10117412_10117413insT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_Intron	NM_033084	NP_149075			Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
IRAK2	3656	broad.mit.edu	37	3	10255595	10255595	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10255595delT	uc003bve.1	+							NM_001570	NP_001561			interleukin-1 receptor-associated kinase 2						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8																		---	---	---	---
TATDN2	9797	broad.mit.edu	37	3	10302551	10302552	+	Intron	DEL	TT	-	-	rs35507180		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10302551_10302552delTT	uc003bvg.2	+						TATDN2_uc003bvf.2_Intron|TATDN2_uc011atr.1_Intron|TATDN2_uc011ats.1_Intron|TATDN2_uc011att.1_Intron	NM_014760	NP_055575			TatD DNase domain containing 2							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	11773352	11773352	+	IGR	DEL	T	-	-	rs5846728		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11773352delT								VGLL4 (11132 upstream) : C3orf31 (58568 downstream)																																			---	---	---	---
C3orf31	132001	broad.mit.edu	37	3	11878946	11878946	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11878946delT	uc003bwh.2	-						C3orf31_uc003bwj.2_Intron|C3orf31_uc003bwi.2_Intron|C3orf31_uc011auo.1_Intron|C3orf31_uc011aup.1_Intron|C3orf31_uc010hdy.1_Intron	NM_138807	NP_620162			MMP37-like protein, mitochondrial precursor						protein import into mitochondrial matrix	extrinsic to mitochondrial inner membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	12317740	12317752	+	IGR	DEL	AAGGGAGGAAGGA	-	-	rs57844015		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12317740_12317752delAAGGGAGGAAGGA								SYN2 (84210 upstream) : PPARG (11597 downstream)																																			---	---	---	---
WNT7A	7476	broad.mit.edu	37	3	13869628	13869628	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13869628delT	uc003bye.1	-							NM_004625	NP_004616			wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3																		---	---	---	---
TPRXL	348825	broad.mit.edu	37	3	14028157	14028158	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14028157_14028158insT	uc011avd.1	+							NR_002223				RecName: Full=Putative protein TPRXL;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	14146573	14146573	+	IGR	DEL	T	-	-	rs72208150		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14146573delT								TPRXL (39094 upstream) : CHCHD4 (7005 downstream)																																			---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16001553	16001554	+	Intron	INS	-	AC	AC	rs143368752		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16001553_16001554insAC	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	16861506	16861506	+	Intron	DEL	T	-	-	rs2347653	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16861506delT	uc010het.1	+											Homo sapiens cDNA, FLJ99987.						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	18024213	18024213	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18024213delG	uc003cbg.2	+											Homo sapiens cDNA clone IMAGE:5584035.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	18331250	18331250	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18331250delA								TBC1D5 (547010 upstream) : SATB1 (58016 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	19057615	19057615	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19057615delG								SATB1 (577363 upstream) : KCNH8 (132402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	20383567	20383568	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20383567_20383568delTG								SGOL1 (155884 upstream) : None (None downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21499808	21499808	+	Intron	DEL	A	-	-	rs33984907		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21499808delA	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973			zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21882071	21882071	+	Intron	DEL	A	-	-	rs75160659		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21882071delA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	23210456	23210456	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23210456delC								ZNF385D (796333 upstream) : UBE2E2 (34197 downstream)																																			---	---	---	---
UBE2E1	7324	broad.mit.edu	37	3	23855645	23855646	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23855645_23855646insA	uc003cch.2	+						UBE2E1_uc003cci.2_Intron|UBE2E1_uc011awh.1_Intron	NM_003341	NP_003332			ubiquitin-conjugating enzyme E2E 1 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|histone H2B ubiquitination|histone monoubiquitination|ISG15-protein conjugation|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K48-linked ubiquitination	cytosol|nucleoplasm|ubiquitin ligase complex	ATP binding|ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity				0																		---	---	---	---
NKIRAS1	28512	broad.mit.edu	37	3	23978681	23978681	+	Intron	DEL	C	-	-	rs11332963		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23978681delC	uc003cck.2	-							NM_020345	NP_065078			kappa B-ras 1						I-kappaB kinase/NF-kappaB cascade|small GTPase mediated signal transduction	cytoplasm	GTP binding|GTPase activity				0																		---	---	---	---
RARB	5915	broad.mit.edu	37	3	25601171	25601171	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25601171delT	uc011awl.1	+						RARB_uc003cdi.1_Intron|RARB_uc003cdh.2_Intron	NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	26756968	26756968	+	IGR	DEL	T	-	-	rs112860442		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26756968delT								LRRC3B (4705 upstream) : NEK10 (395427 downstream)																																			---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28436806	28436806	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28436806delA	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron	NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29827590	29827590	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29827590delA	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30808339	30808340	+	Intron	DEL	GG	-	-	rs72407122		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30808339_30808340delGG	uc003cep.2	-							NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
DYNC1LI1	51143	broad.mit.edu	37	3	32586236	32586237	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32586236_32586237delAA	uc003cfb.3	-						DYNC1LI1_uc011axh.1_Intron	NM_016141	NP_057225			dynein, cytoplasmic 1, light intermediate chain						cell division|interspecies interaction between organisms|mitosis|positive regulation of mitotic cell cycle spindle assembly checkpoint|transport	centrosome|condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|plasma membrane|spindle pole	ATP binding|motor activity			ovary(1)	1																		---	---	---	---
GLB1	2720	broad.mit.edu	37	3	33110886	33110890	+	Intron	DEL	AAAGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33110886_33110890delAAAGA	uc003cfi.1	-						GLB1_uc003cfh.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron	NM_000404	NP_000395			galactosidase, beta 1 isoform a preproprotein						carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)																---	---	---	---
Unknown	0	broad.mit.edu	37	3	36980752	36980753	+	IGR	DEL	AC	-	-	rs71937663		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36980752_36980753delAC								TRANK1 (78341 upstream) : EPM2AIP1 (46605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	36995987	36995987	+	IGR	DEL	A	-	-	rs142149321		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36995987delA								TRANK1 (93576 upstream) : EPM2AIP1 (31371 downstream)																																			---	---	---	---
C3orf23	285343	broad.mit.edu	37	3	44396739	44396739	+	Intron	DEL	A	-	-	rs11310966		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44396739delA	uc010him.2	+						C3orf23_uc003cnd.3_Intron|C3orf23_uc003cne.3_Intron|C3orf23_uc003cnb.3_Intron|C3orf23_uc003cnc.3_Intron	NM_173826	NP_776187			hypothetical protein LOC285343 isoform 1							mitochondrion				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)														---	---	---	---
KIF15	56992	broad.mit.edu	37	3	44831676	44831676	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44831676delT	uc003cnx.3	+						KIF15_uc010hiq.2_Intron	NM_020242	NP_064627			kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)														---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46242821	46242821	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46242821delA	uc003cpg.1	+							NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46298513	46298513	+	Intron	DEL	A	-	-	rs35365421		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46298513delA	uc003cpg.1	+						CCR3_uc003cpi.1_Intron|CCR3_uc003cpj.1_Intron|CCR3_uc003cpk.1_Intron|CCR3_uc010hjb.1_Intron|CCR3_uc003cpl.1_Intron	NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	46338010	46338011	+	IGR	INS	-	CA	CA	rs139048530	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46338010_46338011insCA								CCR3 (29848 upstream) : CCR2 (57224 downstream)																																			---	---	---	---
CCR2	729230	broad.mit.edu	37	3	46393933	46393935	+	5'Flank	DEL	ACA	-	-	rs35424113		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46393933_46393935delACA	uc003cpn.3	+						CCR2_uc003cpm.3_5'Flank	NM_001123041	NP_001116513			chemokine (C-C motif) receptor 2 isoform A						astrocyte cell migration|blood vessel remodeling|cellular defense response|chemokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response|interspecies interaction between organisms|JAK-STAT cascade|monocyte extravasation|negative regulation of adenylate cyclase activity|negative regulation of angiogenesis|negative regulation of eosinophil degranulation|negative regulation of type 2 immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of immune complex clearance by monocytes and macrophages|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-2 production|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|positive regulation of T cell extravasation|positive regulation of T-helper 1 type immune response|positive regulation of tumor necrosis factor biosynthetic process|regulation of vascular endothelial growth factor production|T-helper 17 cell chemotaxis	cytosol|dendrite|integral to plasma membrane|perikaryon|perinuclear region of cytoplasm|soluble fraction	C-C chemokine receptor activity|CCR2 chemokine receptor binding|protein homodimerization activity			lung(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)														---	---	---	---
CCDC36	339834	broad.mit.edu	37	3	49249056	49249057	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49249056_49249057insA	uc003cwk.2	+						CCDC36_uc003cwl.3_Intron|CCDC36_uc011bck.1_Intron|CCDC36_uc010hkt.2_Intron	NM_178173	NP_835467			coiled-coil domain containing 36											ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	50758395	50758395	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50758395delT	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
RAD54L2	23132	broad.mit.edu	37	3	51585133	51585134	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51585133_51585134insT	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron	NM_015106	NP_055921			RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	52213377	52213377	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52213377delT								POC1A (24671 upstream) : ALAS1 (18739 downstream)																																			---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52958675	52958677	+	Intron	DEL	AAC	-	-	rs112207109		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52958675_52958677delAAC	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159			Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
RFT1	91869	broad.mit.edu	37	3	53154133	53154142	+	Intron	DEL	TTAACTGCAC	-	-	rs142901692		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53154133_53154142delTTAACTGCAC	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091			RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56085441	56085441	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56085441delA	uc003dhr.1	-						ERC2_uc003dht.1_Intron	NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56345848	56345849	+	Intron	DEL	TG	-	-	rs147769025		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56345848_56345849delTG	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ARHGEF3	50650	broad.mit.edu	37	3	57005991	57005991	+	Intron	DEL	C	-	-	rs35995504		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57005991delC	uc003dih.2	-							NM_001128615	NP_001122087			Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)														---	---	---	---
C3orf49	132200	broad.mit.edu	37	3	63811659	63811659	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63811659delG	uc003dls.3	+							NR_026866				RecName: Full=Putative uncharacterized protein C3orf49;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	64945576	64945576	+	Intron	DEL	G	-	-	rs11318844		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64945576delG	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65723743	65723743	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65723743delG	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
SLC25A26	115286	broad.mit.edu	37	3	66301049	66301049	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66301049delG	uc011bfq.1	+						SLC25A26_uc011bfs.1_Intron|SLC25A26_uc011bft.1_Intron|SLC25A26_uc011bfr.1_Intron|SLC25A26_uc003dmt.2_Intron	NM_173471	NP_775742			solute carrier family 25, member 26 isoform a							integral to membrane|mitochondrial inner membrane|nucleus	S-adenosylmethionine transmembrane transporter activity			pancreas(1)	1		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	67386965	67386965	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67386965delC								KBTBD8 (325335 upstream) : SUCLG2 (38180 downstream)																																			---	---	---	---
FAM19A1	407738	broad.mit.edu	37	3	68091951	68091951	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68091951delG	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774			family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	69689856	69689856	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69689856delA								FRMD4B (98123 upstream) : MITF (98777 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	70384214	70384215	+	IGR	INS	-	A	A	rs111531843		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70384214_70384215insA								MITF (366728 upstream) : FOXP1 (620522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	70545832	70545832	+	IGR	DEL	A	-	-	rs141905438		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70545832delA								MITF (528346 upstream) : FOXP1 (458905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72064251	72064251	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72064251delC								PROK2 (229894 upstream) : RYBP (359500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72517456	72517457	+	IGR	INS	-	A	A	rs145410168	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72517456_72517457insA								RYBP (21682 upstream) : SHQ1 (280973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73146926	73146927	+	IGR	INS	-	AC	AC	rs138404636	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73146926_73146927insAC								PPP4R2 (31915 upstream) : PDZRN3 (284725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74897919	74897919	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74897919delT								CNTN3 (327576 upstream) : FAM86D (572786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75449583	75449584	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75449583_75449584delTG								CNTN3 (879240 upstream) : FAM86D (21121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75914540	75914543	+	IGR	DEL	TTAA	-	-	rs34899328		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75914540_75914543delTTAA								ZNF717 (79870 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76109260	76109260	+	IGR	DEL	T	-	-	rs11347851		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76109260delT								ZNF717 (274590 upstream) : ROBO2 (980034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76252743	76252744	+	IGR	INS	-	C	C	rs11370344		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76252743_76252744insC								ZNF717 (418073 upstream) : ROBO2 (836550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76512985	76512986	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76512985_76512986insA								ZNF717 (678315 upstream) : ROBO2 (576308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76521256	76521263	+	IGR	DEL	GTGTGCGT	-	-	rs67538284		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76521256_76521263delGTGTGCGT								ZNF717 (686586 upstream) : ROBO2 (568031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	77076761	77076761	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77076761delC								None (None upstream) : ROBO2 (12533 downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77374952	77374953	+	Intron	INS	-	AAC	AAC	rs141431298	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77374952_77374953insAAC	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77586424	77586425	+	Intron	INS	-	T	T	rs141500793	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77586424_77586425insT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	78309802	78309803	+	IGR	INS	-	T	T	rs147992358	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78309802_78309803insT								ROBO2 (613141 upstream) : ROBO1 (336585 downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78646607	78646607	+	3'UTR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78646607delT	uc003dqe.2	-	31					ROBO1_uc003dqb.2_3'UTR|ROBO1_uc003dqc.2_3'UTR|ROBO1_uc003dqd.2_3'UTR|ROBO1_uc010hoh.2_3'UTR	NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	79384102	79384102	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79384102delA	uc003dqe.2	-							NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	80451378	80451379	+	IGR	INS	-	GGGGTCA	GGGGTCA	rs142602969	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80451378_80451379insGGGGTCA								ROBO1 (634319 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	81878852	81878856	+	IGR	DEL	AAAAC	-	-	rs74631256		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81878852_81878856delAAAAC								GBE1 (67902 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82076636	82076636	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82076636delT	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	83687190	83687190	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83687190delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	83949728	83949730	+	IGR	DEL	TTT	-	-	rs149198927		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83949728_83949730delTTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	84394974	84394974	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84394974delA								None (None upstream) : CADM2 (613159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	86794475	86794477	+	IGR	DEL	GAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86794475_86794477delGAA								CADM2 (676527 upstream) : VGLL3 (192648 downstream)																																			---	---	---	---
CHMP2B	25978	broad.mit.edu	37	3	87301522	87301523	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87301522_87301523insT	uc003dqp.3	+						CHMP2B_uc011bgn.1_Intron	NM_014043	NP_054762			chromatin modifying protein 2B						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane|mitochondrion|nucleus	protein domain specific binding			skin(2)|ovary(1)	3	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	88228323	88228323	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88228323delA								C3orf38 (21210 upstream) : EPHA3 (928351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	89044441	89044441	+	IGR	DEL	T	-	-	rs56870794	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89044441delT								C3orf38 (837328 upstream) : EPHA3 (112233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90374127	90374128	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90374127_90374128insA								EPHA3 (842845 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90465116	90465117	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90465116_90465117delAG								EPHA3 (933834 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	97581623	97581625	+	Intron	DEL	TCT	-	-	rs139635446		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97581623_97581625delTCT	uc011bgq.1	+											SubName: Full=cDNA FLJ60082, weakly similar to Uro-adherence factor A; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	98720528	98720528	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98720528delA								DCBLD2 (99995 upstream) : COL8A1 (636926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	98725504	98725505	+	IGR	INS	-	T	T	rs146878144	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98725504_98725505insT								DCBLD2 (104971 upstream) : COL8A1 (631949 downstream)																																			---	---	---	---
C3orf26	84319	broad.mit.edu	37	3	99853032	99853033	+	Intron	INS	-	T	T	rs113154926		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99853032_99853033insT	uc003dtl.2	+							NM_032359	NP_115735			hypothetical protein LOC84319								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	100194175	100194175	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100194175delT								LNP1 (19006 upstream) : TMEM45A (17288 downstream)																																			---	---	---	---
TMEM45A	55076	broad.mit.edu	37	3	100282628	100282628	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100282628delC	uc003dtz.1	+						TMEM45A_uc003dua.1_Intron	NM_018004	NP_060474			transmembrane protein 45A							integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
CEP97	79598	broad.mit.edu	37	3	101466542	101466543	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101466542_101466543insT	uc003dvk.1	+						CEP97_uc010hpm.1_Intron|CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Intron|CEP97_uc003dvm.1_Intron	NM_024548	NP_078824			centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	107165086	107165086	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107165086delT	uc003dwj.2	+											Homo sapiens cDNA clone IMAGE:5312582.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	111149403	111149404	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111149403_111149404insT								PVRL3 (237030 upstream) : CD96 (111522 downstream)																																			---	---	---	---
CD200R1	131450	broad.mit.edu	37	3	112688865	112688865	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112688865delA	uc003dzk.1	-						CD200R1_uc003dzj.1_Intron|CD200R1_uc011bhx.1_Intron|CD200R1_uc003dzl.1_Intron|CD200R1_uc003dzm.1_Intron	NM_170780	NP_740750			CD200 receptor 1 isoform d						interspecies interaction between organisms|regulation of immune response	extracellular region|integral to membrane|plasma membrane	receptor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	115003294	115003294	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115003294delA								ZBTB20 (137167 upstream) : GAP43 (338857 downstream)																																			---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	115779285	115779288	+	Intron	DEL	ACAC	-	-	rs112268583		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115779285_115779288delACAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	116086343	116086344	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116086343_116086344delTT	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	116104768	116104770	+	Intron	DEL	TAC	-	-	rs147125234		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116104768_116104770delTAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	116784820	116784821	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116784820_116784821delTG								LOC285194 (348935 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117108935	117108936	+	IGR	INS	-	AG	AG	rs150348096	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117108935_117108936insAG								LOC285194 (673050 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117640089	117640090	+	IGR	DEL	TG	-	-	rs28646104		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117640089_117640090delTG								None (None upstream) : IGSF11 (979391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117741369	117741369	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117741369delT								None (None upstream) : IGSF11 (878112 downstream)																																			---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	120684556	120684556	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120684556delT	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795			syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	125353556	125353556	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125353556delG								OSBPL11 (39175 upstream) : MIR548I1 (155691 downstream)																																			---	---	---	---
EEFSEC	60678	broad.mit.edu	37	3	128067121	128067122	+	Intron	DEL	GT	-	-	rs138972080	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128067121_128067122delGT	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756			eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1																		---	---	---	---
RAB7A	7879	broad.mit.edu	37	3	128485811	128485812	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128485811_128485812insT	uc003eks.1	+						RAB7A_uc010hsv.1_Intron	NM_004637	NP_004628			RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)														---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131442751	131442751	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131442751delT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
TOPBP1	11073	broad.mit.edu	37	3	133334125	133334125	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133334125delC	uc003eps.2	-							NM_007027	NP_008958			topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7													Other_conserved_DNA_damage_response_genes					---	---	---	---
Unknown	0	broad.mit.edu	37	3	135493923	135493923	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135493923delA								EPHB1 (514618 upstream) : PPP2R3A (190644 downstream)																																			---	---	---	---
IL20RB	53833	broad.mit.edu	37	3	136698492	136698493	+	Intron	DEL	TG	-	-	rs71758231		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136698492_136698493delTG	uc003eri.1	+						IL20RB_uc003erj.1_Intron|IL20RB_uc010hud.1_5'Flank	NM_144717	NP_653318			interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	137586816	137586816	+	IGR	DEL	T	-	-	rs112685466		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137586816delT								SOX14 (102420 upstream) : CLDN18 (130842 downstream)																																			---	---	---	---
PIK3CB	5291	broad.mit.edu	37	3	138436793	138436793	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138436793delT	uc011bmq.1	-							NM_006219	NP_006210			catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143126391	143126391	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143126391delT	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144580466	144580467	+	IGR	DEL	CA	-	-	rs72244395		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144580466_144580467delCA								C3orf58 (869257 upstream) : None (None downstream)																																			---	---	---	---
PLOD2	5352	broad.mit.edu	37	3	145798309	145798310	+	Intron	DEL	AT	-	-	rs148003646		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145798309_145798310delAT	uc003evs.1	-						PLOD2_uc003evq.1_Intron|PLOD2_uc011bnm.1_Intron|PLOD2_uc003evr.1_Intron	NM_000935	NP_000926			procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)													---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149258546	149258547	+	Intron	DEL	AC	-	-	rs57129997		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149258546_149258547delAC	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
FAM194A	131831	broad.mit.edu	37	3	150417716	150417717	+	Intron	INS	-	A	A	rs138552124	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150417716_150417717insA	uc003eyg.2	-						FAM194A_uc003eyh.2_Intron	NM_152394	NP_689607			hypothetical protein LOC131831											skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	152489324	152489324	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152489324delC								MBNL1 (305756 upstream) : P2RY1 (63412 downstream)																																			---	---	---	---
DHX36	170506	broad.mit.edu	37	3	154038645	154038645	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154038645delG	uc003ezy.3	-						DHX36_uc010hvq.2_Intron|DHX36_uc003ezz.3_Intron	NM_020865	NP_065916			DEAH (Asp-Glu-Ala-His) box polypeptide 36							cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)															---	---	---	---
GPR149	344758	broad.mit.edu	37	3	154115726	154115727	+	Intron	INS	-	A	A	rs138551459	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154115726_154115727insA	uc003faa.2	-							NM_001038705	NP_001033794			G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	154526712	154526712	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154526712delT								GPR149 (379208 upstream) : MME (215201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	154527470	154527471	+	IGR	INS	-	T	T	rs148393058	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154527470_154527471insT								GPR149 (379966 upstream) : MME (214442 downstream)																																			---	---	---	---
MME	4311	broad.mit.edu	37	3	154868863	154868863	+	Intron	DEL	A	-	-	rs142702408		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154868863delA	uc010hvr.1	+						MME_uc003fab.1_Intron|MME_uc003fac.1_Intron|MME_uc003fad.1_Intron|MME_uc003fae.1_Intron	NM_007289	NP_009220			membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	156795935	156795935	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156795935delA								LEKR1 (32017 upstream) : CCNL1 (68362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	156852169	156852170	+	IGR	DEL	GT	-	-	rs67167974		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156852169_156852170delGT								LEKR1 (88251 upstream) : CCNL1 (12127 downstream)																																			---	---	---	---
VEPH1	79674	broad.mit.edu	37	3	157025979	157025980	+	Intron	INS	-	TC	TC	rs145438189	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157025979_157025980insTC	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897			ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	159800682	159800682	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159800682delC	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	160402681	160402681	+	IGR	DEL	C	-	-	rs11356529		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160402681delC								ARL14 (6448 upstream) : PPM1L (71315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163063525	163063525	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163063525delA								None (None upstream) : MIR1263 (825734 downstream)																																			---	---	---	---
SI	6476	broad.mit.edu	37	3	164730382	164730383	+	Intron	INS	-	T	T	rs141223879	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164730382_164730383insT	uc003fei.2	-							NM_001041	NP_001032			sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)										HNSCC(35;0.089)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165297364	165297364	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165297364delA								SLITRK3 (382895 upstream) : BCHE (193330 downstream)																																			---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	166969740	166969741	+	Intron	INS	-	CG	CG	rs71697930		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166969740_166969741insCG	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963			zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169250967	169250967	+	Intron	DEL	C	-	-	rs67796202		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169250967delC	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
PRKCI	5584	broad.mit.edu	37	3	170000562	170000562	+	Intron	DEL	T	-	-	rs74481959		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170000562delT	uc003fgs.2	+							NM_002740	NP_002731			protein kinase C, iota						anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170394690	170394690	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170394690delA	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	170817164	170817165	+	Intron	INS	-	T	T	rs111964336		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170817164_170817165insT	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhg.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171027901	171027903	+	Intron	DEL	CTA	-	-	rs67944582		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171027901_171027903delCTA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171091088	171091089	+	Intron	INS	-	C	C	rs146642098	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171091088_171091089insC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171940741	171940741	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171940741delT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173354089	173354089	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173354089delA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173460214	173460215	+	Intron	INS	-	G	G	rs145602585	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173460214_173460215insG	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174825302	174825303	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174825302_174825303delAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175091235	175091235	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175091235delT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	176606661	176606661	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176606661delG								None (None upstream) : TBL1XR1 (131882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177011590	177011590	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177011590delT								TBL1XR1 (96542 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177292124	177292125	+	IGR	INS	-	ACAC	ACAC	rs34115198		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177292124_177292125insACAC								TBL1XR1 (377076 upstream) : KCNMB2 (962099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180157300	180157301	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180157300_180157301insA								PEX5L (402783 upstream) : TTC14 (162617 downstream)																																			---	---	---	---
SOX2OT	347689	broad.mit.edu	37	3	181373642	181373643	+	Intron	INS	-	CTCTC	CTCTC	rs145576066	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181373642_181373643insCTCTC	uc003fkv.2	+						SOX2OT_uc003fkw.3_Intron					Homo sapiens cDNA FLJ12764 fis, clone NT2RP2001506.												0																		---	---	---	---
SOX2OT	347689	broad.mit.edu	37	3	181403482	181403483	+	Intron	INS	-	AAAC	AAAC	rs142832919	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181403482_181403483insAAAC	uc003fkv.2	+						SOX2OT_uc003fkw.3_Intron					Homo sapiens cDNA FLJ12764 fis, clone NT2RP2001506.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	182388309	182388309	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182388309delA								SOX2OT (929306 upstream) : ATP11B (122982 downstream)																																			---	---	---	---
MCCC1	56922	broad.mit.edu	37	3	182777785	182777785	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182777785delC	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron|MCCC1_uc011bqq.1_Intron	NM_020166	NP_064551			methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---
YEATS2	55689	broad.mit.edu	37	3	183464697	183464698	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183464697_183464698delTT	uc003fly.2	+							NM_018023	NP_060493			YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
C3orf70	285382	broad.mit.edu	37	3	184871553	184871554	+	5'Flank	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184871553_184871554delTG	uc003fpd.2	-							NM_001025266	NP_001020437			hypothetical protein LOC285382												0																		---	---	---	---
LIPH	200879	broad.mit.edu	37	3	185270030	185270031	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185270030_185270031delTT	uc003fpm.2	-						LIPH_uc010hyh.2_Intron	NM_139248	NP_640341			lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	186607564	186607575	+	IGR	DEL	TCTTCTTCTTCC	-	-	rs141863178	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186607564_186607575delTCTTCTTCTTCC								ADIPOQ (31314 upstream) : ST6GAL1 (40941 downstream)																																			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189475703	189475712	+	Intron	DEL	AGACCTCAGG	-	-	rs74554110		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189475703_189475712delAGACCTCAGG	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191726542	191726542	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191726542delT								PYDC2 (547299 upstream) : FGF12 (133142 downstream)																																			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192273843	192273844	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192273843_192273844insA	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192357797	192357798	+	Intron	INS	-	A	A	rs113963078		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192357797_192357798insA	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193069205	193069207	+	Intron	DEL	GAG	-	-	rs138530610		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193069205_193069207delGAG	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193743068	193743069	+	IGR	INS	-	GTGTGCATGT	GTGTGCATGT	rs116692890	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193743068_193743069insGTGTGCATGT								LOC100128023 (31041 upstream) : HES1 (110865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195353380	195353381	+	IGR	INS	-	TG	TG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195353380_195353381insTG								APOD (42304 upstream) : SDHAP2 (31529 downstream)																																			---	---	---	---
C3orf43	255798	broad.mit.edu	37	3	196241222	196241223	+	Intron	DEL	CT	-	-	rs111733782		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196241222_196241223delCT	uc003fws.2	-						C3orf43_uc003fwr.2_Intron	NM_001077657	NP_001071125			hypothetical protein LOC255798							integral to membrane				ovary(1)	1	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;2.13e-23)|all cancers(36;2e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00298)														---	---	---	---
GAK	2580	broad.mit.edu	37	4	914096	914096	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:914096delA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbo.2_Intron	NM_005255	NP_005246			cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)														---	---	---	---
FAM53A	152877	broad.mit.edu	37	4	1682047	1682047	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1682047delA	uc011bve.1	-						FAM53A_uc010ibw.2_Intron	NM_001013622	NP_001013644			dorsal neural-tube nuclear protein							nucleus					0		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	4564189	4564190	+	Intron	DEL	TG	-	-	rs71638568		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4564189_4564190delTG	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																														---	---	---	---
PPP2R2C	5522	broad.mit.edu	37	4	6414970	6414973	+	Intron	DEL	ACAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6414970_6414973delACAC	uc003gjc.2	-						PPP2R2C_uc003gjb.2_Intron|PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron	NM_020416	NP_065149			gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
PPP2R2C	5522	broad.mit.edu	37	4	6446935	6446936	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6446935_6446936insA	uc003gjc.2	-						PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron	NM_020416	NP_065149			gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	9998213	9998214	+	Intron	INS	-	GCCTG	GCCTG	rs149534293	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9998213_9998214insGCCTG	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	10125815	10125816	+	5'Flank	INS	-	A	A	rs139342610	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10125815_10125816insA	uc003gmm.2	+											DQ573667																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	12272886	12272886	+	IGR	DEL	T	-	-	rs78706294		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12272886delT								HS3ST1 (842349 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13138130	13138130	+	IGR	DEL	A	-	-	rs34294590		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13138130delA								None (None upstream) : HSP90AB2P (196907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13180112	13180112	+	IGR	DEL	A	-	-	rs113143113		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13180112delA								None (None upstream) : HSP90AB2P (154925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13216064	13216064	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13216064delA								None (None upstream) : HSP90AB2P (118973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13636735	13636736	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13636735_13636736delTG								BOD1L (7407 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13686529	13686529	+	Intron	DEL	T	-	-	rs72102534		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13686529delT	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	22226915	22226916	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22226915_22226916insA								KCNIP4 (276541 upstream) : GPR125 (162083 downstream)																																			---	---	---	---
GPR125	166647	broad.mit.edu	37	4	22501806	22501807	+	Intron	INS	-	CTGTT	CTGTT	rs143429494	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22501806_22501807insCTGTT	uc003gqm.1	-						GPR125_uc003gqo.2_Intron	NM_145290	NP_660333			G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	22623070	22623070	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22623070delT								GPR125 (105398 upstream) : GBA3 (71478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	23677147	23677147	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23677147delA								GBA3 (855956 upstream) : PPARGC1A (116498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24445652	24445654	+	IGR	DEL	GTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24445652_24445654delGTT								PPARGC1A (553952 upstream) : MIR573 (76161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24689257	24689258	+	IGR	INS	-	TT	TT	rs34126799		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24689257_24689258insTT								DHX15 (103073 upstream) : SOD3 (107827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	25630591	25630591	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25630591delT								ANAPC4 (210472 upstream) : SLC34A2 (26844 downstream)																																			---	---	---	---
TBC1D19	55296	broad.mit.edu	37	4	26617077	26617078	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26617077_26617078insT	uc003gsf.3	+						TBC1D19_uc010iew.2_Intron|TBC1D19_uc011bxu.1_Intron	NM_018317	NP_060787			TBC1 domain family, member 19							intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	29351198	29351201	+	IGR	DEL	AAAC	-	-	rs112586971		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29351198_29351201delAAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31381838	31381839	+	IGR	INS	-	C	C	rs144902275	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31381838_31381839insC								PCDH7 (233417 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33843457	33843458	+	IGR	INS	-	TTT	TTT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33843457_33843458insTTT								None (None upstream) : None (None downstream)																																			---	---	---	---
KIAA1239	57495	broad.mit.edu	37	4	37432292	37432292	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37432292delG	uc011bxz.1	+	4	456	c.456delG	c.(454-456)CTGfs	p.L152fs		NM_001144990	NP_001138462	Q9ULI1	K1239_HUMAN	hypothetical protein LOC57495	152											0																		---	---	---	---
RELL1	768211	broad.mit.edu	37	4	37688859	37688859	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37688859delT	uc003gsz.2	-						RELL1_uc010ifc.2_5'Flank	NM_001085399	NP_001078868			receptor expressed in lymphoid tissues like 1							cytoplasm|integral to membrane|microtubule cytoskeleton|plasma membrane					0																		---	---	---	---
WDR19	57728	broad.mit.edu	37	4	39255399	39255399	+	Intron	DEL	A	-	-	rs75042299		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39255399delA	uc003gtv.2	+						WDR19_uc011byi.1_Intron|WDR19_uc003gtw.1_Intron	NM_025132	NP_079408			WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1																		---	---	---	---
UBE2K	3093	broad.mit.edu	37	4	39698961	39698963	+	5'Flank	DEL	ATA	-	-	rs142346788		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39698961_39698963delATA	uc003guu.3	+						UBE2K_uc003gus.3_5'Flank|UBE2K_uc003gut.3_5'Flank|UBE2K_uc010ifn.2_5'Flank|UBE2K_uc011byq.1_5'Flank|UBE2K_uc003guq.3_5'Flank	NM_005339	NP_005330			ubiquitin-conjugating enzyme E2K isoform 1						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|ubiquitin protein ligase binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	41197769	41197770	+	Intron	INS	-	A	A	rs145573953	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41197769_41197770insA	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	45460030	45460031	+	IGR	INS	-	A	A	rs35177507		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45460030_45460031insA								GNPDA2 (731418 upstream) : GABRG1 (577758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45547528	45547528	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45547528delA								GNPDA2 (818916 upstream) : GABRG1 (490261 downstream)																																			---	---	---	---
COX7B2	170712	broad.mit.edu	37	4	46885794	46885794	+	Intron	DEL	A	-	-	rs112798647		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46885794delA	uc003gxf.2	-						COX7B2_uc010ige.2_Intron	NM_130902	NP_570972			cytochrome c oxidase subunit VIIb2 precursor							integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	48470213	48470213	+	IGR	DEL	T	-	-	rs72328823		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48470213delT								SLAIN2 (42000 upstream) : SLC10A4 (15147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49133540	49133549	+	IGR	DEL	ACTCGGGTAG	-	-	rs142760702		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49133540_49133549delACTCGGGTAG								CWH43 (69447 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49211579	49211582	+	IGR	DEL	TTCT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49211579_49211582delTTCT								CWH43 (147486 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49644024	49644025	+	IGR	INS	-	ATGGA	ATGGA	rs138643557		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49644024_49644025insATGGA								CWH43 (579931 upstream) : None (None downstream)																																			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54641101	54641101	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54641101delA	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54775467	54775468	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54775467_54775468insA	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	55088106	55088106	+	Intron	DEL	A	-	-	rs113204370		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55088106delA	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56171010	56171011	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56171010_56171011insTT								KDR (179248 upstream) : SRD5A3 (41398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56784757	56784757	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56784757delT								EXOC1 (13513 upstream) : CEP135 (30280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56908516	56908517	+	IGR	INS	-	TTTC	TTTC	rs149700510	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56908516_56908517insTTTC								CEP135 (8990 upstream) : KIAA1211 (127844 downstream)																																			---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57092292	57092293	+	Intron	INS	-	G	G	rs147218437	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57092292_57092293insG	uc003hbk.2	+							NM_020722	NP_065773			hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	59602863	59602867	+	IGR	DEL	AGGTT	-	-	rs35295526		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59602863_59602867delAGGTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60626014	60626015	+	IGR	INS	-	T	T	rs67637695	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60626014_60626015insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61059596	61059597	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61059596_61059597delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61100468	61100469	+	IGR	INS	-	T	T	rs150250773	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61100468_61100469insT								None (None upstream) : LPHN3 (966505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61289525	61289532	+	IGR	DEL	AGGGAGGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61289525_61289532delAGGGAGGA								None (None upstream) : LPHN3 (777442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65352393	65352393	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65352393delT								TECRL (77215 upstream) : EPHA5 (832889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66061381	66061384	+	IGR	DEL	CCAT	-	-	rs11471063		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66061381_66061384delCCAT								TECRL (786203 upstream) : EPHA5 (123898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	68017334	68017335	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68017334_68017335insC								MIR1269 (874688 upstream) : CENPC1 (320654 downstream)																																			---	---	---	---
TMPRSS11D	9407	broad.mit.edu	37	4	68725580	68725581	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68725580_68725581insT	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253			transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	69554962	69554963	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69554962_69554963insC								UGT2B15 (18588 upstream) : UGT2B10 (126750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72452636	72452636	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72452636delT								SLC4A4 (14833 upstream) : GC (154777 downstream)																																			---	---	---	---
COX18	285521	broad.mit.edu	37	4	73923142	73923143	+	3'UTR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73923142_73923143insA	uc003hgm.1	-	6					COX18_uc003hgn.1_3'UTR|COX18_uc011cbc.1_3'UTR|COX18_uc010iih.1_3'UTR	NM_173827	NP_776188			mitochondrial COX18 precursor						protein insertion into mitochondrial membrane|respiratory chain complex IV assembly	integral to mitochondrial inner membrane	protein transporter activity				0	Breast(15;0.00096)		Epithelial(6;1.26e-06)|OV - Ovarian serous cystadenocarcinoma(6;9.45e-06)|all cancers(17;2.05e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
ANKRD17	26057	broad.mit.edu	37	4	74064939	74064940	+	Intron	DEL	TG	-	-	rs150020625		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74064939_74064940delTG	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593			ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
ART3	419	broad.mit.edu	37	4	76933831	76933831	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76933831delG	uc003hjk.2	+						ART3_uc003hji.2_Intron|ART3_uc003hjj.2_Intron	NM_001130017	NP_001123489			ADP-ribosyltransferase 3 isoform c						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	77836974	77836977	+	IGR	DEL	AAAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77836974_77836977delAAAC								ANKRD56 (17972 upstream) : SEPT11 (33918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	78357111	78357111	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78357111delT								CCNG2 (265901 upstream) : CXCL13 (75796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	79623457	79623457	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79623457delA								ANXA3 (91855 upstream) : BMP2K (74075 downstream)																																			---	---	---	---
LIN54	132660	broad.mit.edu	37	4	83882920	83882921	+	Intron	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83882920_83882921insC	uc003hnx.3	-						LIN54_uc003hnz.3_Intron|LIN54_uc003hny.3_Intron|LIN54_uc010ijt.2_Intron|LIN54_uc010iju.2_Intron|LIN54_uc010ijv.2_Intron	NM_194282	NP_919258			lin-54 homolog isoform a						cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Hepatocellular(203;0.114)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	84988463	84988463	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84988463delA	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	90232766	90232767	+	IGR	DEL	AC	-	-	rs34846829		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90232766_90232767delAC								GPRIN3 (3605 upstream) : SNCA (412484 downstream)																																			---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91948804	91948805	+	Intron	DEL	CT	-	-	rs34404295		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91948804_91948805delCT	uc003hsv.3	+						FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	92983876	92983876	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92983876delC								FAM190A (460507 upstream) : GRID2 (241674 downstream)																																			---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93878745	93878746	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93878745_93878746insT	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94441490	94441491	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94441490_94441491insA	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
BMPR1B	658	broad.mit.edu	37	4	95713626	95713627	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95713626_95713627delAC	uc003htm.3	+							NM_001203	NP_001194			bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	97631878	97631879	+	IGR	INS	-	TA	TA	rs142538276	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97631878_97631879insTA								PDHA2 (869254 upstream) : C4orf37 (848155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	97688309	97688310	+	IGR	INS	-	TG	TG	rs33946251		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97688309_97688310insTG								PDHA2 (925685 upstream) : C4orf37 (791724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	99756177	99756180	+	IGR	DEL	AAGG	-	-	rs146288190		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99756177_99756180delAAGG								TSPAN5 (176450 upstream) : EIF4E (43427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	99889458	99889459	+	IGR	INS	-	T	T	rs140695647		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99889458_99889459insT								EIF4E (37672 upstream) : METAP1 (27329 downstream)																																			---	---	---	---
ADH5	128	broad.mit.edu	37	4	100000519	100000519	+	Intron	DEL	A	-	-	rs36160699		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100000519delA	uc003hui.2	-						ADH5_uc003huk.1_Intron|ADH5_uc003huj.2_Intron	NM_000671	NP_000662			class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	105379797	105379799	+	IGR	DEL	CGG	-	-	rs150241351		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105379797_105379799delCGG								TACR3 (738824 upstream) : CXXC4 (13546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105815745	105815746	+	IGR	DEL	CA	-	-	rs35141968		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105815745_105815746delCA								CXXC4 (399687 upstream) : TET2 (252197 downstream)																																			---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107113603	107113603	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107113603delA	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
SGMS2	166929	broad.mit.edu	37	4	108823498	108823498	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108823498delT	uc003hyl.3	+						uc003hym.1_Intron|SGMS2_uc003hyn.2_Intron|SGMS2_uc003hyo.2_Intron	NM_001136258	NP_001129730			sphingomyelin synthase 2						sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)													---	---	---	---
COL25A1	84570	broad.mit.edu	37	4	110085657	110085657	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110085657delG	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014			collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111188219	111188220	+	IGR	INS	-	AT	AT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111188219_111188220insAT								ELOVL6 (68399 upstream) : ENPEP (209009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	111983129	111983129	+	IGR	DEL	T	-	-	rs35350330		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111983129delT								MIR297 (201326 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	112440907	112440908	+	IGR	INS	-	TTAGA	TTAGA	rs140168313	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112440907_112440908insTTAGA								MIR297 (659104 upstream) : C4orf32 (625645 downstream)																																			---	---	---	---
ANK2	287	broad.mit.edu	37	4	113956909	113956912	+	Intron	DEL	AGAT	-	-	rs111287576		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113956909_113956912delAGAT	uc003ibd.3	+						ANK2_uc003ibc.2_Intron	NM_001127493	NP_001120965			ankyrin 2 isoform 3						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
ANK2	287	broad.mit.edu	37	4	114119995	114119996	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114119995_114119996insT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139			ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	114699246	114699246	+	IGR	DEL	A	-	-	rs34970235		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114699246delA								CAMK2D (16163 upstream) : ARSJ (122194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117134017	117134017	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117134017delA								None (None upstream) : MIR1973 (86864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	123452995	123452996	+	IGR	INS	-	A	A	rs143189248	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123452995_123452996insA								IL2 (75345 upstream) : IL21 (80787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128356200	128356201	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128356200_128356201insA								None (None upstream) : INTU (197919 downstream)																																			---	---	---	---
C4orf29	80167	broad.mit.edu	37	4	128954409	128954409	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128954409delA	uc003ifs.2	+						C4orf29_uc003ift.2_Intron|C4orf29_uc003ifv.2_Intron					SubName: Full=Putative uncharacterized protein C4orf29;							extracellular region				ovary(1)	1																		---	---	---	---
SCLT1	132320	broad.mit.edu	37	4	130008641	130008641	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130008641delA	uc003igp.2	-						SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron|SCLT1_uc003igr.2_Intron|SCLT1_uc003igs.2_Intron|SCLT1_uc003igt.3_Intron	NM_144643	NP_653244			sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	130207491	130207494	+	IGR	DEL	ATGT	-	-	rs113456066		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130207491_130207494delATGT								C4orf33 (173649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131975627	131975627	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131975627delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133738675	133738676	+	IGR	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133738675_133738676delTC								None (None upstream) : PCDH10 (331794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136552650	136552652	+	IGR	DEL	AAA	-	-	rs114478377	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136552650_136552652delAAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137184436	137184437	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137184436_137184437delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137348374	137348375	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137348374_137348375insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139714912	139714915	+	IGR	DEL	AAAG	-	-	rs143077373		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139714912_139714915delAAAG								SLC7A11 (551409 upstream) : CCRN4L (222028 downstream)																																			---	---	---	---
SETD7	80854	broad.mit.edu	37	4	140438395	140438395	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140438395delG	uc003ihw.2	-							NM_030648	NP_085151			SET domain-containing protein 7						peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.156)																	---	---	---	---
MGST2	4258	broad.mit.edu	37	4	140637351	140637352	+	Intron	INS	-	AAG	AAG	rs142738312	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140637351_140637352insAAG	uc010ioi.1	+											Homo sapiens cDNA FLJ27438 fis, clone TST09249, highly similar to Homo sapiens microsomal glutathione S-transferase 2 (MGST2).						glutathione biosynthetic process|leukotriene biosynthetic process|leukotriene production involved in inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane|plasma membrane	enzyme activator activity|glutathione peroxidase activity|glutathione transferase activity|leukotriene-C4 synthase activity			ovary(1)	1	all_hematologic(180;0.162)				Glutathione(DB00143)													---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140954579	140954579	+	Intron	DEL	G	-	-	rs10713599		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140954579delG	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	141100795	141100809	+	IGR	DEL	TGTTTTGTTTTGTTT	-	-	rs72318905		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141100795_141100809delTGTTTTGTTTTGTTT								MAML3 (25562 upstream) : SCOC (77631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141124258	141124259	+	IGR	INS	-	CCA	CCA	rs149355541	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141124258_141124259insCCA								MAML3 (49025 upstream) : SCOC (54181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141360177	141360177	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141360177delC								CLGN (11362 upstream) : ELMOD2 (85175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	142128181	142128183	+	IGR	DEL	CTT	-	-	rs147211749		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142128181_142128183delCTT								RNF150 (73565 upstream) : ZNF330 (13866 downstream)																																			---	---	---	---
IL15	3600	broad.mit.edu	37	4	142580360	142580360	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142580360delT	uc003iis.2	+						IL15_uc003iit.2_Intron|IL15_uc010iol.2_Intron|IL15_uc003iiu.2_Intron	NM_000585	NP_000576			interleukin 15 preproprotein						cell-cell signaling|immune response|positive regulation of interleukin-17 production	endosome|extracellular space|Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	cytokine activity|cytokine receptor binding|signal transducer activity				0	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	145866025	145866025	+	IGR	DEL	G	-	-	rs59314832	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145866025delG								HHIP (206144 upstream) : ANAPC10 (50289 downstream)																																			---	---	---	---
ZNF827	152485	broad.mit.edu	37	4	146860090	146860091	+	5'Flank	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146860090_146860091delCA	uc003ikn.2	-						ZNF827_uc003ikm.2_5'Flank|ZNF827_uc010iox.2_5'Flank	NM_178835	NP_849157			zinc finger protein 827						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)																	---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147224528	147224528	+	Intron	DEL	T	-	-	rs111238580		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147224528delT	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	149525801	149525801	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149525801delA								NR3C2 (162158 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	150067948	150067949	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150067948_150067949insA								NR3C2 (704305 upstream) : DCLK2 (932131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	150198990	150198991	+	IGR	INS	-	T	T	rs148229579	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150198990_150198991insT								NR3C2 (835347 upstream) : DCLK2 (801089 downstream)																																			---	---	---	---
LRBA	987	broad.mit.edu	37	4	151395483	151395483	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151395483delC	uc010ipj.2	-						LRBA_uc003ils.3_Intron|LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
LRBA	987	broad.mit.edu	37	4	151824209	151824209	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151824209delG	uc010ipj.2	-						LRBA_uc003ilu.3_Intron|LRBA_uc010ipk.1_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
SH3D19	152503	broad.mit.edu	37	4	152089328	152089348	+	Intron	DEL	AAGGTGAGAAGTATATTGAAA	-	-	rs36212469		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152089328_152089348delAAGGTGAGAAGTATATTGAAA	uc010ipl.1	-						SH3D19_uc003imb.2_5'Flank|SH3D19_uc003imc.2_Intron|SH3D19_uc003ime.2_Intron|SH3D19_uc010ipm.2_Intron	NM_001009555	NP_001009555			SH3 domain containing 19 isoform a						cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	152266895	152266896	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152266895_152266896insT								PRSS48 (54292 upstream) : FAM160A1 (63502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	153542971	153542972	+	IGR	INS	-	T	T	rs71596299		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153542971_153542972insT								FBXW7 (86628 upstream) : TMEM154 (4299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	156473830	156473831	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156473830_156473831delGA								MAP9 (175708 upstream) : GUCY1A3 (114031 downstream)																																			---	---	---	---
GRIA2	2891	broad.mit.edu	37	4	158272084	158272084	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158272084delT	uc003ipm.3	+						GRIA2_uc011cit.1_Intron|GRIA2_uc003ipl.3_Intron|GRIA2_uc003ipk.3_Intron|GRIA2_uc010iqh.1_Intron	NM_001083619	NP_001077088			glutamate receptor, ionotropic, AMPA 2 isoform 2						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	158609099	158609100	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158609099_158609100delTG								LOC340017 (111804 upstream) : FAM198B (436633 downstream)																																			---	---	---	---
C4orf45	152940	broad.mit.edu	37	4	159891698	159891698	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159891698delG	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756			hypothetical protein LOC152940												0																		---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	165247657	165247658	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165247657_165247658delTG	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	168941014	168941015	+	IGR	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168941014_168941015delCT								SPOCK3 (785273 upstream) : ANXA10 (72692 downstream)																																			---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169728429	169728430	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169728429_169728430delCA	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
AADAT	51166	broad.mit.edu	37	4	171002383	171002383	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171002383delA	uc003isr.2	-						AADAT_uc003iss.2_Intron|AADAT_uc003ist.2_Intron	NM_016228	NP_057312			kynurenine aminotransferase II						2-oxoglutarate metabolic process|biosynthetic process|glutamate metabolic process|lysine catabolic process	mitochondrial matrix	2-aminoadipate transaminase activity|kynurenine-oxoglutarate transaminase activity|protein homodimerization activity				0		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	172952371	172952372	+	Intron	INS	-	AA	AA	rs138454237	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172952371_172952372insAA	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	175091999	175092000	+	Intron	DEL	AC	-	-	rs150663766		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175091999_175092000delAC	uc003ito.1	-											Homo sapiens cDNA FLJ43267 fis, clone IMR322007704.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	175762694	175762694	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175762694delG	uc003iua.1	+						uc003iub.1_Intron					Homo sapiens cDNA FLJ35945 fis, clone TESTI2011915.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	178954549	178954550	+	IGR	INS	-	GAG	GAG	rs140250253	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178954549_178954550insGAG								LOC285501 (42646 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	179665597	179665597	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179665597delC								LOC285501 (753694 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180449936	180449937	+	IGR	INS	-	T	T	rs112270566		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180449936_180449937insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181134516	181134517	+	IGR	DEL	TG	-	-	rs147923036		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181134516_181134517delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181650995	181650995	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181650995delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181926523	181926523	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181926523delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188250839	188250840	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188250839_188250840delCA								FAT1 (602989 upstream) : ZFP42 (666085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188397095	188397095	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188397095delA								FAT1 (749245 upstream) : ZFP42 (519830 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188729961	188729962	+	IGR	INS	-	G	G	rs79853961	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188729961_188729962insG								None (None upstream) : ZFP42 (186963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189736924	189736924	+	IGR	DEL	G	-	-	rs56098978	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189736924delG								TRIML1 (668275 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190565934	190565934	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190565934delG								None (None upstream) : FRG1 (296040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190631648	190631649	+	IGR	INS	-	G	G	rs144718795		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190631648_190631649insG								None (None upstream) : FRG1 (230325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190825682	190825683	+	Intron	INS	-	T	T	rs138468383		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190825682_190825683insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190828972	190828974	+	Intron	DEL	ATG	-	-	rs112405826		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190828972_190828974delATG	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
AHRR	57491	broad.mit.edu	37	5	350891	350891	+	Intron	DEL	A	-	-	rs11306167		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:350891delA	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_Intron	NM_020731	NP_065782			arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)															---	---	---	---
SLC9A3	6550	broad.mit.edu	37	5	503114	503115	+	Intron	INS	-	GCTGT	GCTGT	rs68049670		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:503114_503115insGCTGT	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron	NM_004174	NP_004165			solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	1380022	1380023	+	RNA	DEL	AC	-	-	rs72323935		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1380022_1380023delAC	uc003jci.1	-	1		c.141_142delGT			uc003jcj.1_RNA					Homo sapiens cDNA clone IMAGE:4830758.																														---	---	---	---
SDHAP3	728609	broad.mit.edu	37	5	1574154	1574154	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1574154delT	uc011cmd.1	-						SDHAP3_uc011cme.1_Intron					Homo sapiens cDNA FLJ58919 complete cds, moderately similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial precursor (EC1.3.5.1).												0																		---	---	---	---
MTRR	4552	broad.mit.edu	37	5	7871264	7871266	+	Intron	DEL	CTT	-	-	rs139287124		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7871264_7871266delCTT	uc003jed.2	+						FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_Intron|MTRR_uc003jee.3_Intron|MTRR_uc003jef.3_Intron|MTRR_uc003jeg.3_Intron|MTRR_uc010ito.2_Intron	NM_024010	NP_076915			methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	8448899	8448899	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8448899delA	uc003jeh.1	-											Homo sapiens cDNA clone IMAGE:5297486.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	10530902	10530903	+	IGR	DEL	GT	-	-	rs111992505		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10530902_10530903delGT								ROPN1L (65765 upstream) : DAP (148440 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11768340	11768340	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11768340delG	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	14949479	14949479	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14949479delT								ANKH (77592 upstream) : FBXL7 (550826 downstream)																																			---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15886320	15886321	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15886320_15886321delGT	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	16381444	16381446	+	IGR	DEL	TGT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16381444_16381446delTGT								MARCH11 (201547 upstream) : ZNF622 (70183 downstream)																																			---	---	---	---
MYO10	4651	broad.mit.edu	37	5	16748504	16748504	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16748504delC	uc003jft.3	-						MYO10_uc010itx.2_Intron	NM_012334	NP_036466			myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	16972278	16972278	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16972278delA								MYO10 (35893 upstream) : LOC285696 (157859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17127319	17127335	+	IGR	DEL	GACCTCAATCTTTCACA	-	-	rs72422924		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17127319_17127335delGACCTCAATCTTTCACA								MYO10 (190934 upstream) : LOC285696 (2802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17335842	17335843	+	IGR	INS	-	CTAT	CTAT	rs150964576	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17335842_17335843insCTAT								BASP1 (58907 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17692804	17692804	+	IGR	DEL	G	-	-	rs70947615		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17692804delG								BASP1 (415869 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17888690	17888690	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17888690delA	uc003jgb.2	+											Homo sapiens cDNA clone IMAGE:5201079.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	18056602	18056603	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18056602_18056603insA								BASP1 (779667 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	21124522	21124522	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21124522delT								None (None upstream) : GUSBP1 (217420 downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21536533	21536538	+	Intron	DEL	ATAAGC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21536533_21536538delATAAGC	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	23298415	23298416	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23298415_23298416insA								CDH12 (444684 upstream) : PRDM9 (209308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25061601	25061601	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25061601delC								CDH10 (416690 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25585202	25585202	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25585202delT								CDH10 (940291 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28591548	28591549	+	IGR	INS	-	AA	AA	rs117293687	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28591548_28591549insAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28682701	28682704	+	IGR	DEL	TTTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28682701_28682704delTTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29433951	29433952	+	IGR	INS	-	A	A	rs145991737	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29433951_29433952insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29876063	29876063	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29876063delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30505575	30505575	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30505575delT								None (None upstream) : CDH6 (688221 downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	32037951	32037952	+	Intron	INS	-	T	T	rs34782483		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32037951_32037952insT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
GOLPH3	64083	broad.mit.edu	37	5	32155900	32155907	+	Intron	DEL	CTAAAAAT	-	-	rs71300158		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32155900_32155907delCTAAAAAT	uc003jhp.1	-							NM_022130	NP_071413			golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32580943	32580944	+	IGR	INS	-	T	T	rs79787728		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32580943_32580944insT								ZFR (136099 upstream) : SUB1 (4661 downstream)																																			---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33548808	33548809	+	Intron	DEL	CA	-	-	rs72462060		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33548808_33548809delCA	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35719731	35719731	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35719731delT	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143			KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	38251126	38251127	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38251126_38251127delTG								GDNF (411344 upstream) : EGFLAM (7406 downstream)																																			---	---	---	---
RICTOR	253260	broad.mit.edu	37	5	39046301	39046302	+	Intron	INS	-	A	A	rs115256138	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39046301_39046302insA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969			rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	40711356	40711357	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40711356_40711357delAA								PTGER4 (17521 upstream) : TTC33 (323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41662618	41662619	+	IGR	INS	-	G	G	rs151025866	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41662618_41662619insG								PLCXD3 (151888 upstream) : OXCT1 (67549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41959531	41959532	+	IGR	INS	-	T	T	rs146562941	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41959531_41959532insT								FBXO4 (17868 upstream) : GHR (464494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	43117444	43117447	+	IGR	DEL	TTTT	-	-	rs35770329		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43117444_43117447delTTTT								LOC153684 (72074 upstream) : ZNF131 (3538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	43354471	43354471	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43354471delA								HMGCS1 (40876 upstream) : CCL28 (22279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45798668	45798669	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45798668_45798669insT								HCN1 (102448 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46341233	46341233	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46341233delA								HCN1 (645013 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50572499	50572499	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50572499delA								PARP8 (434330 upstream) : ISL1 (106459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50700813	50700813	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50700813delT								ISL1 (10256 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52686934	52686935	+	IGR	INS	-	A	A	rs71598851		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52686934_52686935insA								MOCS2 (281336 upstream) : FST (89660 downstream)																																			---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53488391	53488392	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53488391_53488392insT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	57445915	57445916	+	IGR	DEL	AG	-	-	rs149383367		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57445915_57445916delAG								ACTBL2 (667279 upstream) : PLK2 (303896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	57780125	57780126	+	IGR	INS	-	T	T	rs59246863		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57780125_57780126insT								PLK2 (24212 upstream) : GAPT (7204 downstream)																																			---	---	---	---
NDUFAF2	91942	broad.mit.edu	37	5	60263362	60263362	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60263362delT	uc003jsp.3	+						NDUFAF2_uc003jso.3_Intron	NM_174889	NP_777549			NADH dehydrogenase (ubiquinone) 1 alpha							membrane|mitochondrion	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	61280048	61280048	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61280048delC								FLJ37543 (277686 upstream) : KIF2A (321941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62712903	62712903	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62712903delC								ISCA1P1 (639733 upstream) : HTR1A (543376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	65588415	65588415	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65588415delT								SFRS12 (111703 upstream) : MAST4 (303761 downstream)																																			---	---	---	---
MAST4	375449	broad.mit.edu	37	5	65902068	65902068	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65902068delT	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
MAST4	375449	broad.mit.edu	37	5	66252678	66252678	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66252678delA	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron|MAST4_uc003juu.1_5'Flank|MAST4_uc011cra.1_5'Flank	NM_015183	NP_055998			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
PTCD2	79810	broad.mit.edu	37	5	71625509	71625509	+	Intron	DEL	C	-	-	rs11313142		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71625509delC	uc003kcb.2	+						PTCD2_uc011csf.1_Intron|PTCD2_uc003kcc.2_Intron|PTCD2_uc011csg.1_Intron|PTCD2_uc011csh.1_Intron|PTCD2_uc003kcd.2_Intron	NM_024754	NP_079030			pentatricopeptide repeat domain 2												0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)														---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71778573	71778574	+	Intron	INS	-	TGTG	TGTG	rs150309169	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71778573_71778574insTGTG	uc003kce.1	-							NM_152625	NP_689838			zinc finger protein 366						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	74195097	74195097	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74195097delA								FAM169A (3309 upstream) : GCNT4 (128193 downstream)																																			---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75943648	75943649	+	Intron	INS	-	CA	CA	rs34315403		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75943648_75943649insCA	uc003kek.2	+						IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron	NM_006633	NP_006624			IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76075492	76075492	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76075492delT								F2R (43898 upstream) : F2RL1 (39341 downstream)																																			---	---	---	---
WDR41	55255	broad.mit.edu	37	5	76741292	76741293	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76741292_76741293insA	uc003kff.1	-						WDR41_uc011csy.1_Intron|WDR41_uc011csz.1_Intron|WDR41_uc011cta.1_Intron|WDR41_uc011ctb.1_Intron	NM_018268	NP_060738			WD repeat domain 41												0		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	78653119	78653120	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78653119_78653120delTT								JMY (30083 upstream) : HOMER1 (16667 downstream)																																			---	---	---	---
ATG10	83734	broad.mit.edu	37	5	81291266	81291266	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81291266delT	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500			APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)														---	---	---	---
XRCC4	7518	broad.mit.edu	37	5	82545540	82545541	+	Intron	INS	-	AATC	AATC	rs137999328	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82545540_82545541insAATC	uc003kib.2	+						XRCC4_uc003kia.1_Intron|XRCC4_uc003kid.2_Intron|XRCC4_uc003kic.2_Intron|XRCC4_uc003kie.2_Intron|XRCC4_uc003kif.1_Intron|XRCC4_uc003kig.2_Intron	NM_022406	NP_071801			X-ray repair cross complementing protein 4						DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)									NHEJ					---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90295293	90295293	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90295293delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron|GPR98_uc003kjx.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	91277886	91277887	+	IGR	INS	-	T	T	rs11438673		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91277886_91277887insT								LOC100129716 (561355 upstream) : None (None downstream)																																			---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94164895	94164895	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94164895delG	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Intron|MCTP1_uc003kku.2_Intron	NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	96747289	96747289	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96747289delG								RIOK2 (228284 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	97217766	97217767	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97217766_97217767insA								RIOK2 (698761 upstream) : RGMB (887232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	97671946	97671946	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97671946delT								None (None upstream) : RGMB (433053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	103246489	103246489	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103246489delA								NUDT12 (347999 upstream) : None (None downstream)																																			---	---	---	---
EFNA5	1946	broad.mit.edu	37	5	106816608	106816609	+	Intron	DEL	AA	-	-	rs71955507		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106816608_106816609delAA	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953			ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
FBXL17	64839	broad.mit.edu	37	5	107714030	107714031	+	Intron	INS	-	TTTG	TTTG	rs149601086	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107714030_107714031insTTTG	uc011cvc.1	-							NM_001163315	NP_001156787			F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	108979186	108979187	+	IGR	INS	-	T	T	rs139938450	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108979186_108979187insT								PJA2 (233511 upstream) : MAN2A1 (45969 downstream)																																			---	---	---	---
EPB41L4A	64097	broad.mit.edu	37	5	111711006	111711007	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111711006_111711007delTC	uc003kpv.1	-						EPB41L4A_uc003kpw.1_Intron	NM_022140	NP_071423			erythrocyte protein band 4.1-like 4							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)														---	---	---	---
REEP5	7905	broad.mit.edu	37	5	112260381	112260381	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112260381delA	uc003kqe.1	-						REEP5_uc011cvx.1_5'Flank|REEP5_uc011cvy.1_5'Flank|REEP5_uc011cvz.1_5'Flank	NM_005669	NP_005660			receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)														---	---	---	---
MCC	4163	broad.mit.edu	37	5	112675106	112675107	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112675106_112675107delGT	uc003kql.3	-						MCC_uc003kqk.3_Intron	NM_001085377	NP_001078846			mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
MCC	4163	broad.mit.edu	37	5	112745056	112745057	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112745056_112745057insT	uc003kql.3	-							NM_001085377	NP_001078846			mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	114140843	114140843	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114140843delG								KCNN2 (308647 upstream) : TRIM36 (319624 downstream)																																			---	---	---	---
CCDC112	153733	broad.mit.edu	37	5	114634218	114634220	+	5'Flank	DEL	AGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114634218_114634220delAGA	uc003kqy.2	-						CCDC112_uc003kqz.2_5'Flank|CCDC112_uc003kra.2_5'Flank	NM_152549	NP_689762			coiled-coil domain containing 112 isoform 2												0		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	116253478	116253478	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116253478delA								SEMA6A (342927 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116879804	116879805	+	Intron	INS	-	A	A	rs112595539		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116879804_116879805insA	uc003kry.2	+											Homo sapiens cDNA clone IMAGE:5297581.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	117916448	117916448	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117916448delC								None (None upstream) : DTWD2 (256123 downstream)																																			---	---	---	---
TNFAIP8	25816	broad.mit.edu	37	5	118728496	118728496	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118728496delT	uc003ksh.2	+						TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron|TNFAIP8_uc011cwf.1_Intron|TNFAIP8_uc003ksi.2_Intron	NM_014350	NP_055165			tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	119127866	119127866	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119127866delG								FAM170A (156350 upstream) : PRR16 (672153 downstream)																																			---	---	---	---
ZNF608	57507	broad.mit.edu	37	5	124025724	124025725	+	Intron	INS	-	A	A	rs149788738	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124025724_124025725insA	uc003ktq.1	-						ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Intron|ZNF608_uc003ktt.1_Intron	NM_020747	NP_065798			zinc finger protein 608							intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)														---	---	---	---
CHSY3	337876	broad.mit.edu	37	5	129283161	129283162	+	Intron	INS	-	A	A	rs10044593	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129283161_129283162insA	uc003kvd.2	+							NM_175856	NP_787052			chondroitin sulfate synthase 3							Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	129935984	129935984	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129935984delA								CHSY3 (413658 upstream) : HINT1 (558891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	130133364	130133365	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130133364_130133365delCA								CHSY3 (611038 upstream) : HINT1 (361510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133183412	133183412	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133183412delC								FSTL4 (235189 upstream) : C5orf15 (107787 downstream)																																			---	---	---	---
PHF15	23338	broad.mit.edu	37	5	133911414	133911415	+	Intron	INS	-	A	A	rs112254639		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133911414_133911415insA	uc003kzo.1	+						PHF15_uc011cxt.1_Intron|PHF15_uc003kzk.2_Intron|PHF15_uc003kzl.2_Intron|PHF15_uc003kzm.2_Intron|PHF15_uc003kzn.2_Intron|PHF15_uc003kzp.2_3'UTR	NM_015288	NP_056103			PHD finger protein 15						histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	137957650	137957651	+	IGR	INS	-	AA	AA	rs113435719		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137957650_137957651insAA								HSPA9 (46535 upstream) : CTNNA1 (131456 downstream)																																			---	---	---	---
CXXC5	51523	broad.mit.edu	37	5	139056414	139056414	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139056414delC	uc010jfg.1	+						CXXC5_uc003let.2_Intron	NM_016463	NP_057547			CXXC finger 5						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|nucleus	DNA binding|signal transducer activity|zinc ion binding			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
C5orf32	84418	broad.mit.edu	37	5	139602830	139602830	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139602830delC	uc003lfd.2	+						C5orf32_uc010jfi.2_Intron	NM_032412	NP_115788			hypothetical protein LOC84418												0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
FGF1	2246	broad.mit.edu	37	5	142061240	142061241	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142061240_142061241insA	uc003lmn.3	-						FGF1_uc003lmp.3_Intron|FGF1_uc003lmq.2_Intron|FGF1_uc010jgj.2_Intron|FGF1_uc003lmr.2_Intron|FGF1_uc003lms.3_Intron	NM_000800	NP_000791			fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	145708816	145708816	+	IGR	DEL	C	-	-	rs145073715		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145708816delC								RBM27 (40034 upstream) : POU4F3 (9771 downstream)																																			---	---	---	---
STK32A	202374	broad.mit.edu	37	5	146745693	146745693	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146745693delG	uc010jgn.1	+						STK32A_uc003lom.2_Intron|STK32A_uc011dbw.1_Intron	NM_001112724	NP_001106195			serine/threonine kinase 32A isoform 1								ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
HTR4	3360	broad.mit.edu	37	5	147960997	147960997	+	Intron	DEL	C	-	-	rs59629272		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147960997delC	uc003lpn.2	-						HTR4_uc010jgu.1_Intron|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron|HTR4_uc003lpk.2_Intron|HTR4_uc011dby.1_Intron|HTR4_uc003lpl.2_Intron|HTR4_uc003lpm.2_Intron|HTR4_uc010jgv.2_Intron|HTR4_uc003lpo.1_Intron|SH3TC2_uc003lpp.1_Intron	NM_000870	NP_000861			serotonin 5-HT4 receptor isoform b						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	148855705	148855708	+	IGR	DEL	TTTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148855705_148855708delTTTG								LOC728264 (43306 upstream) : CSNK1A1 (17241 downstream)																																			---	---	---	---
GM2A	2760	broad.mit.edu	37	5	150788561	150788561	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150788561delT	uc011dcs.1	+							NM_000405				GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	151762377	151762377	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151762377delA								GLRA1 (457980 upstream) : NMUR2 (8725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	153982967	153982967	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153982967delT								HAND1 (125143 upstream) : MIR1303 (82369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157628510	157628510	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157628510delT								CLINT1 (342342 upstream) : EBF1 (494414 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157926087	157926087	+	IGR	DEL	C	-	-	rs111824611		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157926087delC								CLINT1 (639919 upstream) : EBF1 (196837 downstream)																																			---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160257998	160257999	+	Intron	INS	-	CACT	CACT	rs7710664		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160257998_160257999insCACT	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	162608071	162608072	+	IGR	INS	-	TGTG	TGTG	rs148385181	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162608071_162608072insTGTG								None (None upstream) : CCNG1 (256505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	163411106	163411107	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163411106_163411107delGA								MAT2B (464773 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164526430	164526430	+	IGR	DEL	T	-	-	rs112745250		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164526430delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164961524	164961524	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164961524delC								None (None upstream) : None (None downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	166927033	166927034	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166927033_166927034delGT	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	168845581	168845584	+	IGR	DEL	TCAT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168845581_168845584delTCAT								SLIT3 (117448 upstream) : CCDC99 (165054 downstream)																																			---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169087596	169087596	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169087596delC	uc003maf.2	+						DOCK2_uc011der.1_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169365229	169365229	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169365229delC	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron|FAM196B_uc003mag.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	169514230	169514233	+	IGR	DEL	TCTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169514230_169514233delTCTC								DOCK2 (3846 upstream) : FOXI1 (18684 downstream)																																			---	---	---	---
LCP2	3937	broad.mit.edu	37	5	169706758	169706765	+	Intron	DEL	AGGAACTT	-	-	rs113238416		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169706758_169706765delAGGAACTT	uc003man.1	-						LCP2_uc011det.1_Intron	NM_005565	NP_005556			lymphocyte cytosolic protein 2						immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	172188919	172188919	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172188919delT								NEURL1B (70388 upstream) : DUSP1 (6183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	172729772	172729773	+	IGR	DEL	GT	-	-	rs34335259		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172729772_172729773delGT								NKX2-5 (67510 upstream) : STC2 (11953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173985448	173985452	+	IGR	DEL	CCTTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173985448_173985452delCCTTT								HMP19 (449267 upstream) : MSX2 (166123 downstream)																																			---	---	---	---
CPLX2	10814	broad.mit.edu	37	5	175301433	175301433	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175301433delG	uc003mde.1	+						CPLX2_uc003mdf.1_Intron	NM_006650	NP_006641			complexin 2						mast cell degranulation|positive regulation of synaptic plasticity|vesicle docking involved in exocytosis	cytosol				ovary(1)	1	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	177488314	177488315	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177488314_177488315insT								FAM153C (12226 upstream) : N4BP3 (52241 downstream)																																			---	---	---	---
ADAMTS2	9509	broad.mit.edu	37	5	178709839	178709839	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178709839delG	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	179066624	179066625	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179066624_179066625delAA								HNRNPH1 (14954 upstream) : C5orf60 (1935 downstream)																																			---	---	---	---
TBC1D9B	23061	broad.mit.edu	37	5	179337128	179337128	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179337128delT	uc003mlh.2	-						TBC1D9B_uc003mli.2_5'Flank|TBC1D9B_uc003mlj.2_5'Flank	NM_198868	NP_942568			TBC1 domain family, member 9B (with GRAM domain)							integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
CNOT6	57472	broad.mit.edu	37	5	179943183	179943184	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179943183_179943184delTT	uc003mlx.2	+						CNOT6_uc010jld.2_Intron|CNOT6_uc010jle.2_Intron	NM_015455	NP_056270			CCR4-NOT transcription complex, subunit 6						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)														---	---	---	---
TRIM7	81786	broad.mit.edu	37	5	180625373	180625373	+	Intron	DEL	G	-	-	rs7701372	byFrequency;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180625373delG	uc003mmz.1	-						TRIM7_uc003mmv.1_Intron|TRIM7_uc003mmw.1_Intron|TRIM7_uc003mmx.1_Intron|TRIM7_uc003mmy.1_Intron	NM_203293	NP_976038			tripartite motif-containing 7 isoform 1							cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	783035	783036	+	5'Flank	INS	-	T	T	rs140242327		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:783035_783036insT	uc003mti.1	-											Homo sapiens cDNA FLJ36084 fis, clone TESTI2020029.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	793797	793798	+	IGR	DEL	TT	-	-	rs67857941		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:793797_793798delTT								EXOC2 (100688 upstream) : LOC285768 (167444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	914637	914637	+	IGR	DEL	T	-	-	rs67936554		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:914637delT								EXOC2 (221528 upstream) : LOC285768 (46605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1542472	1542483	+	IGR	DEL	GAAGGAAGGAAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1542472_1542483delGAAGGAAGGAAA								FOXF2 (146641 upstream) : FOXC1 (68198 downstream)																																			---	---	---	---
NQO2	4835	broad.mit.edu	37	6	3011186	3011187	+	Intron	INS	-	A	A	rs35198315	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3011186_3011187insA	uc003mus.2	+						NQO2_uc003mup.1_Intron|NQO2_uc003mut.2_Intron	NM_000904	NP_000895			NAD(P)H dehydrogenase, quinone 2							cytoplasm|nucleus	coenzyme binding|dihydronicotinamide riboside quinone reductase activity|electron carrier activity|metal ion binding|NADPH dehydrogenase (quinone) activity			ovary(1)	1	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Menadione(DB00170)|NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	4696292	4696292	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4696292delA								PECI (560461 upstream) : CDYL (10101 downstream)																																			---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4779356	4779356	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4779356delT	uc003mwi.2	+						CDYL_uc003mwj.2_Intron|CDYL_uc003mwk.2_Intron	NM_001143971	NP_001137443			chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5588488	5588490	+	Intron	DEL	GTG	-	-	rs113813112		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5588488_5588490delGTG	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	5875777	5875778	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5875777_5875778delAC								FARS2 (103961 upstream) : NRN1 (122457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7010648	7010648	+	IGR	DEL	A	-	-	rs57570152	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7010648delA								LY86 (355432 upstream) : RREB1 (97540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7026064	7026064	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7026064delA								LY86 (370848 upstream) : RREB1 (82124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8847732	8847733	+	IGR	INS	-	TG	TG	rs148911027	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8847732_8847733insTG								HULC (193655 upstream) : None (None downstream)																																			---	---	---	---
C6orf218	221718	broad.mit.edu	37	6	10434186	10434186	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10434186delA	uc003myz.2	-							NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	11656661	11656661	+	IGR	DEL	T	-	-	rs111340936		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11656661delT								TMEM170B (72905 upstream) : C6orf105 (57229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	11686927	11686927	+	IGR	DEL	A	-	-	rs35778589		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11686927delA								TMEM170B (103171 upstream) : C6orf105 (26963 downstream)																																			---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13179638	13179639	+	Intron	DEL	GT	-	-	rs6149433		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13179638_13179639delGT	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	13868389	13868390	+	IGR	DEL	TC	-	-	rs145823198		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13868389_13868390delTC								CCDC90A (53600 upstream) : RNF182 (56813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	14658774	14658774	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14658774delG								CD83 (521628 upstream) : JARID2 (586960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	17163089	17163089	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17163089delA								ATXN1 (401368 upstream) : RBM24 (118720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18932499	18932500	+	IGR	DEL	TT	-	-	rs67696125		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18932499_18932500delTT								MIR548A1 (360388 upstream) : ID4 (905117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19947570	19947570	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19947570delT								ID4 (106656 upstream) : MBOAT1 (153365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	20231056	20231056	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20231056delA								MBOAT1 (18386 upstream) : E2F3 (171081 downstream)																																			---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	20555072	20555073	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20555072_20555073insT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc010jpo.1_Intron|CDKAL1_uc003ndb.1_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	22619678	22619678	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22619678delT								HDGFL1 (48929 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23140034	23140034	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23140034delC								HDGFL1 (569285 upstream) : NRSN1 (986380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23875528	23875528	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23875528delA								None (None upstream) : NRSN1 (250886 downstream)																																			---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24996036	24996037	+	Intron	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24996036_24996037insG	uc011dju.1	-							NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25899430	25899431	+	IGR	DEL	CA	-	-	rs34800930		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25899430_25899431delCA								SLC17A3 (24959 upstream) : SLC17A2 (13560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26605148	26605149	+	RNA	INS	-	GGA	GGA	rs146176704	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26605148_26605149insGGA	uc010jqm.1	+	2		c.1124_1125insGGA								Homo sapiens cDNA clone IMAGE:4830894.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	28210535	28210536	+	IGR	DEL	AC	-	-	rs68170691		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28210535_28210536delAC								ZNF193 (9275 upstream) : ZKSCAN4 (1954 downstream)																																			---	---	---	---
ZSCAN12	9753	broad.mit.edu	37	6	28364385	28364386	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28364385_28364386insT	uc011dlh.1	-						ZSCAN12_uc010jre.2_Intron	NM_001163391	NP_001156863			zinc finger and SCAN domain containing 12												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30392201	30392202	+	IGR	INS	-	TA	TA	rs141645277	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30392201_30392202insTA								TRIM39 (77569 upstream) : HLA-E (65069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30450318	30450318	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30450318delT								TRIM39 (135686 upstream) : HLA-E (6953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30800928	30800928	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30800928delT	uc003nrp.1	-											RecName: Full=Putative uncharacterized protein C6orf214;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	30820601	30820602	+	IGR	INS	-	TTC	TTC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30820601_30820602insTTC								IER3 (108274 upstream) : DDR1 (30092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30837455	30837455	+	IGR	DEL	T	-	-	rs9278787		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30837455delT								IER3 (125128 upstream) : DDR1 (13239 downstream)																																			---	---	---	---
DPCR1	135656	broad.mit.edu	37	6	30909235	30909238	+	Intron	DEL	TTTT	-	-	rs34866734		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30909235_30909238delTTTT	uc003nsg.2	+							NM_080870	NP_543146			diffuse panbronchiolitis critical region 1							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	31076113	31076113	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31076113delT								HCG22 (48460 upstream) : C6orf15 (2887 downstream)																																			---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31289834	31289834	+	Intron	DEL	T	-	-	rs111463026		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31289834delT	uc003ntf.2	-						HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron					SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
C2	717	broad.mit.edu	37	6	31886376	31886376	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31886376delA	uc011dop.1	+						C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron	NM_001145903	NP_001139375			complement component 2 isoform 2 preproprotein						complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	33573532	33573532	+	IGR	DEL	C	-	-	rs34396378		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33573532delC								C6orf227 (12417 upstream) : ITPR3 (15629 downstream)																																			---	---	---	---
C6orf106	64771	broad.mit.edu	37	6	34638465	34638466	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34638465_34638466insA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270			chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3																		---	---	---	---
RPL10A	4736	broad.mit.edu	37	6	35434890	35434890	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35434890delT	uc003okp.1	+						RPL10A_uc003okq.1_5'Flank|RPL10A_uc003okr.1_5'Flank|RPL10A_uc003oks.1_5'Flank	NM_007104	NP_009035			ribosomal protein L10a						anatomical structure morphogenesis|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	RNA binding|structural constituent of ribosome			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	36459554	36459556	+	IGR	DEL	TTG	-	-	rs35453626		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36459554_36459556delTTG								KCTD20 (1241 upstream) : STK38 (2118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37001960	37001960	+	IGR	DEL	G	-	-	rs78352377		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37001960delG								FGD2 (5115 upstream) : PIM1 (135962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37179028	37179031	+	IGR	DEL	TGTT	-	-	rs148026758		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37179028_37179031delTGTT								PIM1 (35826 upstream) : TMEM217 (924 downstream)																																			---	---	---	---
ZFAND3	60685	broad.mit.edu	37	6	37961895	37961896	+	Intron	DEL	TG	-	-	rs10535939		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37961895_37961896delTG	uc003onx.2	+							NM_021943	NP_068762			zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39615418	39615418	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39615418delA	uc003oot.2	-						KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39624129	39624130	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39624129_39624130delTG	uc003oot.2	-						KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39731994	39731994	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39731994delA								KIF6 (38813 upstream) : DAAM2 (28148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	39739698	39739699	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39739698_39739699insA								KIF6 (46517 upstream) : DAAM2 (20443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40656454	40656454	+	IGR	DEL	G	-	-	rs111234311		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40656454delG								LRFN2 (101328 upstream) : UNC5CL (338318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	41477712	41477713	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41477712_41477713delGT	uc003oqk.1	+											Homo sapiens mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	41629236	41629236	+	IGR	DEL	T	-	-	rs140882872		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41629236delT								MDFI (7255 upstream) : TFEB (22480 downstream)																																			---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42268739	42268740	+	Intron	DEL	AG	-	-	rs34724916		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42268739_42268740delAG	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	42844561	42844562	+	IGR	DEL	TT	-	-	rs79634695		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42844561_42844562delTT								KIAA0240 (8265 upstream) : RPL7L1 (3109 downstream)																																			---	---	---	---
XPO5	57510	broad.mit.edu	37	6	43498982	43498983	+	Intron	DEL	AC	-	-	rs3830212		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43498982_43498983delAC	uc003ovp.2	-							NM_020750	NP_065801			exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	44012399	44012400	+	Intron	DEL	AA	-	-	rs144698796	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44012399_44012400delAA	uc003owm.1	-											Homo sapiens cDNA: FLJ21083 fis, clone CAS03150.																														---	---	---	---
SPATS1	221409	broad.mit.edu	37	6	44285521	44285521	+	Intron	DEL	T	-	-	rs35098526		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44285521delT	uc003oxg.2	+											Homo sapiens cDNA FLJ25442 fis, clone TST08489.											skin(1)	1	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	44770199	44770200	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44770199_44770200delAG								CDC5L (355420 upstream) : SUPT3H (6854 downstream)																																			---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45298842	45298843	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45298842_45298843delGT	uc011dvx.1	+						SUPT3H_uc003oxn.1_Intron|SUPT3H_uc003oxo.2_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|RUNX2_uc011dvy.1_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	47395988	47395989	+	IGR	DEL	GG	-	-	rs34198768		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47395988_47395989delGG								TNFRSF21 (118308 upstream) : CD2AP (49536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49168796	49168796	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49168796delA								None (None upstream) : MUT (230198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49898607	49898608	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49898607_49898608delTG								CRISP1 (64389 upstream) : DEFB114 (29398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50956216	50956216	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50956216delA								TFAP2B (140891 upstream) : PKHD1 (523929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51161543	51161543	+	IGR	DEL	G	-	-	rs11312755		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51161543delG								TFAP2B (346218 upstream) : PKHD1 (318602 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53328474	53328475	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53328474_53328475insT								ELOVL5 (114532 upstream) : GCLC (33665 downstream)																																			---	---	---	---
C6orf142	90523	broad.mit.edu	37	6	54031380	54031380	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54031380delT	uc003pcg.3	+						C6orf142_uc003pcf.2_Intron|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Intron	NM_138569	NP_612636			hypothetical protein LOC90523							nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	54455809	54455809	+	IGR	DEL	T	-	-	rs113501642		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54455809delT								TINAG (200859 upstream) : FAM83B (255760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	54980305	54980313	+	IGR	DEL	TGTGTGGTA	-	-	rs67252860		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54980305_54980313delTGTGTGGTA								FAM83B (173488 upstream) : HCRTR2 (29189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	55478468	55478473	+	IGR	DEL	CAGAGG	-	-	rs77510225		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55478468_55478473delCAGAGG								HMGCLL1 (34456 upstream) : BMP5 (141767 downstream)																																			---	---	---	---
DST	667	broad.mit.edu	37	6	56531535	56531536	+	Intron	INS	-	T	T	rs111274857		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56531535_56531536insT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron|DST_uc003pde.2_Intron	NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
DST	667	broad.mit.edu	37	6	56681887	56681888	+	Intron	DEL	AC	-	-	rs34924606		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56681887_56681888delAC	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron	NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	56933243	56933244	+	IGR	INS	-	A	A	rs139975474	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56933243_56933244insA								KIAA1586 (13222 upstream) : ZNF451 (21584 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57212684	57212686	+	Intron	DEL	TTC	-	-	rs34106811		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57212684_57212686delTTC	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57226699	57226700	+	Intron	INS	-	A	A	rs140726189	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57226699_57226700insA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57233224	57233225	+	Intron	INS	-	A	A	rs150569832	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57233224_57233225insA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57253252	57253254	+	Intron	DEL	ATA	-	-	rs147405680		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57253252_57253254delATA	uc003pdx.2	+						hsa-mir-548u|MI0014168_5'Flank	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57262323	57262324	+	Intron	INS	-	G	G	rs142886884	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57262323_57262324insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57322786	57322812	+	Intron	DEL	ACTCATATTTAGGTTGTGGCATATCAC	-	-	rs67472830		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57322786_57322812delACTCATATTTAGGTTGTGGCATATCAC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57357900	57357903	+	Intron	DEL	GATC	-	-	rs141818741		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57357900_57357903delGATC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57374266	57374267	+	Intron	INS	-	T	T	rs78781001		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57374266_57374267insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57406654	57406655	+	Intron	INS	-	T	T	rs112281124		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57406654_57406655insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57445623	57445623	+	Intron	DEL	T	-	-	rs5876623		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57445623delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57448117	57448117	+	Intron	DEL	T	-	-	rs67190200		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57448117delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57488541	57488541	+	Intron	DEL	T	-	-	rs61132673		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57488541delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57515144	57515146	+	IGR	DEL	AAG	-	-	rs67325572		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515144_57515146delAAG								PRIM2 (1769 upstream) : GUSBL2 (731013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57604274	57604275	+	IGR	INS	-	C	C	rs142180710	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57604274_57604275insC								PRIM2 (90899 upstream) : GUSBL2 (641884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57924514	57924514	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57924514delG								PRIM2 (411139 upstream) : GUSBL2 (321645 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62514895	62514895	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62514895delA	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	64093277	64093278	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64093277_64093278delAC								LGSN (63395 upstream) : PTP4A1 (138373 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64701132	64701132	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64701132delT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	64756257	64756258	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64756257_64756258delTC	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66068493	66068494	+	Intron	DEL	GT	-	-	rs67163460		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66068493_66068494delGT	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66322404	66322404	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66322404delG	uc011dxu.1	-						EYS_uc003peq.2_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	68925875	68925875	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68925875delG								None (None upstream) : BAI3 (419757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	69175744	69175745	+	IGR	INS	-	A	A	rs150545340	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69175744_69175745insA								None (None upstream) : BAI3 (169887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	72192693	72192694	+	IGR	INS	-	C	C	rs142384996	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72192693_72192694insC								C6orf155 (62245 upstream) : RIMS1 (403956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	72529748	72529749	+	IGR	INS	-	A	A	rs72353358		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72529748_72529749insA								C6orf155 (399300 upstream) : RIMS1 (66901 downstream)																																			---	---	---	---
CD109	135228	broad.mit.edu	37	6	74415346	74415347	+	Intron	INS	-	AAAAG	AAAAG	rs146782182	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74415346_74415347insAAAAG	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000			CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	76210688	76210688	+	IGR	DEL	A	-	-	rs149290851		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76210688delA								FILIP1 (7192 upstream) : SENP6 (100934 downstream)																																			---	---	---	---
PHIP	55023	broad.mit.edu	37	6	79718302	79718302	+	Intron	DEL	T	-	-	rs66826280		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79718302delT	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404			pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)														---	---	---	---
SH3BGRL2	83699	broad.mit.edu	37	6	80338468	80338469	+	5'Flank	INS	-	A	A	rs150051794	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80338468_80338469insA	uc003piz.1	+							NM_031469	NP_113657			SH3 domain binding glutamic acid-rich protein							nucleus	SH3 domain binding				0		all_cancers(76;0.00188)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.174)		BRCA - Breast invasive adenocarcinoma(397;0.0278)														---	---	---	---
BCKDHB	594	broad.mit.edu	37	6	80967921	80967921	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80967921delA	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047			branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	81623441	81623441	+	IGR	DEL	T	-	-	rs71553656		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81623441delT								BCKDHB (567454 upstream) : FAM46A (832007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82323573	82323573	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82323573delA								None (None upstream) : FAM46A (131875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	83241051	83241052	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs2917483	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83241051_83241052insGTGTGTGTGT								TPBG (164437 upstream) : UBE2CBP (361134 downstream)																																			---	---	---	---
SNAP91	9892	broad.mit.edu	37	6	84269419	84269420	+	Intron	DEL	TT	-	-	rs145988652		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84269419_84269420delTT	uc011dze.1	-						SNAP91_uc011dzd.1_Intron|SNAP91_uc003pkb.2_Intron|SNAP91_uc003pkc.2_Intron|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Intron	NM_014841	NP_055656			synaptosomal-associated protein, 91kDa homolog						clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	84518353	84518353	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84518353delA								SNAP91 (99226 upstream) : RIPPLY2 (44632 downstream)																																			---	---	---	---
KIAA1009	22832	broad.mit.edu	37	6	84881834	84881834	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84881834delA	uc010kbp.2	-						KIAA1009_uc003pkj.3_Intron|KIAA1009_uc003pki.3_Intron	NM_014895	NP_055710			KIAA1009 protein						cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	85212264	85212268	+	IGR	DEL	GAAAA	-	-	rs66588631		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85212264_85212268delGAAAA								KIAA1009 (274929 upstream) : TBX18 (184813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85884863	85884863	+	IGR	DEL	C	-	-	rs34745077		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85884863delC								TBX18 (410964 upstream) : NT5E (274439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87019702	87019702	+	IGR	DEL	A	-	-	rs74806457		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87019702delA								SNHG5 (631251 upstream) : HTR1E (627322 downstream)																																			---	---	---	---
C6orf164	63914	broad.mit.edu	37	6	88096241	88096244	+	Intron	DEL	AAAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88096241_88096244delAAAC	uc003plr.2	+											Homo sapiens DC18 mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	88627618	88627619	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88627618_88627619insT								AKIRIN2 (215633 upstream) : SPACA1 (129888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89068990	89068990	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89068990delC								CNR1 (193223 upstream) : RNGTT (250999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89070005	89070006	+	IGR	DEL	TG	-	-	rs71794151		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89070005_89070006delTG								CNR1 (194238 upstream) : RNGTT (249983 downstream)																																			---	---	---	---
PM20D2	135293	broad.mit.edu	37	6	89858704	89858704	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89858704delT	uc003pmz.2	+							NM_001010853	NP_001010853			aminoacylase 1-like 2								hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	90032862	90032862	+	IGR	DEL	T	-	-	rs35634192		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90032862delT								GABRR2 (7895 upstream) : UBE2J1 (3483 downstream)																																			---	---	---	---
BACH2	60468	broad.mit.edu	37	6	90905847	90905847	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90905847delT	uc011eab.1	-						BACH2_uc003pnw.2_Intron|BACH2_uc010kch.2_Intron	NM_021813	NP_068585			BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	91186183	91186184	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91186183_91186184insT								BACH2 (179621 upstream) : MAP3K7 (39169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	91415403	91415403	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91415403delT								MAP3K7 (118496 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92021593	92021594	+	IGR	INS	-	TG	TG	rs145835957	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92021593_92021594insTG								MAP3K7 (724686 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96130679	96130679	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96130679delT								MANEA (73353 upstream) : FUT9 (333166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96421060	96421061	+	IGR	DEL	AC	-	-	rs72469475		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96421060_96421061delAC								MANEA (363734 upstream) : FUT9 (42784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96841276	96841276	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96841276delG								FUT9 (177789 upstream) : KIAA0776 (128426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98034115	98034117	+	Intron	DEL	AAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98034115_98034117delAAC	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	99288913	99288913	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99288913delT								POU3F2 (2248 upstream) : FBXL4 (32688 downstream)																																			---	---	---	---
PRDM13	59336	broad.mit.edu	37	6	100063022	100063026	+	3'UTR	DEL	TTCTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100063022_100063026delTTCTG	uc003pqg.1	+	4						NM_021620	NP_067633			PR domain containing 13						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)														---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	101065564	101065564	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101065564delC	uc003pqk.2	-							NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	101534541	101534541	+	IGR	DEL	A	-	-	rs67608100		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101534541delA								ASCC3 (205317 upstream) : GRIK2 (312364 downstream)																																			---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	101952085	101952088	+	Intron	DEL	ACAT	-	-	rs71695247		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101952085_101952088delACAT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102086433	102086433	+	Intron	DEL	A	-	-	rs10716146		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102086433delA	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	103028238	103028239	+	IGR	INS	-	TG	TG	rs148427852	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103028238_103028239insTG								GRIK2 (510281 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104738932	104738932	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104738932delT								None (None upstream) : HACE1 (437036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104786305	104786305	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104786305delT								None (None upstream) : HACE1 (389663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	105055224	105055225	+	IGR	INS	-	A	A	rs66617168		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105055224_105055225insA								None (None upstream) : HACE1 (120743 downstream)																																			---	---	---	---
HACE1	57531	broad.mit.edu	37	6	105287415	105287415	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105287415delT	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron	NM_020771	NP_065822			HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)														---	---	---	---
ATG5	9474	broad.mit.edu	37	6	106678581	106678581	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106678581delG	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840			APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)														---	---	---	---
PDSS2	57107	broad.mit.edu	37	6	107655731	107655733	+	Intron	DEL	GTT	-	-	rs141150367		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107655731_107655733delGTT	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron|PDSS2_uc003prv.2_Intron	NM_020381	NP_065114			prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)														---	---	---	---
LACE1	246269	broad.mit.edu	37	6	108662647	108662647	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108662647delA	uc003psj.2	+							NM_145315	NP_660358			lactation elevated 1								ATP binding			central_nervous_system(1)	1		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)														---	---	---	---
FOXO3	2309	broad.mit.edu	37	6	108977496	108977496	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108977496delA	uc003psk.2	+						FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Intron|FOXO3_uc011ean.1_Intron|FOXO3_uc010kdj.1_5'Flank	NM_201559	NP_963853			forkhead box O3A						antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	109544455	109544455	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109544455delC								C6orf182 (59342 upstream) : CD164 (143263 downstream)																																			---	---	---	---
DDO	8528	broad.mit.edu	37	6	110731198	110731198	+	Intron	DEL	T	-	-	rs57627094		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110731198delT	uc003puc.2	-						C6orf186_uc003pub.2_Intron|DDO_uc003pud.2_Intron	NM_003649	NP_003640			D-aspartate oxidase isoform a						aspartate catabolic process	peroxisome	binding|D-amino-acid oxidase activity|D-aspartate oxidase activity			ovary(2)|breast(1)	3		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112214296	112214296	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112214296delT								FYN (19669 upstream) : WISP3 (160982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115874760	115874761	+	IGR	DEL	GT	-	-	rs73554404	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115874760_115874761delGT								None (None upstream) : FRK (387932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115927346	115927346	+	IGR	DEL	T	-	-	rs67737424		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115927346delT								None (None upstream) : FRK (335347 downstream)																																			---	---	---	---
DSE	29940	broad.mit.edu	37	6	116709406	116709406	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116709406delG	uc003pws.2	+						DSE_uc011ebf.1_Intron|DSE_uc003pwq.1_Intron|DSE_uc011ebg.1_Intron|DSE_uc003pwt.2_Intron	NM_001080976	NP_001074445			dermatan sulfate epimerase precursor						dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)														---	---	---	---
ZUFSP	221302	broad.mit.edu	37	6	116957607	116957610	+	Intron	DEL	AATT	-	-	rs10573597		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116957607_116957610delAATT	uc003pxf.1	-							NM_145062	NP_659499			zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)														---	---	---	---
KPNA5	3841	broad.mit.edu	37	6	117001199	117001199	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117001199delT	uc003pxh.2	+						uc003pxg.1_RNA	NM_002269	NP_002260			karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)														---	---	---	---
DCBLD1	285761	broad.mit.edu	37	6	117843356	117843356	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117843356delA	uc003pxs.2	+						GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Intron	NM_173674	NP_775945			discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)														---	---	---	---
DCBLD1	285761	broad.mit.edu	37	6	117846780	117846781	+	Intron	INS	-	TTC	TTC	rs146408484	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117846780_117846781insTTC	uc003pxs.2	+						GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Intron	NM_173674	NP_775945			discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)														---	---	---	---
GOPC	57120	broad.mit.edu	37	6	117911185	117911185	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117911185delC	uc003pxu.2	-						GOPC_uc003pxv.2_Intron	NM_020399	NP_065132			golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)				O	ROS1	glioblastoma								---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121508073	121508074	+	Intron	DEL	AA	-	-	rs5879590		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121508073_121508074delAA	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron|C6orf170_uc010kej.1_Intron|C6orf170_uc003pyp.1_Intron	NM_152730	NP_689943			hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	121786220	121786227	+	IGR	DEL	TTTGACTT	-	-	rs72051101		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121786220_121786227delTTTGACTT								GJA1 (15348 upstream) : HSF2 (934469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122060483	122060483	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122060483delA								GJA1 (289611 upstream) : HSF2 (660213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122420568	122420568	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122420568delT								GJA1 (649696 upstream) : HSF2 (300128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	123184054	123184055	+	IGR	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123184054_123184055delCT								SMPDL3A (53192 upstream) : CLVS2 (133527 downstream)																																			---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123776528	123776529	+	Intron	INS	-	A	A	rs144008763	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123776528_123776529insA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|uc003pzm.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124135001	124135001	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124135001delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124648208	124648209	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124648208_124648209insT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124782441	124782442	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124782441_124782442delGT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	126462923	126462923	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126462923delA								TRMT11 (102505 upstream) : CENPW (198330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	127336418	127336418	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127336418delA	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	127869519	127869520	+	IGR	INS	-	T	T	rs139153707	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127869519_127869520insT								C6orf174 (29019 upstream) : C6orf58 (28799 downstream)																																			---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128588291	128588291	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128588291delT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron	NM_002844	NP_002835			protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129754394	129754394	+	Intron	DEL	T	-	-	rs66503334		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129754394delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130212351	130212351	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130212351delT								C6orf191 (29935 upstream) : L3MBTL3 (127383 downstream)																																			---	---	---	---
EPB41L2	2037	broad.mit.edu	37	6	131234751	131234751	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131234751delG	uc003qch.2	-						EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Intron|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_Intron	NM_001431	NP_001422			erythrocyte membrane protein band 4.1-like 2						cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)														---	---	---	---
AKAP7	9465	broad.mit.edu	37	6	131462462	131462462	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131462462delT	uc003qck.2	+							NM_016377	NP_057461			A-kinase anchor protein 7 isoform gamma						intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)														---	---	---	---
MED23	9439	broad.mit.edu	37	6	131896094	131896094	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131896094delG	uc003qcq.2	-						ARG1_uc003qco.1_Intron|ARG1_uc003qcp.1_Intron|ARG1_uc010kfm.1_Intron	NM_015979	NP_057063			mediator complex subunit 23 isoform b						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	132921426	132921426	+	IGR	DEL	A	-	-	rs75866809		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132921426delA								TAAR5 (10549 upstream) : TAAR2 (16863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133321745	133321746	+	IGR	DEL	GT	-	-	rs72436116		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133321745_133321746delGT								RPS12 (183043 upstream) : LOC285735 (87473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133536737	133536738	+	IGR	DEL	TT	-	-	rs66939976		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133536737_133536738delTT								LOC285735 (109027 upstream) : EYA4 (24998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	134052736	134052737	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134052736_134052737delAC	uc003qeg.1	-											Homo sapiens cDNA FLJ36194 fis, clone TESTI2027615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	134062620	134062620	+	Intron	DEL	A	-	-	rs66696645		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134062620delA	uc003qeg.1	-											Homo sapiens cDNA FLJ36194 fis, clone TESTI2027615.																														---	---	---	---
MAP3K5	4217	broad.mit.edu	37	6	136956027	136956028	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136956027_136956028insT	uc003qhc.2	-						MAP3K5_uc011edj.1_Intron|MAP3K5_uc011edk.1_Intron	NM_005923	NP_005914			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)														---	---	---	---
PEX7	5191	broad.mit.edu	37	6	137163045	137163045	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137163045delA	uc003qhd.2	+						PEX7_uc010kgx.2_Intron	NM_000288	NP_000279			peroxisomal biogenesis factor 7						ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	137549837	137549837	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137549837delA								IFNGR1 (9270 upstream) : OLIG3 (263499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138155802	138155803	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138155802_138155803delAC	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	138704353	138704354	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138704353_138704354insA								KIAA1244 (44417 upstream) : HEBP2 (20982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	139075385	139075385	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139075385delT	uc003qid.1	-											Homo sapiens cDNA FLJ35273 fis, clone PROST2006020.																														---	---	---	---
REPS1	85021	broad.mit.edu	37	6	139285346	139285346	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139285346delT	uc003qii.2	-						REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Intron|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128			RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	139419457	139419457	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139419457delA								C6orf115 (55018 upstream) : HECA (36792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140450079	140450080	+	IGR	INS	-	TATGGAG	TATGGAG	rs148035480	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140450079_140450080insTATGGAG								CITED2 (754294 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140646849	140646849	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140646849delC								CITED2 (951064 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142152536	142152536	+	Intron	DEL	T	-	-	rs112612157		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142152536delT	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
GPR126	57211	broad.mit.edu	37	6	142713371	142713371	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142713371delA	uc010khc.2	+						GPR126_uc010khd.2_Intron|GPR126_uc010khe.2_Intron|GPR126_uc010khf.2_Intron	NM_020455	NP_065188			G protein-coupled receptor 126 alpha 1						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	143705037	143705038	+	IGR	DEL	CT	-	-	rs144935414	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143705037_143705038delCT								AIG1 (43598 upstream) : ADAT2 (38932 downstream)																																			---	---	---	---
PHACTR2	9749	broad.mit.edu	37	6	143980161	143980161	+	Intron	DEL	A	-	-	rs111327324		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143980161delA	uc003qjq.3	+						PHACTR2_uc010khh.2_Intron	NM_014721	NP_055536			phosphatase and actin regulator 2 isoform 3								actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	145517047	145517047	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145517047delA								UTRN (342879 upstream) : EPM2A (429399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145601154	145601155	+	IGR	DEL	AC	-	-	rs139306285		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145601154_145601155delAC								UTRN (426986 upstream) : EPM2A (345291 downstream)																																			---	---	---	---
STXBP5	134957	broad.mit.edu	37	6	147658305	147658306	+	Intron	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147658305_147658306delAT	uc003qlz.2	+						STXBP5_uc010khz.1_Intron|STXBP5_uc003qlx.2_Intron|STXBP5_uc003qly.2_Intron|STXBP5_uc003qma.2_Intron	NM_001127715	NP_001121187			syntaxin binding protein 5 (tomosyn) isoform b						exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	148087241	148087241	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148087241delA								SAMD5 (196084 upstream) : SASH1 (576488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148230080	148230080	+	IGR	DEL	A	-	-	rs5880741		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148230080delA								SAMD5 (338923 upstream) : SASH1 (433649 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149366311	149366312	+	Intron	INS	-	C	C	rs140436246	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149366311_149366312insC	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149850375	149850376	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149850375_149850376insA	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311			peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
C6orf72	116254	broad.mit.edu	37	6	149894960	149894961	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149894960_149894961insA	uc003qmq.1	+						C6orf72_uc010kie.1_Intron	NM_138785	NP_620140			hypothetical protein LOC116254 precursor							integral to membrane					0		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.66e-12)|GBM - Glioblastoma multiforme(68;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	150460339	150460339	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150460339delT								ULBP3 (70056 upstream) : PPP1R14C (3849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	150890506	150890506	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150890506delT								IYD (164742 upstream) : PLEKHG1 (30493 downstream)																																			---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151404332	151404332	+	Intron	DEL	T	-	-	rs144339364		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151404332delT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152455030	152455031	+	Intron	INS	-	A	A	rs143229485	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152455030_152455031insA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155454874	155454874	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155454874delT	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron	NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	155667535	155667536	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155667535_155667536insTT								TFB1M (31909 upstream) : NOX3 (48967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156068883	156068884	+	IGR	DEL	AA	-	-	rs5881151		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156068883_156068884delAA								NOX3 (291846 upstream) : MIR1202 (199047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	158161790	158161790	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158161790delC								ZDHHC14 (66814 upstream) : SNX9 (82504 downstream)																																			---	---	---	---
TMEM181	57583	broad.mit.edu	37	6	158959175	158959176	+	Intron	INS	-	T	T	rs149418036		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158959175_158959176insT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874			G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	160052408	160052408	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160052408delA								FNDC1 (359269 upstream) : SOD2 (47743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160068558	160068558	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160068558delA								FNDC1 (375419 upstream) : SOD2 (31593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160259344	160259345	+	IGR	INS	-	AG	AG	rs148292762	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160259344_160259345insAG								PNLDC1 (17609 upstream) : MAS1 (68629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160881863	160881863	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160881863delA								SLC22A3 (5850 upstream) : LPAL2 (5724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160882859	160882860	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160882859_160882860delGT								SLC22A3 (6846 upstream) : LPAL2 (4727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164039078	164039079	+	IGR	INS	-	CCT	CCT	rs138322931	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164039078_164039079insCCT								QKI (44186 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164233369	164233370	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164233369_164233370delGT								QKI (238477 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164461677	164461678	+	IGR	INS	-	TT	TT	rs141216580	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164461677_164461678insTT								QKI (466785 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165328692	165328692	+	IGR	DEL	T	-	-	rs72086597		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165328692delT								None (None upstream) : C6orf118 (364463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165632817	165632817	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165632817delA								None (None upstream) : C6orf118 (60338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166242867	166242870	+	Intron	DEL	AGTT	-	-	rs144082745		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166242867_166242870delAGTT	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166416347	166416347	+	IGR	DEL	C	-	-	rs113887580		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166416347delC								LOC441177 (13244 upstream) : T (154739 downstream)																																			---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	167196413	167196414	+	Intron	DEL	TC	-	-	rs71758369		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167196413_167196414delTC	uc003qvd.1	-						RPS6KA2_uc003qvc.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168489561	168489561	+	IGR	DEL	C	-	-	rs35785724		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168489561delC								FRMD1 (9722 upstream) : DACT2 (218025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168792932	168792932	+	IGR	DEL	C	-	-	rs35492825		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168792932delC								DACT2 (72530 upstream) : SMOC2 (49099 downstream)																																			---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	168919705	168919710	+	Intron	DEL	ATGTGT	-	-	rs142937762		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168919705_168919710delATGTGT	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421			SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	169059552	169059553	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169059552_169059553delTG	uc003qws.1	+						SMOC2_uc003qwr.1_Intron|SMOC2_uc011egu.1_Intron	NM_022138	NP_071421			SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
WDR27	253769	broad.mit.edu	37	6	170010298	170010298	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170010298delT	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170444610	170444610	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170444610delC								C6orf208 (241641 upstream) : LOC154449 (118812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	360732	360732	+	IGR	DEL	T	-	-	rs36156540		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:360732delT								FAM20C (60021 upstream) : PDGFA (176167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1238238	1238238	+	IGR	DEL	T	-	-	rs34344874		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1238238delT								ZFAND2A (38383 upstream) : UNCX (34416 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	1959635	1959652	+	Intron	DEL	CCAGTGACACGGAGGTCC	-	-	rs36202989		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1959635_1959652delCCAGTGACACGGAGGTCC	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2941250	2941250	+	IGR	DEL	G	-	-	rs35179561		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2941250delG								GNA12 (57291 upstream) : CARD11 (4519 downstream)																																			---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3548700	3548701	+	Intron	DEL	GT	-	-	rs59252283	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3548700_3548701delGT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3642503	3642504	+	Intron	INS	-	TCG	TCG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3642503_3642504insTCG	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3888306	3888307	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3888306_3888307insT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3940828	3940828	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3940828delT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	4064531	4064532	+	Intron	INS	-	G	G	rs138289529	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4064531_4064532insG	uc003smx.2	+						SDK1_uc010kso.2_Intron	NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4443086	4443087	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4443086_4443087delGA								SDK1 (134457 upstream) : FOXK1 (240301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	4661120	4661120	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4661120delT								SDK1 (352491 upstream) : FOXK1 (22268 downstream)																																			---	---	---	---
LOC389458	389458	broad.mit.edu	37	7	5042317	5042317	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5042317delC	uc003snr.2	+											Synthetic construct DNA, clone: pF1KB3788, Homo sapiens RBAK gene for RB-associated KRAB repressor, complete cds, without stop codon, in Flexi system.												0																		---	---	---	---
TNRC18	84629	broad.mit.edu	37	7	5379173	5379174	+	Intron	DEL	TG	-	-	rs71536907		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5379173_5379174delTG	uc003soi.3	-							NM_001080495	NP_001073964			trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	6129167	6129168	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6129167_6129168insT								EIF2AK1 (30307 upstream) : USP42 (15382 downstream)																																			---	---	---	---
GRID2IP	392862	broad.mit.edu	37	7	6591242	6591242	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6591242delT	uc011jwx.1	-							NM_001145118	NP_001138590			glutamate receptor, ionotropic, delta 2 (Grid2)						actin cytoskeleton organization	cell junction|postsynaptic membrane	actin binding				0																		---	---	---	---
C1GALT1	56913	broad.mit.edu	37	7	7255105	7255105	+	Intron	DEL	C	-	-	rs34468590		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7255105delC	uc010ktn.2	+						C1GALT1_uc010ktm.1_Intron	NM_020156	NP_064541			core 1 synthase,						angiogenesis|cell differentiation|kidney development	integral to membrane	glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase activity|metal ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	7356023	7356028	+	IGR	DEL	CAGTCA	-	-	rs149334298		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7356023_7356028delCAGTCA								C1GALT1 (72044 upstream) : COL28A1 (42216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	7375312	7375313	+	IGR	INS	-	AT	AT	rs72564368	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7375312_7375313insAT								C1GALT1 (91333 upstream) : COL28A1 (22931 downstream)																																			---	---	---	---
COL28A1	340267	broad.mit.edu	37	7	7538542	7538543	+	Intron	DEL	CA	-	-	rs115826583	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7538542_7538543delCA	uc003src.1	-						COL28A1_uc011jxe.1_Intron|COL28A1_uc003srd.2_Intron	NM_001037763	NP_001032852			collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)														---	---	---	---
RPA3	6119	broad.mit.edu	37	7	7707715	7707715	+	Intron	DEL	T	-	-	rs11763161		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7707715delT	uc003sri.2	-							NM_002947	NP_002938			replication protein A3, 14kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	cytoplasm|DNA replication factor A complex|nucleoplasm	protein binding|single-stranded DNA binding			large_intestine(1)	1		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)									Direct_reversal_of_damage|NER					---	---	---	---
RPA3	6119	broad.mit.edu	37	7	7759274	7759274	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7759274delT	uc003sri.2	-						uc011jxf.1_Intron	NM_002947	NP_002938			replication protein A3, 14kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	cytoplasm|DNA replication factor A complex|nucleoplasm	protein binding|single-stranded DNA binding			large_intestine(1)	1		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)									Direct_reversal_of_damage|NER					---	---	---	---
Unknown	0	broad.mit.edu	37	7	8432319	8432319	+	IGR	DEL	T	-	-	rs35726262		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8432319delT								ICA1 (130134 upstream) : NXPH1 (41266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9076257	9076259	+	IGR	DEL	AAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9076257_9076259delAAC								NXPH1 (283665 upstream) : PER4 (597641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10646752	10646752	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10646752delA								PER4 (971305 upstream) : NDUFA4 (326063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	12122877	12122878	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12122877_12122878delGA								THSD7A (251053 upstream) : TMEM106B (127970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	12712553	12712554	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12712553_12712554delAC								SCIN (19328 upstream) : ARL4A (13927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	16992209	16992210	+	IGR	DEL	AC	-	-	rs71681767		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16992209_16992210delAC								AGR3 (70596 upstream) : AHR (346066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	17189077	17189078	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17189077_17189078insT								AGR3 (267464 upstream) : AHR (149198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	17793829	17793829	+	IGR	DEL	T	-	-	rs116355711	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17793829delT								AHR (408054 upstream) : SNX13 (36557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19980318	19980318	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19980318delT								TMEM196 (167102 upstream) : MACC1 (193970 downstream)																																			---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21703376	21703376	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21703376delT	uc003svc.2	+							NM_003777	NP_003768			dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	22451851	22451852	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22451851_22451852delGA								RAPGEF5 (55318 upstream) : MGC87042 (7214 downstream)																																			---	---	---	---
IL6	3569	broad.mit.edu	37	7	22770846	22770846	+	Intron	DEL	A	-	-	rs78229116	byFrequency;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22770846delA	uc011jyn.1	+						IL6_uc003svj.3_Intron	NM_000600	NP_000591			interleukin 6 precursor						acute-phase response|cellular response to hydrogen peroxide|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|defense response to virus|endocrine pancreas development|glucagon secretion|hepatic immune response|interleukin-6-mediated signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of chemokine biosynthetic process|negative regulation of collagen biosynthetic process|negative regulation of fat cell differentiation|negative regulation of lipid storage|neuron projection development|neutrophil apoptosis|platelet activation|positive regulation of acute inflammatory response|positive regulation of anti-apoptosis|positive regulation of B cell activation|positive regulation of chemokine production|positive regulation of immunoglobulin secretion|positive regulation of interleukin-6 production|positive regulation of osteoblast differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of smooth muscle cell proliferation|positive regulation of T cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of translation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of vascular endothelial growth factor production|response to glucocorticoid stimulus|response to peptidoglycan	extracellular space|interleukin-6 receptor complex	cytokine activity|growth factor activity|interleukin-6 receptor binding				0					Arsenic trioxide(DB01169)|Bicalutamide(DB01128)|Ginseng(DB01404)|Simvastatin(DB00641)													---	---	---	---
TAX1BP1	8887	broad.mit.edu	37	7	27833101	27833101	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27833101delA	uc003szl.2	+						TAX1BP1_uc011jzo.1_Intron|TAX1BP1_uc003szk.2_Intron|TAX1BP1_uc011jzp.1_Intron	NM_006024	NP_006015			Tax1 (human T-cell leukemia virus type I)						anti-apoptosis|apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production	cytosol	identical protein binding|kinase binding|zinc ion binding			breast(1)	1			GBM - Glioblastoma multiforme(3;0.0823)															---	---	---	---
JAZF1	221895	broad.mit.edu	37	7	27953365	27953367	+	Intron	DEL	CTT	-	-	rs79603145		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27953365_27953367delCTT	uc003szn.2	-						JAZF1_uc003szm.2_Intron	NM_175061	NP_778231			JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131								T	SUZ12	endometrial stromal tumours								---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28805703	28805704	+	Intron	INS	-	A	A	rs141450639	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28805703_28805704insA	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
CPVL	54504	broad.mit.edu	37	7	29036090	29036090	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29036090delA	uc003szv.2	-						CPVL_uc003szw.2_Intron|CPVL_uc003szx.2_Intron	NM_031311	NP_112601			serine carboxypeptidase vitellogenic-like						proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	30223691	30223692	+	IGR	INS	-	T	T	rs146951574	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30223691_30223692insT								C7orf41 (21310 upstream) : ZNRF2 (100231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	31492372	31492373	+	IGR	DEL	CT	-	-	rs71909977		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31492372_31492373delCT								NEUROD6 (111834 upstream) : CCDC129 (61312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	32413791	32413792	+	IGR	INS	-	AAG	AAG	rs141907621		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32413791_32413792insAAG								PDE1C (74850 upstream) : LSM5 (111153 downstream)																																			---	---	---	---
AVL9	23080	broad.mit.edu	37	7	32935871	32935871	+	Intron	DEL	C	-	-	rs71559276		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32935871delC	uc011kai.1	+							NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34025163	34025164	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34025163_34025164delGT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34156604	34156604	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34156604delA	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	34939037	34939038	+	IGR	INS	-	CTTC	CTTC	rs142168465	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34939037_34939038insCTTC								NPSR1 (21093 upstream) : DPY19L1 (22043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36546943	36546943	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36546943delC								ANLN (53545 upstream) : AOAH (5667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	38680906	38680907	+	IGR	INS	-	T	T	rs147300296	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38680906_38680907insT								AMPH (9886 upstream) : FAM183B (44040 downstream)																																			---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38794818	38794818	+	Intron	DEL	C	-	-	rs74734537		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38794818delC	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211			vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	39566364	39566364	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39566364delA								POU6F2 (61974 upstream) : C7orf36 (39645 downstream)																																			---	---	---	---
LOC646999	646999	broad.mit.edu	37	7	39648565	39648565	+	5'Flank	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39648565delG	uc011kbe.1	+							NR_024390				Homo sapiens cDNA FLJ39538 fis, clone PUAEN2008123.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41018538	41018538	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41018538delT								C7orf10 (118181 upstream) : INHBA (710065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	43030157	43030158	+	IGR	INS	-	TTTTGT	TTTTGT	rs147899464	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43030157_43030158insTTTTGT								MRPL32 (52706 upstream) : HECW1 (122040 downstream)																																			---	---	---	---
RASA4P	401331	broad.mit.edu	37	7	44073250	44073251	+	Intron	INS	-	AAC	AAC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44073250_44073251insAAC	uc011kbk.1	-						RASA4P_uc003tji.2_RNA|RASA4P_uc010kxx.2_Intron	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	44766860	44766864	+	IGR	DEL	CATGG	-	-	rs143493460		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44766860_44766864delCATGG								OGDH (18192 upstream) : ZMIZ2 (21316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44771000	44771001	+	IGR	INS	-	T	T	rs141138643	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44771000_44771001insT								OGDH (22332 upstream) : ZMIZ2 (17179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44969476	44969477	+	IGR	INS	-	TC	TC	rs144170109	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44969476_44969477insTC								PURB (44516 upstream) : MYO1G (32783 downstream)																																			---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47462230	47462231	+	Intron	INS	-	A	A	rs142247035		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47462230_47462231insA	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47520258	47520259	+	Intron	INS	-	AC	AC	rs146659817	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47520258_47520259insAC	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	48993780	48993781	+	IGR	INS	-	TG	TG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48993780_48993781insTG								CDC14C (26731 upstream) : VWC2 (819476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49364437	49364437	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49364437delC								CDC14C (397388 upstream) : VWC2 (448820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	50281792	50281793	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50281792_50281793insG								C7orf72 (82434 upstream) : IKZF1 (62585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51589127	51589127	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51589127delA								COBL (204612 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51618997	51618997	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51618997delG								COBL (234482 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53223659	53223660	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53223659_53223660delAC								POM121L12 (119042 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53811633	53811635	+	IGR	DEL	CCC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53811633_53811635delCCC								POM121L12 (707016 upstream) : HPVC1 (457282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54206003	54206004	+	IGR	INS	-	T	T	rs71560082		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54206003_54206004insT								None (None upstream) : HPVC1 (62913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54410352	54410353	+	IGR	INS	-	A	A	rs72572234	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54410352_54410353insA								HPVC1 (140238 upstream) : VSTM2A (199666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54415455	54415456	+	IGR	INS	-	CTATCTAC	CTATCTAC	rs62451193	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54415455_54415456insCTATCTAC								HPVC1 (145341 upstream) : VSTM2A (194563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54590446	54590447	+	IGR	DEL	TA	-	-	rs142233411	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54590446_54590447delTA								HPVC1 (320332 upstream) : VSTM2A (19572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54699343	54699344	+	IGR	INS	-	T	T	rs142514589	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54699343_54699344insT								VSTM2A (61156 upstream) : SEC61G (120597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54745421	54745422	+	IGR	INS	-	TTTGT	TTTGT	rs139907993	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54745421_54745422insTTTGT								VSTM2A (107234 upstream) : SEC61G (74519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54842480	54842481	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54842480_54842481delAA								SEC61G (15541 upstream) : EGFR (244244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55838759	55838762	+	5'Flank	DEL	TTTG	-	-	rs34347580		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55838759_55838762delTTTG	uc003tqy.2	+											Homo sapiens mRNA for L-3-phosphoserine-phosphatase homologue.																														---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56095742	56095742	+	Intron	DEL	A	-	-	rs35662903		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56095742delA	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	56363935	56363935	+	IGR	DEL	T	-	-	rs34207696		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56363935delT								PSPH (179845 upstream) : DKFZp434L192 (199981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56567332	56567335	+	IGR	DEL	ACAC	-	-	rs149342394		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56567332_56567335delACAC								DKFZp434L192 (2355 upstream) : ZNF479 (619993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56668245	56668246	+	IGR	INS	-	T	T	rs148041394	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56668245_56668246insT								DKFZp434L192 (103268 upstream) : ZNF479 (519082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57296751	57296751	+	IGR	DEL	A	-	-	rs150192663		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57296751delA								ZNF479 (89180 upstream) : ZNF716 (213132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57553353	57553357	+	IGR	DEL	TGGAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57553353_57553357delTGGAA								ZNF716 (20088 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57555694	57555703	+	IGR	DEL	ATCGAATGGA	-	-	rs113492372		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57555694_57555703delATCGAATGGA								ZNF716 (22429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57663518	57663518	+	IGR	DEL	G	-	-	rs75291606		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57663518delG								ZNF716 (130253 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57723992	57723993	+	IGR	DEL	AG	-	-	rs142987140		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57723992_57723993delAG								ZNF716 (190727 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57728139	57728139	+	IGR	DEL	C	-	-	rs138237727		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57728139delC								ZNF716 (194874 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57957298	57957298	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57957298delG								ZNF716 (424033 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61077032	61077032	+	IGR	DEL	A	-	-	rs74858662		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61077032delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61886967	61886968	+	IGR	INS	-	T	T	rs145530532	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61886967_61886968insT								None (None upstream) : LOC643955 (864704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63393055	63393055	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63393055delT								LOC100287704 (580904 upstream) : ZNF727 (112766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64037008	64037009	+	Intron	INS	-	A	A	rs151289476	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64037008_64037009insA	uc003ttc.1	+											Homo sapiens cDNA FLJ43440 fis, clone OCBBF2030517.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	65079340	65079342	+	IGR	DEL	CCC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65079340_65079342delCCC								ZNF92 (213343 upstream) : INTS4L2 (33435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65249356	65249357	+	IGR	INS	-	T	T	rs111318953		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65249356_65249357insT								CCT6P1 (20695 upstream) : VKORC1L1 (88900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65257020	65257021	+	IGR	DEL	CC	-	-	rs147916926		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65257020_65257021delCC								CCT6P1 (28359 upstream) : VKORC1L1 (81236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65265813	65265815	+	IGR	DEL	GAC	-	-	rs72489750		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65265813_65265815delGAC								CCT6P1 (37152 upstream) : VKORC1L1 (72442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67456547	67456548	+	IGR	INS	-	C	C	rs58895220	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67456547_67456548insC								STAG3L4 (670035 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67941872	67941873	+	IGR	DEL	GT	-	-	rs35100087		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67941872_67941873delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67956593	67956595	+	IGR	DEL	ATG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67956593_67956595delATG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68094835	68094836	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68094835_68094836insT								None (None upstream) : AUTS2 (969069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68625213	68625213	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68625213delC								None (None upstream) : AUTS2 (438692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68629836	68629836	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68629836delG								None (None upstream) : AUTS2 (434069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68917479	68917479	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68917479delT								None (None upstream) : AUTS2 (146426 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69962683	69962683	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69962683delT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69980241	69980241	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69980241delG	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70140083	70140083	+	Intron	DEL	C	-	-	rs35791080		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70140083delC	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	71107690	71107690	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71107690delT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
SPDYE7P	441251	broad.mit.edu	37	7	72341662	72341662	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72341662delT	uc010lal.1	-							NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0																		---	---	---	---
BAZ1B	9031	broad.mit.edu	37	7	72893839	72893840	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72893839_72893840delAA	uc003tyc.2	-							NM_032408	NP_115784			bromodomain adjacent to zinc finger domain, 1B						ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	73833117	73833118	+	IGR	DEL	AC	-	-	rs144286567		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73833117_73833118delAC								CLIP2 (12845 upstream) : GTF2IRD1 (35002 downstream)																																			---	---	---	---
GTF2IRD1	9569	broad.mit.edu	37	7	73931346	73931347	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73931346_73931347insT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412			GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	75383189	75383189	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75383189delT								HIP1 (14910 upstream) : CCL26 (15653 downstream)																																			---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75873295	75873295	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75873295delC	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0																		---	---	---	---
RSBN1L	222194	broad.mit.edu	37	7	77384198	77384198	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77384198delA	uc010ldt.1	+						RSBN1L_uc003ugm.2_Intron	NM_198467	NP_940869			round spermatid basic protein 1-like							nucleus				ovary(1)	1																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78501426	78501426	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78501426delC	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78902972	78902973	+	Intron	INS	-	TTG	TTG	rs149970286	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78902972_78902973insTTG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81913505	81913505	+	Intron	DEL	A	-	-	rs79618250		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81913505delA	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	82353108	82353109	+	IGR	INS	-	A	A	rs74448816		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82353108_82353109insA								CACNA2D1 (280077 upstream) : PCLO (30212 downstream)																																			---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82633799	82633800	+	Intron	DEL	TG	-	-	rs141989534		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82633799_82633800delTG	uc003uhx.2	-						PCLO_uc003uhv.2_Intron	NM_033026	NP_149015			piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	83356964	83356965	+	IGR	INS	-	A	A	rs74324910		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83356964_83356965insA								SEMA3E (78640 upstream) : SEMA3A (230700 downstream)																																			---	---	---	---
SEMA3A	10371	broad.mit.edu	37	7	83765381	83765382	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83765381_83765382delAC	uc003uhz.2	-							NM_006080	NP_006071			semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	84446486	84446488	+	IGR	DEL	TCA	-	-	rs10561563		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84446486_84446488delTCA								SEMA3A (622269 upstream) : SEMA3D (178386 downstream)																																			---	---	---	---
ABCB1	5243	broad.mit.edu	37	7	87134284	87134284	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87134284delT	uc003uiz.1	-						ABCB1_uc011khc.1_Intron	NM_000927	NP_000918			ATP-binding cassette, subfamily B, member 1						G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)													---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87681814	87681815	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87681814_87681815insA	uc003ujn.2	+						ADAM22_uc003uji.1_Intron|ADAM22_uc003ujj.1_Intron|ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369			ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	88035020	88035020	+	IGR	DEL	G	-	-	rs5885621		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88035020delG								STEAP4 (98811 upstream) : ZNF804B (353733 downstream)																																			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88571816	88571817	+	Intron	DEL	GT	-	-	rs72429940		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88571816_88571817delGT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90794792	90794792	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90794792delG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	92559575	92559575	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92559575delT								CDK6 (93634 upstream) : SAMD9 (169257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	93909243	93909243	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93909243delT								BET1 (275553 upstream) : COL1A2 (114630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95340990	95340991	+	IGR	INS	-	A	A	rs1227527	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95340990_95340991insA								PDK4 (115065 upstream) : DYNC1I1 (60827 downstream)																																			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95711594	95711595	+	Intron	DEL	AA	-	-	rs138397159		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95711594_95711595delAA	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	96014318	96014319	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96014318_96014319delAG								SLC25A13 (62859 upstream) : SHFM1 (287918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	96290913	96290916	+	Intron	DEL	AGAG	-	-	rs78653026		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96290913_96290916delAGAG	uc010lfm.1	-											Homo sapiens cDNA, FLJ17342.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	96864162	96864162	+	IGR	DEL	C	-	-	rs60358694		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96864162delC								ACN9 (53089 upstream) : TAC1 (497109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	96977125	96977126	+	IGR	DEL	TT	-	-	rs113422042		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96977125_96977126delTT								ACN9 (166052 upstream) : TAC1 (384145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97436854	97436855	+	IGR	INS	-	A	A	rs151055648	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97436854_97436855insA								TAC1 (67072 upstream) : ASNS (44588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97664896	97664897	+	IGR	INS	-	A	A	rs13233058	byFrequency;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97664896_97664897insA								OCM2 (45480 upstream) : LMTK2 (71300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98130540	98130549	+	IGR	DEL	TTTTCTTTTC	-	-	rs67611483		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98130540_98130549delTTTTCTTTTC								BAIAP2L1 (100113 upstream) : NPTX2 (116048 downstream)																																			---	---	---	---
TMEM130	222865	broad.mit.edu	37	7	98459997	98459998	+	Intron	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98459997_98459998delAA	uc003upo.2	-						TMEM130_uc011kiq.1_Intron|TMEM130_uc011kir.1_Intron|TMEM130_uc003upn.2_Intron	NM_001134450	NP_001127922			transmembrane protein 130 isoform a							Golgi membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
CYP3A4	1576	broad.mit.edu	37	7	99357048	99357049	+	Intron	DEL	CA	-	-	rs28988598		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99357048_99357049delCA	uc003urv.1	-						CYP3A4_uc003urw.1_Intron|CYP3A4_uc011kiz.1_Intron|CYP3A4_uc011kja.1_Intron|CYP3A4_uc011kjb.1_Intron	NM_017460	NP_059488			cytochrome P450, family 3, subfamily A,						alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity			central_nervous_system(3)|ovary(1)	4	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	101447728	101447729	+	IGR	DEL	TC	-	-	rs57782870		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101447728_101447729delTC								MYL10 (175152 upstream) : CUX1 (11563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	103943108	103943108	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103943108delC								ORC5L (94645 upstream) : LHFPL3 (25996 downstream)																																			---	---	---	---
SRPK2	6733	broad.mit.edu	37	7	104919300	104919300	+	Intron	DEL	A	-	-	rs59542934		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104919300delA	uc003vcv.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634			serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SRPK2	6733	broad.mit.edu	37	7	104925833	104925839	+	Intron	DEL	AAAAAAA	-	-	rs112939912		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104925833_104925839delAAAAAAA	uc003vcv.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634			serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105374054	105374054	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105374054delA	uc003vde.2	-							NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107617390	107617393	+	Intron	DEL	CTCC	-	-	rs71540989		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107617390_107617393delCTCC	uc003vew.2	-						LAMB1_uc003vev.2_Intron|LAMB1_uc003vex.2_Intron|LAMB1_uc010ljn.1_Intron	NM_002291	NP_002282			laminin, beta 1 precursor						axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	108277052	108277053	+	IGR	DEL	AC	-	-	rs34765493		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108277052_108277053delAC								DNAJB9 (61760 upstream) : C7orf66 (246987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109311680	109311680	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109311680delT								C7orf66 (787043 upstream) : EIF3IP1 (287604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109677669	109677671	+	IGR	DEL	TCA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109677669_109677671delTCA								EIF3IP1 (77399 upstream) : IMMP2L (625439 downstream)																																			---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111814066	111814073	+	Intron	DEL	TCCCCACC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111814066_111814073delTCCCCACC	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
ZNF277	11179	broad.mit.edu	37	7	111966435	111966436	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111966435_111966436delAC	uc003vge.2	+						ZNF277_uc003vgd.2_Intron|ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834			zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---
C7orf60	154743	broad.mit.edu	37	7	112582526	112582527	+	5'Flank	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112582526_112582527delCT	uc003vgo.1	-						C7orf60_uc011kms.1_5'Flank	NM_152556	NP_689769			hypothetical protein LOC154743											ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	112825125	112825125	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112825125delA								LOC401397 (66488 upstream) : PPP1R3A (691757 downstream)																																			---	---	---	---
PPP1R3A	5506	broad.mit.edu	37	7	113561669	113561669	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113561669delT	uc010ljy.1	-							NM_002711	NP_002702			protein phosphatase 1, regulatory (inhibitor)						glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34																		---	---	---	---
MDFIC	29969	broad.mit.edu	37	7	114650508	114650508	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114650508delT	uc003vhf.2	+							NM_199072	NP_951038			MyoD family inhibitor domain containing protein						activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	114876888	114876889	+	IGR	INS	-	T	T	rs35335808		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114876888_114876889insT								MDFIC (217625 upstream) : TFEC (698313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115064089	115064090	+	IGR	DEL	TC	-	-	rs5886763		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115064089_115064090delTC								MDFIC (404826 upstream) : TFEC (511112 downstream)																																			---	---	---	---
CAV1	857	broad.mit.edu	37	7	115948498	115948499	+	Intron	INS	-	AG	AG	rs145602535	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115948498_115948499insAG	uc010lkd.1	+						CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_Intron|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_Intron|CAV2_uc003via.2_Intron|CAV1_uc010lke.1_Intron|uc003vhu.1_Intron|uc003vhs.1_Intron|uc003vht.1_Intron|uc003vhy.1_Intron	NM_001753	NP_001744			caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
MET	4233	broad.mit.edu	37	7	116364824	116364824	+	Intron	DEL	A	-	-	rs34822187		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116364824delA	uc003vij.2	+						MET_uc010lkh.2_Intron|MET_uc011knc.1_Intron|MET_uc011knd.1_Intron|MET_uc011kne.1_Intron|MET_uc011knf.1_Intron|MET_uc011kng.1_Intron|MET_uc011knh.1_Intron|MET_uc011kni.1_Intron|MET_uc011knj.1_Splice_Site|MET_uc010lkg.2_Intron|MET_uc011kmz.1_Splice_Site_p.A401_splice|MET_uc011kna.1_Intron|MET_uc011knb.1_Intron	NM_000245	NP_000236			met proto-oncogene isoform b precursor						axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)					Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				---	---	---	---
WNT2	7472	broad.mit.edu	37	7	116957564	116957564	+	Intron	DEL	A	-	-	rs66463152		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116957564delA	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382			wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
CFTR	1080	broad.mit.edu	37	7	117138871	117138871	+	Intron	DEL	T	-	-	rs74683624		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117138871delT	uc003vjd.2	+						CFTR_uc011knq.1_Intron	NM_000492	NP_000483			cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)									Cystic_Fibrosis				---	---	---	---
CTTNBP2	83992	broad.mit.edu	37	7	117354403	117354403	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117354403delC	uc003vjf.2	-							NM_033427	NP_219499			cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	117963264	117963264	+	IGR	DEL	T	-	-	rs34036194		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117963264delT								ANKRD7 (80482 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118080271	118080272	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118080271_118080272insA								ANKRD7 (197489 upstream) : None (None downstream)																																			---	---	---	---
FAM3C	10447	broad.mit.edu	37	7	120996250	120996251	+	Intron	INS	-	G	G	rs141644089	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120996250_120996251insG	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703			family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	121048751	121048751	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121048751delA								FAM3C (12329 upstream) : PTPRZ1 (464408 downstream)																																			---	---	---	---
HYAL4	23553	broad.mit.edu	37	7	123503763	123503763	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123503763delT	uc003vlc.2	+						HYAL4_uc011knz.1_Intron	NM_012269	NP_036401			hyaluronoglucosaminidase 4						fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	124269724	124269724	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124269724delA								TMEM229A (596201 upstream) : GPR37 (116392 downstream)																																			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126800581	126800582	+	Intron	INS	-	CG	CG	rs139582628	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126800581_126800582insCG	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126895489	126895489	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126895489delT	uc010lkz.1	-							NM_001127323				glutamate receptor, metabotropic 8 isoform b						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	129209472	129209473	+	IGR	INS	-	AAAC	AAAC	rs142768398	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129209472_129209473insAAAC								FAM40B (81235 upstream) : NRF1 (42082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132818955	132818955	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132818955delA								CHCHD3 (52127 upstream) : EXOC4 (118868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132890647	132890648	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132890647_132890648delAA								CHCHD3 (123819 upstream) : EXOC4 (47175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132932975	132932976	+	IGR	DEL	AA	-	-	rs34946280		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132932975_132932976delAA								CHCHD3 (166147 upstream) : EXOC4 (4847 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133464625	133464626	+	Intron	INS	-	CAG	CAG	rs141366445	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133464625_133464626insCAG	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	134321961	134321962	+	IGR	DEL	TT	-	-	rs66992296		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134321961_134321962delTT								AKR1B15 (57661 upstream) : BPGM (9569 downstream)																																			---	---	---	---
C7orf49	78996	broad.mit.edu	37	7	134825161	134825161	+	Intron	DEL	T	-	-	rs34970616		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134825161delT	uc003vsh.2	-						uc003vsg.2_Intron					Homo sapiens cDNA: FLJ22450 fis, clone HRC09626.							cytoplasm				large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	134962938	134962939	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134962938_134962939insA								STRA8 (19696 upstream) : CNOT4 (83614 downstream)																																			---	---	---	---
SLC13A4	26266	broad.mit.edu	37	7	135404552	135404553	+	Intron	DEL	TG	-	-	rs113694819		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135404552_135404553delTG	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron|SLC13A4_uc003vtc.1_Intron	NM_012450	NP_036582			solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	135449967	135449968	+	IGR	INS	-	TT	TT	rs145973862	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135449967_135449968insTT								FAM180A (16373 upstream) : LUZP6 (161537 downstream)																																			---	---	---	---
LUZP6	767558	broad.mit.edu	37	7	135662672	135662673	+	5'Flank	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135662672_135662673insA	uc003vte.3	-						LUZP6_uc010lmv.2_5'Flank	NM_145808	NP_665807			myotrophin												0																		---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137190458	137190458	+	Intron	DEL	A	-	-	rs138633220		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137190458delA	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
CREB3L2	64764	broad.mit.edu	37	7	137631172	137631173	+	Intron	INS	-	A	A	rs34011740		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137631172_137631173insA	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Intron	NM_194071	NP_919047			cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138533061	138533061	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138533061delA	uc011kql.1	-						KIAA1549_uc011kqi.1_Intron|KIAA1549_uc003vuk.3_Intron|KIAA1549_uc011kqj.1_Intron|KIAA1549_uc011kqk.1_Intron	NM_020910	NP_065961			hypothetical protein LOC57670 isoform 1							integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139348888	139348889	+	Intron	INS	-	AACC	AACC	rs139804642	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139348888_139348889insAACC	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139359291	139359304	+	Intron	DEL	AGACAGGCTACGTG	-	-	rs57767531		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139359291_139359304delAGACAGGCTACGTG	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
DENND2A	27147	broad.mit.edu	37	7	140262462	140262463	+	Intron	INS	-	AAAC	AAAC	rs143656212	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140262462_140262463insAAAC	uc010lnj.2	-						DENND2A_uc011kre.1_Intron|DENND2A_uc010lnk.2_Intron|DENND2A_uc003vvw.2_Intron|DENND2A_uc003vvx.2_Intron	NM_015689	NP_056504			DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)																	---	---	---	---
DENND2A	27147	broad.mit.edu	37	7	140339240	140339241	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140339240_140339241delAC	uc010lnk.2	-						DENND2A_uc003vvw.2_Intron|DENND2A_uc003vvx.2_Intron	NM_015689	NP_056504			DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)																	---	---	---	---
KIAA1147	57189	broad.mit.edu	37	7	141374031	141374032	+	Intron	DEL	AC	-	-	rs35125206		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141374031_141374032delAC	uc003vwk.2	-							NM_001080392	NP_001073861			hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)																	---	---	---	---
LOC100124692	100124692	broad.mit.edu	37	7	141892107	141892107	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141892107delT	uc003vxa.2	+							NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	142537672	142537672	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142537672delA								TRY6 (55275 upstream) : EPHB6 (15120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142848714	142848715	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142848714_142848715delTT								PIP (11880 upstream) : TAS2R39 (31797 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147302851	147302851	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147302851delC	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147963694	147963695	+	Intron	DEL	GT	-	-	rs71838472		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147963694_147963695delGT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
ZNF775	285971	broad.mit.edu	37	7	150092120	150092121	+	Intron	INS	-	T	T	rs140453229	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150092120_150092121insT	uc003whf.1	+							NM_173680	NP_775951			zinc finger protein 775						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	150321779	150321780	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150321779_150321780insA								GIMAP4 (50739 upstream) : GIMAP6 (686 downstream)																																			---	---	---	---
WDR86	349136	broad.mit.edu	37	7	151101314	151101315	+	Intron	INS	-	A	A	rs148524576	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151101314_151101315insA	uc003wkb.2	-						WDR86_uc003wka.2_Intron|WDR86_uc011kvk.1_Intron|WDR86_uc003wkc.2_Intron	NM_198285	NP_938026			WD repeat domain 86												0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
RHEB	6009	broad.mit.edu	37	7	151204493	151204494	+	Intron	INS	-	T	T	rs145095584	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151204493_151204494insT	uc003wkh.1	-							NM_005614	NP_005605			Ras homolog enriched in brain precursor						cell cycle arrest|insulin receptor signaling pathway|positive regulation of TOR signaling cascade|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|metal ion binding|protein binding			large_intestine(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00306)	UCEC - Uterine corpus endometrioid carcinoma (81;0.174)														---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151519934	151519937	+	Intron	DEL	AGGT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151519934_151519937delAGGT	uc003wkk.2	-						PRKAG2_uc010lqe.1_Intron|PRKAG2_uc003wkm.1_Intron	NM_016203	NP_057287			AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152085821	152085821	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152085821delG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152106897	152106898	+	Intron	DEL	TA	-	-	rs66662919		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152106897_152106898delTA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152428004	152428005	+	IGR	INS	-	T	T	rs13231875	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152428004_152428005insT								XRCC2 (54754 upstream) : ACTR3B (28846 downstream)																																			---	---	---	---
ACTR3B	57180	broad.mit.edu	37	7	152486149	152486150	+	Intron	INS	-	AC	AC	rs138529199	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152486149_152486150insAC	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178			actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	152875446	152875447	+	IGR	INS	-	A	A	rs76427412		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152875446_152875447insA								ACTR3B (322983 upstream) : DPP6 (708972 downstream)																																			---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153809824	153809824	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153809824delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156621733	156621733	+	Intron	DEL	A	-	-	rs112349840		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156621733delA	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156649404	156649404	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156649404delA	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157889884	157889884	+	Intron	DEL	C	-	-	rs74652834		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157889884delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
VIPR2	7434	broad.mit.edu	37	7	158907492	158907493	+	Intron	INS	-	AGAA	AGAA	rs138810767	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158907492_158907493insAGAA	uc003woh.2	-						VIPR2_uc010lqx.2_Intron|VIPR2_uc010lqy.2_Intron	NM_003382	NP_003373			vasoactive intestinal peptide receptor 2						cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	269282	269283	+	IGR	INS	-	T	T	rs143634703	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:269282_269283insT								ZNF596 (71950 upstream) : FBXO25 (87525 downstream)																																			---	---	---	---
C8orf42	157695	broad.mit.edu	37	8	462274	462274	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:462274delA	uc003wpd.2	-						C8orf42_uc011kwg.1_Intron	NM_175075	NP_778250			hypothetical protein LOC157695												0		Ovarian(12;0.0481)|Colorectal(14;0.0815)|Hepatocellular(245;0.0968)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;5.16e-14)|OV - Ovarian serous cystadenocarcinoma(5;7.35e-07)|BRCA - Breast invasive adenocarcinoma(11;4.17e-06)|COAD - Colon adenocarcinoma(149;0.0255)														---	---	---	---
ERICH1	157697	broad.mit.edu	37	8	678924	678925	+	Intron	INS	-	A	A	rs150263436	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:678924_678925insA	uc003wph.2	-						ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron	NM_207332	NP_997215			glutamate-rich 1											large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1106726	1106726	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1106726delC								ERICH1 (425500 upstream) : DLGAP2 (342843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1308639	1308640	+	IGR	INS	-	ACCC	ACCC	rs138009996	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1308639_1308640insACCC								ERICH1 (627413 upstream) : DLGAP2 (140929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1955226	1955227	+	IGR	INS	-	A	A	rs147688685	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1955226_1955227insA								KBTBD11 (118 upstream) : MYOM2 (37931 downstream)																																			---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2045811	2045812	+	Intron	INS	-	CCCCTCAGCT	CCCCTCAGCT	rs147500462	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2045811_2045812insCCCCTCAGCT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961			myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2069599	2069600	+	Intron	DEL	AC	-	-	rs67598844		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2069599_2069600delAC	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961			myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2191273	2191273	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2191273delT								MYOM2 (97894 upstream) : CSMD1 (601603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2204936	2204936	+	IGR	DEL	C	-	-	rs111664070		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2204936delC								MYOM2 (111557 upstream) : CSMD1 (587940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2214613	2214614	+	IGR	INS	-	A	A	rs35938363		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2214613_2214614insA								MYOM2 (121234 upstream) : CSMD1 (578262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2280865	2280868	+	IGR	DEL	TAAT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2280865_2280868delTAAT								MYOM2 (187486 upstream) : CSMD1 (512008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2296185	2296188	+	IGR	DEL	GTGA	-	-	rs142139267	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2296185_2296188delGTGA								MYOM2 (202806 upstream) : CSMD1 (496688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2312066	2312067	+	IGR	INS	-	C	C	rs148322366	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2312066_2312067insC								MYOM2 (218687 upstream) : CSMD1 (480809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2393097	2393098	+	IGR	INS	-	ATAG	ATAG	rs147837763	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2393097_2393098insATAG								MYOM2 (299718 upstream) : CSMD1 (399778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2526087	2526088	+	IGR	INS	-	T	T	rs144813786	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2526087_2526088insT								MYOM2 (432708 upstream) : CSMD1 (266788 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2920079	2920080	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2920079_2920080insA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3050460	3050460	+	Intron	DEL	A	-	-	rs34513186		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3050460delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3082743	3082743	+	Intron	DEL	A	-	-	rs34404782		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3082743delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3659570	3659570	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3659570delG	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	6116781	6116781	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6116781delG								None (None upstream) : MCPH1 (147340 downstream)																																			---	---	---	---
LOC349196	349196	broad.mit.edu	37	8	7212115	7212116	+	Intron	INS	-	AT	AT	rs141198662	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7212115_7212116insAT	uc010lrk.1	-						uc011kwo.1_Intron					Homo sapiens cDNA FLJ37516 fis, clone BRCAN2000832.												0																		---	---	---	---
DEFB107A	245910	broad.mit.edu	37	8	7671187	7671187	+	Intron	DEL	A	-	-	rs68164755		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7671187delA	uc003wrs.1	-							NM_001040705	NP_001035795			defensin, beta 107B precursor						defense response to bacterium	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	8246208	8246208	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8246208delT								SGK223 (6951 upstream) : CLDN23 (313458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8553381	8553382	+	IGR	INS	-	T	T	rs145110248	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8553381_8553382insT								SGK223 (314124 upstream) : CLDN23 (6284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8570159	8570159	+	IGR	DEL	C	-	-	rs34576727		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8570159delC								CLDN23 (8543 upstream) : MFHAS1 (71840 downstream)																																			---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8703874	8703876	+	Intron	DEL	AGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8703874_8703876delAGA	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	9268012	9268013	+	IGR	DEL	TG	-	-	rs35696085		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9268012_9268013delTG								PPP1R3B (258928 upstream) : TNKS (145432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9845296	9845296	+	IGR	DEL	T	-	-	rs111445632		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9845296delT								MIR124-1 (84314 upstream) : MSRA (66534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9890511	9890511	+	IGR	DEL	C	-	-	rs111786890		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9890511delC								MIR124-1 (129529 upstream) : MSRA (21319 downstream)																																			---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10181255	10181256	+	Intron	INS	-	GT	GT	rs145723947	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10181255_10181256insGT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10772856	10772857	+	Intron	INS	-	GCC	GCC	rs142947415	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10772856_10772857insGCC	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10812334	10812334	+	Intron	DEL	T	-	-	rs34180049		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10812334delT	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10945767	10945768	+	Intron	INS	-	A	A	rs140135498	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10945767_10945768insA	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11348053	11348054	+	IGR	INS	-	A	A	rs141064538	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11348053_11348054insA								FAM167A (23777 upstream) : BLK (3467 downstream)																																			---	---	---	---
BLK	640	broad.mit.edu	37	8	11416837	11416838	+	Intron	DEL	CA	-	-	rs141977327		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11416837_11416838delCA	uc003wty.2	+						BLK_uc003wtz.2_Intron|BLK_uc003wua.2_5'Flank	NM_001715	NP_001706			B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11499856	11499857	+	IGR	INS	-	T	T	rs138632656	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11499856_11499857insT								BLK (77749 upstream) : GATA4 (34611 downstream)																																			---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11667617	11667619	+	Intron	DEL	TAA	-	-	rs35185460		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11667617_11667619delTAA	uc003wui.2	+						FDFT1_uc003wuh.2_Intron|FDFT1_uc010lsa.1_Intron|FDFT1_uc011kxe.1_Intron|FDFT1_uc011kxf.1_Intron|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Intron|FDFT1_uc010lsb.2_Intron|FDFT1_uc011kxh.1_Intron|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Intron|FDFT1_uc003wuk.2_Intron|FDFT1_uc011kxk.1_Intron	NM_004462	NP_004453			squalene synthase						cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11675331	11675332	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11675331_11675332insT	uc003wui.2	+						FDFT1_uc003wuh.2_Intron|FDFT1_uc010lsa.1_Intron|FDFT1_uc011kxe.1_Intron|FDFT1_uc011kxf.1_Intron|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Intron|FDFT1_uc010lsb.2_Intron|FDFT1_uc011kxh.1_Intron|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Intron|FDFT1_uc003wuk.2_Intron|FDFT1_uc011kxk.1_Intron	NM_004462	NP_004453			squalene synthase						cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11729107	11729108	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11729107_11729108insT								CTSB (3461 upstream) : DEFB136 (102340 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12389848	12389849	+	Intron	INS	-	T	T	rs144471162		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12389848_12389849insT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12397982	12397988	+	Intron	DEL	TTTTTTT	-	-	rs3988688		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397982_12397988delTTTTTTT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12442106	12442106	+	Intron	DEL	C	-	-	rs147039223		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12442106delC	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12742221	12742222	+	IGR	INS	-	ACAC	ACAC	rs146836559	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12742221_12742222insACAC								LOC340357 (73311 upstream) : C8orf79 (60929 downstream)																																			---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13089851	13089851	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13089851delT	uc003wwm.2	-						DLC1_uc003wwl.1_Intron|DLC1_uc003wwn.2_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	13468027	13468028	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13468027_13468028delTG								C8orf48 (42231 upstream) : SGCZ (479346 downstream)																																			---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14140753	14140753	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14140753delT	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14592359	14592359	+	Intron	DEL	A	-	-	rs66928991		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14592359delA	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	15179567	15179568	+	IGR	INS	-	A	A	rs72044574		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15179567_15179568insA								SGCZ (83775 upstream) : TUSC3 (218162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	15653016	15653016	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15653016delT								TUSC3 (31023 upstream) : MSR1 (312372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	16533214	16533215	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16533214_16533215delCA								MSR1 (482914 upstream) : FGF20 (317119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	17319041	17319046	+	IGR	DEL	ACACAC	-	-	rs147639512		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17319041_17319046delACACAC								MTMR7 (48001 upstream) : SLC7A2 (35554 downstream)																																			---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19419829	19419829	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19419829delT	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron|CSGALNACT1_uc003wzh.2_Intron	NM_001130518	NP_001123990			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
SLC18A1	6570	broad.mit.edu	37	8	20029236	20029237	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20029236_20029237delTG	uc011kyq.1	-						SLC18A1_uc003wzl.2_Intron|SLC18A1_uc003wzm.2_Intron|SLC18A1_uc011kyr.1_Intron|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_Intron|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163			solute carrier family 18 (vesicular monoamine),						neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23734729	23734730	+	IGR	INS	-	T	T	rs73555348	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23734729_23734730insT								STC1 (22409 upstream) : ADAM28 (416850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24727982	24727983	+	IGR	INS	-	A	A	rs138482273	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24727982_24727983insA								ADAM7 (343501 upstream) : NEFM (43291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24750403	24750404	+	IGR	INS	-	AC	AC	rs149420388	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24750403_24750404insAC								ADAM7 (365922 upstream) : NEFM (20870 downstream)																																			---	---	---	---
DOCK5	80005	broad.mit.edu	37	8	25248335	25248335	+	Intron	DEL	T	-	-	rs77439889		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25248335delT	uc003xeg.2	+						PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216			dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)														---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25790602	25790603	+	Intron	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25790602_25790603insC	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150			early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26320899	26320900	+	IGR	INS	-	TG	TG	rs150818297	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26320899_26320900insTG								BNIP3L (50255 upstream) : PNMA2 (41296 downstream)																																			---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27893564	27893564	+	Intron	DEL	T	-	-	rs79770016		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27893564delT	uc003xgm.3	-							NM_001010906	NP_001010906			speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31986997	31986997	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31986997delT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32272882	32272883	+	Intron	DEL	AA	-	-	rs72306347		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32272882_32272883delAA	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	34632919	34632920	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34632919_34632920delTG								None (None upstream) : UNC5D (460055 downstream)																																			---	---	---	---
PROSC	11212	broad.mit.edu	37	8	37622696	37622697	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37622696_37622697insA	uc003xkh.2	+							NM_007198	NP_009129			proline synthetase co-transcribed homolog								pyridoxal phosphate binding			central_nervous_system(1)	1		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)|Pyridoxal Phosphate(DB00114)													---	---	---	---
WHSC1L1	54904	broad.mit.edu	37	8	38145173	38145174	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38145173_38145174insT	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron	NM_023034	NP_075447			WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)					T	NUP98	AML								---	---	---	---
FGFR1	2260	broad.mit.edu	37	8	38297633	38297633	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38297633delA	uc003xlp.2	-						FGFR1_uc011lbo.1_Intron|FGFR1_uc011lbp.1_Intron|FGFR1_uc011lbq.1_Intron|FGFR1_uc010lwk.2_Intron|FGFR1_uc011lbs.1_Intron|FGFR1_uc011lbt.1_Intron|FGFR1_uc011lbu.1_Intron|FGFR1_uc011lbv.1_Intron|FGFR1_uc011lbw.1_Intron|FGFR1_uc011lbx.1_Intron|FGFR1_uc003xlv.2_Intron|FGFR1_uc003xlu.2_Intron|FGFR1_uc003xlw.1_Intron	NM_023110	NP_075598			fibroblast growth factor receptor 1 isoform 1						axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	8	41027426	41027426	+	IGR	DEL	A	-	-	rs111495557		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41027426delA								ZMAT4 (272083 upstream) : SFRP1 (92053 downstream)																																			---	---	---	---
GOLGA7	51125	broad.mit.edu	37	8	41363690	41363691	+	Intron	INS	-	T	T	rs149330272	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41363690_41363691insT	uc003xnu.2	+						GOLGA7_uc003xnv.2_Intron|GOLGA7_uc003xnw.2_Intron	NM_016099	NP_057183			golgi autoantigen, golgin subfamily a, 7							Golgi membrane				breast(1)	1	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)															---	---	---	---
MYST3	7994	broad.mit.edu	37	8	41830747	41830747	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41830747delT	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882			MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)															---	---	---	---
POTEA	340441	broad.mit.edu	37	8	43192391	43192391	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43192391delT	uc003xpz.1	+						POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365			POTE ankyrin domain family, member A isoform 2											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	47826889	47826889	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47826889delG								BEYLA (59482 upstream) : KIAA0146 (346653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	48068638	48068639	+	IGR	INS	-	A	A	rs142878498	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48068638_48068639insA								BEYLA (301231 upstream) : KIAA0146 (104903 downstream)																																			---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48484917	48484917	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48484917delA	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863			hypothetical protein LOC23514												0		Lung NSC(58;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	49777109	49777110	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49777109_49777110delTG								EFCAB1 (129239 upstream) : SNAI2 (53129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	50738653	50738654	+	IGR	INS	-	AAATAGC	AAATAGC	rs145494474	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50738653_50738654insAAATAGC								C8orf22 (750012 upstream) : SNTG1 (83695 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51572934	51572937	+	Intron	DEL	GAAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51572934_51572937delGAAG	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	55155307	55155307	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55155307delT								MRPL15 (94233 upstream) : SOX17 (215188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57324577	57324577	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57324577delC								SDR16C5 (91336 upstream) : PENK (28936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57717201	57717201	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57717201delG								PENK (357919 upstream) : IMPAD1 (153290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58116712	58116712	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58116712delG								IMPAD1 (210285 upstream) : C8orf71 (75390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58133875	58133876	+	Intron	INS	-	A	A	rs138126705	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58133875_58133876insA	uc003xtf.2	+											Homo sapiens mRNA; cDNA DKFZp434D1072 (from clone DKFZp434D1072).																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	58695374	58695375	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58695374_58695375delCA								C8orf71 (498086 upstream) : FAM110B (211738 downstream)																																			---	---	---	---
RAB2A	5862	broad.mit.edu	37	8	61436251	61436252	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61436251_61436252insT	uc003xud.1	+						RAB2A_uc011lef.1_Intron	NM_002865	NP_002856			RAB2A, member RAS oncogene family						ER to Golgi vesicle-mediated transport|protein transport|small GTPase mediated signal transduction	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|melanosome	GDP binding|GTP binding|GTPase activity				0			BRCA - Breast invasive adenocarcinoma(89;0.0805)															---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63404030	63404030	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63404030delG	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63520193	63520193	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63520193delA	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63601297	63601302	+	Intron	DEL	ACAGAC	-	-	rs58329339		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63601297_63601302delACAGAC	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
PDE7A	5150	broad.mit.edu	37	8	66741204	66741204	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66741204delT	uc003xvq.2	-						PDE7A_uc003xvr.2_Intron	NM_002604	NP_002595			phosphodiesterase 7A isoform b							cell fraction|cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding				0			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	66780654	66780654	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66780654delG								PDE7A (26899 upstream) : DNAJC5B (153137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	66853826	66853827	+	IGR	DEL	CA	-	-	rs35921841		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66853826_66853827delCA								PDE7A (100071 upstream) : DNAJC5B (79964 downstream)																																			---	---	---	---
TRIM55	84675	broad.mit.edu	37	8	67074710	67074711	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67074710_67074711insT	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973			tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	67095810	67095813	+	IGR	DEL	GATA	-	-	rs35828022		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67095810_67095813delGATA								CRH (5112 upstream) : RRS1 (245450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	67449127	67449127	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67449127delA								C8orf46 (18370 upstream) : MYBL1 (25284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	68843459	68843459	+	IGR	DEL	T	-	-	rs150497893		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68843459delT								CPA6 (184839 upstream) : PREX2 (20889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	70033218	70033218	+	IGR	DEL	A	-	-	rs34838524		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70033218delA								C8orf34 (301962 upstream) : SULF1 (345641 downstream)																																			---	---	---	---
UBE2W	55284	broad.mit.edu	37	8	74763429	74763430	+	Intron	INS	-	TT	TT	rs71561537		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74763429_74763430insTT	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769			ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75664964	75664964	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75664964delT	uc003yaj.1	+											Homo sapiens cDNA FLJ39080 fis, clone NT2RP7018197.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	76682874	76682874	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76682874delT								HNF4G (203815 upstream) : LOC100192378 (840241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76754229	76754230	+	IGR	INS	-	TA	TA	rs34610672		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76754229_76754230insTA								HNF4G (275170 upstream) : LOC100192378 (768885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78265469	78265469	+	IGR	DEL	T	-	-	rs145914399		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78265469delT								PEX2 (352945 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78890069	78890070	+	IGR	INS	-	A	A	rs147542274	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78890069_78890070insA								PEX2 (977545 upstream) : PKIA (538266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80666003	80666003	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80666003delA								STMN2 (87609 upstream) : HEY1 (10243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81813668	81813669	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81813668_81813669delAG								ZNF704 (26652 upstream) : PAG1 (66379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84441905	84441905	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84441905delG								None (None upstream) : RALYL (653548 downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85323731	85323731	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85323731delT	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85366511	85366512	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85366511_85366512insA	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
CA13	377677	broad.mit.edu	37	8	86152964	86152964	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86152964delA	uc003ydf.1	+											Homo sapiens cDNA FLJ36434 fis, clone THYMU2012002.						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88040260	88040261	+	Intron	INS	-	AC	AC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88040260_88040261insAC	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	89422719	89422720	+	IGR	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89422719_89422720delCT								MMP16 (83002 upstream) : None (None downstream)																																			---	---	---	---
NBN	4683	broad.mit.edu	37	8	90972364	90972364	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90972364delC	uc003yej.1	-						NBN_uc003yei.1_Intron|NBN_uc011lgb.1_Intron	NM_002485	NP_002476			nibrin						cell cycle arrest|DNA damage response, signal transduction by p53 class mediator|DNA duplex unwinding|double-strand break repair via homologous recombination|meiosis|mitotic cell cycle G1/S transition checkpoint|mitotic cell cycle G2/M transition DNA damage checkpoint|positive regulation of kinase activity|positive regulation of protein autophosphorylation|regulation of DNA-dependent DNA replication initiation|telomere maintenance	Mre11 complex|nuclear chromosome, telomeric region|nuclear inclusion body|nucleolus|nucleoplasm	protein N-terminus binding|transcription factor binding			central_nervous_system(3)|kidney(3)|lung(1)	7			BRCA - Breast invasive adenocarcinoma(11;0.0344)										Direct_reversal_of_damage|Homologous_recombination	Nijmegen_Breakage_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	92776409	92776412	+	IGR	DEL	TATT	-	-	rs148988204		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92776409_92776412delTATT								SLC26A7 (366029 upstream) : RUNX1T1 (194740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92880531	92880531	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92880531delA								SLC26A7 (470151 upstream) : RUNX1T1 (90621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	93133539	93133539	+	IGR	DEL	C	-	-	rs144777352		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93133539delC								RUNX1T1 (25833 upstream) : C8orf83 (762326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94227129	94227129	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94227129delA								C8orf83 (197228 upstream) : FAM92A1 (485644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	95359371	95359372	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95359371_95359372insT								GEM (84814 upstream) : RAD54B (24817 downstream)																																			---	---	---	---
RAD54B	25788	broad.mit.edu	37	8	95438493	95438494	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95438493_95438494insA	uc003ygk.2	-						RAD54B_uc010may.1_Intron|RAD54B_uc003ygl.1_Intron	NM_012415	NP_036547			RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)										Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
INTS8	55656	broad.mit.edu	37	8	95880908	95880909	+	Intron	INS	-	T	T	rs149066579	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95880908_95880909insT	uc003yhb.2	+						INTS8_uc011lgq.1_Intron|INTS8_uc011lgr.1_Intron|INTS8_uc010mba.2_Intron	NM_017864	NP_060334			integrator complex subunit 8						snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	96221437	96221437	+	IGR	DEL	C	-	-	rs66649477		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96221437delC								PLEKHF2 (52526 upstream) : C8orf37 (36798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	97399093	97399094	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97399093_97399094delAC								PTDSS1 (52319 upstream) : SDC2 (106788 downstream)																																			---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100819906	100819907	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100819906_100819907delTG	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103654417	103654418	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103654417_103654418delAC								ODF1 (81172 upstream) : KLF10 (6587 downstream)																																			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104744766	104744766	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104744766delA	uc003ylp.2	+							NM_001100117	NP_001093587			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104840129	104840129	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104840129delA	uc003ylp.2	+						RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_001100117	NP_001093587			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104996023	104996023	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104996023delT	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	107827861	107827861	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107827861delA								ABRA (45389 upstream) : ANGPT1 (433850 downstream)																																			---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108278137	108278139	+	Intron	DEL	AAT	-	-	rs142511641		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108278137_108278139delAAT	uc003ymn.2	-						ANGPT1_uc011lhv.1_Intron|ANGPT1_uc003ymo.2_Intron	NM_001146	NP_001137			angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
NUDCD1	84955	broad.mit.edu	37	8	110260162	110260163	+	Intron	DEL	AA	-	-	rs151238360		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110260162_110260163delAA	uc003ynb.3	-						NUDCD1_uc003yna.2_Intron|NUDCD1_uc010mcl.2_Intron	NM_032869	NP_116258			NudC domain containing 1 isoform 1											ovary(1)|breast(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113424591	113424593	+	Intron	DEL	GTG	-	-	rs148136851		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113424591_113424593delGTG	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114636255	114636255	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114636255delT								CSMD3 (187013 upstream) : None (None downstream)																																			---	---	---	---
RAD21	5885	broad.mit.edu	37	8	117870037	117870039	+	Intron	DEL	ATA	-	-	rs139669353		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117870037_117870039delATA	uc003yod.2	-							NM_006265	NP_006256			RAD21 homolog						apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding			lung(1)|skin(1)	2	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	117907103	117907103	+	IGR	DEL	A	-	-	rs113639596		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117907103delA								RAD21 (19998 upstream) : C8orf85 (43361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118444306	118444306	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118444306delA								SLC30A8 (255354 upstream) : MED30 (88659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118728645	118728646	+	IGR	DEL	AT	-	-	rs140794352		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118728645_118728646delAT								MED30 (176146 upstream) : EXT1 (82956 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119110998	119110998	+	Intron	DEL	A	-	-	rs11365839		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119110998delA	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119497445	119497445	+	Intron	DEL	C	-	-	rs77576547		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119497445delC	uc003yom.2	-						SAMD12_uc010mda.1_Intron|SAMD12_uc010mdb.1_Intron	NM_207506	NP_997389			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	119702422	119702422	+	IGR	DEL	T	-	-	rs5894449		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119702422delT								SAMD12 (68188 upstream) : TNFRSF11B (233375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122079527	122079527	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122079527delA								SNTB1 (255218 upstream) : HAS2 (545744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122159683	122159683	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122159683delT								SNTB1 (335374 upstream) : HAS2 (465588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122923554	122923554	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122923554delT								HAS2AS (266621 upstream) : ZHX2 (870347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123088557	123088557	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123088557delA	uc003ypj.2	-											Homo sapiens, clone IMAGE:5466006, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	123284228	123284229	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123284228_123284229insA								HAS2AS (627295 upstream) : ZHX2 (509672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	124187299	124187299	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124187299delT								WDR67 (22909 upstream) : FAM83A (3988 downstream)																																			---	---	---	---
ZHX1	11244	broad.mit.edu	37	8	124264279	124264279	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124264279delA	uc003yqe.2	-						C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Intron|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Intron	NM_007222	NP_009153			zinc fingers and homeoboxes 1						negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126902295	126902295	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126902295delT								TRIB1 (451653 upstream) : FAM84B (662392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127561594	127561594	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127561594delG								None (None upstream) : FAM84B (3093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127793639	127793639	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127793639delA								FAM84B (223173 upstream) : LOC727677 (508423 downstream)																																			---	---	---	---
LOC727677	727677	broad.mit.edu	37	8	128435079	128435079	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128435079delA	uc003yse.1	-						uc003ysc.1_5'Flank|uc003ysd.1_5'Flank					Homo sapiens isolate DGPc1_8_exons1-2-3-4-5 unknown mRNA, alternatively spliced.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	129750999	129751000	+	IGR	DEL	GT	-	-	rs10531311		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129750999_129751000delGT								MIR1208 (588565 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129997224	129997224	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129997224delG								MIR1208 (834790 upstream) : GSDMC (763219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130527936	130527936	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130527936delT								None (None upstream) : GSDMC (232507 downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131385262	131385267	+	Intron	DEL	ACACAG	-	-	rs7818977		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131385262_131385267delACACAG	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	131538055	131538055	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131538055delG								ASAP1 (123839 upstream) : ADCY8 (254493 downstream)																																			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131804216	131804217	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131804216_131804217insT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133184450	133184450	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184450delA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133388643	133388643	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133388643delT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	133537743	133537743	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133537743delA								KCNQ3 (44739 upstream) : HPYR1 (35002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134407046	134407047	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134407046_134407047insC								NDRG1 (97499 upstream) : ST3GAL1 (60044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134427761	134427762	+	IGR	INS	-	A	A	rs143734023	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134427761_134427762insA								NDRG1 (118214 upstream) : ST3GAL1 (39329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134429205	134429205	+	IGR	DEL	A	-	-	rs78920062		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134429205delA								NDRG1 (119658 upstream) : ST3GAL1 (37886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134607564	134607570	+	IGR	DEL	TGTACTA	-	-	rs34427443		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134607564_134607570delTGTACTA								ST3GAL1 (23381 upstream) : ZFAT (882463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135381077	135381079	+	IGR	DEL	TTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135381077_135381079delTTG								ST3GAL1 (796894 upstream) : ZFAT (108954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135475935	135475936	+	IGR	INS	-	A	A	rs143963201	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135475935_135475936insA								ST3GAL1 (891752 upstream) : ZFAT (14097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136334399	136334399	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136334399delA								LOC286094 (22440 upstream) : KHDRBS3 (135317 downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139359350	139359353	+	Intron	DEL	GAAT	-	-	rs143494888		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139359350_139359353delGAAT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140522263	140522263	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140522263delG								COL22A1 (596027 upstream) : KCNK9 (90819 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140878262	140878262	+	Intron	DEL	G	-	-	rs68159883		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140878262delG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140992214	140992214	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140992214delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141683205	141683205	+	Intron	DEL	T	-	-	rs34388720		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141683205delT	uc003yvu.2	-						PTK2_uc011ljp.1_Intron|PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141722294	141722295	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141722294_141722295insA	uc003yvu.2	-						PTK2_uc011ljp.1_Intron|PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
LOC100133669	100133669	broad.mit.edu	37	8	144065765	144065766	+	Intron	INS	-	C	C	rs146925511	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144065765_144065766insC	uc011ljz.1	-							NR_026913				Homo sapiens, clone IMAGE:3342869, mRNA.												0																OREG0019042	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	8	144748698	144748698	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144748698delC								ZNF623 (12798 upstream) : ZNF707 (17924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	203899	203900	+	IGR	INS	-	T	T	rs149525865	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:203899_203900insT								CBWD1 (24824 upstream) : C9orf66 (9209 downstream)																																			---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2091058	2091058	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2091058delA	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
RFX3	5991	broad.mit.edu	37	9	3468046	3468046	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3468046delC	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304			regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)												OREG0019078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	9	4474023	4474023	+	IGR	DEL	T	-	-	rs35722592		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4474023delT								GLIS3 (173988 upstream) : SLC1A1 (16421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	4933164	4933164	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4933164delT								RCL1 (47247 upstream) : JAK2 (51922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	6370563	6370564	+	IGR	INS	-	T	T	rs147351877	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6370563_6370564insT								TPD52L3 (38663 upstream) : UHRF2 (42587 downstream)																																			---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6910812	6910812	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6910812delA	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6973383	6973383	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6973383delA	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	7478759	7478760	+	IGR	INS	-	T	T	rs139915662	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7478759_7478760insT								KDM4C (303112 upstream) : C9orf123 (317733 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	7928476	7928476	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7928476delT								C9orf123 (128677 upstream) : PTPRD (385771 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9889789	9889790	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9889789_9889790delGT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9943917	9943917	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9943917delT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11075869	11075869	+	IGR	DEL	T	-	-	rs146813373		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11075869delT								PTPRD (463146 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11695116	11695119	+	IGR	DEL	CAAA	-	-	rs146735253		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11695116_11695119delCAAA								None (None upstream) : TYRP1 (998267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11709200	11709200	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11709200delT								None (None upstream) : TYRP1 (984186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12754183	12754183	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12754183delG								TYRP1 (43918 upstream) : C9orf150 (20829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	14373640	14373641	+	IGR	INS	-	GT	GT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14373640_14373641insGT								NFIB (59695 upstream) : ZDHHC21 (181840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	14548664	14548664	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14548664delT								NFIB (234719 upstream) : ZDHHC21 (6817 downstream)																																			---	---	---	---
ZDHHC21	340481	broad.mit.edu	37	9	14621595	14621595	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14621595delT	uc003zli.2	-						ZDHHC21_uc003zlg.1_Intron	NM_178566	NP_848661			zinc finger, DHHC-type containing 21						nitric oxide metabolic process|regulation of nitric-oxide synthase activity	Golgi membrane|integral to membrane	palmitoyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(50;4.31e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	15388167	15388167	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15388167delA								TTC39B (80923 upstream) : SNAPC3 (34615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	16122761	16122761	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16122761delT								C9orf93 (150866 upstream) : BNC2 (286741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	19148831	19148832	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19148831_19148832delTC	uc003znp.1	-											Homo sapiens cDNA FLJ36877 fis, clone BEAST2000454.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	20295617	20295621	+	IGR	DEL	TGAAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20295617_20295621delTGAAC								SLC24A2 (506809 upstream) : MLLT3 (49347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23160368	23160369	+	IGR	DEL	AG	-	-	rs142617400		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23160368_23160369delAG								DMRTA1 (707896 upstream) : ELAVL2 (529736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23973280	23973280	+	IGR	DEL	T	-	-	rs11304743		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23973280delT								ELAVL2 (147217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25464300	25464300	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25464300delA								None (None upstream) : TUSC1 (212094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	25566496	25566496	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25566496delC								None (None upstream) : TUSC1 (109898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26710234	26710234	+	IGR	DEL	C	-	-	rs35915354		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26710234delC								None (None upstream) : C9orf82 (130450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	29693904	29693904	+	IGR	DEL	C	-	-	rs149036556		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29693904delC								MIR873 (804951 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30288819	30288820	+	IGR	DEL	AC	-	-	rs10559630		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30288819_30288820delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30888479	30888480	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30888479_30888480delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32708740	32708741	+	IGR	INS	-	A	A	rs59255207		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32708740_32708741insA								TAF1L (73073 upstream) : TMEM215 (74756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	37386190	37386190	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37386190delT								ZCCHC7 (28047 upstream) : GRHPR (36491 downstream)																																			---	---	---	---
FBXO10	26267	broad.mit.edu	37	9	37575131	37575131	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37575131delT	uc004aab.2	-						FBXO10_uc004aac.2_Intron|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298			F-box protein 10							ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)														---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37648162	37648163	+	5'Flank	INS	-	A	A	rs147285418	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37648162_37648163insA	uc004aag.1	+							NM_014907	NP_055722			FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
SHB	6461	broad.mit.edu	37	9	37989086	37989087	+	Intron	INS	-	CT	CT	rs140994932	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37989086_37989087insCT	uc004aax.2	-							NM_003028	NP_003019			Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	38104209	38104209	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38104209delA								SHB (34999 upstream) : ALDH1B1 (288493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44742109	44742110	+	IGR	INS	-	TG	TG	rs145005151	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44742109_44742110insTG								None (None upstream) : FAM27C (248126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44770271	44770272	+	IGR	INS	-	AGAAAG	AGAAAG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44770271_44770272insAGAAAG								None (None upstream) : FAM27C (219964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66245063	66245064	+	IGR	INS	-	T	T	rs74614480		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66245063_66245064insT								FAM74A4 (750677 upstream) : LOC442421 (251406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66510122	66510122	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66510122delT								LOC442421 (7095 upstream) : AQP7P1 (744145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66797636	66797636	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66797636delT								LOC442421 (294609 upstream) : AQP7P1 (456631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68393954	68393954	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68393954delT								FAM27B (599765 upstream) : MIR1299 (608285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68491533	68491534	+	IGR	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491533_68491534delTC								FAM27B (697344 upstream) : MIR1299 (510705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68701418	68701419	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68701418_68701419delGA								FAM27B (907229 upstream) : MIR1299 (300820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70126408	70126408	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70126408delA								LOC100133920 (461459 upstream) : FOXD4L5 (49301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	72383904	72383904	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72383904delG								PTAR1 (9028 upstream) : C9orf135 (51827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	77312718	77312718	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77312718delT								RORB (10603 upstream) : TRPM6 (24693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	78901360	78901360	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78901360delG								PCSK5 (93022 upstream) : RFK (99073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	79703292	79703292	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79703292delA								FOXB2 (67423 upstream) : VPS13A (89069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81093475	81093476	+	IGR	INS	-	T	T	rs139777898	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81093475_81093476insT								PSAT1 (148468 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81983185	81983185	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81983185delG								None (None upstream) : TLE4 (203693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82510009	82510009	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82510009delC								TLE4 (168352 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82584697	82584697	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82584697delA								TLE4 (243040 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82994563	82994564	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82994563_82994564delAA								TLE4 (652906 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	85199602	85199602	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85199602delT								FLJ46321 (589432 upstream) : RASEF (397715 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	85309727	85309727	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85309727delT								FLJ46321 (699557 upstream) : RASEF (287590 downstream)																																			---	---	---	---
UBQLN1	29979	broad.mit.edu	37	9	86297402	86297405	+	Intron	DEL	AAAC	-	-	rs72405846		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86297402_86297405delAAAC	uc004amv.2	-						UBQLN1_uc004amw.2_Intron	NM_013438	NP_038466			ubiquilin 1 isoform 1						apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0																		---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87436854	87436854	+	Intron	DEL	T	-	-	rs36102395		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87436854delT	uc004aoa.1	+						NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron|NTRK2_uc011lsz.1_Intron|NTRK2_uc011lta.1_Intron|NTRK2_uc004aoc.2_Intron	NM_001018064	NP_001018074			neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87608896	87608896	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87608896delA	uc004aoa.1	+						NTRK2_uc004anz.1_Intron	NM_001018064	NP_001018074			neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90168989	90168992	+	Intron	DEL	ACTC	-	-	rs138498468		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90168989_90168992delACTC	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929			death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	9	91106658	91106659	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91106658_91106659insA								SPIN1 (13038 upstream) : NXNL2 (43357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91508302	91508303	+	IGR	INS	-	TTG	TTG	rs141514114	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91508302_91508303insTTG								LOC286238 (241227 upstream) : C9orf47 (97475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93691987	93691987	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93691987delA								SYK (31154 upstream) : AUH (284112 downstream)																																			---	---	---	---
AUH	549	broad.mit.edu	37	9	94016753	94016754	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94016753_94016754insT	uc004arf.3	-						AUH_uc004arg.3_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
AUH	549	broad.mit.edu	37	9	94105550	94105550	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94105550delA	uc004arf.3	-						AUH_uc004arg.3_Intron|AUH_uc011ltu.1_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	95541478	95541478	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95541478delG								BICD2 (14395 upstream) : ANKRD19 (30415 downstream)																																			---	---	---	---
FANCC	2176	broad.mit.edu	37	9	97943785	97943785	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97943785delA	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127			Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)						D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
Unknown	0	broad.mit.edu	37	9	98474938	98474938	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98474938delG								PTCH1 (195691 upstream) : C9orf130 (93434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	99903762	99903762	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99903762delG								LOC340508 (59535 upstream) : ZNF322B (53871 downstream)																																			---	---	---	---
TBC1D2	55357	broad.mit.edu	37	9	101009611	101009612	+	Intron	INS	-	A	A	rs34334323		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101009611_101009612insA	uc011lvb.1	-						TBC1D2_uc004ayq.2_Intron|TBC1D2_uc004ayr.2_Intron|TBC1D2_uc004ayo.3_Intron	NM_018421	NP_060891			TBC1 domain family, member 2							cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	102076677	102076677	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102076677delC								SEC61B (83777 upstream) : NR4A3 (507460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102642716	102642716	+	IGR	DEL	T	-	-	rs11321924		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102642716delT								NR4A3 (13543 upstream) : STX17 (26199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	103167745	103167745	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103167745delA								TEX10 (52486 upstream) : C9orf30 (21897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	103680136	103680136	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103680136delG								MURC (329965 upstream) : LPPR1 (110895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104580118	104580120	+	IGR	DEL	CAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104580118_104580120delCAA								GRIN3A (79256 upstream) : None (None downstream)																																			---	---	---	---
ABCA1	19	broad.mit.edu	37	9	107573842	107573843	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107573842_107573843insA	uc004bcl.2	-							NM_005502	NP_005493			ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	108621653	108621656	+	IGR	DEL	AAAG	-	-	rs35428187		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108621653_108621656delAAAG								TMEM38B (84209 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108740533	108740535	+	IGR	DEL	TGT	-	-	rs141295615		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108740533_108740535delTGT								TMEM38B (203089 upstream) : ZNF462 (884843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	109195791	109195791	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109195791delC								TMEM38B (658347 upstream) : ZNF462 (429587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	109839956	109839957	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109839956_109839957delTC	uc004bdc.1	-											Homo sapiens cDNA FLJ40387 fis, clone TESTI2036129.																														---	---	---	---
PALM2-AKAP2	445815	broad.mit.edu	37	9	112875808	112875809	+	Intron	INS	-	T	T	rs144289550		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112875808_112875809insT	uc004bei.2	+						PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron|AKAP2_uc011lwi.1_Intron|AKAP2_uc004bem.2_Intron|PALM2-AKAP2_uc010mtw.1_Intron	NM_001136562	NP_001130034			A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	114270643	114270644	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114270643_114270644delGT								KIAA0368 (23618 upstream) : ZNF483 (16803 downstream)																																			---	---	---	---
ZNF618	114991	broad.mit.edu	37	9	116644020	116644020	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116644020delT	uc004bid.2	+						ZNF618_uc004bib.1_Intron|ZNF618_uc004bic.2_Intron|ZNF618_uc011lxi.1_Intron|ZNF618_uc011lxj.1_Intron	NM_133374	NP_588615			zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119264420	119264421	+	Intron	INS	-	TG	TG	rs142464736	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119264420_119264421insTG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_5'Flank	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121065081	121065081	+	IGR	DEL	G	-	-	rs34964017		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121065081delG								TLR4 (585317 upstream) : DBC1 (863827 downstream)																																			---	---	---	---
CDK5RAP2	55755	broad.mit.edu	37	9	123276651	123276652	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123276651_123276652delCA	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719			CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124417666	124417666	+	Intron	DEL	G	-	-	rs34349737		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124417666delG	uc004bln.2	+							NM_032552	NP_115941			disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TTLL11	158135	broad.mit.edu	37	9	124658072	124658073	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124658072_124658073delTG	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914			tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126162200	126162200	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126162200delA	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc010mwh.1_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																OREG0019469	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	9	126970030	126970031	+	IGR	INS	-	T	T	rs72449391		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126970030_126970031insT								LHX2 (174588 upstream) : NEK6 (49855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	127185433	127185434	+	IGR	INS	-	A	A	rs72542522	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127185433_127185434insA								PSMB7 (7712 upstream) : GPR144 (27989 downstream)																																			---	---	---	---
NR6A1	2649	broad.mit.edu	37	9	127472554	127472554	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127472554delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591			nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
GOLGA1	2800	broad.mit.edu	37	9	127701422	127701422	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127701422delT	uc004bpc.2	-						GOLGA1_uc010mwt.1_5'Flank	NM_002077	NP_002068			golgin 97							Golgi cisterna membrane				ovary(1)	1																		---	---	---	---
SCAI	286205	broad.mit.edu	37	9	127762883	127762883	+	Intron	DEL	A	-	-	rs35069965		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127762883delA	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349			suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128473101	128473101	+	IGR	DEL	T	-	-	rs33988310		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128473101delT								MAPKAP1 (3588 upstream) : PBX3 (36516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	128857216	128857217	+	IGR	INS	-	CTTTCTTCTTCA	CTTTCTTCTTCA	rs145104246	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128857216_128857217insCTTTCTTCTTCA								PBX3 (127563 upstream) : FAM125B (231911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	128990917	128990918	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128990917_128990918delAC								PBX3 (261264 upstream) : FAM125B (98210 downstream)																																	OREG0019490	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LMX1B	4010	broad.mit.edu	37	9	129413433	129413434	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129413433_129413434delTC	uc004bqj.2	+						LMX1B_uc004bqi.2_Intron|LMX1B_uc011maa.1_Intron	NM_002316	NP_002307			LIM homeobox transcription factor 1, beta						dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														Nail-Patella_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	9	129489644	129489645	+	IGR	INS	-	TT	TT	rs150760866		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129489644_129489645insTT								LMX1B (26333 upstream) : ZBTB43 (77640 downstream)																																			---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129835726	129835727	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129835726_129835727delTG	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
SLC2A8	29988	broad.mit.edu	37	9	130170155	130170158	+	3'UTR	DEL	AAAC	-	-	rs67561937		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130170155_130170158delAAAC	uc004bqu.2	+	10					SLC2A8_uc010mxj.2_3'UTR|SLC2A8_uc004bqv.2_3'UTR	NM_014580	NP_055395			solute carrier family 2 (facilitated glucose							cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2																		---	---	---	---
STXBP1	6812	broad.mit.edu	37	9	130375526	130375526	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130375526delC	uc004brl.2	+						STXBP1_uc004brk.2_Intron	NM_001032221	NP_001027392			syntaxin binding protein 1 isoform b						axon target recognition|energy reserve metabolic process|glutamate secretion|negative regulation of synaptic transmission, GABAergic|neurotransmitter secretion|platelet aggregation|platelet degranulation|protein transport|regulation of insulin secretion|regulation of synaptic vesicle priming|synaptic vesicle maturation|vesicle docking involved in exocytosis	cytosol|mitochondrion|plasma membrane|platelet alpha granule|protein complex	identical protein binding|syntaxin-1 binding|syntaxin-2 binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	131061646	131061646	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131061646delA								C9orf119 (10379 upstream) : TRUB2 (9750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	131211268	131211268	+	IGR	DEL	T	-	-	rs67816352		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131211268delT								CERCAM (11641 upstream) : ODF2 (6198 downstream)																																			---	---	---	---
ODF2	4957	broad.mit.edu	37	9	131217140	131217141	+	5'Flank	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131217140_131217141insG	uc011mbd.1	+						ODF2_uc011maz.1_5'Flank|ODF2_uc011mba.1_5'Flank|ODF2_uc010myb.2_5'Flank|ODF2_uc011mbb.1_5'Flank|ODF2_uc011mbc.1_5'Flank|ODF2_uc004bva.2_5'Flank|ODF2_uc004bvb.2_5'Flank|ODF2_uc011mbe.1_5'Flank|ODF2_uc004bvc.2_5'Flank|ODF2_uc010myc.2_5'Flank|ODF2_uc011mbf.1_5'Flank|ODF2_uc004bvd.3_5'Flank|ODF2_uc004bve.2_5'Flank	NM_002540	NP_002531			outer dense fiber of sperm tails 2 isoform 1						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1																		---	---	---	---
SPTAN1	6709	broad.mit.edu	37	9	131353357	131353357	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131353357delA	uc004bvl.3	+						SPTAN1_uc011mbg.1_Intron|SPTAN1_uc011mbh.1_Intron|SPTAN1_uc004bvm.3_Intron|SPTAN1_uc004bvn.3_Intron	NM_003127	NP_003118			spectrin, alpha, non-erythrocytic 1						actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10																		---	---	---	---
ZER1	10444	broad.mit.edu	37	9	131527492	131527495	+	Intron	DEL	ACAC	-	-	rs71497410		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131527492_131527495delACAC	uc004bwa.1	-							NM_006336	NP_006327			zyg-11 homolog B (C. elegans)-like						ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
PPP2R4	5524	broad.mit.edu	37	9	131881093	131881093	+	Intron	DEL	T	-	-	rs72442789		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131881093delT	uc004bxm.1	+						PPP2R4_uc004bxl.1_Intron|PPP2R4_uc011mbo.1_Intron|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Intron|PPP2R4_uc004bxo.1_Intron|PPP2R4_uc011mbp.1_Intron|PPP2R4_uc011mbq.1_Intron|PPP2R4_uc010mys.1_Intron	NM_178001	NP_821068			protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	131946374	131946375	+	IGR	DEL	GT	-	-	rs17486841		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131946374_131946375delGT								IER5L (5834 upstream) : C9orf106 (136920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	132194343	132194343	+	IGR	DEL	G	-	-	rs67048043		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132194343delG								C9orf106 (109461 upstream) : C9orf50 (180163 downstream)																																			---	---	---	---
FNBP1	23048	broad.mit.edu	37	9	132753555	132753555	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132753555delT	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848			formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)				T	MLL	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	9	134210734	134210734	+	IGR	DEL	T	-	-	rs74790889		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134210734delT								PPAPDC3 (26085 upstream) : BAT2L1 (58866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134446080	134446080	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134446080delT								UCK1 (39418 upstream) : RAPGEF1 (6078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134636698	134636698	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134636698delT								RAPGEF1 (21481 upstream) : MED27 (98801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134659389	134659396	+	IGR	DEL	TTTGTTTG	-	-	rs71501278		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134659389_134659396delTTTGTTTG								RAPGEF1 (44172 upstream) : MED27 (76103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134664534	134664535	+	IGR	INS	-	TCTT	TCTT	rs142013946	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134664534_134664535insTCTT								RAPGEF1 (49317 upstream) : MED27 (70964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	135033267	135033267	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135033267delG								MED27 (78014 upstream) : NTNG2 (4067 downstream)																																			---	---	---	---
C9orf98	158067	broad.mit.edu	37	9	135695600	135695600	+	Intron	DEL	A	-	-	rs66490117		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135695600delA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785			putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)														---	---	---	---
C9orf98	158067	broad.mit.edu	37	9	135737717	135737717	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135737717delT	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785			putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)														---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136799035	136799041	+	Intron	DEL	GATGGAT	-	-	rs61119780		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136799035_136799041delGATGGAT	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137577431	137577432	+	Intron	INS	-	A	A	rs139419653		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577431_137577432insA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138491719	138491719	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138491719delA								PAEP (33097 upstream) : GLT6D1 (23783 downstream)																																			---	---	---	---
NACC2	138151	broad.mit.edu	37	9	138914770	138914770	+	Intron	DEL	T	-	-	rs35317169		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138914770delT	uc004cgw.2	-						NACC2_uc010nbh.2_Intron	NM_144653	NP_653254			BTB (POZ) domain containing 14A						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0																		---	---	---	---
NACC2	138151	broad.mit.edu	37	9	138958050	138958052	+	Intron	DEL	AAG	-	-	rs60945683		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138958050_138958052delAAG	uc004cgw.2	-						NACC2_uc010nbh.2_Intron	NM_144653	NP_653254			BTB (POZ) domain containing 14A						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0																		---	---	---	---
ABCA2	20	broad.mit.edu	37	9	139916656	139916658	+	Intron	DEL	GAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139916656_139916658delGAG	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004cko.1_Intron|ABCA2_uc010nca.2_Intron	NM_001606	NP_001597			ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)														---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1624399	1624400	+	Intron	INS	-	TTGGAG	TTGGAG	rs139882350	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1624399_1624400insTTGGAG	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2340645	2340646	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2340645_2340646insA								ADARB2 (560927 upstream) : PFKP (769106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2862357	2862357	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2862357delT								None (None upstream) : PFKP (247395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3090040	3090041	+	IGR	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3090040_3090041delCT								None (None upstream) : PFKP (19711 downstream)																																			---	---	---	---
PFKP	5214	broad.mit.edu	37	10	3122292	3122293	+	Intron	DEL	AG	-	-	rs79799896		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3122292_3122293delAG	uc001igp.2	+						PFKP_uc001igq.2_Intron|PFKP_uc009xhr.2_Intron	NM_002627	NP_002618			phosphofructokinase, platelet						glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	5673331	5673332	+	IGR	INS	-	ATTG	ATTG	rs142940814	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5673331_5673332insATTG								CALML3 (105106 upstream) : ASB13 (7488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6052539	6052540	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6052539_6052540insA								IL15RA (32397 upstream) : IL2RA (966 downstream)																																			---	---	---	---
IL2RA	3559	broad.mit.edu	37	10	6070623	6070623	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6070623delA	uc001iiz.1	-						IL2RA_uc009xih.1_Intron|IL2RA_uc001ija.1_5'Flank	NM_000417	NP_000408			interleukin 2 receptor, alpha chain precursor						cell proliferation	integral to membrane	interleukin-2 receptor activity			ovary(1)|skin(1)	2					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)													---	---	---	---
PRKCQ	5588	broad.mit.edu	37	10	6512889	6512889	+	Intron	DEL	A	-	-	rs111588366		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6512889delA	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248			protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6																		---	---	---	---
TAF3	83860	broad.mit.edu	37	10	7880326	7880327	+	Intron	INS	-	TTG	TTG	rs139232371	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7880326_7880327insTTG	uc010qbd.1	+							NM_031923	NP_114129			RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	8219332	8219333	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8219332_8219333insT								GATA3 (102170 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10686365	10686366	+	IGR	INS	-	GTGT	GTGT	rs142923377	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10686365_10686366insGTGT								None (None upstream) : SFTA1P (140036 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11229753	11229753	+	Intron	DEL	T	-	-	rs79909536		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11229753delT	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc009xiw.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	11728663	11728663	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11728663delG								USP6NL (74984 upstream) : ECHDC3 (55693 downstream)																																			---	---	---	---
ECHDC3	79746	broad.mit.edu	37	10	11803087	11803087	+	Intron	DEL	G	-	-	rs67425305		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11803087delG	uc001ikw.3	+						ECHDC3_uc009xix.2_Intron	NM_024693	NP_078969			enoyl Coenzyme A hydratase domain containing 3							mitochondrion	catalytic activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	12304366	12304367	+	IGR	INS	-	A	A	rs147345312	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12304366_12304367insA								CDC123 (11779 upstream) : CAMK1D (87216 downstream)																																			---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	13020551	13020552	+	Intron	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13020551_13020552delAG	uc001ilq.1	-						CCDC3_uc009xjb.1_Intron|CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron	NM_031455	NP_113643			coiled-coil domain containing 3 precursor							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	13114674	13114678	+	Intron	DEL	TTTTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13114674_13114678delTTTTC	uc001ilr.2	-						CCDC3_uc009xjc.1_Intron|uc009xjd.1_Intron					Homo sapiens MSTP151 (MST151) mRNA, complete cds.							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	13126288	13126288	+	Intron	DEL	T	-	-	rs10906297		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13126288delT	uc001ilr.2	-						CCDC3_uc009xjc.1_Intron|uc009xjd.1_Intron					Homo sapiens MSTP151 (MST151) mRNA, complete cds.							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
MCM10	55388	broad.mit.edu	37	10	13252313	13252314	+	3'UTR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13252313_13252314insA	uc001ima.2	+	20					MCM10_uc001imb.2_3'UTR|MCM10_uc001imc.2_3'UTR	NM_182751	NP_877428			minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13767538	13767538	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13767538delT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13851519	13851520	+	Intron	INS	-	A	A	rs147401665	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13851519_13851520insA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
FAM107B	83641	broad.mit.edu	37	10	14641853	14641853	+	Intron	DEL	A	-	-	rs140027833		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14641853delA	uc001ina.1	-						FAM107B_uc010qbu.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641			hypothetical protein LOC83641											breast(4)	4																		---	---	---	---
FAM107B	83641	broad.mit.edu	37	10	14720608	14720612	+	Intron	DEL	TCCTC	-	-	rs148296816		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14720608_14720612delTCCTC	uc001ina.1	-						FAM107B_uc010qbu.1_Intron	NM_031453	NP_113641			hypothetical protein LOC83641											breast(4)	4																		---	---	---	---
OLAH	55301	broad.mit.edu	37	10	15094666	15094667	+	Intron	DEL	TC	-	-	rs5783428		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15094666_15094667delTC	uc001inu.2	+						ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Intron	NM_001039702	NP_001034791			oleoyl-ACP hydrolase isoform 2						fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15146414	15146415	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15146414_15146415insT								RPP38 (159 upstream) : NMT2 (1356 downstream)																																			---	---	---	---
FAM171A1	221061	broad.mit.edu	37	10	15341959	15341960	+	Intron	INS	-	CAAA	CAAA	rs138282595	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15341959_15341960insCAAA	uc001iob.2	-							NM_001010924	NP_001010924			hypothetical protein LOC221061 precursor							integral to membrane				ovary(2)|breast(1)|skin(1)	4																		---	---	---	---
RSU1	6251	broad.mit.edu	37	10	16857437	16857437	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16857437delA	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron|RSU1_uc001ion.2_Intron	NM_152724	NP_689937			ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	17280527	17280527	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17280527delC								VIM (935 upstream) : ST8SIA6 (82150 downstream)																																			---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18928017	18928020	+	Intron	DEL	CAAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18928017_18928020delCAAA	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	19447635	19447635	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19447635delA								ARL5B (480695 upstream) : PLXDC2 (657737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	20773111	20773111	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20773111delG								PLXDC2 (203996 upstream) : NEBL (295794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	21004388	21004389	+	IGR	INS	-	T	T	rs141382810	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21004388_21004389insT								PLXDC2 (435273 upstream) : NEBL (64516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	21770299	21770300	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21770299_21770300insA								NEBL (307183 upstream) : C10orf114 (13122 downstream)																																			---	---	---	---
MLLT10	8028	broad.mit.edu	37	10	21940832	21940832	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21940832delC	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001ira.2_Intron|MLLT10_uc001iqz.2_Intron	NM_004641	NP_004632			myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2								T	MLL|PICALM|CDK6	AL								---	---	---	---
DNAJC1	64215	broad.mit.edu	37	10	22149624	22149627	+	Intron	DEL	AAAC	-	-	rs143467058		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22149624_22149627delAAAC	uc001irc.2	-						DNAJC1_uc001ird.2_Intron	NM_022365	NP_071760			DnaJ (Hsp40) homolog, subfamily C, member 1						negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	23062850	23062850	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23062850delT								PIP4K2A (59347 upstream) : ARMC3 (154104 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24612718	24612727	+	Intron	DEL	GTGTGTGTGT	-	-	rs72227631		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24612718_24612727delGTGTGTGTGT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24652909	24652910	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24652909_24652910insT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	24838664	24838664	+	IGR	DEL	T	-	-	rs79800834		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24838664delT								KIAA1217 (1893 upstream) : ARHGAP21 (33874 downstream)																																			---	---	---	---
ARHGAP21	57584	broad.mit.edu	37	10	24897708	24897708	+	Intron	DEL	A	-	-	rs5783899		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24897708delA	uc001isb.2	-						ARHGAP21_uc010qdb.1_Intron|ARHGAP21_uc009xkl.1_Intron|ARHGAP21_uc010qdc.1_Intron	NM_020824	NP_065875			Rho GTPase activating protein 21						signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8																		---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25598145	25598146	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25598145_25598146delTG	uc001isj.2	+							NM_020752	NP_065803			G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25637326	25637327	+	Intron	DEL	AC	-	-	rs71766432		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25637326_25637327delAC	uc001isj.2	+							NM_020752	NP_065803			G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
APBB1IP	54518	broad.mit.edu	37	10	26829864	26829864	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26829864delT	uc001iss.2	+						APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916			amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26899975	26899976	+	IGR	INS	-	A	A	rs141473028	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26899975_26899976insA								C10orf50 (16726 upstream) : LOC731789 (32061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	26980896	26980896	+	IGR	DEL	G	-	-	rs67736801		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26980896delG								LOC731789 (38514 upstream) : PDSS1 (5699 downstream)																																			---	---	---	---
NCRNA00202	387644	broad.mit.edu	37	10	27233662	27233662	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27233662delA	uc001itf.2	-							NR_026795				Homo sapiens cDNA FLJ40086 fis, clone TESTI2003031.												0																		---	---	---	---
MKX	283078	broad.mit.edu	37	10	27997656	27997657	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27997656_27997657insA	uc001ity.3	-						MKX_uc001itx.3_Intron	NM_173576	NP_775847			mohawk homeobox						muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
ARMC4	55130	broad.mit.edu	37	10	28210416	28210416	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28210416delA	uc009xky.2	-						ARMC4_uc010qds.1_Intron|ARMC4_uc010qdt.1_Intron|ARMC4_uc001itz.2_Intron	NM_018076	NP_060546			armadillo repeat containing 4								binding			ovary(4)|skin(2)	6																		---	---	---	---
WAC	51322	broad.mit.edu	37	10	28836465	28836466	+	Intron	INS	-	A	A	rs76722945		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28836465_28836466insA	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc009xlb.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712			WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29543255	29543268	+	IGR	DEL	AACAGGAGGAGGAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29543255_29543268delAACAGGAGGAGGAG								BAMBI (571387 upstream) : LYZL1 (34722 downstream)																																			---	---	---	---
LOC387647	387647	broad.mit.edu	37	10	29744560	29744561	+	Intron	INS	-	T	T	rs148893966	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29744560_29744561insT	uc001iuo.1	+						LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|uc001iur.1_RNA|uc001ius.1_5'Flank					Homo sapiens cDNA FLJ31518 fis, clone NT2RI2000064.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30520653	30520653	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30520653delT								KIAA1462 (116233 upstream) : MTPAP (78078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30934596	30934597	+	IGR	INS	-	TG	TG	rs143024525	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30934596_30934597insTG								LYZL2 (15949 upstream) : ZNF438 (198970 downstream)																																			---	---	---	---
ZEB1	6935	broad.mit.edu	37	10	31691571	31691571	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31691571delT	uc001ivs.3	+						ZEB1_uc001ivr.3_Intron|ZEB1_uc010qee.1_Intron|ZEB1_uc010qef.1_Intron|ZEB1_uc009xlh.1_Intron|ZEB1_uc009xli.1_Intron|ZEB1_uc009xlj.1_Intron|ZEB1_uc010qeg.1_Intron|ZEB1_uc009xlk.1_Intron|ZEB1_uc001ivt.3_Intron|ZEB1_uc001ivu.3_Intron|ZEB1_uc001ivv.3_Intron|ZEB1_uc010qeh.1_Intron|ZEB1_uc009xll.2_Intron|ZEB1_uc009xlm.1_Intron|ZEB1_uc009xln.1_Intron|ZEB1_uc009xlo.1_Intron|ZEB1_uc009xlp.2_Intron	NM_030751	NP_110378			zinc finger E-box binding homeobox 1 isoform b						cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)																---	---	---	---
EPC1	80314	broad.mit.edu	37	10	32659396	32659396	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32659396delT	uc001iwi.3	-						EPC1_uc009xlt.2_Intron	NM_025209	NP_079485			enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	33871868	33871868	+	IGR	DEL	T	-	-	rs145607514		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33871868delT								NRP1 (247862 upstream) : PARD3 (528230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	34349339	34349339	+	IGR	DEL	T	-	-	rs140936319		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34349339delT								NRP1 (725333 upstream) : PARD3 (50759 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34455556	34455556	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34455556delA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35110613	35110616	+	IGR	DEL	AAAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35110613_35110616delAAAG								PARD3 (6690 upstream) : CUL2 (188192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37012730	37012730	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37012730delA								None (None upstream) : ANKRD30A (402055 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38778441	38778445	+	IGR	DEL	GAATG	-	-	rs112838314		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38778441_38778445delGAATG								LOC399744 (37361 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38946141	38946142	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38946141_38946142insTT								LOC399744 (205061 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38974472	38974473	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38974472_38974473insA								LOC399744 (233392 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39079003	39079007	+	IGR	DEL	CGTGT	-	-	rs146311877		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39079003_39079007delCGTGT								LOC399744 (337923 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39091666	39091667	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39091666_39091667insT								LOC399744 (350586 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39117315	39117315	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39117315delG								LOC399744 (376235 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42631641	42631642	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42631641_42631642insT								None (None upstream) : LOC441666 (195673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42653302	42653303	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42653302_42653303insA								None (None upstream) : LOC441666 (174012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44136381	44136382	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44136381_44136382delTT	uc001jba.2	+											Homo sapiens chromosome 10 open reading frame 44, mRNA (cDNA clone IMAGE:4837462).																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	45743812	45743812	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45743812delT								LOC100133308 (93768 upstream) : OR13A1 (54290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45941633	45941634	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45941633_45941634insA								ALOX5 (72 upstream) : MARCH8 (11183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	46989395	46989411	+	IGR	DEL	AACAGGGGGACTACAGA	-	-	rs72031633		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46989395_46989411delAACAGGGGGACTACAGA								SYT15 (18794 upstream) : GPRIN2 (4135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	47539037	47539037	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47539037delT								FAM35B2 (117801 upstream) : ANTXRL (119197 downstream)																																			---	---	---	---
MAPK8	5599	broad.mit.edu	37	10	49532999	49533000	+	Intron	INS	-	TTTTTTGTTTTTG	TTTTTTGTTTTTG	rs145139286	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49532999_49533000insTTTTTTGTTTTTG	uc009xnz.2	+						MAPK8_uc001jgl.2_Intron	NM_139047	NP_620635			mitogen-activated protein kinase 8 isoform JNK1						activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)														---	---	---	---
PARG	8505	broad.mit.edu	37	10	51488138	51488138	+	Intron	DEL	A	-	-	rs33959440		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51488138delA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|AGAP7_uc001jio.2_5'Flank	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53358566	53358567	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53358566_53358567insT	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53891265	53891265	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53891265delG	uc001jjm.2	+						PRKG1_uc001jjo.2_Intron|PRKG1_uc009xow.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54329878	54329879	+	IGR	INS	-	AA	AA	rs67508993		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54329878_54329879insAA								DKK1 (252462 upstream) : MBL2 (195262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54437069	54437069	+	IGR	DEL	G	-	-	rs74611091		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54437069delG								DKK1 (359653 upstream) : MBL2 (88072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54817578	54817578	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54817578delA								MBL2 (286118 upstream) : PCDH15 (744957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54829544	54829545	+	IGR	INS	-	A	A	rs144919595	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54829544_54829545insA								MBL2 (298084 upstream) : PCDH15 (732990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	57781506	57781507	+	IGR	INS	-	AT	AT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57781506_57781507insAT								PCDH15 (393804 upstream) : ZWINT (335692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58058833	58058833	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58058833delC								PCDH15 (671131 upstream) : ZWINT (58366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58547452	58547455	+	IGR	DEL	TTGA	-	-	rs34642090		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58547452_58547455delTTGA								ZWINT (426418 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58633172	58633172	+	IGR	DEL	A	-	-	rs34493852		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58633172delA								ZWINT (512138 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58944398	58944399	+	IGR	INS	-	TG	TG	rs71836149		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58944398_58944399insTG								ZWINT (823364 upstream) : None (None downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60271924	60271925	+	5'Flank	DEL	AA	-	-	rs34535202		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60271924_60271925delAA	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
ANK3	288	broad.mit.edu	37	10	62124500	62124500	+	Intron	DEL	C	-	-	rs35996229		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62124500delC	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
ANK3	288	broad.mit.edu	37	10	62429748	62429748	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62429748delT	uc001jkz.3	-							NM_001149	NP_001140			ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	62604438	62604438	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62604438delT								CDK1 (49834 upstream) : RHOBTB1 (24762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	62917826	62917827	+	IGR	INS	-	GA	GA	rs34812402		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62917826_62917827insGA								RHOBTB1 (156628 upstream) : TMEM26 (248574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63120339	63120339	+	IGR	DEL	T	-	-	rs111759168		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63120339delT								RHOBTB1 (359141 upstream) : TMEM26 (46062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63338367	63338368	+	IGR	INS	-	A	A	rs143052209	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63338367_63338368insA								TMEM26 (125159 upstream) : C10orf107 (84351 downstream)																																			---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63778339	63778340	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63778339_63778340insT	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	64019037	64019038	+	Intron	INS	-	TAAAT	TAAAT	rs146727560	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64019037_64019038insTAAAT	uc001jlw.2	-						ZNF365_uc001jly.3_Intron|RTKN2_uc001jlx.2_Intron	NM_145307	NP_660350			rhotekin 2						signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
ZNF365	22891	broad.mit.edu	37	10	64030882	64030883	+	Intron	INS	-	GAAAA	GAAAA	rs144330433	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64030882_64030883insGAAAA	uc001jly.3	+						RTKN2_uc001jlw.2_5'Flank|RTKN2_uc001jlx.2_5'Flank	NM_014951	NP_055766			zinc finger protein 365 isoform A											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	64556543	64556544	+	IGR	DEL	TT	-	-	rs78833811		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64556543_64556544delTT								ZNF365 (124772 upstream) : ADO (7972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	64835619	64835619	+	IGR	DEL	G	-	-	rs34474532		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64835619delG								EGR2 (256692 upstream) : NRBF2 (57388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65244406	65244407	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65244406_65244407insA								LOC84989 (18086 upstream) : REEP3 (36716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65538149	65538149	+	IGR	DEL	T	-	-	rs113611224		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65538149delT								REEP3 (156178 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65572367	65572369	+	IGR	DEL	TGT	-	-	rs71463543		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65572367_65572369delTGT								REEP3 (190396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66028800	66028801	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66028800_66028801insT								REEP3 (646829 upstream) : ANXA2P3 (556484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66140211	66140211	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66140211delT								REEP3 (758240 upstream) : ANXA2P3 (445074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67273712	67273712	+	IGR	DEL	T	-	-	rs147366307		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67273712delT								ANXA2P3 (687078 upstream) : CTNNA3 (406013 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68579819	68579819	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68579819delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	69494905	69494906	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69494905_69494906delAC								CTNNA3 (38956 upstream) : DNAJC12 (61522 downstream)																																			---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69739858	69739858	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69739858delC	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69789104	69789104	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69789104delC	uc001jng.3	-						HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69791517	69791518	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69791517_69791518insT	uc001jng.3	-						HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
PBLD	64081	broad.mit.edu	37	10	70080578	70080579	+	Intron	INS	-	T	T	rs7903155		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70080578_70080579insT	uc001jns.1	-						PBLD_uc001jnt.1_Intron|PBLD_uc001jnu.1_Intron	NM_022129	NP_071412			MAWD binding protein isoform a						biosynthetic process		isomerase activity			skin(2)|ovary(1)	3																		---	---	---	---
TET1	80312	broad.mit.edu	37	10	70419061	70419062	+	Intron	DEL	AG	-	-	rs138296634		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70419061_70419062delAG	uc001jok.3	+							NM_030625	NP_085128			CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9																		---	---	---	---
HK1	3098	broad.mit.edu	37	10	71104180	71104181	+	Intron	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71104180_71104181delCT	uc001jpl.3	+						HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_Intron|HK1_uc009xqd.2_Intron	NM_000188	NP_000179			hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1																		---	---	---	---
TSPAN15	23555	broad.mit.edu	37	10	71263946	71263946	+	Intron	DEL	G	-	-	rs11306774		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71263946delG	uc001jpo.1	+							NM_012339	NP_036471			transmembrane 4 superfamily member 15							integral to plasma membrane|membrane fraction					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71447100	71447101	+	IGR	DEL	TG	-	-	rs112365811		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71447100_71447101delTG								C10orf35 (53753 upstream) : COL13A1 (114543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	71543262	71543263	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71543262_71543263delAG								C10orf35 (149915 upstream) : COL13A1 (18381 downstream)																																			---	---	---	---
COL13A1	1305	broad.mit.edu	37	10	71575643	71575644	+	Intron	INS	-	A	A	rs148958172	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71575643_71575644insA	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron	NM_005203	NP_005194			alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	72011377	72011377	+	IGR	DEL	T	-	-	rs35050111		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72011377delT								PPA1 (18187 upstream) : NPFFR1 (3337 downstream)																																			---	---	---	---
SGPL1	8879	broad.mit.edu	37	10	72609336	72609336	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72609336delG	uc001jrm.2	+							NM_003901	NP_003892			sphingosine-1-phosphate lyase 1						apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	72720335	72720338	+	IGR	DEL	TGTA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72720335_72720338delTGTA								PCBD1 (71794 upstream) : UNC5B (251960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	73645816	73645817	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73645816_73645817insT								PSAP (34734 upstream) : CHST3 (78303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	74053184	74053186	+	IGR	DEL	TGT	-	-	rs148204257		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74053184_74053186delTGT								DDIT4 (17387 upstream) : DNAJB12 (39402 downstream)																																			---	---	---	---
ADK	132	broad.mit.edu	37	10	76059810	76059811	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76059810_76059811insT	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
ADK	132	broad.mit.edu	37	10	76412524	76412524	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76412524delA	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron|ADK_uc001jwl.2_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	77457593	77457596	+	IGR	DEL	GTGT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77457593_77457596delGTGT								MIR606 (145282 upstream) : C10orf11 (84923 downstream)																																			---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	77664234	77664235	+	Intron	INS	-	A	A	rs78361409		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77664234_77664235insA	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	77728304	77728304	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77728304delT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	77805897	77805898	+	Intron	INS	-	T	T	rs140673926	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77805897_77805898insT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	77877456	77877456	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77877456delG	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	78058915	78058916	+	Intron	DEL	GT	-	-	rs61439349		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78058915_78058916delGT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79196716	79196717	+	Intron	DEL	AC	-	-	rs147446936		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79196716_79196717delAC	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	80257903	80257904	+	Intron	INS	-	TTA	TTA	rs66737449		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80257903_80257904insTTA	uc010qlp.1	+											SubName: Full=cDNA FLJ57363;																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	81996795	81996796	+	IGR	INS	-	ACAT	ACAT	rs10671039		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81996795_81996796insACAT								ANXA11 (31362 upstream) : MAT1A (34781 downstream)																																			---	---	---	---
SH2D4B	387694	broad.mit.edu	37	10	82391513	82391514	+	Intron	INS	-	ACTT	ACTT	rs149706741	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82391513_82391514insACTT	uc001kck.1	+						SH2D4B_uc001kcl.1_Intron|SH2D4B_uc001kcm.1_Intron	NM_207372	NP_997255			SH2 domain containing 4B isoform 1												0			Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	86535364	86535365	+	IGR	INS	-	TTC	TTC	rs72828679		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86535364_86535365insTTC								FAM190B (257088 upstream) : GRID1 (823947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86585000	86585001	+	IGR	INS	-	TG	TG	rs147105205	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86585000_86585001insTG								FAM190B (306724 upstream) : GRID1 (774311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86599190	86599190	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86599190delG								FAM190B (320914 upstream) : GRID1 (760122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86965824	86965824	+	IGR	DEL	C	-	-	rs113901555		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86965824delC								FAM190B (687548 upstream) : GRID1 (393488 downstream)																																			---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90217374	90217374	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90217374delT	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
LOC100188947	100188947	broad.mit.edu	37	10	93340894	93340895	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93340894_93340895delTG	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0																		---	---	---	---
EXOC6	54536	broad.mit.edu	37	10	94634314	94634315	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94634314_94634315delTG	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc001kif.3_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron	NM_019053	NP_061926			SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)																---	---	---	---
EXOC6	54536	broad.mit.edu	37	10	94658187	94658187	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94658187delA	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc001kif.3_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron	NM_019053	NP_061926			SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)																---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95168294	95168295	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95168294_95168295insA	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc001kip.3_Intron|MYOF_uc009xuf.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	95802171	95802171	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95802171delT	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron	NM_016341	NP_057425			phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	101083764	101083765	+	IGR	DEL	AA	-	-	rs151014065		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101083764_101083765delAA								HPSE2 (88145 upstream) : CNNM1 (5091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	102402876	102402876	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102402876delA								HIF1AN (89196 upstream) : PAX2 (102592 downstream)																																			---	---	---	---
INA	9118	broad.mit.edu	37	10	105038661	105038662	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105038661_105038662delCA	uc001kws.2	+						uc001kwr.2_5'Flank|INA_uc009xxj.2_Intron	NM_032727	NP_116116			internexin neuronal intermediate filament						cell differentiation|nervous system development	neurofilament	structural constituent of cytoskeleton			ovary(1)|breast(1)	2				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)														---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106850878	106850885	+	Intron	DEL	TCCCTCCT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106850878_106850885delTCCCTCCT	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107913376	107913377	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107913376_107913377delTG	uc001kyk.2	+											Homo sapiens cDNA clone IMAGE:4826823.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	108278653	108278654	+	IGR	DEL	TG	-	-	rs72220286		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108278653_108278654delTG								None (None upstream) : SORCS1 (54768 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108383549	108383549	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108383549delA	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	110445586	110445586	+	IGR	DEL	G	-	-	rs144990096		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110445586delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113138492	113138493	+	IGR	INS	-	T	T	rs79216161		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113138492_113138493insT								ADRA2A (297832 upstream) : GPAM (771129 downstream)																																			---	---	---	---
ACSL5	51703	broad.mit.edu	37	10	114161706	114161707	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114161706_114161707delTC	uc001kzs.2	+						ACSL5_uc001kzt.2_Intron|ACSL5_uc001kzu.2_Intron|ACSL5_uc009xxz.2_Intron	NM_203379	NP_976313			acyl-CoA synthetase long-chain family member 5						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(2)|skin(1)	3		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)														---	---	---	---
VTI1A	143187	broad.mit.edu	37	10	114444196	114444197	+	Intron	INS	-	T	T	rs148266275		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114444196_114444197insT	uc001kzy.2	+						VTI1A_uc001kzz.2_Intron	NM_145206	NP_660207			SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)														---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114828658	114828659	+	Intron	INS	-	T	T	rs141539840		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114828658_114828659insT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	115074856	115074863	+	IGR	DEL	CTGTTGAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115074856_115074863delCTGTTGAC								TCF7L2 (147422 upstream) : HABP2 (237915 downstream)																																			---	---	---	---
FAM160B1	57700	broad.mit.edu	37	10	116634872	116634872	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116634872delC	uc001lcc.2	+							NM_001135051	NP_001128523			hypothetical protein LOC57700 isoform b											lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	116766635	116766635	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116766635delA								TRUB1 (29197 upstream) : ATRNL1 (86489 downstream)																																			---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117831584	117831584	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117831584delT	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255			GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117955704	117955705	+	Intron	INS	-	A	A	rs138710936		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117955704_117955705insA	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255			GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
KIAA1598	57698	broad.mit.edu	37	10	118659058	118659061	+	Intron	DEL	GAGA	-	-	rs150198964	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118659058_118659061delGAGA	uc009xyw.2	-						KIAA1598_uc001lcz.3_Intron|KIAA1598_uc010qso.1_Intron|KIAA1598_uc001lcy.3_Intron	NM_001127211	NP_001120683			shootin1 isoform a						axon guidance	axon					0				all cancers(201;0.00494)														---	---	---	---
KIAA1598	57698	broad.mit.edu	37	10	118780011	118780011	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118780011delA	uc010qsq.1	-							NM_018330	NP_060800			shootin1 isoform b						axon guidance	axon					0				all cancers(201;0.00494)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	118926390	118926391	+	IGR	INS	-	T	T	rs71929025		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118926390_118926391insT								VAX1 (28578 upstream) : KCNK18 (30609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	118987855	118987858	+	IGR	DEL	TCCT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118987855_118987858delTCCT								KCNK18 (18046 upstream) : SLC18A2 (12858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120666280	120666280	+	IGR	DEL	A	-	-	rs111690506		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120666280delA								C10orf46 (151522 upstream) : NANOS1 (122948 downstream)																																			---	---	---	---
SFXN4	119559	broad.mit.edu	37	10	120924286	120924286	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120924286delA	uc001leb.2	-						SFXN4_uc001ldz.2_Intron|SFXN4_uc001lea.2_Intron	NM_213649	NP_998814			sideroflexin 4						iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)														---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121096796	121096796	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121096796delC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121144217	121144217	+	Intron	DEL	A	-	-	rs11297190		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121144217delA	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	121936479	121936480	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121936479_121936480delGT								SEC23IP (235234 upstream) : PPAPDC1A (279986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122521257	122521258	+	IGR	DEL	GA	-	-	rs2997253	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122521257_122521258delGA								PPAPDC1A (171890 upstream) : WDR11 (89437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122999501	122999501	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122999501delA								WDR11 (330466 upstream) : FGFR2 (238344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123084678	123084679	+	IGR	INS	-	A	A	rs148832871	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123084678_123084679insA								WDR11 (415643 upstream) : FGFR2 (153166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123113762	123113763	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123113762_123113763insA								WDR11 (444727 upstream) : FGFR2 (124082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123361742	123361745	+	IGR	DEL	AAAC	-	-	rs113793069		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123361742_123361745delAAAC								FGFR2 (3770 upstream) : ATE1 (140881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123374937	123374938	+	IGR	INS	-	TTTTT	TTTTT	rs144724674	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123374937_123374938insTTTTT								FGFR2 (16965 upstream) : ATE1 (127688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123490130	123490131	+	IGR	INS	-	T	T	rs150234711		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123490130_123490131insT								FGFR2 (132158 upstream) : ATE1 (12495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	124488368	124488368	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124488368delA								C10orf120 (29030 upstream) : FLJ46361 (27842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	125336190	125336190	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125336190delA								BUB3 (411304 upstream) : GPR26 (89681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	126004807	126004808	+	IGR	INS	-	AT	AT	rs140456722	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126004807_126004808insAT								CHST15 (151601 upstream) : OAT (81064 downstream)																																			---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126693049	126693049	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126693049delT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lid.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126834490	126834490	+	Intron	DEL	T	-	-	rs112934983		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126834490delT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
C10orf122	387718	broad.mit.edu	37	10	127284767	127284767	+	Intron	DEL	G	-	-	rs111672116		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127284767delG	uc001lij.2	-							NM_001128202	NP_001121674			hypothetical protein LOC387718												0																		---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127583786	127583787	+	Intron	INS	-	CTTT	CTTT	rs148039570		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127583786_127583787insCTTT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
C10orf90	118611	broad.mit.edu	37	10	128196607	128196607	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128196607delA	uc001ljq.2	-						C10orf90_uc001ljp.2_5'Flank|C10orf90_uc010qum.1_Intron|C10orf90_uc009yao.2_Intron|C10orf90_uc001ljs.1_Intron	NM_001004298	NP_001004298			hypothetical protein LOC118611											ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129059527	129059528	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129059527_129059528delGT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129060155	129060156	+	Intron	DEL	TG	-	-	rs151281435		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129060155_129060156delTG	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	129256421	129256421	+	IGR	DEL	T	-	-	rs74914126		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129256421delT								DOCK1 (5640 upstream) : NPS (91192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129940273	129940273	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129940273delT								MKI67 (15805 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130402596	130402596	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130402596delA								MKI67 (478128 upstream) : MGMT (862858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	131893253	131893254	+	Intron	INS	-	A	A	rs140600120	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131893253_131893254insA	uc010qus.1	-											Homo sapiens cDNA FLJ36799 fis, clone ADRGL2007357.																														---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	132905988	132905989	+	Intron	DEL	AT	-	-	rs113135784		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132905988_132905989delAT	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	133121397	133121397	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133121397delA								TCERG1L (11413 upstream) : PPP2R2D (626563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133464926	133464926	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133464926delA								TCERG1L (354942 upstream) : PPP2R2D (283034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133574886	133574902	+	IGR	DEL	GATCCTCGGCACTGAGT	-	-	rs76385612		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133574886_133574902delGATCCTCGGCACTGAGT								TCERG1L (464902 upstream) : PPP2R2D (173058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	135453411	135453412	+	IGR	INS	-	AC	AC	rs145083550	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135453411_135453412insAC								FRG2B (13112 upstream) : LOC653544 (36867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	135468451	135468452	+	IGR	INS	-	C	C	rs147271835		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135468451_135468452insC								FRG2B (28152 upstream) : LOC653544 (21827 downstream)																																			---	---	---	---
SCGB1C1	147199	broad.mit.edu	37	11	191868	191869	+	5'Flank	INS	-	C	C	rs151168670		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:191868_191869insC	uc001loa.1	+							NM_145651	NP_663626			secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---
DRD4	1815	broad.mit.edu	37	11	635383	635383	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:635383delA	uc001lqp.1	+							NM_000797	NP_000788			dopamine receptor D4						activation of MAPK activity|adult locomotory behavior|arachidonic acid secretion|behavioral fear response|behavioral response to cocaine|behavioral response to ethanol|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cAMP biosynthetic process|negative regulation of protein secretion|positive regulation of sodium:hydrogen antiporter activity|regulation of dopamine metabolic process|regulation of inhibitory postsynaptic membrane potential|response to amphetamine|response to histamine|social behavior	integral to plasma membrane	dopamine D4 receptor activity|drug binding|potassium channel regulator activity|SH3 domain binding				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Apomorphine(DB00714)|Clozapine(DB00363)|Olanzapine(DB00334)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Ropinirole(DB00268)|Thiethylperazine(DB00372)|Ziprasidone(DB00246)													---	---	---	---
MOB2	81532	broad.mit.edu	37	11	1508928	1508928	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1508928delA	uc010qwz.1	-							NM_053005	NP_443731			HCCA2 protein							nucleus|perinuclear region of cytoplasm	metal ion binding				0																		---	---	---	---
KRTAP5-5	439915	broad.mit.edu	37	11	1648541	1648542	+	5'Flank	INS	-	AC	AC	rs147349395	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1648541_1648542insAC	uc001lty.2	+							NM_001001480	NP_001001480			keratin associated protein 5-5							keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	1752534	1752535	+	IGR	INS	-	AT	AT	rs140162570	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1752534_1752535insAT								KRTAP5-6 (33550 upstream) : CTSD (21450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1752595	1752596	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1752595_1752596delAA								KRTAP5-6 (33611 upstream) : CTSD (21389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1965255	1965256	+	IGR	DEL	AT	-	-	rs144628180		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1965255_1965256delAT								TNNT3 (5320 upstream) : MRPL23 (3246 downstream)																																			---	---	---	---
LOC650368	650368	broad.mit.edu	37	11	3417951	3417951	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3417951delT	uc001lxw.3	+						LOC650368_uc010qxs.1_Intron|LOC650368_uc001lxx.2_Intron|LOC650368_uc001lxy.2_Intron					Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	3586983	3586983	+	IGR	DEL	G	-	-	rs35603289		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3586983delG								LOC650368 (156605 upstream) : TRPC2 (51479 downstream)																																			---	---	---	---
STIM1	6786	broad.mit.edu	37	11	4101631	4101634	+	Intron	DEL	TCTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4101631_4101634delTCTG	uc001lyv.2	+						STIM1_uc009yef.2_Intron|STIM1_uc009yeg.2_Intron	NM_003156	NP_003147			stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)														---	---	---	---
DCHS1	8642	broad.mit.edu	37	11	6663783	6663783	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6663783delG	uc001mem.1	-							NM_003737	NP_003728			dachsous 1 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
STK33	65975	broad.mit.edu	37	11	8443119	8443119	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8443119delT	uc001mgi.1	-						STK33_uc001mgj.1_Intron|STK33_uc001mgk.1_Intron|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron	NM_030906	NP_112168			serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)														---	---	---	---
ST5	6764	broad.mit.edu	37	11	8721612	8721612	+	Intron	DEL	G	-	-	rs111663713		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8721612delG	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbp.1_Intron|ST5_uc009yfs.2_Intron	NM_213618	NP_998783			suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	10329610	10329610	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10329610delA								ADM (687 upstream) : AMPD3 (142258 downstream)																																	OREG0020748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10701944	10701945	+	Intron	INS	-	AAAGA	AAAGA			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10701944_10701945insAAAGA	uc010rcc.1	-						MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron	NM_001100167	NP_001093637			JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11721691	11721692	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11721691_11721692delGA								GALNTL4 (78130 upstream) : USP47 (141278 downstream)																																			---	---	---	---
PARVA	55742	broad.mit.edu	37	11	12431179	12431180	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12431179_12431180insA	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692			parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	12686656	12686657	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12686656_12686657insA								PARVA (135246 upstream) : TEAD1 (9312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13220801	13220801	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13220801delA								RASSF10 (188154 upstream) : ARNTL (78524 downstream)																																			---	---	---	---
PSMA1	5682	broad.mit.edu	37	11	14638441	14638441	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14638441delA	uc001mll.2	-							NM_148976	NP_683877			proteasome alpha 1 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity			upper_aerodigestive_tract(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15067486	15067487	+	IGR	INS	-	A	A	rs145152712	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15067486_15067487insA								CALCA (73654 upstream) : CALCB (27659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15349676	15349677	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15349676_15349677delGT								INSC (80924 upstream) : SOX6 (638319 downstream)																																			---	---	---	---
TSG101	7251	broad.mit.edu	37	11	18529197	18529197	+	Intron	DEL	A	-	-	rs77538217		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18529197delA	uc001mor.2	-						TSG101_uc001mos.1_Intron|TSG101_uc009yhs.1_Intron	NM_006292	NP_006283			tumor susceptibility gene 101						cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	20189066	20189066	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20189066delG								DBX1 (7196 upstream) : HTATIP2 (196165 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	23280788	23280789	+	IGR	INS	-	AGAT	AGAT	rs10694707		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23280788_23280789insAGAT								SVIP (429406 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24071441	24071441	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24071441delA								None (None upstream) : LUZP2 (447115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	27286864	27286865	+	IGR	INS	-	A	A	rs142359287		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27286864_27286865insA								BBOX1 (137510 upstream) : CCDC34 (73196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	28525926	28525926	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28525926delT								METT5D1 (170872 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	28688651	28688652	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28688651_28688652delTG								METT5D1 (333597 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29199317	29199317	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29199317delA								METT5D1 (844263 upstream) : KCNA4 (832449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29491508	29491508	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29491508delA								None (None upstream) : KCNA4 (540258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29802183	29802184	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29802183_29802184insA								None (None upstream) : KCNA4 (229582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	31018018	31018018	+	Intron	DEL	G	-	-	rs71481496		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31018018delG	uc009yjk.1	-						uc009yjl.1_Intron|DCDC1_uc001msu.1_Intron					RecName: Full=Doublecortin domain-containing protein 5;																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	32821302	32821302	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32821302delA								CCDC73 (5115 upstream) : PRRG4 (30187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	33947854	33947854	+	IGR	DEL	A	-	-	rs139599016		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33947854delA								LMO2 (34018 upstream) : CAPRIN1 (125376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	35962069	35962070	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35962069_35962070insG								TRIM44 (131139 upstream) : LDLRAD3 (3542 downstream)																																			---	---	---	---
COMMD9	29099	broad.mit.edu	37	11	36305655	36305657	+	Intron	DEL	CAA	-	-	rs138180702		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36305655_36305657delCAA	uc001mwn.3	-						COMMD9_uc009ykj.2_Intron|COMMD9_uc010rfb.1_Intron	NM_014186	NP_054905			COMM domain containing 9 isoform 1											ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	36765933	36765934	+	IGR	INS	-	A	A	rs10836607	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36765933_36765934insA								C11orf74 (69543 upstream) : None (None downstream)																																	OREG0020896	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	37084429	37084430	+	IGR	INS	-	AA	AA	rs11390347		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37084429_37084430insAA								C11orf74 (388039 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37299641	37299642	+	IGR	INS	-	TG	TG	rs139581344	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37299641_37299642insTG								C11orf74 (603251 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39735694	39735697	+	IGR	DEL	ACAC	-	-	rs10562397		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39735694_39735697delACAC								None (None upstream) : LRRC4C (400056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	41612152	41612152	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41612152delC								LRRC4C (130829 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	41688442	41688442	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41688442delA								LRRC4C (207119 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42578508	42578509	+	IGR	INS	-	ACAC	ACAC	rs150338835	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42578508_42578509insACAC								None (None upstream) : API5 (754996 downstream)																																			---	---	---	---
HSD17B12	51144	broad.mit.edu	37	11	43717221	43717222	+	Intron	INS	-	TCT	TCT	rs145954928	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43717221_43717222insTCT	uc001mxq.3	+						HSD17B12_uc001mxp.2_Intron	NM_016142	NP_057226			hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	44002646	44002647	+	IGR	INS	-	AAAC	AAAC	rs142235852	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44002646_44002647insAAAC								AG2 (37214 upstream) : ACCSL (66884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	44064177	44064177	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44064177delT								AG2 (98745 upstream) : ACCSL (5354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45336102	45336105	+	IGR	DEL	TGTG	-	-	rs140767234		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45336102_45336105delTGTG								SYT13 (28218 upstream) : CHST1 (334322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45586894	45586894	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45586894delC								SYT13 (279010 upstream) : CHST1 (83533 downstream)																																			---	---	---	---
PHF21A	51317	broad.mit.edu	37	11	46033042	46033043	+	Intron	INS	-	A	A	rs75718116		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46033042_46033043insA	uc001ncc.3	-						PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Intron	NM_001101802	NP_001095272			BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	46189113	46189113	+	IGR	DEL	A	-	-	rs71451636		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46189113delA								PHF21A (46128 upstream) : CREB3L1 (110115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	46283364	46283364	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46283364delA								PHF21A (140379 upstream) : CREB3L1 (15864 downstream)																																			---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46568174	46568174	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46568174delA	uc010rgu.1	-						AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219			activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	46950491	46950491	+	IGR	DEL	A	-	-	rs113767085		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46950491delA								LRP4 (10415 upstream) : C11orf49 (7760 downstream)																																			---	---	---	---
C11orf49	79096	broad.mit.edu	37	11	47035937	47035937	+	Intron	DEL	A	-	-	rs76665306		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47035937delA	uc001ndp.2	+						C11orf49_uc001nds.2_Intron|C11orf49_uc001ndq.2_Intron|C11orf49_uc001ndr.2_Intron|C11orf49_uc010rgx.1_Intron|C11orf49_uc010rgy.1_Intron|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018			hypothetical protein LOC79096 isoform 3												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	47451519	47451519	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47451519delT								PSMC3 (3495 upstream) : RAPSN (7796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48854812	48854812	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48854812delA								OR4A47 (343540 upstream) : FOLH1 (313376 downstream)																																			---	---	---	---
LOC440040	440040	broad.mit.edu	37	11	49729300	49729300	+	Intron	DEL	C	-	-	rs67084465		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49729300delC	uc010rhy.1	+						LOC440040_uc009ymb.2_Intron	NR_027044				SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	49839754	49839755	+	IGR	INS	-	C	C	rs145191242		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49839754_49839755insC								LOC440040 (7787 upstream) : OR4C13 (134220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	49848837	49848838	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49848837_49848838delGA								LOC440040 (16870 upstream) : OR4C13 (125137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50669139	50669139	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50669139delC								LOC646813 (289336 upstream) : OR4A5 (742309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55446699	55446699	+	IGR	DEL	T	-	-	rs35514616		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55446699delT								OR4C6 (12541 upstream) : OR5D13 (94215 downstream)																																			---	---	---	---
SERPING1	710	broad.mit.edu	37	11	57377055	57377055	+	Intron	DEL	A	-	-	rs76687969		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57377055delA	uc001nkp.1	+						SERPING1_uc001nkq.1_Intron|SERPING1_uc010rju.1_Intron|SERPING1_uc010rjv.1_Intron|SERPING1_uc001nkr.1_Intron|SERPING1_uc009ymi.1_Intron|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Intron	NM_000062	NP_000053			serpin peptidase inhibitor, clade G, member 1						blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1														Hereditary_Angioedema				---	---	---	---
OR9Q1	219956	broad.mit.edu	37	11	57928844	57928845	+	Intron	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57928844_57928845delAG	uc001nmj.2	+							NM_001005212	NP_001005212			olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	59511820	59511820	+	IGR	DEL	A	-	-	rs10708122		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59511820delA								OR10V1 (30502 upstream) : STX3 (11069 downstream)																																			---	---	---	---
CD6	923	broad.mit.edu	37	11	60768671	60768671	+	Intron	DEL	T	-	-	rs149979736		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60768671delT	uc001nqq.2	+						CD6_uc009yni.2_Intron|CD6_uc009ynj.2_Intron|CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716			CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1																		---	---	---	---
GPR137	56834	broad.mit.edu	37	11	64038854	64038855	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64038854_64038855delCA	uc009ypj.1	+						BAD_uc001nzd.2_Intron|BAD_uc001nzc.2_Intron	NM_020155	NP_064540			G protein-coupled receptor 137							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	65702242	65702242	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65702242delA								DRAP1 (13211 upstream) : TSGA10IP (10873 downstream)																																			---	---	---	---
KDM2A	22992	broad.mit.edu	37	11	66903452	66903452	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66903452delT	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron	NM_012308	NP_036440			F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
C11orf24	53838	broad.mit.edu	37	11	68036580	68036580	+	Intron	DEL	T	-	-	rs147773525		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68036580delT	uc001onr.3	-						C11orf24_uc001ons.2_5'Flank	NM_022338	NP_071733			hypothetical protein LOC53838 precursor							integral to membrane					0																		---	---	---	---
LRP5	4041	broad.mit.edu	37	11	68132499	68132499	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68132499delC	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326			low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	69799084	69799085	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69799084_69799085delGA								FGF3 (164892 upstream) : ANO1 (125323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69863613	69863614	+	IGR	INS	-	CTCA	CTCA			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69863613_69863614insCTCA								FGF3 (229421 upstream) : ANO1 (60794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	70036032	70036033	+	IGR	DEL	TA	-	-	rs11235501		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70036032_70036033delTA								ANO1 (383 upstream) : FADD (13236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71308924	71308924	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71308924delA								KRTAP5-11 (15003 upstream) : FAM86C (189633 downstream)																																			---	---	---	---
PDE2A	5138	broad.mit.edu	37	11	72288803	72288809	+	Intron	DEL	AGTCAGG	-	-	rs147098484		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72288803_72288809delAGTCAGG	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590			phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)													---	---	---	---
FCHSD2	9873	broad.mit.edu	37	11	72662312	72662312	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72662312delA	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639			FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)															---	---	---	---
MRPL48	51642	broad.mit.edu	37	11	73504110	73504113	+	Intron	DEL	TATT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73504110_73504113delTATT	uc001ouh.3	+						MRPL48_uc009ytt.2_Intron|MRPL48_uc010rri.1_Intron|MRPL48_uc009ytu.2_Intron	NM_016055	NP_057139			mitochondrial ribosomal protein L48 precursor						translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0																		---	---	---	---
LIPT2	387787	broad.mit.edu	37	11	74203594	74203595	+	Intron	INS	-	A	A	rs72521530		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74203594_74203595insA	uc010rrk.1	-						uc001ove.2_5'Flank	NM_001144869	NP_001138341			lipoyl(octanoyl) transferase precursor						lipoate biosynthetic process|protein modification process	mitochondrion	ligase activity|lipoyl(octanoyl) transferase activity|octanoyltransferase activity				0																		---	---	---	---
RNF169	254225	broad.mit.edu	37	11	74529447	74529447	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74529447delT	uc001ovl.3	+						XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108			ring finger protein 169								zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	74719603	74719603	+	5'Flank	DEL	T	-	-	rs5792678		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74719603delT	uc010rrm.1	+						uc001ovx.1_5'Flank|uc010rrn.1_5'Flank|uc001ovz.1_5'Flank					DQ588214																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	80934407	80934408	+	IGR	INS	-	GT	GT	rs145549275	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80934407_80934408insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81253630	81253630	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81253630delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81468307	81468309	+	IGR	DEL	AGG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81468307_81468309delAGG								None (None upstream) : FAM181B (974744 downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84902329	84902329	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84902329delT	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
TMEM135	65084	broad.mit.edu	37	11	86752326	86752326	+	Intron	DEL	T	-	-	rs36088444		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86752326delT	uc001pch.2	+						TMEM135_uc010rtt.1_Intron|TMEM135_uc001pci.2_Intron|TMEM135_uc001pcg.1_Intron	NM_022918	NP_075069			transmembrane protein 135							integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89295651	89295652	+	Intron	INS	-	TC	TC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89295651_89295652insTC	uc009yvq.2	-							NM_001143837	NP_001137309			NADPH oxidase 4 isoform c						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	90500806	90500808	+	IGR	DEL	AAC	-	-	rs36095305		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90500806_90500808delAAC								CHORDC1 (544274 upstream) : MIR1261 (101481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95110040	95110043	+	IGR	DEL	CTTT	-	-	rs117683436	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110040_95110043delCTTT								SESN3 (144335 upstream) : FAM76B (392063 downstream)																																			---	---	---	---
CEP57	9702	broad.mit.edu	37	11	95553068	95553069	+	Intron	INS	-	TTG	TTG	rs141988347	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95553068_95553069insTTG	uc001pfp.1	+						CEP57_uc001pfo.1_Intron|CEP57_uc010ruh.1_Intron|CEP57_uc010rui.1_Intron|CEP57_uc009ywn.1_Intron|CEP57_uc001pfq.1_Intron|CEP57_uc001pfr.1_Intron	NM_014679	NP_055494			translokin						fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)												Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	11	96494732	96494733	+	IGR	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96494732_96494733insG								JRKL (368005 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96852341	96852341	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96852341delA								JRKL (725614 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97449293	97449293	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97449293delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97522308	97522309	+	IGR	INS	-	C	C	rs146571048	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97522308_97522309insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97749907	97749910	+	IGR	DEL	GAGA	-	-	rs35498608		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97749907_97749910delGAGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98455602	98455602	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98455602delT								None (None upstream) : CNTN5 (436269 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99751165	99751165	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99751165delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99862200	99862203	+	Intron	DEL	AAAC	-	-	rs35179064		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99862200_99862203delAAAC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
GRIA4	2893	broad.mit.edu	37	11	105786782	105786799	+	Intron	DEL	CGCCTGTAATCCCAGCTA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105786782_105786799delCGCCTGTAATCCCAGCTA	uc001pix.2	+						GRIA4_uc001piw.2_Intron	NM_000829	NP_000820			glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)													---	---	---	---
GUCY1A2	2977	broad.mit.edu	37	11	106558684	106558684	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106558684delA	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846			guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	108867041	108867041	+	IGR	DEL	T	-	-	rs112023016		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108867041delT								DDX10 (55395 upstream) : C11orf87 (425834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	110801014	110801019	+	IGR	DEL	ACACAC	-	-	rs72468937		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110801014_110801019delACACAC								ARHGAP20 (217102 upstream) : C11orf53 (325688 downstream)																																			---	---	---	---
BTG4	54766	broad.mit.edu	37	11	111359875	111359876	+	Intron	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111359875_111359876insG	uc001plj.2	-							NM_017589	NP_060059			B-cell translocation gene 4						cell cycle arrest|negative regulation of cell proliferation|neuron differentiation						0		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)														---	---	---	---
DIXDC1	85458	broad.mit.edu	37	11	111822593	111822594	+	Intron	INS	-	T	T	rs35155467		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111822593_111822594insT	uc001pml.2	+						DIXDC1_uc001pmj.2_Intron|DIXDC1_uc001pmk.2_Intron	NM_001037954	NP_001033043			DIX domain containing 1 isoform a						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytosol|focal adhesion	actin binding|gamma-tubulin binding|signal transducer activity			ovary(1)	1		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	112611033	112611033	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112611033delT								PTS (470356 upstream) : NCAM1 (220962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	112772418	112772418	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112772418delT								PTS (631741 upstream) : NCAM1 (59577 downstream)																																			---	---	---	---
USP28	57646	broad.mit.edu	37	11	113689604	113689605	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113689604_113689605insA	uc001poh.2	-						USP28_uc001pog.2_Intron|USP28_uc010rwy.1_Intron|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Intron	NM_020886	NP_065937			ubiquitin specific protease 28						cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)														---	---	---	---
USP28	57646	broad.mit.edu	37	11	113713308	113713309	+	Intron	INS	-	A	A	rs74383535		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113713308_113713309insA	uc001poh.2	-						USP28_uc010rwy.1_Intron|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Intron|USP28_uc010rwz.1_Intron	NM_020886	NP_065937			ubiquitin specific protease 28						cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)														---	---	---	---
HTR3A	3359	broad.mit.edu	37	11	113845072	113845073	+	5'Flank	INS	-	A	A	rs33982341		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113845072_113845073insA	uc010rxb.1	+						HTR3A_uc010rxa.1_5'Flank|HTR3A_uc009yyx.2_5'Flank	NM_213621	NP_998786			5-hydroxytryptamine (serotonin) receptor 3A						digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	115008147	115008147	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115008147delT								FAM55B (430495 upstream) : CADM1 (31806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	115615747	115615747	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115615747delT								CADM1 (240506 upstream) : None (None downstream)																																			---	---	---	---
CEP164	22897	broad.mit.edu	37	11	117216352	117216352	+	Intron	DEL	G	-	-	rs57315779		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117216352delG	uc001prc.2	+						CEP164_uc001prb.2_Intron|CEP164_uc001prd.2_Intron|CEP164_uc010rxj.1_Intron|CEP164_uc010rxk.1_Intron	NM_014956	NP_055771			centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120575942	120575942	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120575942delT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
LOC399959	399959	broad.mit.edu	37	11	122220841	122220842	+	Intron	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122220841_122220842insTT	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	122328035	122328035	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122328035delA								LOC399959 (89568 upstream) : UBASH3B (198363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122356719	122356720	+	IGR	INS	-	CT	CT	rs150092995	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122356719_122356720insCT								LOC399959 (118252 upstream) : UBASH3B (169678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122837873	122837874	+	IGR	DEL	AC	-	-	rs72364161		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122837873_122837874delAC								C11orf63 (7444 upstream) : BSX (10484 downstream)																																			---	---	---	---
OR10G7	390265	broad.mit.edu	37	11	123910147	123910148	+	5'Flank	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123910147_123910148delAC	uc001pzq.1	-							NM_001004463	NP_001004463			olfactory receptor, family 10, subfamily G,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124459129	124459129	+	IGR	DEL	G	-	-	rs58705413		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124459129delG								OR8A1 (18185 upstream) : PANX3 (22324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	124716611	124716611	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124716611delT								C11orf61 (46312 upstream) : ROBO3 (18671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	125414191	125414192	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125414191_125414192insTT								FEZ1 (48068 upstream) : EI24 (25106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	127205278	127205279	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127205278_127205279delTG	uc001qeh.2	+											Homo sapiens cDNA clone IMAGE:4794631.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	128097400	128097400	+	IGR	DEL	T	-	-	rs35983954		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128097400delT								None (None upstream) : ETS1 (231256 downstream)																																			---	---	---	---
ST14	6768	broad.mit.edu	37	11	130040750	130040750	+	Intron	DEL	T	-	-	rs75405909		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130040750delT	uc001qfw.2	+							NM_021978	NP_068813			matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)													---	---	---	---
NTM	50863	broad.mit.edu	37	11	131878633	131878634	+	Intron	INS	-	T	T	rs2517994		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131878633_131878634insT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132664995	132664996	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132664995_132664996delAC	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132735967	132735967	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132735967delA	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	133467279	133467280	+	IGR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133467279_133467280delAG								OPCML (64876 upstream) : SPATA19 (243237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	134407503	134407503	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134407503delT								B3GAT1 (125691 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	134914203	134914204	+	IGR	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134914203_134914204delTC								B3GAT1 (632391 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	134922626	134922626	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134922626delT								B3GAT1 (640814 upstream) : None (None downstream)																																			---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1203581	1203582	+	Intron	INS	-	T	T	rs66474750		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1203581_1203582insT	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1402620	1402622	+	Intron	DEL	AAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1402620_1402622delAAC	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
WNT5B	81029	broad.mit.edu	37	12	1704349	1704349	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1704349delC	uc009zdq.2	+							NM_032642	NP_116031			wingless-type MMTV integration site family,						angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	2126827	2126827	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2126827delT								DCP1B (13150 upstream) : CACNA1C (35589 downstream)																																			---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2167698	2167698	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2167698delA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	2854989	2854989	+	IGR	DEL	C	-	-	rs144447589	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2854989delC								CACNA1C (47874 upstream) : FKBP4 (49119 downstream)																																			---	---	---	---
TULP3	7289	broad.mit.edu	37	12	3002796	3002796	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3002796delA	uc010seh.1	+						TULP3_uc010sef.1_Intron|TULP3_uc009zec.1_Intron|TULP3_uc010seg.1_Intron|TULP3_uc001qlj.2_Intron|TULP3_uc010sei.1_Intron	NM_003324	NP_003315			tubby like protein 3 isoform 1						G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	3400416	3400417	+	IGR	INS	-	T	T	rs67993515		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3400416_3400417insT								TSPAN9 (4687 upstream) : PRMT8 (90098 downstream)																																			---	---	---	---
C12orf4	57102	broad.mit.edu	37	12	4638063	4638066	+	Intron	DEL	ACAC	-	-	rs141774281	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4638063_4638066delACAC	uc001qms.2	-						C12orf4_uc001qmt.2_Intron	NM_020374	NP_065107			hypothetical protein LOC57102												0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	5038381	5038382	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5038381_5038382delTT								KCNA1 (10961 upstream) : KCNA5 (114703 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5767536	5767538	+	Intron	DEL	ATC	-	-	rs71445664		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5767536_5767538delATC	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	6290680	6290681	+	IGR	INS	-	TG	TG	rs144655277	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6290680_6290681insTG								VWF (56844 upstream) : CD9 (18192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	6813534	6813534	+	IGR	DEL	T	-	-	rs63018061		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6813534delT								C12orf53 (3722 upstream) : COPS7A (19616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7719996	7719996	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7719996delC								CD163 (63582 upstream) : APOBEC1 (82001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	8270667	8270667	+	IGR	DEL	A	-	-	rs66470455		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8270667delA								NECAP1 (20294 upstream) : CLEC4A (5561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9193383	9193383	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9193383delA								KLRG1 (30045 upstream) : LOC144571 (24390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	11494267	11494268	+	IGR	INS	-	AG	AG	rs140006096	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11494267_11494268insAG								PRB4 (30901 upstream) : PRB1 (10489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	11726773	11726774	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11726773_11726774insA								PRB2 (178275 upstream) : ETV6 (76014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	14879802	14879802	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14879802delC								GUCY2C (30283 upstream) : HIST4H4 (41132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	15222543	15222543	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15222543delC								PDE6H (87746 upstream) : RERG (38175 downstream)																																			---	---	---	---
PIK3C2G	5288	broad.mit.edu	37	12	18501264	18501265	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18501264_18501265delGT	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561			phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)																---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21168393	21168393	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21168393delA	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_5'Flank					SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
ST8SIA1	6489	broad.mit.edu	37	12	22401258	22401259	+	Intron	INS	-	T	T	rs149531833	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22401258_22401259insT	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025			alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24469492	24469495	+	Intron	DEL	GAAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24469492_24469495delGAAG	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
CASC1	55259	broad.mit.edu	37	12	25317360	25317360	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25317360delT	uc001rgl.2	-						CASC1_uc001rgk.2_Intron|CASC1_uc001rgm.3_Intron|CASC1_uc001rgj.2_Intron|CASC1_uc010sje.1_Intron|CASC1_uc010sjf.1_Intron|CASC1_uc010sjg.1_Intron|CASC1_uc010sjh.1_Intron	NM_001082973	NP_001076442			cancer susceptibility candidate 1 isoform b											ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	26078135	26078135	+	IGR	DEL	A	-	-	rs75082036		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26078135delA								IFLTD1 (276647 upstream) : RASSF8 (33834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	26283832	26283832	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26283832delT								BHLHE41 (5829 upstream) : SSPN (64437 downstream)																																			---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26718387	26718387	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26718387delA	uc001rhg.2	-							NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	28830672	28830672	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28830672delT								CCDC91 (127574 upstream) : FAR2 (471560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	28926147	28926148	+	IGR	DEL	TG	-	-	rs140225148		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28926147_28926148delTG								CCDC91 (223049 upstream) : FAR2 (376084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	29122985	29122986	+	IGR	INS	-	TTG	TTG	rs145484400	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29122985_29122986insTTG								CCDC91 (419887 upstream) : FAR2 (179246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31956269	31956270	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31956269_31956270delAA								H3F3C (11094 upstream) : C12orf35 (156083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32248199	32248199	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32248199delC								C12orf35 (102168 upstream) : BICD1 (11986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32256892	32256893	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32256892_32256893delAA								C12orf35 (110861 upstream) : BICD1 (3292 downstream)																																			---	---	---	---
BICD1	636	broad.mit.edu	37	12	32293434	32293434	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32293434delG	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
BICD1	636	broad.mit.edu	37	12	32312224	32312224	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32312224delT	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	34125520	34125520	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34125520delA								SYT10 (532766 upstream) : ALG10 (49696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38054178	38054178	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38054178delA								None (None upstream) : ALG10B (656379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38125297	38125297	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38125297delC								None (None upstream) : ALG10B (585260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38783239	38783240	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38783239_38783240insA								ALG10B (59712 upstream) : CPNE8 (262762 downstream)																																			---	---	---	---
C12orf40	283461	broad.mit.edu	37	12	40111774	40111774	+	Intron	DEL	T	-	-	rs34302141		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40111774delT	uc001rmc.2	+						C12orf40_uc009zjv.1_Intron	NM_001031748	NP_001026918			hypothetical protein LOC283461											ovary(6)	6																		---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42690102	42690102	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42690102delA	uc001rmy.2	+							NM_201439	NP_958847			periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	44805487	44805488	+	IGR	DEL	CA	-	-	rs72226041		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44805487_44805488delCA								TMEM117 (21947 upstream) : NELL2 (96570 downstream)																																			---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45068200	45068200	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45068200delG	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580			NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45162767	45162767	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45162767delT	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580			NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45294767	45294768	+	Intron	INS	-	CAAAA	CAAAA	rs140014427	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45294767_45294768insCAAAA	uc010sla.1	-							NM_001145110	NP_001138582			NEL-like protein 2 isoform d						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	46821109	46821109	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46821109delA								SLC38A2 (54464 upstream) : SLC38A4 (337435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47102179	47102180	+	IGR	INS	-	TG	TG	rs143818215	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47102179_47102180insTG								SLC38A2 (335534 upstream) : SLC38A4 (56364 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47233802	47233802	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47233802delA								SLC38A4 (14022 upstream) : AMIGO2 (235689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47769629	47769630	+	IGR	INS	-	A	A	rs147878493	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47769629_47769630insA								FAM113B (139188 upstream) : RPAP3 (286086 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47875401	47875401	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47875401delG								FAM113B (244960 upstream) : RPAP3 (180315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	48226900	48226901	+	IGR	DEL	GT	-	-	rs62984061		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48226900_48226901delGT								HDAC7 (13137 upstream) : VDR (8421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	48652999	48652999	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48652999delT								OR10AD1 (55924 upstream) : H1FNT (69764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	49694631	49694632	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49694631_49694632delTT								PRPH (2151 upstream) : TROAP (22339 downstream)																																			---	---	---	---
SPATS2	65244	broad.mit.edu	37	12	49854238	49854239	+	Intron	INS	-	A	A	rs144252136	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49854238_49854239insA	uc001rud.2	+						SPATS2_uc001ruc.2_Intron|SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron|SPATS2_uc001rug.2_5'Flank	NM_023071	NP_075559			spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1																		---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50633414	50633415	+	Intron	DEL	CT	-	-	rs139787054		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50633414_50633415delCT	uc001rwj.3	-						LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50648830	50648831	+	Intron	INS	-	A	A	rs141016271	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50648830_50648831insA	uc001rwj.3	-						LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ATF1	466	broad.mit.edu	37	12	51201595	51201596	+	Intron	DEL	TG	-	-	rs60898769		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51201595_51201596delTG	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162			activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329								T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								---	---	---	---
TFCP2	7024	broad.mit.edu	37	12	51502069	51502069	+	Intron	DEL	A	-	-	rs75142023		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51502069delA	uc001rxw.2	-						TFCP2_uc001rxv.1_Intron|TFCP2_uc009zlx.1_Intron|TFCP2_uc001rxx.2_Intron|TFCP2_uc009zly.1_Intron	NM_005653	NP_005644			transcription factor CP2						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51786838	51786841	+	Intron	DEL	CTCT	-	-	rs139179142		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51786838_51786841delCTCT	uc001ryo.2	+						GALNT6_uc001ryl.1_5'Flank|GALNT6_uc010snh.1_5'Flank|SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryp.1_Intron	NM_001039960	NP_001035049			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51857902	51857902	+	Intron	DEL	C	-	-	rs35905015		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51857902delC	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	53145360	53145360	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53145360delA								KRT77 (48113 upstream) : KRT76 (16580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	53368487	53368498	+	IGR	DEL	TCTCTCTCTCTC	-	-	rs67975208		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53368487_53368498delTCTCTCTCTCTC								KRT18 (21803 upstream) : EIF4B (31564 downstream)																																			---	---	---	---
AMHR2	269	broad.mit.edu	37	12	53817077	53817078	+	5'Flank	DEL	AA	-	-	rs72414612		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53817077_53817078delAA	uc001scx.1	+						AMHR2_uc009zmy.1_5'Flank	NM_020547	NP_065434			anti-Mullerian hormone receptor, type II isoform						Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				---	---	---	---
ATF7	11016	broad.mit.edu	37	12	54016687	54016687	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54016687delT	uc001sdz.2	-						ATF7_uc010sok.1_Intron|ATF7_uc010sol.1_Intron|ATF7_uc001sea.3_Intron|ATF7_uc001seb.3_Intron	NM_006856	NP_006847			activating transcription factor 7 isoform 2						interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	54879103	54879103	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54879103delA								GTSF1 (11717 upstream) : NCKAP1L (12392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	55197915	55197915	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55197915delT								DCD (155766 upstream) : MUCL1 (50384 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	55455929	55455929	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55455929delC								NEUROD4 (32129 upstream) : OR9K2 (67624 downstream)																																			---	---	---	---
SMARCC2	6601	broad.mit.edu	37	12	56572454	56572474	+	Intron	DEL	AAAGGGTCAGAGTTTTGAACA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56572454_56572474delAAAGGGTCAGAGTTTTGAACA	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)															---	---	---	---
R3HDM2	22864	broad.mit.edu	37	12	57751247	57751248	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57751247_57751248insA	uc001snt.2	-						R3HDM2_uc001sns.2_Intron|R3HDM2_uc009zpo.1_Intron	NM_014925	NP_055740			R3H domain containing 2							nucleus	nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58581470	58581471	+	IGR	INS	-	A	A	rs142544388	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58581470_58581471insA								XRCC6BP1 (230419 upstream) : LRIG3 (684467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58945860	58945860	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58945860delA								XRCC6BP1 (594809 upstream) : LRIG3 (320078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59918315	59918316	+	IGR	INS	-	T	T	rs138992630		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59918315_59918316insT								LRIG3 (604053 upstream) : SLC16A7 (71532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61554072	61554073	+	IGR	INS	-	AC	AC	rs142140817	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61554072_61554073insAC								None (None upstream) : FAM19A2 (547970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61969758	61969760	+	IGR	DEL	TTG	-	-	rs34826314		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61969758_61969760delTTG								None (None upstream) : FAM19A2 (132283 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62482662	62482665	+	Intron	DEL	TCTC	-	-	rs35124773		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62482662_62482665delTCTC	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63361405	63361406	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63361405_63361406delTT								PPM1H (32490 upstream) : AVPR1A (178810 downstream)																																			---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	67000773	67000774	+	Intron	DEL	GA	-	-	rs111313476		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67000773_67000774delGA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	67614190	67614190	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67614190delT								GRIP1 (416296 upstream) : CAND1 (48871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	67986222	67986226	+	IGR	DEL	GGAAG	-	-	rs141797505	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67986222_67986226delGGAAG								CAND1 (277834 upstream) : DYRK2 (56286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68917433	68917433	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68917433delT								MDM1 (191272 upstream) : RAP1B (87219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	70330904	70330905	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70330904_70330905delAC	uc001svu.1	+						uc010stn.1_Intron					RecName: Full=Uncharacterized protein C12orf28; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	70423652	70423652	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70423652delA								RAB3IP (206670 upstream) : CNOT2 (213125 downstream)																																			---	---	---	---
KCNMB4	27345	broad.mit.edu	37	12	70809063	70809063	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70809063delA	uc001svx.2	+							NM_014505	NP_055320			calcium-activated potassium channel beta 4						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)															---	---	---	---
ZFC3H1	196441	broad.mit.edu	37	12	72012475	72012477	+	Intron	DEL	GAG	-	-	rs143400725		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72012475_72012477delGAG	uc001swo.2	-							NM_144982	NP_659419			proline/serine-rich coiled-coil 2						RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	77672799	77672800	+	IGR	INS	-	TG	TG	rs11104577	byFrequency;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77672799_77672800insTG								E2F7 (213439 upstream) : NAV3 (552269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	78063759	78063759	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78063759delA								E2F7 (604399 upstream) : NAV3 (161310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	78814463	78814468	+	IGR	DEL	ATAAAG	-	-	rs10617367		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78814463_78814468delATAAAG								NAV3 (207675 upstream) : SYT1 (443305 downstream)																																			---	---	---	---
SYT1	6857	broad.mit.edu	37	12	79396966	79396967	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79396966_79396967insA	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron	NM_001135805	NP_001129277			synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6																		---	---	---	---
PTPRQ	374462	broad.mit.edu	37	12	80935796	80935796	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80935796delT	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	86044431	86044434	+	IGR	DEL	TGTG	-	-	rs150993235		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86044431_86044434delTGTG								ALX1 (348872 upstream) : RASSF9 (153897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	88191945	88191945	+	IGR	DEL	T	-	-	rs5799833		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88191945delT								MGAT4C (959264 upstream) : C12orf50 (181871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	88682542	88682543	+	IGR	INS	-	T	T	rs111885228		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88682542_88682543insT								TMTC3 (88879 upstream) : KITLG (204026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91774954	91774955	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91774954_91774955insT								DCN (198148 upstream) : BTG1 (603911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	93746085	93746085	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93746085delT								EEA1 (422978 upstream) : NUDT4 (25616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	94311428	94311429	+	IGR	DEL	TG	-	-	rs72075408		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94311428_94311429delTG								CRADD (22812 upstream) : PLXNC1 (231070 downstream)																																			---	---	---	---
CCDC41	51134	broad.mit.edu	37	12	94711451	94711451	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94711451delT	uc001tdd.2	-						CCDC41_uc001tde.2_Intron|CCDC41_uc009zsw.1_Intron	NM_016122	NP_057206			NY-REN-58 antigen												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	95205805	95205806	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95205805_95205806delTG								TMCC3 (161481 upstream) : MIR492 (22368 downstream)																																			---	---	---	---
METAP2	10988	broad.mit.edu	37	12	95885908	95885909	+	Intron	INS	-	TGTG	TGTG	rs149609517	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95885908_95885909insTGTG	uc001tec.2	+						METAP2_uc010suv.1_Intron|METAP2_uc009ztd.2_Intron|METAP2_uc001ted.2_Intron|METAP2_uc001tef.2_Intron|METAP2_uc001tee.2_Intron	NM_006838	NP_006829			methionyl aminopeptidase 2						N-terminal protein amino acid modification|peptidyl-methionine modification|protein processing|proteolysis	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0					L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	96473207	96473207	+	IGR	DEL	T	-	-	rs11338622		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96473207delT								LTA4H (35909 upstream) : ELK3 (115000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	96850092	96850092	+	IGR	DEL	G	-	-	rs36122152		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96850092delG								CDK17 (55869 upstream) : C12orf63 (191661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	97478513	97478514	+	IGR	INS	-	AG	AG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97478513_97478514insAG								NEDD1 (131052 upstream) : RMST (380285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	101963457	101963457	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101963457delT								SPIC (82683 upstream) : MYBPC1 (25290 downstream)																																			---	---	---	---
C12orf42	374470	broad.mit.edu	37	12	103710945	103710945	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103710945delG	uc001tjt.2	-						C12orf42_uc001tjs.2_Intron|C12orf42_uc009zuf.1_Intron|C12orf42_uc001tju.2_Intron	NM_198521	NP_940923			hypothetical protein LOC374470											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	103942542	103942542	+	RNA	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103942542delC	uc001tjv.2	+	2		c.229delC								Homo sapiens cDNA clone IMAGE:5272084.																														---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104075928	104075935	+	Intron	DEL	GATGGGAA	-	-	rs112020995		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104075928_104075935delGATGGGAA	uc001tjw.2	+							NM_017564	NP_060034			stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104087301	104087301	+	Intron	DEL	G	-	-	rs10708785		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104087301delG	uc001tjw.2	+							NM_017564	NP_060034			stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
LOC253724	253724	broad.mit.edu	37	12	104288654	104288657	+	Intron	DEL	CTGT	-	-	rs144747978		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104288654_104288657delCTGT	uc010swf.1	-							NR_027249				Homo sapiens cDNA FLJ56788 complete cds, moderately similar to Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant 2, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	104750190	104750191	+	IGR	DEL	GT	-	-	rs75052768		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104750190_104750191delGT								TXNRD1 (6132 upstream) : CHST11 (100558 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104984102	104984102	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104984102delG	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
C12orf75	387882	broad.mit.edu	37	12	105738523	105738524	+	Intron	INS	-	A	A	rs35185869		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105738523_105738524insA	uc001tlh.3	+						C12orf75_uc001tli.3_Intron	NM_001145199	NP_001138671			hypothetical protein LOC387882												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	106280656	106280656	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106280656delG								C12orf75 (515361 upstream) : NUAK1 (176469 downstream)																																			---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107091224	107091224	+	Intron	DEL	T	-	-	rs72456293		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107091224delT	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_Intron	NM_213594	NP_998759			regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107937116	107937116	+	Intron	DEL	A	-	-	rs5800754		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107937116delA	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108524253	108524260	+	Intron	DEL	GTGTGTGT	-	-	rs35359828	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108524253_108524260delGTGTGTGT	uc001tms.2	+						WSCD2_uc001tmt.2_5'Flank	NM_014653	NP_055468			WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
SART3	9733	broad.mit.edu	37	12	108955106	108955107	+	5'UTR	INS	-	T	T	rs139279716	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108955106_108955107insT	uc001tmz.1	-	1					SART3_uc009zux.1_5'UTR|SART3_uc010swx.1_5'UTR|SART3_uc010swz.1_5'UTR|SART3_uc001tna.1_RNA|SART3_uc001tnb.2_5'UTR|ISCU_uc010sxa.1_5'Flank|ISCU_uc010sxb.1_5'Flank|ISCU_uc001tnc.3_5'Flank|ISCU_uc010sxc.1_5'Flank|ISCU_uc009zuy.2_5'Flank|ISCU_uc010sxd.1_5'Flank	NM_014706	NP_055521			squamous cell carcinoma antigen recognized by T						RNA processing	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding			pancreas(1)	1														Porokeratosis				---	---	---	---
ISCU	23479	broad.mit.edu	37	12	108957481	108957481	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108957481delG	uc010sxc.1	+						SART3_uc001tmz.1_5'Flank|SART3_uc009zux.1_5'Flank|SART3_uc010swx.1_5'Flank|SART3_uc010swz.1_5'Flank|SART3_uc001tna.1_5'Flank|SART3_uc001tnb.2_5'Flank|ISCU_uc010sxa.1_Intron|ISCU_uc010sxb.1_Intron|ISCU_uc001tnc.3_Intron|ISCU_uc009zuy.2_Intron|ISCU_uc010sxd.1_Intron	NM_213595	NP_998760			iron-sulfur cluster assembly enzyme isoform						iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0																OREG0022095	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ACACB	32	broad.mit.edu	37	12	109622512	109622513	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109622512_109622513delTT	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
MYL2	4633	broad.mit.edu	37	12	111353302	111353302	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111353302delA	uc001try.3	-						MYL2_uc001trx.3_Intron	NM_000432	NP_000423			slow cardiac myosin regulatory light chain 2						cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1																		---	---	---	---
BRAP	8315	broad.mit.edu	37	12	112108906	112108906	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112108906delA	uc001tsn.3	-						BRAP_uc010syh.1_Intron|BRAP_uc009zvv.2_Intron	NM_006768	NP_006759			BRCA1 associated protein						MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1																		---	---	---	---
ACAD10	80724	broad.mit.edu	37	12	112151121	112151121	+	Intron	DEL	A	-	-	rs111453943		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112151121delA	uc001tsq.2	+						ACAD10_uc001tso.3_Intron|ACAD10_uc001tsp.2_Intron|ACAD10_uc009zvx.2_Intron|ACAD10_uc001tsr.2_Intron|ACAD10_uc001tss.1_5'Flank	NM_025247	NP_079523			acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2																		---	---	---	---
ACAD10	80724	broad.mit.edu	37	12	112190031	112190031	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112190031delA	uc001tsq.2	+						ACAD10_uc009zvx.2_Intron|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523			acyl-Coenzyme A dehydrogenase family, member 10								acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2																		---	---	---	---
TMEM116	89894	broad.mit.edu	37	12	112401846	112401847	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112401846_112401847insT	uc001ttc.1	-						TMEM116_uc001ttd.1_Intron|TMEM116_uc001tte.1_Intron|TMEM116_uc001ttf.1_Intron|TMEM116_uc001ttg.1_Intron|TMEM116_uc001tth.1_Intron|TMEM116_uc001tti.1_Intron	NM_138341	NP_612350			transmembrane protein 116							integral to membrane				ovary(1)	1																		---	---	---	---
SDS	10993	broad.mit.edu	37	12	113832148	113832149	+	Intron	INS	-	T	T	rs113227139		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113832148_113832149insT	uc001tvg.2	-							NM_006843	NP_006834			serine dehydratase						gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	114103445	114103446	+	IGR	DEL	AC	-	-	rs113277935		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114103445_114103446delAC								LHX5 (193568 upstream) : RBM19 (151097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115787094	115787095	+	IGR	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115787094_115787095delTC								TBX3 (665125 upstream) : MED13L (609288 downstream)																																			---	---	---	---
MED13L	23389	broad.mit.edu	37	12	116427231	116427231	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116427231delC	uc001tvw.2	-							NM_015335	NP_056150			mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	117042416	117042417	+	IGR	INS	-	T	T	rs34780013		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117042416_117042417insT								MAP1LC3B2 (27991 upstream) : C12orf49 (111179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	117061841	117061842	+	IGR	INS	-	A	A	rs140680006		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117061841_117061842insA								MAP1LC3B2 (47416 upstream) : C12orf49 (91754 downstream)																																			---	---	---	---
TESC	54997	broad.mit.edu	37	12	117520307	117520307	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117520307delA	uc001twh.2	-						TESC_uc001twi.2_Intron	NM_017899	NP_060369			tescalcin						negative regulation of cell proliferation|positive regulation of megakaryocyte differentiation|positive regulation of transcription, DNA-dependent|regulation of cell adhesion mediated by integrin	cytoplasm|lamellipodium|nucleus|plasma membrane|ruffle	calcium ion binding|magnesium ion binding|phosphatase inhibitor activity|protein binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)														---	---	---	---
FBXO21	23014	broad.mit.edu	37	12	117614645	117614646	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117614645_117614646insA	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373			F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)														---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118404400	118404401	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118404400_118404401delTC	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	118587323	118587324	+	IGR	INS	-	TGTG	TGTG	rs142861139	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118587323_118587324insTGTG								PEBP1 (3933 upstream) : TAOK3 (283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	119005066	119005066	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119005066delA								SUDS3 (149227 upstream) : SRRM4 (414330 downstream)																																			---	---	---	---
SPPL3	121665	broad.mit.edu	37	12	121230775	121230775	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121230775delA	uc001tzd.2	-						SPPL3_uc009zwz.2_Intron	NM_139015	NP_620584			signal peptide peptidase 3							integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
RNF34	80196	broad.mit.edu	37	12	121841218	121841218	+	Intron	DEL	A	-	-	rs112419511		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121841218delA	uc001ual.1	+						RNF34_uc010szw.1_Intron|RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402			ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)														---	---	---	---
ABCB9	23457	broad.mit.edu	37	12	123414957	123414957	+	Intron	DEL	T	-	-	rs79220139		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123414957delT	uc001udm.3	-						ABCB9_uc010tai.1_Intron|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Intron|ABCB9_uc010taj.1_Intron|ABCB9_uc001udp.2_Intron	NM_019625	NP_062571			ATP-binding cassette, sub-family B (MDR/TAP),						positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)														---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126139933	126139933	+	3'UTR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126139933delG	uc001uhe.1	+	9					TMEM132B_uc001uhf.1_3'UTR	NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	127990538	127990539	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127990538_127990539delTG								None (None upstream) : TMEM132C (908752 downstream)																																			---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129898083	129898084	+	Intron	INS	-	A	A	rs72524764	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129898083_129898084insA	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131490195	131490195	+	Intron	DEL	G	-	-	rs66999537		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131490195delG	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131530746	131530747	+	Intron	DEL	CT	-	-	rs67229639		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131530746_131530747delCT	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131939339	131939340	+	IGR	INS	-	ACAG	ACAG	rs143861088	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131939339_131939340insACAG								LOC116437 (241864 upstream) : SFRS8 (256295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132292881	132292881	+	IGR	DEL	T	-	-	rs139523183		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132292881delT								SFRS8 (8599 upstream) : MMP17 (20060 downstream)																																			---	---	---	---
GALNT9	50614	broad.mit.edu	37	12	132877551	132877551	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132877551delG	uc001ukc.3	-						GALNT9_uc009zys.2_Intron	NM_001122636	NP_001116108			UDP-N-acetyl-alpha-D-galactosamine:polypeptide						protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)														---	---	---	---
ZMYM2	7750	broad.mit.edu	37	13	20540598	20540598	+	Intron	DEL	T	-	-	rs113111970		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20540598delT	uc001umr.2	+						ZMYM2_uc001umq.2_Intron|ZMYM2_uc001ums.2_Intron|ZMYM2_uc001umt.2_Intron|ZMYM2_uc009zzn.1_Intron	NM_003453	NP_003444			zinc finger protein 198						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	20912715	20912715	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20912715delG								GJB6 (106181 upstream) : CRYL1 (65094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	21648557	21648558	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21648557_21648558insA								LATS2 (12835 upstream) : SAP18 (66095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22344573	22344574	+	IGR	INS	-	T	T	rs34808158		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22344573_22344574insT								FGF9 (65933 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22581268	22581269	+	IGR	DEL	GT	-	-	rs71733436		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22581268_22581269delGT								FGF9 (302628 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23517791	23517792	+	IGR	INS	-	GC	GC	rs149218978	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23517791_23517792insGC								None (None upstream) : SGCG (237268 downstream)																																			---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24756633	24756634	+	Intron	INS	-	AG	AG	rs138362893	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24756633_24756634insAG	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc001upf.1_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29855525	29855526	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29855525_29855526delTG	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	31608820	31608821	+	IGR	DEL	GG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31608820_31608821delGG								C13orf26 (59669 upstream) : HSPH1 (101944 downstream)																																			---	---	---	---
FRY	10129	broad.mit.edu	37	13	32636239	32636239	+	Intron	DEL	A	-	-	rs9533320	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32636239delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
FRY	10129	broad.mit.edu	37	13	32637466	32637466	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32637466delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	34324039	34324039	+	IGR	DEL	A	-	-	rs34374960		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34324039delA								STARD13 (73107 upstream) : RFC3 (68167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	35131449	35131449	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35131449delG								RFC3 (590755 upstream) : NBEA (385007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	36254887	36254887	+	IGR	DEL	C	-	-	rs35917472		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36254887delC								NBEA (8015 upstream) : DCLK1 (88236 downstream)																																			---	---	---	---
TRPC4	7223	broad.mit.edu	37	13	38391575	38391575	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38391575delG	uc001uws.2	-						TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263			transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	39526197	39526197	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39526197delA								FREM2 (64932 upstream) : STOML3 (13866 downstream)																																			---	---	---	---
LOC646982	646982	broad.mit.edu	37	13	41027089	41027089	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41027089delA	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron|LOC646982_uc001uxk.2_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0																		---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42678690	42678690	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42678690delC	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
EPSTI1	94240	broad.mit.edu	37	13	43502810	43502810	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43502810delA	uc001uyw.1	-						EPSTI1_uc001uyx.1_Intron	NM_001002264	NP_001002264			epithelial stromal interaction 1 isoform 1											ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)														---	---	---	---
SIAH3	283514	broad.mit.edu	37	13	46404968	46404969	+	Intron	DEL	AA	-	-	rs10533676		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46404968_46404969delAA	uc001vap.2	-							NM_198849	NP_942146			seven in absentia homolog 3						multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	47737920	47737920	+	IGR	DEL	A	-	-	rs34119092		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47737920delA								HTR2A (266870 upstream) : SUCLA2 (778872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	50393726	50393727	+	IGR	INS	-	T	T	rs144608950		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50393726_50393727insT								KPNA3 (26669 upstream) : LOC220429 (70818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	52946769	52946770	+	IGR	INS	-	TTTCTTTC	TTTCTTTC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52946769_52946770insTTTCTTTC								THSD1P1 (81089 upstream) : THSD1 (4535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54504127	54504127	+	IGR	DEL	T	-	-	rs34616973		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54504127delT								OLFM4 (877941 upstream) : MIR1297 (381980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56976355	56976356	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56976355_56976356delAC								None (None upstream) : PRR20C (738696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58548779	58548780	+	IGR	INS	-	AC	AC	rs141761680	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58548779_58548780insAC								PCDH17 (245714 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59860507	59860508	+	IGR	INS	-	AAGTA	AAGTA	rs145992023	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59860507_59860508insAAGTA								None (None upstream) : DIAPH3 (379217 downstream)																																			---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60518348	60518348	+	Intron	DEL	A	-	-	rs148198800		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60518348delA	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron|DIAPH3_uc001vhv.2_Intron	NM_001042517	NP_001035982			diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	62294915	62294915	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62294915delG								PCDH20 (292836 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62579584	62579585	+	IGR	INS	-	ACAC	ACAC	rs139423389	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62579584_62579585insACAC								PCDH20 (577505 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62791323	62791325	+	IGR	DEL	ACT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62791323_62791325delACT								PCDH20 (789244 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64659116	64659117	+	IGR	INS	-	TCT	TCT	rs140266556	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64659116_64659117insTCT								OR7E156P (342415 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64857627	64857628	+	IGR	INS	-	GGAA	GGAA	rs138501773	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64857627_64857628insGGAA								OR7E156P (540926 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65134599	65134599	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65134599delA								OR7E156P (817898 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65620895	65620896	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65620895_65620896insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69575211	69575211	+	IGR	DEL	T	-	-	rs112765164		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69575211delT								None (None upstream) : KLHL1 (699515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69610136	69610137	+	IGR	DEL	TT	-	-	rs72132020	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69610136_69610137delTT								None (None upstream) : KLHL1 (664589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69790943	69790944	+	IGR	DEL	TG	-	-	rs66575188		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69790943_69790944delTG								None (None upstream) : KLHL1 (483782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70098995	70098999	+	IGR	DEL	TTAAG	-	-	rs139294248		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70098995_70098999delTTAAG								None (None upstream) : KLHL1 (175727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70212262	70212262	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70212262delA								None (None upstream) : KLHL1 (62464 downstream)																																			---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70327337	70327337	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70327337delT	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917			kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	72010840	72010840	+	IGR	DEL	A	-	-	rs11313225		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72010840delA								None (None upstream) : DACH1 (1258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74213906	74213907	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74213906_74213907insT								KLF5 (562231 upstream) : KLF12 (46243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75270339	75270340	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75270339_75270340insT								KLF12 (561945 upstream) : LOC647288 (541550 downstream)																																			---	---	---	---
TBC1D4	9882	broad.mit.edu	37	13	75929706	75929707	+	Intron	INS	-	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75929706_75929707insG	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647			TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	76632434	76632435	+	IGR	INS	-	A	A	rs149854369	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76632434_76632435insA								LMO7 (198430 upstream) : KCTD12 (821869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77299314	77299314	+	IGR	DEL	T	-	-	rs67098774		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77299314delT								LMO7 (865310 upstream) : KCTD12 (154990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78384758	78384758	+	IGR	DEL	T	-	-	rs113921754		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78384758delT								SLAIN1 (46381 upstream) : EDNRB (84858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80219305	80219305	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80219305delT								NDFIP2 (89100 upstream) : SPRY2 (690809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84714854	84714855	+	IGR	INS	-	GTGT	GTGT	rs146385745	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84714854_84714855insGTGT								SLITRK1 (258326 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86308226	86308229	+	IGR	DEL	TTTG	-	-	rs66483028		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86308226_86308229delTTTG								None (None upstream) : SLITRK6 (58693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90005583	90005584	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90005583_90005584insA								None (None upstream) : MIR622 (877852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	95390521	95390522	+	IGR	INS	-	C	C	rs61204376		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95390521_95390522insC								SOX21 (26132 upstream) : ABCC4 (281562 downstream)																																			---	---	---	---
HS6ST3	266722	broad.mit.edu	37	13	97424418	97424418	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97424418delT	uc001vmw.2	+							NM_153456	NP_703157			heparan sulfate 6-O-sulfotransferase 3							integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	98537592	98537593	+	IGR	DEL	CA	-	-	rs72242284		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98537592_98537593delCA								RAP2A (417341 upstream) : IPO5 (68336 downstream)																																			---	---	---	---
CLYBL	171425	broad.mit.edu	37	13	100349916	100349916	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100349916delT	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
PCCA	5095	broad.mit.edu	37	13	100818564	100818573	+	Intron	DEL	TGTTTTGTTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100818564_100818573delTGTTTTGTTT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102728696	102728696	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102728696delC	uc001vpf.2	-							NM_175929	NP_787125			fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	103017585	103017586	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103017585_103017586delCA	uc001vpf.2	-						uc001vph.1_Intron|uc001vpg.1_Intron	NM_175929	NP_787125			fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	104213316	104213316	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104213316delG								SLC10A2 (494120 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105087051	105087051	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105087051delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105869955	105869956	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105869955_105869956delGA								None (None upstream) : DAOA (248260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107067426	107067426	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107067426delA								DAOA (924044 upstream) : EFNB2 (74672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107139172	107139172	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107139172delT								DAOA (995790 upstream) : EFNB2 (2926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107603688	107603689	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107603688_107603689delTG								ARGLU1 (383174 upstream) : FAM155A (217191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	109110903	109110904	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109110903_109110904insA								TNFSF13B (151539 upstream) : MYO16 (137596 downstream)																																			---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109836941	109836942	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109836941_109836942insT	uc001vqt.1	+						MYO16_uc010agk.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113392915	113392915	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113392915delG	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	19432504	19432511	+	IGR	DEL	TGTGTGGA	-	-	rs151114802		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19432504_19432511delTGTGTGGA								OR11H12 (53932 upstream) : POTEG (120854 downstream)																																			---	---	---	---
CCNB1IP1	57820	broad.mit.edu	37	14	20782696	20782696	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20782696delG	uc001vwv.2	-						CCNB1IP1_uc001vww.2_Intron|CCNB1IP1_uc001vwx.2_Intron|CCNB1IP1_uc001vwy.2_Intron|CCNB1IP1_uc001vwz.2_Intron	NM_182851	NP_878271			cyclin B1 interacting protein 1 isoform 3							chromosome|nucleus	ligase activity|metal ion binding|protein binding		HMGA2/CCNB1IP1(2)	soft_tissue(2)|ovary(1)	3	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)				T	HMGA2	leiomyoma								---	---	---	---
Unknown	0	broad.mit.edu	37	14	22124390	22124390	+	IGR	DEL	A	-	-	rs34195525		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22124390delA								OR10G2 (21392 upstream) : OR4E2 (8907 downstream)																																			---	---	---	---
DAD1	1603	broad.mit.edu	37	14	23042081	23042082	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23042081_23042082insT	uc001wgl.2	-							NM_001344	NP_001335			defender against cell death 1						anti-apoptosis|apoptosis|post-translational protein modification	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity			ovary(1)	1	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0156)														---	---	---	---
SLC7A7	9056	broad.mit.edu	37	14	23244457	23244472	+	Intron	DEL	GTACCATTCCTTAGAG	-	-	rs151185590	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23244457_23244472delGTACCATTCCTTAGAG	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973			solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)														---	---	---	---
PRMT5	10419	broad.mit.edu	37	14	23401404	23401404	+	5'Flank	DEL	A	-	-	rs11321570		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23401404delA	uc001whm.1	-						PRMT5_uc001whl.1_5'Flank|PRMT5_uc010akd.1_5'Flank|PRMT5_uc010tnf.1_5'Flank|PRMT5_uc010tng.1_5'Flank|PRMT5_uc010tnh.1_5'Flank|PRMT5_uc001whn.1_5'Flank	NM_006109	NP_006100			protein arginine methyltransferase 5 isoform a						cell proliferation|histone H4-R3 methylation|ncRNA metabolic process|regulation of mitosis|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	histone-arginine N-methyltransferase activity|protein binding|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding			ovary(1)	1	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)														---	---	---	---
ACIN1	22985	broad.mit.edu	37	14	23550266	23550267	+	Intron	INS	-	T	T	rs57582315		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23550266_23550267insT	uc001wit.3	-						ACIN1_uc001wis.3_5'Flank|ACIN1_uc010akg.2_Intron|ACIN1_uc010tnj.1_Intron	NM_014977	NP_055792			apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25162266	25162266	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25162266delA								GZMB (58834 upstream) : STXBP6 (119042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	30736217	30736217	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30736217delA								PRKD1 (339318 upstream) : G2E3 (292112 downstream)																																			---	---	---	---
HECTD1	25831	broad.mit.edu	37	14	31591469	31591470	+	Intron	INS	-	GT	GT	rs150478849	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31591469_31591470insGT	uc001wrc.1	-						HECTD1_uc001wra.1_Intron|HECTD1_uc001wrb.1_Intron|HECTD1_uc001wrd.1_Intron	NM_015382	NP_056197			HECT domain containing 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33515657	33515657	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33515657delT	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33768803	33768804	+	Intron	INS	-	TTTC	TTTC	rs75624272		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33768803_33768804insTTTC	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34667741	34667741	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34667741delT								EGLN3 (247454 upstream) : C14orf147 (234404 downstream)																																			---	---	---	---
SNX6	58533	broad.mit.edu	37	14	35060436	35060437	+	Intron	INS	-	A	A	rs146868287	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35060436_35060437insA	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419			sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)														---	---	---	---
SRP54	6729	broad.mit.edu	37	14	35472779	35472779	+	Intron	DEL	T	-	-	rs111562585		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35472779delT	uc001wso.2	+						SRP54_uc010tpp.1_Intron|SRP54_uc010tpq.1_Intron	NM_003136	NP_003127			signal recognition particle 54kDa isoform 1						GTP catabolic process|response to drug|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition|SRP-dependent cotranslational protein targeting to membrane, translocation	cytosol|nuclear speck|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|drug binding|endoplasmic reticulum signal peptide binding|GDP binding|GTP binding|nucleoside-triphosphatase activity|ribonucleoprotein binding			ovary(1)	1	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	40751659	40751659	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40751659delA								FBXO33 (849955 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	42071827	42071827	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42071827delG								None (None upstream) : LRFN5 (4937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43117616	43117616	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43117616delC								LRFN5 (743866 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44634377	44634378	+	IGR	INS	-	C	C	rs142027847	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44634377_44634378insC								None (None upstream) : FSCB (338977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46970694	46970694	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46970694delT								None (None upstream) : RPL10L (149528 downstream)																																			---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47397755	47397758	+	Intron	DEL	AATC	-	-	rs74847385		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47397755_47397758delAATC	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	49675329	49675329	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49675329delA								None (None upstream) : SDCCAG1 (357698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	50343577	50343578	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50343577_50343578insTT								SDCCAG1 (24038 upstream) : ARF6 (16158 downstream)																																			---	---	---	---
C14orf182	283551	broad.mit.edu	37	14	50466494	50466494	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50466494delT	uc001wxi.1	-							NM_001012706	NP_001012724			hypothetical protein LOC283551												0																		---	---	---	---
SOS2	6655	broad.mit.edu	37	14	50664408	50664408	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50664408delT	uc001wxs.3	-						SOS2_uc010tql.1_Intron	NM_006939	NP_008870			son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)																	---	---	---	---
L2HGDH	79944	broad.mit.edu	37	14	50739163	50739163	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50739163delA	uc001wxu.2	-						L2HGDH_uc010tqn.1_Intron|L2HGDH_uc010tqo.1_Intron	NM_024884	NP_079160			L-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process	integral to mitochondrial inner membrane	2-hydroxyglutarate dehydrogenase activity			ovary(2)	2	all_epithelial(31;0.000599)|Breast(41;0.0102)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	51436295	51436297	+	IGR	DEL	CCA	-	-	rs71443136		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51436295_51436297delCCA								PYGL (25047 upstream) : TRIM9 (5685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	51757575	51757575	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51757575delA								TMX1 (33205 upstream) : FRMD6 (198280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54173906	54173908	+	IGR	DEL	TGT	-	-	rs10556683		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54173906_54173908delTGT								DDHD1 (553860 upstream) : BMP4 (242549 downstream)																																			---	---	---	---
SAMD4A	23034	broad.mit.edu	37	14	55095811	55095811	+	Intron	DEL	G	-	-	rs5808783		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55095811delG	uc001xbb.2	+						SAMD4A_uc001xba.2_Intron|SAMD4A_uc001xbc.2_Intron	NM_015589	NP_056404			sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	55375558	55375559	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55375558_55375559insT								GCH1 (6016 upstream) : WDHD1 (31383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	55978457	55978457	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55978457delT								TBPL2 (71194 upstream) : C14orf33 (46233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56554482	56554482	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56554482delT								C14orf34 (291090 upstream) : PELI2 (30611 downstream)																																			---	---	---	---
MUDENG	55745	broad.mit.edu	37	14	57752258	57752258	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57752258delA	uc001xcv.2	+						MUDENG_uc010tri.1_Intron|MUDENG_uc010trj.1_Intron	NM_018229	NP_060699			Mu-2 related death-inducing protein						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	59287085	59287085	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59287085delT								DACT1 (172049 upstream) : DAAM1 (368314 downstream)																																			---	---	---	---
GPR135	64582	broad.mit.edu	37	14	59907789	59907790	+	Intron	INS	-	A	A	rs34075525		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59907789_59907790insA	uc001xed.2	-							NM_022571				G protein-coupled receptor 135							integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)														---	---	---	---
GPR135	64582	broad.mit.edu	37	14	59910738	59910739	+	Intron	INS	-	TTGT	TTGT	rs149041604	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59910738_59910739insTTGT	uc001xed.2	-							NM_022571				G protein-coupled receptor 135							integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	60391618	60391618	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60391618delT	uc001xep.1	+											Homo sapiens cDNA FLJ46156 fis, clone TESTI4001569.																														---	---	---	---
SNAPC1	6617	broad.mit.edu	37	14	62252632	62252633	+	Intron	INS	-	C	C	rs140345704	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62252632_62252633insC	uc001xft.2	+							NM_003082	NP_003073			small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)														---	---	---	---
KCNH5	27133	broad.mit.edu	37	14	63244578	63244579	+	Intron	DEL	TG	-	-	rs147017962	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63244578_63244579delTG	uc001xfx.2	-						KCNH5_uc001xfy.2_Intron|KCNH5_uc001xfz.1_Intron	NM_139318	NP_647479			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	63607199	63607199	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63607199delC								KCNH5 (38615 upstream) : RHOJ (63946 downstream)																																			---	---	---	---
ESR2	2100	broad.mit.edu	37	14	64759162	64759162	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64759162delC	uc001xha.1	-						ESR2_uc001xgu.2_Intron|ESR2_uc001xgv.2_Intron|ESR2_uc001xgw.2_Intron|ESR2_uc001xgx.2_Intron	NM_001437	NP_001428			estrogen receptor beta isoform 1						cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)													---	---	---	---
ZBTB25	7597	broad.mit.edu	37	14	64930755	64930755	+	Intron	DEL	T	-	-	rs35093390		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64930755delT	uc001xhc.2	-						AKAP5_uc001xhd.3_5'Flank					Homo sapiens cDNA FLJ40862 fis, clone TRACH2018262, highly similar to Zinc finger and BTB domain-containing protein 25.							cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65154122	65154122	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65154122delT								C14orf50 (98026 upstream) : PLEKHG3 (17071 downstream)																																			---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65283916	65283917	+	Intron	INS	-	G	G	rs145434122	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65283916_65283917insG	uc001xht.2	-						SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron|SPTB_uc001xhu.2_Intron	NM_000347	NP_000338			spectrin beta isoform b						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65340902	65340902	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65340902delG	uc001xhs.2	-						SPTB_uc001xhu.2_Intron	NM_001024858	NP_001020029			spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	67886565	67886566	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67886565_67886566insA								PLEK2 (7737 upstream) : TMEM229B (34231 downstream)																																			---	---	---	---
VTI1B	10490	broad.mit.edu	37	14	68123593	68123593	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68123593delA	uc001xjt.2	-						VTI1B_uc010aqp.2_Intron|VTI1B_uc001xju.2_Intron	NM_006370	NP_006361			vesicle transport through interaction with						cell proliferation|cellular membrane fusion|intracellular protein transport|vesicle docking involved in exocytosis	endomembrane system|integral to membrane					0				all cancers(60;0.000344)|OV - Ovarian serous cystadenocarcinoma(108;0.00212)|BRCA - Breast invasive adenocarcinoma(234;0.00941)														---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68980909	68980909	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68980909delA	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	69177564	69177564	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69177564delC	uc001xkg.1	+							NM_133510	NP_598194			RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
Unknown	0	broad.mit.edu	37	14	70020987	70020988	+	IGR	INS	-	A	A	rs147436565	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70020987_70020988insA								UPF0639 (25772 upstream) : C14orf162 (15544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	71160704	71160705	+	IGR	INS	-	T	T	rs149429531	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71160704_71160705insT								TTC9 (18627 upstream) : MAP3K9 (34151 downstream)																																			---	---	---	---
ZFYVE1	53349	broad.mit.edu	37	14	73480843	73480847	+	Intron	DEL	TAAAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73480843_73480847delTAAAG	uc001xnm.2	-						ZFYVE1_uc010arj.2_Intron	NM_021260	NP_067083			zinc finger, FYVE domain containing 1 isoform 1							endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	76018090	76018090	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76018090delC								BATF (4763 upstream) : FLVCR2 (26850 downstream)																																			---	---	---	---
FLVCR2	55640	broad.mit.edu	37	14	76106749	76106750	+	Intron	DEL	TG	-	-	rs138889356		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76106749_76106750delTG	uc001xrs.2	+						FLVCR2_uc010tvd.1_Intron	NM_017791	NP_060261			feline leukemia virus subgroup C cellular						transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)														---	---	---	---
ESRRB	2103	broad.mit.edu	37	14	76873951	76873951	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76873951delC	uc001xsq.1	+						ESRRB_uc001xsr.2_Intron|ESRRB_uc001xso.2_Intron	NM_004452	NP_004443			estrogen-related receptor beta							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77485376	77485376	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77485376delT								C14orf166B (148731 upstream) : C14orf4 (5512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	80545548	80545550	+	IGR	DEL	ACT	-	-	rs5809980		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80545548_80545550delACT								NRXN3 (214790 upstream) : DIO2 (118320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	80653453	80653454	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80653453_80653454insA								NRXN3 (322695 upstream) : DIO2 (10416 downstream)																																			---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	80955710	80955711	+	Intron	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80955710_80955711insC	uc010asz.1	-							NM_152446				hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
SEL1L	6400	broad.mit.edu	37	14	81943647	81943648	+	Intron	INS	-	TG	TG	rs140905448	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81943647_81943648insTG	uc010tvv.1	-							NM_005065	NP_005056			sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82532906	82532906	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82532906delG								SEL1L (532701 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82984459	82984462	+	IGR	DEL	AAGG	-	-	rs33984421		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82984459_82984462delAAGG								SEL1L (984254 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84944247	84944247	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84944247delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87332620	87332621	+	IGR	DEL	TG	-	-	rs112372706		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87332620_87332621delTG								None (None upstream) : GALC (971543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87597839	87597842	+	IGR	DEL	ATAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87597839_87597842delATAG								None (None upstream) : GALC (706322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	89465903	89465903	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89465903delT								TTC8 (121569 upstream) : FOXN3 (156614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90233679	90233680	+	IGR	INS	-	AGTTT	AGTTT	rs139390739	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90233679_90233680insAGTTT								FOXN3 (148185 upstream) : C14orf143 (29791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90902784	90902785	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90902784_90902785insA								CALM1 (28174 upstream) : TTC7B (104148 downstream)																																			---	---	---	---
CATSPERB	79820	broad.mit.edu	37	14	92138366	92138367	+	Intron	INS	-	AAC	AAC	rs140003800	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92138366_92138367insAAC	uc001xzs.1	-						CATSPERB_uc010aub.1_5'Flank	NM_024764	NP_079040			cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	92705868	92705869	+	IGR	INS	-	T	T	rs67564335	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92705868_92705869insT								CPSF2 (75325 upstream) : SLC24A4 (83056 downstream)																																			---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	93814196	93814196	+	Intron	DEL	A	-	-	rs112422740		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93814196delA	uc001ybs.1	+						COX8C_uc001ybt.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
SERPINA6	866	broad.mit.edu	37	14	94788850	94788851	+	Intron	INS	-	AAAC	AAAC	rs141998477	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94788850_94788851insAAAC	uc001ycv.2	-						SERPINA6_uc010auv.2_Intron	NM_001756	NP_001747			corticosteroid binding globulin precursor						regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	95098359	95098364	+	IGR	DEL	AAACAT	-	-	rs76311389		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95098359_95098364delAAACAT								SERPINA3 (7970 upstream) : SERPINA13 (8698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	95341211	95341211	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95341211delC								GSC (104712 upstream) : DICER1 (211354 downstream)																																			---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95746310	95746310	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95746310delT	uc001yef.2	-							NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95853273	95853274	+	IGR	INS	-	A	A	rs149061833	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95853273_95853274insA								CLMN (67028 upstream) : C14orf139 (20332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98982249	98982249	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98982249delT								C14orf64 (537788 upstream) : C14orf177 (195701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99580020	99580020	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99580020delT								C14orf177 (395923 upstream) : BCL11B (55607 downstream)																																			---	---	---	---
CCDC85C	317762	broad.mit.edu	37	14	100072314	100072315	+	5'Flank	INS	-	G	G	rs142155357	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100072314_100072315insG	uc010avr.2	-							NM_001144995	NP_001138467			coiled-coil domain containing 85C												0																		---	---	---	---
EVL	51466	broad.mit.edu	37	14	100532730	100532730	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100532730delG	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421			Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	101238003	101238004	+	IGR	DEL	TG	-	-	rs111997583		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101238003_101238004delTG								DLK1 (36529 upstream) : MEG3 (54441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	102107976	102107976	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102107976delA								DIO3 (78187 upstream) : C14orf72 (88798 downstream)																																			---	---	---	---
TRAF3	7187	broad.mit.edu	37	14	103260499	103260500	+	Intron	DEL	TC	-	-	rs146462668		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103260499_103260500delTC	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777			TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)														---	---	---	---
CDC42BPB	9578	broad.mit.edu	37	14	103495633	103495633	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103495633delT	uc001ymi.1	-							NM_006035	NP_006026			CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	103615612	103615613	+	IGR	DEL	AC	-	-	rs59516418		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103615612_103615613delAC								TNFAIP2 (11836 upstream) : EIF5 (184880 downstream)																																			---	---	---	---
KLC1	3831	broad.mit.edu	37	14	104085943	104085944	+	Intron	INS	-	T	T	rs35548721		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104085943_104085944insT	uc010tyd.1	+							NM_005552	NP_005543			kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	104681813	104681814	+	IGR	INS	-	G	G	rs143949770		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104681813_104681814insG								KIF26A (34579 upstream) : C14orf180 (364242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	104755625	104755626	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104755625_104755626delTG								KIF26A (108391 upstream) : C14orf180 (290430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	104910674	104910677	+	IGR	DEL	ATTT	-	-	rs143970494		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104910674_104910677delATTT								KIF26A (263440 upstream) : C14orf180 (135379 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106293476	106293476	+	Intron	DEL	C	-	-	rs11624775		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106293476delC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106772128	106772128	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106772128delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106784104	106784105	+	Intron	INS	-	T	T	rs147719885		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106784104_106784105insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106902128	106902128	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106902128delG	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20088944	20088944	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20088944delA								None (None upstream) : GOLGA6L6 (648150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20595617	20595618	+	Intron	INS	-	A	A	rs138187612		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20595617_20595618insA	uc001ytg.2	-						uc010tyx.1_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
BCL8	606	broad.mit.edu	37	15	20871765	20871766	+	RNA	INS	-	A	A	rs143185107		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20871765_20871766insA	uc010tzd.1	-	4		c.1321_1322insT								Homo sapiens mRNA; cDNA DKFZp686P1536 (from clone DKFZp686P1536).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	22116536	22116537	+	IGR	INS	-	T	T	rs138683465		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22116536_22116537insT								CXADRP2 (99658 upstream) : LOC727924 (161495 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22324137	22324138	+	Intron	DEL	TT	-	-	rs142978360	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22324137_22324138delTT	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22376292	22376292	+	Intron	DEL	T	-	-	rs112543994		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22376292delT	uc001yuc.1	+						LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22469703	22469704	+	IGR	INS	-	A	A	rs139819542	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22469703_22469704insA								OR4N3P (55318 upstream) : MIR1268 (43525 downstream)																																			---	---	---	---
CYFIP1	23191	broad.mit.edu	37	15	22936816	22936816	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22936816delT	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423			cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)														---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	27180162	27180163	+	Intron	INS	-	TGC	TGC	rs10692737		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27180162_27180163insTGC	uc001zbb.2	-						GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27384468	27384468	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27384468delG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
FAM189A1	23359	broad.mit.edu	37	15	29859050	29859051	+	Intron	INS	-	AC	AC	rs146482719	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29859050_29859051insAC	uc010azk.1	-							NM_015307	NP_056122			hypothetical protein LOC23359							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	32596562	32596562	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32596562delA	uc001zfv.1	-											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33860676	33860677	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33860676_33860677insT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34063734	34063734	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34063734delA	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
C15orf29	79768	broad.mit.edu	37	15	34482149	34482149	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34482149delT	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989			hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	35037625	35037626	+	IGR	INS	-	A	A	rs138567804		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35037625_35037626insA								GOLGA8B (209403 upstream) : GJD2 (7053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35468675	35468676	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35468675_35468676insT								ZNF770 (188221 upstream) : LOC723972 (60851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36464871	36464871	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36464871delA								ATPBD4 (626467 upstream) : C15orf41 (406941 downstream)																																			---	---	---	---
FAM98B	283742	broad.mit.edu	37	15	38772780	38772781	+	Intron	INS	-	T	T	rs143625059	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38772780_38772781insT	uc001zkb.1	+						FAM98B_uc001zkc.2_Intron	NM_001042429	NP_001035894			family with sequence similarity 98, member B							tRNA-splicing ligase complex	protein binding			ovary(1)	1		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	39142299	39142299	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39142299delA								C15orf53 (150060 upstream) : C15orf54 (400586 downstream)																																			---	---	---	---
GPR176	11245	broad.mit.edu	37	15	40169022	40169023	+	Intron	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40169022_40169023delAG	uc001zkj.1	-						GPR176_uc001zkk.1_Intron	NM_007223	NP_009154			G protein-coupled receptor 176						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)														---	---	---	---
C15orf57	90416	broad.mit.edu	37	15	40836013	40836013	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40836013delC	uc001zly.2	-						uc001zlx.1_Intron|MRPL42P5_uc010bbq.1_Intron	NM_052849	NP_443081			coiled-coil domain containing 32 isoform a											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	42414200	42414201	+	IGR	INS	-	AC	AC	rs151088355	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42414200_42414201insAC								PLA2G4D (27448 upstream) : PLA2G4F (19198 downstream)																																			---	---	---	---
SNAP23	8773	broad.mit.edu	37	15	42789076	42789076	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42789076delG	uc001zpz.1	+						SNAP23_uc001zqa.1_Intron	NM_003825	NP_003816			synaptosomal-associated protein 23 isoform						cellular membrane fusion|post-Golgi vesicle-mediated transport|protein transport|vesicle targeting	azurophil granule|cell junction|Golgi apparatus|nucleus|plasma membrane enriched fraction|specific granule|synapse|synaptosome	protein binding				0		all_cancers(109;7.14e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;1.18e-08)|all_lung(180;4.2e-08)|Melanoma(134;0.0179)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;2.62e-06)														---	---	---	---
HAUS2	55142	broad.mit.edu	37	15	42845184	42845185	+	Intron	DEL	TT	-	-	rs34872260		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42845184_42845185delTT	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	NM_018097	NP_060567			centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0																		---	---	---	---
TTBK2	146057	broad.mit.edu	37	15	43050853	43050854	+	Intron	DEL	AA	-	-	rs140332386		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43050853_43050854delAA	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron	NM_173500	NP_775771			tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)														---	---	---	---
TGM5	9333	broad.mit.edu	37	15	43546170	43546170	+	Intron	DEL	G	-	-	rs35025462		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43546170delG	uc001zrd.1	-						TGM5_uc001zre.1_Intron	NM_201631	NP_963925			transglutaminase 5 isoform 1						epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	44502224	44502225	+	IGR	INS	-	A	A	rs149916275	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44502224_44502225insA								FRMD5 (14795 upstream) : CASC4 (78704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46294900	46294900	+	IGR	DEL	T	-	-	rs35002126		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46294900delT								SQRDL (311422 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46680207	46680207	+	IGR	DEL	T	-	-	rs67157724		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46680207delT								SQRDL (696729 upstream) : SEMA6D (796196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46972255	46972255	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46972255delA								SQRDL (988777 upstream) : SEMA6D (504148 downstream)																																			---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47749673	47749673	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47749673delG	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
SECISBP2L	9728	broad.mit.edu	37	15	49311770	49311770	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49311770delA	uc001zxe.1	-						SECISBP2L_uc001zxd.1_Intron|SECISBP2L_uc010bep.1_Intron|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516			SECIS binding protein 2-like											breast(1)|skin(1)	2																		---	---	---	---
ATP8B4	79895	broad.mit.edu	37	15	50315977	50315978	+	Intron	DEL	AA	-	-	rs72458889		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50315977_50315978delAA	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113			ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	50695593	50695594	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50695593_50695594insT								LOC100129387 (45092 upstream) : USP8 (20985 downstream)																																			---	---	---	---
TMOD2	29767	broad.mit.edu	37	15	52082804	52082804	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52082804delA	uc002abk.2	+						TMOD2_uc002abl.3_Intron|TMOD2_uc010bfb.2_Intron	NM_014548	NP_055363			neuronal tropomodulin isoform a						nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	52358807	52358809	+	IGR	DEL	TAA	-	-	rs148748542		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52358807_52358809delTAA								MAPK6 (346 upstream) : BCL2L10 (43015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	52976105	52976105	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52976105delC								KIAA1370 (5152 upstream) : ONECUT1 (73248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	53409702	53409703	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53409702_53409703insC								ONECUT1 (327493 upstream) : WDR72 (396235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	53657014	53657014	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53657014delG								ONECUT1 (574805 upstream) : WDR72 (148924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	53705067	53705067	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53705067delT								ONECUT1 (622858 upstream) : WDR72 (100871 downstream)																																			---	---	---	---
TEX9	374618	broad.mit.edu	37	15	56704372	56704373	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56704372_56704373delGT	uc002adp.2	+						TEX9_uc010ugl.1_Intron	NM_198524	NP_940926			testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)														---	---	---	---
ZNF280D	54816	broad.mit.edu	37	15	56931179	56931180	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56931179_56931180insA	uc002adu.2	-						ZNF280D_uc002adv.2_Intron|ZNF280D_uc010bfq.2_Intron|ZNF280D_uc010bfp.2_Intron	NM_017661	NP_060131			suppressor of hairy wing homolog 4 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)														---	---	---	---
CGNL1	84952	broad.mit.edu	37	15	57815409	57815409	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57815409delA	uc002aeg.2	+						CGNL1_uc010bfw.2_Intron	NM_032866	NP_116255			cingulin-like 1							myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	58083879	58083879	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58083879delG								GCOM1 (74127 upstream) : ALDH1A2 (161749 downstream)																																			---	---	---	---
LIPC	3990	broad.mit.edu	37	15	58745474	58745474	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58745474delT	uc010bga.1	+						LIPC_uc010bfz.1_Intron|LIPC_uc002afa.1_Intron|LIPC_uc010bgb.1_Intron|LIPC_uc010ugy.1_Intron|uc002afb.1_Intron	NM_000236	NP_000227			lipase C precursor						cholesterol homeostasis|chylomicron remnant clearance|fatty acid biosynthetic process|high-density lipoprotein particle remodeling|intermediate-density lipoprotein particle remodeling|low-density lipoprotein particle remodeling|phosphatidylcholine catabolic process|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein binding|heparin binding|low-density lipoprotein particle binding|phospholipase activity|triglyceride lipase activity			ovary(1)	1		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	59047730	59047731	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59047730_59047731insT								ADAM10 (5553 upstream) : FAM63B (15662 downstream)																																			---	---	---	---
BNIP2	663	broad.mit.edu	37	15	59974853	59974853	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59974853delT	uc010uhc.1	-						BNIP2_uc010uhb.1_Intron	NM_004330	NP_004321			BCL2/adenovirus E1B 19kD interacting protein 2						anti-apoptosis|apoptosis|positive regulation of muscle cell differentiation	nuclear envelope|perinuclear region of cytoplasm	calcium ion binding|GTPase activator activity|protein binding			ovary(1)	1																		---	---	---	---
RORA	6095	broad.mit.edu	37	15	60807623	60807625	+	Intron	DEL	TCA	-	-	rs76040786		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60807623_60807625delTCA	uc002agv.2	-						uc002ags.1_Intron|RORA_uc002agt.3_Intron|RORA_uc002agw.2_Intron|RORA_uc002agx.2_Intron	NM_134260	NP_599022			RAR-related orphan receptor A isoform b						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	61526749	61526751	+	IGR	DEL	AAG	-	-	rs150010576		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61526749_61526751delAAG								RORA (5247 upstream) : VPS13C (617841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62097123	62097124	+	IGR	INS	-	C	C	rs141445458	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62097123_62097124insC								RORA (575621 upstream) : VPS13C (47468 downstream)																																			---	---	---	---
APH1B	83464	broad.mit.edu	37	15	63596081	63596082	+	Intron	INS	-	AC	AC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63596081_63596082insAC	uc002ama.2	+						APH1B_uc002amb.2_Intron|APH1B_uc010bgq.2_Intron|APH1B_uc010bgr.2_Intron	NM_031301	NP_112591			presenilin stabilization factor-like isoform 1						apoptosis|induction of apoptosis by extracellular signals|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	integral to membrane|plasma membrane|transport vesicle	peptidase activity|protein binding				0																		---	---	---	---
CA12	771	broad.mit.edu	37	15	63661310	63661310	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63661310delG	uc002amc.2	-						CA12_uc002amd.2_Intron|CA12_uc002ame.2_Intron	NM_001218	NP_001209			carbonic anhydrase XII isoform 1 precursor						one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	65005864	65005864	+	IGR	DEL	A	-	-	rs79639485		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65005864delA								OAZ2 (10402 upstream) : RBPMS2 (26234 downstream)																																			---	---	---	---
PLEKHO2	80301	broad.mit.edu	37	15	65141182	65141183	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65141182_65141183insT	uc002anv.2	+						PLEKHO2_uc010bgz.2_Intron|PLEKHO2_uc002anw.2_Intron	NM_025201	NP_079477			pleckstrin homology domain containing, family O											ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	66120515	66120515	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66120515delG								DENND4A (35884 upstream) : RAB11A (41281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	67152343	67152344	+	5'Flank	INS	-	TGAA	TGAA	rs139430141	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67152343_67152344insTGAA	uc002aqh.1	+											Homo sapiens mRNA; cDNA DKFZp686F0429 (from clone DKFZp686F0429).																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	67334669	67334670	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67334669_67334670delGT								SMAD6 (260334 upstream) : SMAD3 (23525 downstream)																																			---	---	---	---
AAGAB	79719	broad.mit.edu	37	15	67543554	67543555	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67543554_67543555delGT	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942			alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0																		---	---	---	---
CLN6	54982	broad.mit.edu	37	15	68530740	68530740	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68530740delA	uc010ujz.1	-							NM_017882	NP_060352			CLN6 protein						cell death|cholesterol metabolic process|ganglioside metabolic process|glycosaminoglycan metabolic process|lysosomal lumen acidification|positive regulation of proteolysis|protein catabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	protein homodimerization activity				0																		---	---	---	---
ANP32A	8125	broad.mit.edu	37	15	69078095	69078095	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69078095delG	uc002arl.2	-							NM_006305	NP_006296			acidic (leucine-rich) nuclear phosphoprotein 32						intracellular signal transduction|mRNA metabolic process|nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
GLCE	26035	broad.mit.edu	37	15	69469365	69469366	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69469365_69469366insT	uc002ary.1	+						GLCE_uc002arw.2_Intron|GLCE_uc002arx.2_Intron	NM_015554	NP_056369			D-glucuronyl C5-epimerase						heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2																		---	---	---	---
KIF23	9493	broad.mit.edu	37	15	69723953	69723953	+	Intron	DEL	A	-	-	rs79724690		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69723953delA	uc002asb.2	+						KIF23_uc002asc.2_Intron|KIF23_uc010bii.2_Intron|KIF23_uc010ukc.1_Intron|KIF23_uc010bih.1_Intron	NM_138555	NP_612565			kinesin family member 23 isoform 1						blood coagulation|cytokinesis|microtubule-based movement|mitosis|mitotic spindle elongation	cytosol|kinesin complex|microtubule|midbody|nucleoplasm|spindle	ATP binding|microtubule motor activity|protein binding				0																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71307582	71307582	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71307582delT	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161			leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71573096	71573096	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71573096delT	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71736033	71736034	+	Intron	INS	-	AT	AT	rs140294349	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71736033_71736034insAT	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73137573	73137574	+	IGR	INS	-	TT	TT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73137573_73137574insTT								ADPGK (60906 upstream) : NEO1 (207301 downstream)																																			---	---	---	---
C15orf60	283677	broad.mit.edu	37	15	73812555	73812555	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73812555delT	uc002avq.2	+						C15orf60_uc010bjb.2_Intron	NM_001042367	NP_001035826			hypothetical protein LOC283677											pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	74085928	74085928	+	IGR	DEL	T	-	-	rs111893534		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74085928delT								C15orf59 (42112 upstream) : TBC1D21 (80040 downstream)																																			---	---	---	---
CCDC33	80125	broad.mit.edu	37	15	74603326	74603326	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74603326delT	uc002axo.2	+						CCDC33_uc002axp.2_Intron	NM_025055	NP_079331			coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5																		---	---	---	---
CSK	1445	broad.mit.edu	37	15	75082065	75082066	+	Intron	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75082065_75082066delCT	uc010bkb.1	+						CSK_uc010bka.2_Intron|CSK_uc002ays.2_Intron	NM_001127190	NP_001120662			c-src tyrosine kinase						blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding			lung(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75512322	75512322	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75512322delT								C15orf39 (7814 upstream) : GOLGA6C (38577 downstream)																																			---	---	---	---
IMP3	55272	broad.mit.edu	37	15	75935957	75935957	+	Intron	DEL	A	-	-	rs76404591		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75935957delA	uc002bat.2	-							NM_018285	NP_060755			IMP3, U3 small nucleolar ribonucleoprotein						rRNA processing	nucleolus|ribonucleoprotein complex	protein binding|rRNA binding				0																		---	---	---	---
UBE2Q2	92912	broad.mit.edu	37	15	76134392	76134392	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76134392delT	uc002bbg.2	+						UBE2Q2_uc002bbh.2_5'Flank|UBE2Q2_uc010umn.1_5'Flank	NM_173469	NP_775740			ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2																		---	---	---	---
SCAPER	49855	broad.mit.edu	37	15	76902974	76902974	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76902974delA	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron	NM_020843	NP_065894			S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77432649	77432650	+	Intron	INS	-	TAA	TAA	rs144369872	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77432649_77432650insTAA	uc002bcm.2	-							NM_024776	NP_079052			NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	78104288	78104288	+	IGR	DEL	A	-	-	rs143732039		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78104288delA								LINGO1 (115813 upstream) : LOC645752 (102271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	78251471	78251472	+	IGR	INS	-	TG	TG	rs144414157	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78251471_78251472insTG								LOC645752 (32283 upstream) : LOC91450 (34104 downstream)																																	OREG0023323	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TBC1D2B	23102	broad.mit.edu	37	15	78293202	78293202	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78293202delC	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173			TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
MORF4L1	10933	broad.mit.edu	37	15	79176545	79176546	+	Intron	INS	-	A	A	rs71451729		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79176545_79176546insA	uc002bel.2	+						MORF4L1_uc010bli.1_Intron|MORF4L1_uc010blj.1_Intron|MORF4L1_uc002bem.2_Intron|MORF4L1_uc010une.1_Intron	NM_206839	NP_996670			MORF-related gene 15 isoform 2						double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79332993	79332994	+	Intron	INS	-	AGAG	AGAG	rs143495730	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79332993_79332994insAGAG	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
FAH	2184	broad.mit.edu	37	15	80459873	80459875	+	Intron	DEL	TTT	-	-	rs71455315		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80459873_80459875delTTT	uc002bfj.2	+						FAH_uc002bfk.1_Intron|FAH_uc002bfm.1_Intron|FAH_uc002bfn.1_Intron	NM_000137	NP_000128			fumarylacetoacetase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0														Tyrosinemia_type_1				---	---	---	---
CPEB1	64506	broad.mit.edu	37	15	83302715	83302716	+	Intron	INS	-	A	A	rs112776351		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83302715_83302716insA	uc002biv.2	-						CPEB1_uc010uof.1_Intron	NM_030594	NP_085097			cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)															---	---	---	---
HDGFRP3	50810	broad.mit.edu	37	15	83816226	83816227	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83816226_83816227insA	uc002bjs.1	-							NM_016073	NP_057157			hepatoma-derived growth factor, related protein						cell proliferation	nucleus	growth factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	83976975	83976976	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83976975_83976976insA								BNC1 (23507 upstream) : SH3GL3 (139115 downstream)																																			---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84591737	84591738	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84591737_84591738insT	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
SLC28A1	9154	broad.mit.edu	37	15	85452268	85452268	+	Intron	DEL	T	-	-	rs11349644		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85452268delT	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204			solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	85957227	85957227	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85957227delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	86412293	86412294	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86412293_86412294insT								KLHL25 (74104 upstream) : AGBL1 (272948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	86552271	86552271	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86552271delA								KLHL25 (214082 upstream) : AGBL1 (132971 downstream)																																			---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86788890	86788890	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86788890delG	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86881760	86881761	+	Intron	INS	-	G	G	rs140954230	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86881760_86881761insG	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87552552	87552552	+	Intron	DEL	C	-	-	rs34608515		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87552552delC	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	87700224	87700228	+	IGR	DEL	TCCTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87700224_87700228delTCCTT								AGBL1 (127941 upstream) : NCRNA00052 (419932 downstream)																																			---	---	---	---
WDR93	56964	broad.mit.edu	37	15	90274114	90274115	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90274114_90274115insA	uc002boj.2	+						WDR93_uc010bnr.2_Intron|WDR93_uc010upz.1_Intron	NM_020212	NP_064597			WD repeat domain 93						electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	92245867	92245867	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92245867delT								SV2B (407219 upstream) : SLCO3A1 (151071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	92294262	92294264	+	IGR	DEL	TAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92294262_92294264delTAG								SV2B (455614 upstream) : SLCO3A1 (102674 downstream)																																			---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93457081	93457082	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93457081_93457082insA	uc002bsp.2	+						CHD2_uc002bsm.1_Intron|CHD2_uc002bsn.2_Intron|CHD2_uc002bso.1_Intron|CHD2_uc010urb.1_Intron	NM_001271	NP_001262			chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	94366982	94366982	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94366982delA	uc002bte.1	-											Homo sapiens cDNA clone IMAGE:5266107.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	95386130	95386130	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95386130delC								MCTP2 (358950 upstream) : LOC145820 (590192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96536204	96536204	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96536204delA								LOC145820 (485130 upstream) : NR2F2 (332953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97762649	97762649	+	IGR	DEL	T	-	-	rs68111425		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97762649delT								SPATA8 (433805 upstream) : LOC91948 (523197 downstream)																																			---	---	---	---
FAM169B	283777	broad.mit.edu	37	15	99056602	99056602	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99056602delA	uc002buk.1	-							NM_182562	NP_872368			hypothetical protein LOC283777												0																		---	---	---	---
PGPEP1L	145814	broad.mit.edu	37	15	99513928	99513928	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99513928delA	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082			pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	100097405	100097406	+	IGR	DEL	AC	-	-	rs137897881	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100097405_100097406delAC								LRRC28 (170125 upstream) : MEF2A (8727 downstream)																																			---	---	---	---
MEF2A	4205	broad.mit.edu	37	15	100134665	100134673	+	Intron	DEL	TTTTTTTTT	-	-	rs112057559		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100134665_100134673delTTTTTTTTT	uc002bve.2	+						MEF2A_uc010urv.1_Intron|MEF2A_uc010bos.2_Intron|MEF2A_uc002bvf.2_Intron|MEF2A_uc002bvg.2_Intron	NM_001130926	NP_001124398			myocyte enhancer factor 2A isoform 2						apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	102359459	102359459	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102359459delA								OR4F15 (133 upstream) : OR4F4 (102886 downstream)																																			---	---	---	---
LUC7L	55692	broad.mit.edu	37	16	244965	244965	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:244965delT	uc002cgc.1	-						LUC7L_uc002cga.1_Intron|LUC7L_uc002cgd.1_Intron|LUC7L_uc002cge.1_Intron|LUC7L_uc002cgb.1_Intron	NM_201412	NP_958815			LUC7-like isoform b								metal ion binding			central_nervous_system(1)	1		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)																---	---	---	---
ABCA17P	650655	broad.mit.edu	37	16	2420744	2420744	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2420744delG	uc002cqc.1	+							NR_003574				Homo sapiens cDNA FLJ37881 fis, clone BRSTN2000367.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	3201139	3201140	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3201139_3201140insT								ZNF213 (8335 upstream) : OR1F1 (53107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	4005874	4005874	+	IGR	DEL	A	-	-	rs71394629		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4005874delA								CREBBP (75753 upstream) : ADCY9 (6779 downstream)																																			---	---	---	---
CORO7	79585	broad.mit.edu	37	16	4394266	4394270	+	Intron	DEL	GGGGG	-	-	rs112221174		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4394266_4394270delGGGGG	uc002cwf.2	-						CORO7_uc002cwe.2_Intron|TIMM16_uc002cwd.2_Intron	NM_024535	NP_078811			coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	4668283	4668283	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4668283delT								FAM100A (3356 upstream) : MGRN1 (6543 downstream)																																			---	---	---	---
C16orf71	146562	broad.mit.edu	37	16	4794635	4794636	+	Intron	INS	-	TTCA	TTCA	rs144683946	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4794635_4794636insTTCA	uc002cxn.2	+							NM_139170	NP_631909			hypothetical protein LOC146562											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	5538287	5538289	+	Intron	DEL	TGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5538287_5538289delTGA	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6311872	6311873	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6311872_6311873insA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6894136	6894137	+	Intron	INS	-	CTC	CTC	rs148534568	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6894136_6894137insCTC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7580506	7580506	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7580506delA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7675436	7675436	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7675436delT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
ABAT	18	broad.mit.edu	37	16	8831777	8831778	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8831777_8831778insA	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737			4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)													---	---	---	---
ATF7IP2	80063	broad.mit.edu	37	16	10548503	10548503	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10548503delC	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Intron|ATF7IP2_uc010uyq.1_Intron	NM_024997	NP_079273			activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	10805208	10805208	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10805208delG								TEKT5 (16406 upstream) : NUBP1 (32490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10831250	10831251	+	IGR	INS	-	T	T	rs151177233		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10831250_10831251insT								TEKT5 (42448 upstream) : NUBP1 (6447 downstream)																																			---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10895325	10895325	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10895325delT	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	11339023	11339029	+	IGR	DEL	TTTGTTT	-	-	rs117861930		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11339023_11339029delTTTGTTT								CLEC16A (62979 upstream) : C16orf75 (4477 downstream)																																			---	---	---	---
C16orf75	116028	broad.mit.edu	37	16	11411114	11411115	+	Intron	INS	-	T	T	rs71406228		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11411114_11411115insT	uc002daq.1	+											Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0								T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
SNX29	92017	broad.mit.edu	37	16	12398039	12398039	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12398039delT	uc002dby.3	+							NM_001080530	NP_001073999			sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	13001705	13001705	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13001705delA	uc010uyy.1	+						SHISA9_uc002dcd.2_Intron	NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17012385	17012386	+	IGR	INS	-	TCT	TCT	rs147292778	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17012385_17012386insTCT								LOC339047 (567948 upstream) : XYLT1 (183797 downstream)																																			---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17239384	17239384	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17239384delC	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17544196	17544199	+	Intron	DEL	AAAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17544196_17544199delAAAC	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	19510462	19510463	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19510462_19510463delTG								TMC5 (30 upstream) : GDE1 (2554 downstream)																																			---	---	---	---
PDZD9	255762	broad.mit.edu	37	16	22000250	22000250	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22000250delT	uc002dka.1	-							NM_173806	NP_776167			hypothetical protein LOC255762											pancreas(1)	1																		---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22102353	22102354	+	5'Flank	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22102353_22102354insC	uc010vbq.1	+						VWA3A_uc010bxc.2_5'Flank	NM_173615	NP_775886			von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22678958	22678958	+	IGR	DEL	G	-	-	rs146639918		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22678958delG								LOC653786 (90772 upstream) : HS3ST2 (146902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22815150	22815150	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22815150delC								LOC653786 (226964 upstream) : HS3ST2 (10710 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23210347	23210347	+	Intron	DEL	T	-	-	rs80183863		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23210347delT	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	23817454	23817455	+	IGR	INS	-	T	T	rs78511679		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23817454_23817455insT								CHP2 (47198 upstream) : PRKCB (29845 downstream)																																			---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	24206524	24206524	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24206524delA	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	24607711	24607711	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24607711delA								RBBP6 (23530 upstream) : TNRC6A (133338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	25246579	25246583	+	IGR	DEL	TTTCT	-	-	rs71385529		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25246579_25246583delTTTCT								AQP8 (6327 upstream) : ZKSCAN2 (741 downstream)																																			---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25782306	25782306	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25782306delT	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	26053675	26053676	+	Intron	INS	-	TG	TG	rs139626208	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26053675_26053676insTG	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	26188442	26188442	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26188442delA								HS3ST4 (39434 upstream) : C16orf82 (889777 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26289927	26289928	+	IGR	INS	-	T	T	rs151161380	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26289927_26289928insT								HS3ST4 (140919 upstream) : C16orf82 (788291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	29056993	29056994	+	Intron	DEL	CG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29056993_29056994delCG	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	30804664	30804665	+	IGR	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30804664_30804665delTC								ZNF629 (6141 upstream) : BCL7C (40708 downstream)																																			---	---	---	---
BCL7C	9274	broad.mit.edu	37	16	30906725	30906725	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30906725delT	uc002dzv.2	-						BCL7C_uc002dzt.1_5'Flank|CTF1_uc002dzw.2_5'Flank|CTF1_uc002dzx.2_5'Flank	NM_004765	NP_004756			B-cell CLL/lymphoma 7C						apoptosis						0			Colorectal(24;0.198)															---	---	---	---
MYST1	84148	broad.mit.edu	37	16	31139866	31139866	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31139866delA	uc002eay.2	+						MYST1_uc002eax.2_Intron|MYST1_uc002eaz.2_Intron|MYST1_uc002eba.2_Intron|MYST1_uc002ebb.2_5'Flank	NM_032188	NP_115564			MYST histone acetyltransferase 1 isoform 1						histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32517938	32517938	+	IGR	DEL	G	-	-	rs75617045		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32517938delG								HERC2P4 (354064 upstream) : TP53TG3B (166903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32518493	32518493	+	IGR	DEL	G	-	-	rs76677034		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32518493delG								HERC2P4 (354619 upstream) : TP53TG3B (166348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33421329	33421329	+	IGR	DEL	A	-	-	rs78383992		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33421329delA								SLC6A10P (524866 upstream) : MIR1826 (544179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33537368	33537369	+	IGR	INS	-	AAAAG	AAAAG	rs147538249		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537368_33537369insAAAAG								SLC6A10P (640905 upstream) : MIR1826 (428139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33820996	33820996	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33820996delG								SLC6A10P (924533 upstream) : MIR1826 (144512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33895711	33895712	+	IGR	INS	-	TGG	TGG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33895711_33895712insTGG								SLC6A10P (999248 upstream) : MIR1826 (69796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33920234	33920235	+	IGR	INS	-	T	T	rs116158230		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33920234_33920235insT								None (None upstream) : MIR1826 (45273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33923144	33923147	+	IGR	DEL	CTCA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33923144_33923147delCTCA								None (None upstream) : MIR1826 (42361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46444744	46444744	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46444744delC								None (None upstream) : ANKRD26P1 (58505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46448646	46448648	+	IGR	DEL	TAT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46448646_46448648delTAT								None (None upstream) : ANKRD26P1 (54601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	47091231	47091232	+	IGR	DEL	TG	-	-	rs112200353		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47091231_47091232delTG								DNAJA2 (83606 upstream) : NETO2 (24210 downstream)																																			---	---	---	---
ITFG1	81533	broad.mit.edu	37	16	47471896	47471896	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47471896delA	uc002eet.2	-						ITFG1_uc010vgh.1_Intron	NM_030790	NP_110417			integrin alpha FG-GAP repeat containing 1							extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	48059599	48059599	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48059599delT								PHKB (324166 upstream) : ABCC12 (57285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51731627	51731627	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51731627delG								SALL1 (546444 upstream) : TOX3 (740291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54251816	54251817	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54251816_54251817insT								FTO (103438 upstream) : IRX3 (65395 downstream)																																			---	---	---	---
SLC6A2	6530	broad.mit.edu	37	16	55731636	55731636	+	Intron	DEL	A	-	-	rs35434599		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55731636delA	uc002eif.2	+						SLC6A2_uc010ccd.2_Intron|SLC6A2_uc002eig.2_Intron|SLC6A2_uc002eih.2_Intron|SLC6A2_uc002eii.2_Intron|SLC6A2_uc002eij.2_Intron	NM_001043	NP_001034			solute carrier family 6 member 2						synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	56592249	56592250	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56592249_56592250insA								BBS2 (38241 upstream) : MT4 (6711 downstream)																																			---	---	---	---
NUP93	9688	broad.mit.edu	37	16	56766230	56766231	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56766230_56766231insT	uc002eka.2	+							NM_014669	NP_055484			nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
PLLP	51090	broad.mit.edu	37	16	57294493	57294493	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57294493delA	uc002elg.1	-							NM_015993	NP_057077			plasmolipin							integral to membrane	ion channel activity				0																		---	---	---	---
MMP15	4324	broad.mit.edu	37	16	58058220	58058220	+	5'Flank	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58058220delG	uc002ena.2	+							NM_002428	NP_002419			matrix metalloproteinase 15 preproprotein						protein modification process|proteolysis	extracellular matrix|integral to plasma membrane	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|protein binding|zinc ion binding			central_nervous_system(2)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58733924	58733924	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58733924delT								SLC38A7 (15250 upstream) : GOT2 (7111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60592329	60592329	+	IGR	DEL	T	-	-	rs144190830		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60592329delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60801910	60801911	+	IGR	DEL	AG	-	-	rs72259294		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60801910_60801911delAG								None (None upstream) : CDH8 (885324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62294254	62294255	+	IGR	DEL	AA	-	-	rs34457440		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62294254_62294255delAA								CDH8 (224218 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63603819	63603819	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63603819delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC283867	283867	broad.mit.edu	37	16	65419677	65419678	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65419677_65419678delTC	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	66038548	66038548	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66038548delT								LOC283867 (428345 upstream) : CDH5 (361977 downstream)																																			---	---	---	---
BEAN	146227	broad.mit.edu	37	16	66496702	66496703	+	Intron	INS	-	A	A	rs79931367		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66496702_66496703insA	uc002eoq.2	+						BEAN_uc002eop.1_Intron	NM_001136106	NP_001129578			brain expressed, associated with Nedd4						cell death	integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	66630280	66630280	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66630280delA								CMTM2 (8105 upstream) : CMTM3 (7922 downstream)																																			---	---	---	---
ATP6V0D1	9114	broad.mit.edu	37	16	67499625	67499625	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67499625delT	uc002ete.1	-						ATP6V0D1_uc010vjo.1_Intron	NM_004691	NP_004682			ATPase, H+ transporting, lysosomal, V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)												OREG0023882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FAM65A	79567	broad.mit.edu	37	16	67561757	67561757	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67561757delA	uc010vjp.1	+						FAM65A_uc010cei.1_5'Flank|FAM65A_uc002eth.2_5'Flank|FAM65A_uc010cej.2_5'Flank	NM_024519	NP_078795			hypothetical protein LOC79567							cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)														---	---	---	---
NFATC3	4775	broad.mit.edu	37	16	68138995	68138996	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68138995_68138996delTT	uc002evo.1	+						NFATC3_uc010vkl.1_Intron|NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vko.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vkr.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vku.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vkx.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vla.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188			nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	68508866	68508866	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68508866delA								SMPD3 (26457 upstream) : ZFP90 (55182 downstream)																																			---	---	---	---
PDPR	55066	broad.mit.edu	37	16	70166561	70166562	+	Intron	DEL	TC	-	-	rs142341422	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70166561_70166562delTC	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron	NM_017990	NP_060460			pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	73807554	73807554	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73807554delA								HTA (679884 upstream) : PSMD7 (523127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74170146	74170146	+	IGR	DEL	A	-	-	rs148115836		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74170146delA								None (None upstream) : PSMD7 (160535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74310085	74310085	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74310085delA								None (None upstream) : PSMD7 (20596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76908412	76908413	+	IGR	INS	-	AG	AG	rs144261745	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76908412_76908413insAG								CNTNAP4 (315277 upstream) : MON1B (316423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76968735	76968736	+	IGR	INS	-	T	T	rs77944281		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76968735_76968736insT								CNTNAP4 (375600 upstream) : MON1B (256100 downstream)																																			---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81163003	81163004	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81163003_81163004delTC	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	82282047	82282047	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82282047delA								MPHOSPH6 (78218 upstream) : CDH13 (378531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	82303971	82303971	+	IGR	DEL	C	-	-	rs11337036		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82303971delC								MPHOSPH6 (100142 upstream) : CDH13 (356607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	84565141	84565141	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84565141delC								KIAA1609 (26853 upstream) : COTL1 (34065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86254217	86254218	+	IGR	INS	-	TTTC	TTTC	rs146554203	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86254217_86254218insTTTC								IRF8 (298008 upstream) : LOC732275 (111238 downstream)																																			---	---	---	---
FBXO31	79791	broad.mit.edu	37	16	87409882	87409883	+	Intron	INS	-	T	T	rs75769125		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87409882_87409883insT	uc002fjw.2	-						FBXO31_uc010vot.1_Intron	NM_024735	NP_079011			F-box protein 31						cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)														---	---	---	---
ZFPM1	161882	broad.mit.edu	37	16	88525840	88525840	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88525840delA	uc002fkv.2	+							NM_153813	NP_722520			zinc finger protein, multitype 1						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)														---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89682480	89682481	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89682480_89682481insA	uc010cin.2	+							NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
VPS53	55275	broad.mit.edu	37	17	454438	454438	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:454438delA	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759			vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)														---	---	---	---
VPS53	55275	broad.mit.edu	37	17	457652	457652	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:457652delT	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759			vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)														---	---	---	---
NXN	64359	broad.mit.edu	37	17	864627	864628	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:864627_864628insA	uc002fsa.2	-							NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
ABR	29	broad.mit.edu	37	17	1040653	1040654	+	Intron	INS	-	AG	AG	rs147514005	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1040653_1040654insAG	uc002fsd.2	-						ABR_uc002fse.2_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
PRPF8	10594	broad.mit.edu	37	17	1574230	1574230	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1574230delA	uc002fte.2	-							NM_006445	NP_006436			U5 snRNP-specific protein							catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)														---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2202012	2202012	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202012delA	uc002fub.1	-							NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
FBXO39	162517	broad.mit.edu	37	17	6691058	6691059	+	Intron	INS	-	T	T	rs71383426		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6691058_6691059insT	uc010cls.1	+											Homo sapiens cDNA, FLJ98753.											ovary(1)|skin(1)	2																		---	---	---	---
NDEL1	81565	broad.mit.edu	37	17	8361866	8361867	+	Intron	INS	-	TG	TG	rs140850394	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8361866_8361867insTG	uc002glj.2	+						NDEL1_uc002gli.2_Intron	NM_030808	NP_110435			nudE nuclear distribution gene E homolog (A.						chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|microtubule|spindle					0																		---	---	---	---
PIK3R6	146850	broad.mit.edu	37	17	8766846	8766847	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8766846_8766847delGT	uc002glq.1	-						PIK3R6_uc002glr.1_Intron|PIK3R6_uc002gls.1_Intron	NM_001010855	NP_001010855			phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0																		---	---	---	---
NTN1	9423	broad.mit.edu	37	17	9132344	9132345	+	Intron	DEL	TG	-	-	rs10551762		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9132344_9132345delTG	uc002glw.3	+							NM_004822	NP_004813			netrin 1 precursor						apoptosis|axon guidance		protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	10951517	10951517	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10951517delT								PIRT (210099 upstream) : SHISA6 (193223 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11843124	11843125	+	Intron	INS	-	ATGG	ATGG	rs66682351		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11843124_11843125insATGG	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12182989	12182996	+	IGR	DEL	TGTGTCCA	-	-	rs149571189		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12182989_12182996delTGTGTCCA								MAP2K4 (135939 upstream) : MYOCD (386211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13737475	13737475	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13737475delA								HS3ST3A1 (232231 upstream) : CDRT15P (190340 downstream)																																			---	---	---	---
PIGL	9487	broad.mit.edu	37	17	16129317	16129318	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16129317_16129318insA	uc002gpv.2	+						PIGL_uc010vwd.1_Intron	NM_004278	NP_004269			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminylphosphatidylinositol deacetylase activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)														---	---	---	---
MPRIP	23164	broad.mit.edu	37	17	16967520	16967521	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16967520_16967521insT	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron	NM_201274	NP_958431			myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0																		---	---	---	---
COPS3	8533	broad.mit.edu	37	17	17159922	17159923	+	Intron	INS	-	T	T	rs113503910		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17159922_17159923insT	uc002grd.2	-						COPS3_uc010vwv.1_Intron|COPS3_uc010vww.1_Intron	NM_003653	NP_003644			COP9 constitutive photomorphogenic homolog						cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1																		---	---	---	---
SREBF1	6720	broad.mit.edu	37	17	17716448	17716448	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17716448delT	uc002gru.1	-						SREBF1_uc002gro.3_5'Flank|SREBF1_uc002grp.1_Intron|SREBF1_uc002grq.1_Intron|SREBF1_uc002grr.1_Intron|SREBF1_uc002grs.1_Intron|SREBF1_uc002grt.1_Intron	NM_004176	NP_004167			sterol regulatory element binding transcription						cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1																		---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20781318	20781319	+	Intron	INS	-	AG	AG	rs143868577	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20781318_20781319insAG	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21341375	21341376	+	IGR	INS	-	A	A	rs142557330	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21341375_21341376insA								KCNJ12 (18196 upstream) : C17orf51 (90196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21870764	21870764	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21870764delA								FAM27L (44261 upstream) : FLJ36000 (33298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25292075	25292076	+	IGR	INS	-	TG	TG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25292075_25292076insTG								None (None upstream) : WSB1 (329030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25293405	25293407	+	IGR	DEL	ATG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293405_25293407delATG								None (None upstream) : WSB1 (327699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25591693	25591696	+	IGR	DEL	TGTG	-	-	rs5819803		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25591693_25591696delTGTG								None (None upstream) : WSB1 (29410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26239806	26239807	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26239806_26239807delCA								NOS2 (19397 upstream) : NLK (129881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26357428	26357428	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26357428delC								NOS2 (137019 upstream) : NLK (12260 downstream)																																			---	---	---	---
MYO18A	399687	broad.mit.edu	37	17	27467820	27467821	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27467820_27467821delAC	uc002hdt.1	-						MYO18A_uc002hds.2_5'Flank|MYO18A_uc010csa.1_Intron|MYO18A_uc002hdu.1_Intron|MYO18A_uc010wbd.1_5'Flank	NM_078471	NP_510880			myosin 18A isoform a						anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)															---	---	---	---
ZNF207	7756	broad.mit.edu	37	17	30691075	30691076	+	Intron	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30691075_30691076delAG	uc002hhh.3	+						ZNF207_uc002hhj.3_Intron|ZNF207_uc002hhi.3_Intron|ZNF207_uc010csz.2_Intron|ZNF207_uc002hhk.1_Intron|ZNF207_uc002hhl.1_Intron	NM_003457	NP_003448			zinc finger protein 207 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)															---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30987698	30987698	+	Intron	DEL	A	-	-	rs111603452		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30987698delA	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	32985247	32985247	+	IGR	DEL	T	-	-	rs66516427		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32985247delT								TMEM132E (18911 upstream) : CCT6B (269693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	33335456	33335457	+	RNA	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33335456_33335457delTT	uc002hil.2	+	1		c.2129_2130delTT								Homo sapiens cDNA FLJ34173 fis, clone FCBBF3015809.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	35232728	35232730	+	IGR	DEL	AAC	-	-	rs74779320		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35232728_35232730delAAC								MRM1 (267322 upstream) : LHX1 (61769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	35285219	35285224	+	IGR	DEL	CACACA	-	-	rs72434249		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35285219_35285224delCACACA								MRM1 (319813 upstream) : LHX1 (9275 downstream)																																			---	---	---	---
TADA2A	6871	broad.mit.edu	37	17	35821069	35821070	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35821069_35821070insA	uc002hnt.2	+						TADA2A_uc002hnu.1_Intron|TADA2A_uc002hnv.2_Intron|TADA2A_uc002hnw.2_Intron|TADA2A_uc010cvb.2_Intron	NM_001488	NP_001479			transcriptional adaptor 2A isoform a						histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4																		---	---	---	---
TBC1D3	729873	broad.mit.edu	37	17	36375920	36375921	+	5'Flank	INS	-	A	A	rs147706178		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36375920_36375921insA	uc010wdn.1	-						uc002hpx.2_Intron					Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	37163137	37163146	+	IGR	DEL	CACACACACA	-	-	rs4795328	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37163137_37163146delCACACACACA								FBXO47 (39482 upstream) : PLXDC1 (56410 downstream)																																			---	---	---	---
JUP	3728	broad.mit.edu	37	17	39747570	39747570	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39747570delC	uc010wfs.1	-							NM_021991	NP_068831			junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)														---	---	---	---
CNTNAP1	8506	broad.mit.edu	37	17	40834653	40834654	+	5'UTR	DEL	AG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40834653_40834654delAG	uc002iay.2	+	1					CCR10_uc002iax.3_5'Flank|CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623			contactin associated protein 1 precursor						axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)														---	---	---	---
EZH1	2145	broad.mit.edu	37	17	40883142	40883142	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40883142delT	uc002iaz.2	-						EZH1_uc002iba.2_Intron|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Intron|EZH1_uc010wgv.1_Intron|EZH1_uc010wgw.1_Intron|EZH1_uc010cyp.2_Intron|EZH1_uc010cyq.2_Intron|EZH1_uc010cys.2_Intron	NM_001991	NP_001982			enhancer of zeste homolog 1						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)														---	---	---	---
LOC100130581	100130581	broad.mit.edu	37	17	41468210	41468210	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41468210delA	uc010wib.1	-						LOC100130581_uc010wic.1_5'Flank|LOC100130581_uc010czf.2_5'Flank|LOC100130581_uc010wid.1_5'Flank|LOC100130581_uc010wie.1_5'Flank	NR_027412				Homo sapiens cDNA FLJ41591 fis, clone CTONG2022153.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	41794145	41794146	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41794145_41794146delAA								MEOX1 (54883 upstream) : SOST (36953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41866398	41866398	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41866398delT								C17orf105 (4344 upstream) : MPP3 (11771 downstream)																																			---	---	---	---
MPP2	4355	broad.mit.edu	37	17	41982456	41982457	+	Intron	INS	-	A	A	rs139037701	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41982456_41982457insA	uc010wip.1	-						MPP2_uc002ieo.1_Intron|MPP2_uc010win.1_Intron|MPP2_uc010wio.1_Intron|MPP2_uc010czm.1_Intron	NM_005374	NP_005365			palmitoylated membrane protein 2						signal transduction	cell surface|integral to plasma membrane|membrane fraction	guanylate kinase activity				0		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	43655191	43655191	+	IGR	DEL	A	-	-	rs71363536		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43655191delA								LRRC37A4 (59675 upstream) : LOC644172 (22300 downstream)																																			---	---	---	---
LOC644172	644172	broad.mit.edu	37	17	43679861	43679864	+	5'Flank	DEL	TTTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43679861_43679864delTTTC	uc010wjw.1	-							NR_026901				Homo sapiens cDNA clone IMAGE:3941904, partial cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	43684094	43684094	+	IGR	DEL	T	-	-	rs71363539		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43684094delT								LOC644172 (4346 upstream) : CRHR1 (13618 downstream)																																			---	---	---	---
CRHR1	1394	broad.mit.edu	37	17	43798585	43798585	+	Intron	DEL	A	-	-	rs67085864		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43798585delA	uc002ijp.2	+						CRHR1_uc010wjx.1_Intron					SubName: Full=cDNA FLJ60308, highly similar to Corticotropin-releasing factor receptor 1;						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)														---	---	---	---
CRHR1	1394	broad.mit.edu	37	17	43893771	43893776	+	Intron	DEL	CTGCCT	-	-	rs10585044		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43893771_43893776delCTGCCT	uc010dap.2	+						CRHR1_uc010wjx.1_Intron|CRHR1_uc002ijp.2_Intron|CRHR1_uc002ijm.2_Intron|CRHR1_uc002ijn.2_Intron|CRHR1_uc010dar.2_Intron|CRHR1_uc010dao.2_Intron|CRHR1_uc010daq.2_Intron|CRHR1_uc010das.1_Intron|CRHR1_uc002ijo.1_Intron	NM_001145146	NP_001138618			corticotropin releasing hormone receptor 1						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	44316594	44316594	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44316594delA								KIAA1267 (13877 upstream) : ARL17B (47269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47553154	47553155	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47553154_47553155delGA								PHB (60912 upstream) : NGFR (19500 downstream)																																			---	---	---	---
SPOP	8405	broad.mit.edu	37	17	47683351	47683352	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47683351_47683352insA	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron	NM_003563	NP_003554			speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6															Prostate(2;0.17)			---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49067393	49067393	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49067393delT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49150445	49150445	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49150445delG	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
MBTD1	54799	broad.mit.edu	37	17	49290909	49290909	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49290909delA	uc002itr.3	-						MBTD1_uc002itp.3_Intron|MBTD1_uc002itq.3_Intron	NM_017643	NP_060113			mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	50423970	50423970	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50423970delT								CA10 (186593 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52938437	52938438	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52938437_52938438delCA								None (None upstream) : TOM1L1 (39614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	53277474	53277474	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53277474delT								STXBP4 (36025 upstream) : HLF (64847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	55776912	55776912	+	IGR	DEL	A	-	-	rs11333262		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55776912delA								MSI2 (19613 upstream) : MRPS23 (139932 downstream)																																			---	---	---	---
VEZF1	7716	broad.mit.edu	37	17	56055571	56055572	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56055571_56055572insA	uc002ivf.1	-							NM_007146	NP_009077			zinc finger protein 161						cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
HSF5	124535	broad.mit.edu	37	17	56561953	56561953	+	Intron	DEL	A	-	-	rs71365894		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56561953delA	uc002iwi.1	-							NM_001080439	NP_001073908			heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
PPM1E	22843	broad.mit.edu	37	17	56841982	56841983	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56841982_56841983insT	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721			protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	57512006	57512006	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57512006delC								YPEL2 (32911 upstream) : DHX40 (130880 downstream)																																			---	---	---	---
TUBD1	51174	broad.mit.edu	37	17	57955850	57955851	+	Intron	INS	-	TT	TT	rs71370137		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57955850_57955851insTT	uc002ixw.1	-						TUBD1_uc010ddf.1_Intron|TUBD1_uc010ddg.1_Intron|TUBD1_uc010ddh.1_Intron|TUBD1_uc010wok.1_Intron|TUBD1_uc002ixx.1_Intron|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345			delta-tubulin						cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)															---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59407152	59407153	+	Intron	INS	-	CACCCTTAC	CACCCTTAC	rs144341168	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59407152_59407153insCACCCTTAC	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	59651019	59651019	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59651019delT								TBX4 (88550 upstream) : NACA2 (16775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	59748618	59748618	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59748618delA								NACA2 (80055 upstream) : BRIP1 (11367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	60335966	60335967	+	IGR	INS	-	T	T	rs139795804		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60335966_60335967insT								MED13 (193323 upstream) : TBC1D3P2 (6102 downstream)																																			---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61447305	61447306	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61447305_61447306insA	uc002jal.3	+						TANC2_uc010wpe.1_Intron|TANC2_uc002jam.1_Intron	NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
DDX42	11325	broad.mit.edu	37	17	61862905	61862905	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61862905delT	uc002jbu.2	+						DDX42_uc002jbv.2_Intron	NM_007372	NP_031398			DEAD box polypeptide 42 protein						protein localization|regulation of anti-apoptosis	Cajal body|cytoplasm|nuclear speck	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)|large_intestine(1)	5																		---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62918365	62918365	+	5'Flank	DEL	A	-	-	rs72022907		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62918365delA	uc010wqg.1	-							NM_199340	NP_955372			leucine rich repeat containing 37, member A3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	63243151	63243152	+	IGR	INS	-	A	A	rs140286065		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63243151_63243152insA								RGS9 (19332 upstream) : AXIN2 (281533 downstream)																																			---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64379518	64379518	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64379518delT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66383221	66383226	+	Intron	DEL	CACACA	-	-	rs72320984	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66383221_66383226delCACACA	uc002jhc.2	+						ARSG_uc002jhb.1_Intron	NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	66764291	66764295	+	IGR	DEL	GCTGA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66764291_66764295delGCTGA								FAM20A (167196 upstream) : ABCA8 (99138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68315849	68315850	+	IGR	INS	-	GA	GA	rs142442374	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68315849_68315850insGA								KCNJ2 (139668 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69164444	69164445	+	Intron	DEL	GC	-	-	rs145077042	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69164444_69164445delGC	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	69196488	69196488	+	Intron	DEL	T	-	-	rs150740206		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69196488delT	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	70345154	70345155	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70345154_70345155insA								SOX9 (222602 upstream) : SLC39A11 (296931 downstream)																																			---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70765680	70765680	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70765680delT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70940669	70940670	+	Intron	INS	-	GA	GA	rs143386832	by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70940669_70940670insGA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	71895626	71895626	+	IGR	DEL	T	-	-	rs71856648		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71895626delT								C17orf54 (70950 upstream) : RPL38 (304169 downstream)																																			---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72247795	72247796	+	Intron	INS	-	C	C	rs147097206	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72247795_72247796insC	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron|TTYH2_uc002jkd.2_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	73198427	73198428	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73198427_73198428delTT								SUMO2 (19329 upstream) : NUP85 (3169 downstream)																																			---	---	---	---
EXOC7	23265	broad.mit.edu	37	17	74096197	74096197	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74096197delA	uc002jqs.2	-						EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron|EXOC7_uc002jqu.2_Intron	NM_001145297	NP_001138769			exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)															---	---	---	---
PRPSAP1	5635	broad.mit.edu	37	17	74321679	74321680	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74321679_74321680insT	uc010wta.1	-						PRPSAP1_uc010wtb.1_Intron	NM_002766	NP_002757			phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1																		---	---	---	---
MGAT5B	146664	broad.mit.edu	37	17	74925146	74925146	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74925146delC	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193			N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	75102070	75102072	+	IGR	DEL	AAA	-	-	rs112870360		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75102070_75102072delAAA								C17orf86 (11003 upstream) : SEC14L1 (34933 downstream)																																			---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75379272	75379273	+	Intron	INS	-	TCCCTCCT	TCCCTCCT	rs138566868	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75379272_75379273insTCCCTCCT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
AFMID	125061	broad.mit.edu	37	17	76185797	76185797	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76185797delC	uc002jva.3	+						TK1_uc002juw.2_5'Flank|TK1_uc002jux.2_5'Flank|AFMID_uc002juy.3_Intron|AFMID_uc010dhj.2_Intron|AFMID_uc002jvb.3_Intron|AFMID_uc002juz.3_Intron	NM_001010982	NP_001010982			arylformamidase isoform 1							cytosol|nucleus	arylformamidase activity			large_intestine(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.134)															---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77443736	77443736	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77443736delT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	77779901	77779914	+	IGR	DEL	GAGAGAGAGAGAGA	-	-	rs1696749		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77779901_77779914delGAGAGAGAGAGAGA								CBX8 (9011 upstream) : CBX4 (27042 downstream)																																			---	---	---	---
BAIAP2	10458	broad.mit.edu	37	17	79048226	79048227	+	Intron	DEL	GT	-	-	rs10580460		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79048226_79048227delGT	uc002jzg.2	+						BAIAP2_uc002jyz.3_Intron|BAIAP2_uc002jza.2_Intron|BAIAP2_uc002jzc.2_Intron|BAIAP2_uc002jzb.2_Intron|BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron	NM_017451	NP_059345			BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	79908164	79908164	+	IGR	DEL	T	-	-	rs71367091		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79908164delT								MYADML2 (3055 upstream) : NOTUM (2220 downstream)																																			---	---	---	---
HEXDC	284004	broad.mit.edu	37	17	80389307	80389307	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80389307delT	uc002kew.2	+						HEXDC_uc002kev.3_Intron|HEXDC_uc010diq.2_Intron|HEXDC_uc010wvm.1_5'Flank					SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;						carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)															---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80541091	80541091	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80541091delT	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
USP14	9097	broad.mit.edu	37	18	205782	205782	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:205782delA	uc002kkf.1	+						USP14_uc002kkg.1_Intron|USP14_uc010wyr.1_Intron	NM_005151	NP_005142			ubiquitin specific protease 14 isoform a						regulation of chemotaxis|regulation of proteasomal protein catabolic process|ubiquitin-dependent protein catabolic process	cell surface|cytoplasmic membrane-bounded vesicle|plasma membrane|proteasome complex	cysteine-type endopeptidase activity|endopeptidase inhibitor activity|proteasome binding|tRNA guanylyltransferase activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)	2		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)																---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	5956910	5956910	+	Intron	DEL	T	-	-	rs11333347		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5956910delT	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735			l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)																---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	5974431	5974432	+	Intron	INS	-	AAC	AAC	rs143712000	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5974431_5974432insAAC	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735			l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	7144666	7144666	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7144666delA								LAMA1 (26853 upstream) : LRRC30 (86471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	7189870	7189870	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7189870delA								LAMA1 (72057 upstream) : LRRC30 (41267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	7502526	7502527	+	IGR	INS	-	A	A	rs150958699	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7502526_7502527insA								LRRC30 (270485 upstream) : PTPRM (64787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	7544478	7544478	+	IGR	DEL	T	-	-	rs79203344		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7544478delT								LRRC30 (312437 upstream) : PTPRM (22836 downstream)																																			---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8046038	8046038	+	Intron	DEL	G	-	-	rs145019865	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8046038delG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	8578108	8578108	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8578108delT								PTPRM (171250 upstream) : RAB12 (31327 downstream)																																			---	---	---	---
TWSG1	57045	broad.mit.edu	37	18	9357839	9357839	+	Intron	DEL	G	-	-	rs67227457		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9357839delG	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699			twisted gastrulation precursor											ovary(1)|pancreas(1)	2																		---	---	---	---
PPP4R1	9989	broad.mit.edu	37	18	9579515	9579516	+	Intron	INS	-	GTGT	GTGT	rs139213474	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9579515_9579516insGTGT	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847			protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1																		---	---	---	---
C18orf1	753	broad.mit.edu	37	18	13273385	13273385	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13273385delA	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146			hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	14001187	14001187	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14001187delT								MC2R (85652 upstream) : ZNF519 (74802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14697355	14697356	+	IGR	INS	-	T	T	rs148226164	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14697355_14697356insT								POTEC (153756 upstream) : ANKRD30B (50883 downstream)																																			---	---	---	---
ESCO1	114799	broad.mit.edu	37	18	19128901	19128901	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19128901delA	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143			establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0																		---	---	---	---
C18orf45	85019	broad.mit.edu	37	18	20889480	20889480	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20889480delT	uc002kuf.2	-						C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_Intron|C18orf45_uc002kug.2_Intron|C18orf45_uc002kuh.2_Intron|C18orf45_uc002kue.2_Intron	NM_032933	NP_116322			hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)																	---	---	---	---
OSBPL1A	114876	broad.mit.edu	37	18	21979211	21979212	+	5'Flank	INS	-	T	T	rs71888355		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21979211_21979212insT	uc002kve.2	-							NM_080597	NP_542164			oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	22991861	22991862	+	IGR	INS	-	T	T	rs139378837	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22991861_22991862insT								ZNF521 (59647 upstream) : SS18 (604357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	23530355	23530355	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23530355delA								ZNF521 (598141 upstream) : SS18 (65864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	24780828	24780829	+	IGR	DEL	GA	-	-	rs79182869	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24780828_24780829delGA								C18orf16 (10178 upstream) : CDH2 (750101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	25247652	25247653	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25247652_25247653delCA								C18orf16 (477002 upstream) : CDH2 (283277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	28142415	28142416	+	IGR	INS	-	GT	GT	rs144956575	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28142415_28142416insGT								MIR302F (263489 upstream) : DSC3 (427637 downstream)																																			---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32329905	32329905	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32329905delA	uc010dmj.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	33088480	33088480	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33088480delC								INO80C (10525 upstream) : GALNT1 (73298 downstream)																																			---	---	---	---
KIAA1328	57536	broad.mit.edu	37	18	34633927	34633927	+	Intron	DEL	A	-	-	rs77752718		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34633927delA	uc002kzz.2	+						KIAA1328_uc002lab.2_Intron|KIAA1328_uc002lac.1_Intron|KIAA1328_uc010dnc.1_Intron	NM_020776	NP_065827			hypothetical protein LOC57536											central_nervous_system(1)	1				COAD - Colon adenocarcinoma(74;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	35574136	35574137	+	IGR	INS	-	TATT	TATT	rs139565953	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35574136_35574137insTATT								CELF4 (428136 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	36192352	36192353	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36192352_36192353delAC								None (None upstream) : LOC647946 (594535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38041796	38041797	+	IGR	DEL	TG	-	-	rs36117518		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38041796_38041797delTG								LOC647946 (661514 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38333000	38333000	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38333000delT								LOC647946 (952718 upstream) : KC6 (727238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	41515082	41515082	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41515082delT								SYT4 (657467 upstream) : SETBP1 (745056 downstream)																																			---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43121179	43121180	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43121179_43121180delTG	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC14A1	6563	broad.mit.edu	37	18	43301237	43301237	+	5'Flank	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43301237delG	uc010xcn.1	+						SLC14A1_uc010dnk.2_5'Flank|SLC14A1_uc002lbf.3_5'Flank|SLC14A1_uc002lbg.3_5'Flank|SLC14A1_uc010xco.1_5'Flank|SLC14A1_uc002lbh.3_5'Flank|SLC14A1_uc002lbi.3_5'Flank	NM_001146036	NP_001139508			solute carrier family 14 (urea transporter),							integral to plasma membrane	urea transmembrane transporter activity			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	43743463	43743474	+	IGR	DEL	TCATTCATTCAT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43743463_43743474delTCATTCATTCAT								HAUS1 (35165 upstream) : C18orf25 (10514 downstream)																																			---	---	---	---
SMAD7	4092	broad.mit.edu	37	18	46455469	46455469	+	Intron	DEL	A	-	-	rs67620130		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46455469delA	uc002ldg.2	-						SMAD7_uc002ldf.2_Intron|SMAD7_uc010xde.1_Intron	NM_005904	NP_005895			SMAD family member 7						adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	46543876	46543876	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46543876delC								SMAD7 (66795 upstream) : DYM (26296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	47255328	47255328	+	IGR	DEL	T	-	-	rs67234658		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47255328delT								LIPG (136052 upstream) : ACAA2 (54547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	47279304	47279307	+	IGR	DEL	TCTG	-	-	rs35923090		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47279304_47279307delTCTG								LIPG (160028 upstream) : ACAA2 (30568 downstream)																																			---	---	---	---
MAPK4	5596	broad.mit.edu	37	18	48239092	48239092	+	Intron	DEL	A	-	-	rs5824848		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48239092delA	uc002lev.2	+						MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Intron	NM_002747	NP_002738			mitogen-activated protein kinase 4						cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	48634486	48634486	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48634486delG								SMAD4 (23077 upstream) : MEX3C (66436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49540491	49540491	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49540491delT								MEX3C (816801 upstream) : DCC (326080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49543299	49543299	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49543299delT								MEX3C (819609 upstream) : DCC (323272 downstream)																																			---	---	---	---
TCF4	6925	broad.mit.edu	37	18	52981799	52981800	+	Intron	INS	-	A	A	rs35480166		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52981799_52981800insA	uc002lfz.2	-						TCF4_uc002lfw.3_Intron|TCF4_uc010xdu.1_Intron|TCF4_uc010xdv.1_Intron|TCF4_uc002lfx.2_Intron|TCF4_uc010xdw.1_Intron|TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190			transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)														---	---	---	---
ATP8B1	5205	broad.mit.edu	37	18	55330252	55330252	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55330252delC	uc002lgw.2	-						uc002lgu.1_Intron|uc002lgv.1_Intron	NM_005603	NP_005594			ATPase, class I, type 8B, member 1						ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)												Byler_disease				---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	55733201	55733201	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55733201delA	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lha.1_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	56859496	56859497	+	IGR	INS	-	TC	TC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56859496_56859497insTC								SEC11C (33435 upstream) : GRP (27903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	57430502	57430502	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57430502delA								CCBE1 (65858 upstream) : PMAIP1 (136690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	60114354	60114354	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60114354delG								TNFRSF11A (60852 upstream) : ZCCHC2 (76304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	60728972	60728973	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60728972_60728973insT								PHLPP1 (81307 upstream) : BCL2 (61606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61503586	61503587	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61503586_61503587insT								SERPINB7 (30983 upstream) : SERPINB2 (51352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	65415057	65415057	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65415057delG								DSEL (231090 upstream) : TMX3 (925870 downstream)																																			---	---	---	---
SOCS6	9306	broad.mit.edu	37	18	67958391	67958391	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67958391delG	uc002lkr.1	+							NM_004232	NP_004223			suppressor of cytokine signaling 6						defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	68102615	68102616	+	IGR	INS	-	A	A	rs139896753	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68102615_68102616insA								SOCS6 (105181 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70316524	70316525	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70316524_70316525delAC								CBLN2 (104801 upstream) : NETO1 (93026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71181377	71181380	+	IGR	DEL	TTCT	-	-	rs113356341		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71181377_71181380delTTCT								NETO1 (646567 upstream) : FBXO15 (559208 downstream)																																			---	---	---	---
CNDP1	84735	broad.mit.edu	37	18	72246439	72246449	+	Intron	DEL	CCTTCCCTTAC	-	-	rs149212258	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72246439_72246449delCCTTCCCTTAC	uc002llq.2	+						CNDP1_uc002lls.2_Intron	NM_032649	NP_116038			carnosinase 1 precursor						proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	73816873	73816873	+	IGR	DEL	A	-	-	rs58563772		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73816873delA								C18orf62 (677284 upstream) : ZNF516 (254746 downstream)																																			---	---	---	---
MBP	4155	broad.mit.edu	37	18	74830603	74830604	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74830603_74830604delCA	uc010xfd.1	-						MBP_uc002lmr.2_Intron	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	76799235	76799236	+	IGR	INS	-	C	C	rs149858455		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76799235_76799236insC								SALL3 (41044 upstream) : ATP9B (30161 downstream)																																			---	---	---	---
NFATC1	4772	broad.mit.edu	37	18	77186236	77186237	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77186236_77186237insT	uc010xfg.1	+						NFATC1_uc002lnc.1_Intron|NFATC1_uc010xff.1_Intron|NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfi.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153			nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	77611699	77611702	+	IGR	DEL	ATGT	-	-	rs35466153		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77611699_77611702delATGT								CTDP1 (97192 upstream) : KCNG2 (11966 downstream)																																			---	---	---	---
ADNP2	22850	broad.mit.edu	37	18	77864026	77864026	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77864026delA	uc002lnw.2	+							NM_014913	NP_055728			ADNP homeobox 2						cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)														---	---	---	---
MIER2	54531	broad.mit.edu	37	19	310682	310682	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:310682delC	uc002lok.1	-							NM_017550	NP_060020			mesoderm induction early response 1, family						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MIDN	90007	broad.mit.edu	37	19	1253043	1253044	+	Intron	INS	-	G	G	rs147781701	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1253043_1253044insG	uc002lrp.2	+							NM_177401	NP_796375			midnolin							nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MBD3	53615	broad.mit.edu	37	19	1578075	1578077	+	3'UTR	DEL	CGC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1578075_1578077delCGC	uc002ltl.1	-	6					uc002lti.1_5'Flank|MBD3_uc002ltj.2_3'UTR|MBD3_uc002ltk.2_3'UTR	NM_003926	NP_003917			methyl-CpG binding domain protein 3						transcription, DNA-dependent	NuRD complex	DNA binding|protein binding			ovary(1)|pancreas(1)|skin(1)	3		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.179)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
LMNB2	84823	broad.mit.edu	37	19	2439430	2439430	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2439430delG	uc002lvy.2	-						LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126			lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	2500294	2500294	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2500294delC								GADD45B (22037 upstream) : GNG7 (10924 downstream)																																			---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2602899	2602900	+	Intron	INS	-	TTTCTTTCTTTCT	TTTCTTTCTTTCT	rs151103355	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2602899_2602900insTTTCTTTCTTTCT	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZFR2	23217	broad.mit.edu	37	19	3807554	3807555	+	Intron	INS	-	AT	AT	rs141308998	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3807554_3807555insAT	uc002lyw.2	-							NM_015174	NP_055989			zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)														---	---	---	---
ZBTB7A	51341	broad.mit.edu	37	19	4057053	4057053	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4057053delA	uc002lzh.2	-						ZBTB7A_uc002lzi.2_Intron	NM_015898	NP_056982			zinc finger and BTB domain containing 7A						cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	4274497	4274497	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4274497delA								CCDC94 (5414 upstream) : SHD (4101 downstream)																																			---	---	---	---
HDGFRP2	84717	broad.mit.edu	37	19	4474676	4474676	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4474676delT	uc002mao.2	+						HDGFRP2_uc002map.2_Intron|HDGFRP2_uc010dtz.1_5'Flank	NM_001001520	NP_001001520			hepatoma-derived growth factor-related protein 2						transcription, DNA-dependent	nucleus	DNA binding|protein binding				0																		---	---	---	---
TMEM146	257062	broad.mit.edu	37	19	5742179	5742180	+	Intron	DEL	GT	-	-	rs79933914	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5742179_5742180delGT	uc002mda.2	+						TMEM146_uc010duj.1_Intron	NM_152784	NP_689997			transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
RFX2	5990	broad.mit.edu	37	19	6070170	6070171	+	Intron	INS	-	ATAGA	ATAGA			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6070170_6070171insATAGA	uc002meb.2	-						RFX2_uc002mec.2_Intron|RFX2_uc010xiy.1_Intron	NM_000635	NP_000626			regulatory factor X2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9757762	9757762	+	IGR	DEL	T	-	-	rs12979091		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9757762delT								ZNF561 (25846 upstream) : ZNF562 (1589 downstream)																																			---	---	---	---
OLFM2	93145	broad.mit.edu	37	19	9999209	9999210	+	Intron	DEL	AC	-	-	rs3075684		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9999209_9999210delAC	uc002mmp.2	-							NM_058164	NP_477512			olfactomedin 2 precursor							extracellular region				large_intestine(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	10331220	10331220	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10331220delT								DNMT1 (25465 upstream) : S1PR2 (889 downstream)																																			---	---	---	---
RGL3	57139	broad.mit.edu	37	19	11527832	11527833	+	Intron	INS	-	T	T	rs160523		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11527832_11527833insT	uc002mrp.2	-						RGL3_uc002mrn.2_Intron|RGL3_uc002mrm.2_Intron|RGL3_uc002mro.2_Intron|RGL3_uc002mrq.2_Intron	NM_001035223	NP_001030300			ral guanine nucleotide dissociation						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1																		---	---	---	---
ZNF627	199692	broad.mit.edu	37	19	11723582	11723582	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11723582delT	uc002msk.2	+						ZNF627_uc010dyf.2_Intron	NM_145295	NP_660338			zinc finger protein 627						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
ZNF44	51710	broad.mit.edu	37	19	12349823	12349823	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12349823delG	uc002mtl.2	-						ZNF44_uc010dyr.1_Intron					Homo sapiens GIOT-2 mRNA for gonadotropin inducible transcription repressor-2, complete cds.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)														---	---	---	---
NFIX	4784	broad.mit.edu	37	19	13139150	13139150	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13139150delA	uc010xmx.1	+						NFIX_uc002mwd.2_Intron|NFIX_uc002mwe.2_Intron|NFIX_uc002mwf.2_Intron|NFIX_uc002mwg.1_Intron					RecName: Full=Nuclear factor 1;						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)															---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13322530	13322531	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13322530_13322531delTG	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13383705	13383705	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13383705delT	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	13782062	13782062	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13782062delT								CACNA1A (164788 upstream) : CCDC130 (60512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13956803	13956803	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13956803delG								MIR23A (9330 upstream) : MIR181C (28710 downstream)																																			---	---	---	---
CC2D1A	54862	broad.mit.edu	37	19	14019286	14019287	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14019286_14019287insT	uc002mxo.2	+						CC2D1A_uc002mxn.2_Intron|CC2D1A_uc002mxp.2_Intron|C19orf57_uc002mxl.1_5'Flank|C19orf57_uc002mxm.1_5'Flank	NM_017721	NP_060191			coiled-coil and C2 domain containing 1A						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)															---	---	---	---
PODNL1	79883	broad.mit.edu	37	19	14045957	14045958	+	Intron	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14045957_14045958delGT	uc002mxr.2	-						PODNL1_uc010xni.1_Intron|PODNL1_uc010xnj.1_Intron|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101			podocan-like 1 isoform 1							proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	14413576	14413576	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14413576delA								LPHN1 (96579 upstream) : CD97 (78637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14621480	14621481	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14621480_14621481delAA								GIPC1 (14536 upstream) : DNAJB1 (4101 downstream)																																			---	---	---	---
ZNF333	84449	broad.mit.edu	37	19	14805551	14805555	+	Intron	DEL	AAAAG	-	-	rs75337291		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14805551_14805555delAAAAG	uc002mzn.2	+						ZNF333_uc010dzq.2_Intron|ZNF333_uc002mzk.3_Intron|ZNF333_uc002mzl.3_Intron|ZNF333_uc002mzm.2_Intron|ZNF333_uc010dzr.1_Intron	NM_032433	NP_115809			zinc finger protein 333						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15108816	15108819	+	Intron	DEL	TGTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15108816_15108819delTGTG	uc010xod.1	-											SubName: Full=cDNA FLJ53385, highly similar to Excitatory amino acid transporter 4;						synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	15892920	15892920	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15892920delA	uc002nbo.2	-											Homo sapiens cDNA FLJ60024 complete cds, highly similar to Cytochrome P450 4F12 (EC 1.14.14.1).																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	16366031	16366032	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16366031_16366032delTG								AP1M1 (19875 upstream) : KLF2 (69619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	17456746	17456746	+	IGR	DEL	G	-	-	rs66627352		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17456746delG								GTPBP3 (3207 upstream) : PLVAP (5518 downstream)																																	OREG0025342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	17804511	17804511	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17804511delT								UNC13A (5110 upstream) : MAP1S (25792 downstream)																																			---	---	---	---
PDE4C	5143	broad.mit.edu	37	19	18354318	18354319	+	Intron	INS	-	G	G	rs140876534	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18354318_18354319insG	uc002nik.3	-						PDE4C_uc002nil.3_Intron	NM_000923	NP_000914			phosphodiesterase 4C isoform PDE4C-1						signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	21016653	21016655	+	IGR	DEL	AGA	-	-	rs111698253		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21016653_21016655delAGA								ZNF626 (172251 upstream) : ZNF85 (89425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	21465711	21465711	+	IGR	DEL	T	-	-	rs34749756		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21465711delT								ZNF431 (96906 upstream) : ZNF708 (8252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	21957944	21957949	+	IGR	DEL	CTCTCC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21957944_21957949delCTCTCC								ZNF100 (7514 upstream) : ZNF43 (29804 downstream)																																			---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22152547	22152548	+	3'UTR	DEL	TT	-	-	rs146685340		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22152547_22152548delTT	uc002nqp.2	-	7					ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	22218707	22218708	+	IGR	INS	-	CACA	CACA	rs143165076	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22218707_22218708insCACA								ZNF208 (24962 upstream) : ZNF257 (16558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22383661	22383662	+	IGR	INS	-	T	T	rs113127118		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22383661_22383662insT								ZNF676 (3908 upstream) : ZNF98 (190237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22486838	22486838	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22486838delT								ZNF676 (107085 upstream) : ZNF98 (87061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23499853	23499854	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23499853_23499854insT								ZNF99 (547069 upstream) : ZNF91 (21565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23764579	23764580	+	IGR	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23764579_23764580insC								ZNF91 (186310 upstream) : ZNF675 (71129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24562219	24562219	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24562219delT								LOC100101266 (215970 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27829509	27829509	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27829509delG								None (None upstream) : LOC148189 (451893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27847333	27847335	+	IGR	DEL	TTT	-	-	rs139611358		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27847333_27847335delTTT								None (None upstream) : LOC148189 (434067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27887282	27887282	+	IGR	DEL	G	-	-	rs35684483		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27887282delG								None (None upstream) : LOC148189 (394120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29333370	29333370	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29333370delG								None (None upstream) : LOC148145 (122670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31196216	31196217	+	IGR	INS	-	TG	TG	rs76233203		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31196216_31196217insTG								ZNF536 (147251 upstream) : DKFZp566F0947 (444566 downstream)																																			---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33546639	33546640	+	Intron	INS	-	A	A	rs60435771		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33546639_33546640insA	uc002nuf.2	-						RHPN2_uc010xro.1_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
ZNF566	84924	broad.mit.edu	37	19	36973407	36973408	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36973407_36973408insA	uc002oea.3	-						ZNF566_uc010xte.1_Intron|ZNF566_uc010xtf.1_Intron|ZNF566_uc002oeb.3_Intron|ZNF566_uc002oec.3_Intron|ZNF566_uc010xtg.1_Intron	NM_032838	NP_116227			zinc finger protein 566 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	37228927	37228930	+	IGR	DEL	CAAT	-	-	rs137957409		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37228927_37228930delCAAT								ZNF567 (14679 upstream) : ZNF790 (79403 downstream)																																			---	---	---	---
ZNF585B	92285	broad.mit.edu	37	19	37701787	37701787	+	5'Flank	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37701787delT	uc002ofq.2	-						ZNF585B_uc002ofr.1_5'Flank	NM_152279	NP_689492			zinc finger protein 585B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
ZNF570	148268	broad.mit.edu	37	19	37961912	37961913	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37961912_37961913delTT	uc002ogk.1	+						ZNF569_uc002ogj.2_5'Flank|ZNF570_uc010efl.1_Intron|ZNF570_uc010xtr.1_Intron	NM_144694	NP_653295			zinc finger protein 570						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	37986506	37986506	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37986506delA								ZNF570 (10264 upstream) : ZNF793 (11335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	38339613	38339614	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38339613_38339614insA	uc002ohi.2	-											Homo sapiens similar to RIKEN cDNA 4930432E11, mRNA (cDNA clone IMAGE:5164439), with apparent retained intron.																														---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38416785	38416785	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38416785delC	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38418368	38418369	+	Intron	DEL	GT	-	-	rs11670302		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38418368_38418369delGT	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	39773945	39773945	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39773945delA								IL28A (13213 upstream) : IL29 (13020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	40340509	40340510	+	IGR	INS	-	G	G	rs140378270	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40340509_40340510insG								FBL (3455 upstream) : FCGBP (13454 downstream)																																			---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40385369	40385370	+	Intron	INS	-	TC	TC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40385369_40385370insTC	uc002omp.3	-							NM_003890	NP_003881			Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41066828	41066829	+	Intron	DEL	AT	-	-	rs58666107		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41066828_41066829delAT	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022			spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	41551789	41551789	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41551789delT								CYP2A7 (17621 upstream) : CYP2A13 (42579 downstream)																																			---	---	---	---
CYP2F1	1572	broad.mit.edu	37	19	42006272	42006272	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42006272delA	uc010xvw.1	+						uc002orb.3_Intron|uc010ehv.2_Intron|uc010ehw.2_Intron					SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	42110370	42110370	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42110370delC								CEACAM21 (17174 upstream) : CEACAM4 (14974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42318432	42318433	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42318432_42318433delCA								CEACAM3 (2841 upstream) : LYPD4 (22717 downstream)																																			---	---	---	---
ZNF235	9310	broad.mit.edu	37	19	44749889	44749892	+	Intron	DEL	GTGT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44749889_44749892delGTGT	uc010eji.2	-						ZNF235_uc002oyx.1_Intron					SubName: Full=Kruppel-associated box; Flags: Fragment;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44963686	44963686	+	IGR	DEL	T	-	-	rs35917955		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44963686delT								ZNF229 (10920 upstream) : ZNF180 (16174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	45100644	45100645	+	IGR	INS	-	TT	TT	rs141937428	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45100644_45100645insTT								CEACAM22P (40494 upstream) : PVR (46453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	45127521	45127523	+	Intron	DEL	TCC	-	-	rs35551910		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45127521_45127523delTCC	uc002ozk.2	+											SubName: Full=LOC147710 protein; Flags: Fragment;																														---	---	---	---
CKM	1158	broad.mit.edu	37	19	45822684	45822685	+	Intron	INS	-	C	C	rs148572878	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45822684_45822685insC	uc002pbd.2	-							NM_001824	NP_001815			muscle creatine kinase						creatine metabolic process	cytosol	ATP binding|creatine kinase activity			skin(1)	1		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)													---	---	---	---
ERCC1	2067	broad.mit.edu	37	19	45939028	45939028	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45939028delT	uc002pbu.1	-											SubName: Full=cDNA FLJ34720 fis, clone MESAN2005724, highly similar to DNA EXCISION REPAIR PROTEIN ERCC-1;						mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)									NER					---	---	---	---
Unknown	0	broad.mit.edu	37	19	46646660	46646660	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46646660delT								IGFL3 (18729 upstream) : IGFL2 (4379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	47060849	47060850	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47060849_47060850delTT	uc002pev.1	-											SubName: Full=cDNA FLJ37185 fis, clone BRALZ2001743, moderately similar to Serine/threonine-protein phosphatase 5;          EC=3.1.3.16;																														---	---	---	---
PRKD2	25865	broad.mit.edu	37	19	47213127	47213128	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47213127_47213128insT	uc002pfh.2	-						PRKD2_uc002pfg.2_Intron|PRKD2_uc002pfi.2_Intron|PRKD2_uc002pfj.2_Intron|PRKD2_uc010xye.1_Intron|PRKD2_uc002pfk.2_Intron|hsa-mir-320e|MI0014234_5'Flank	NM_001079881	NP_001073350			protein kinase D2 isoform A						cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)														---	---	---	---
NPAS1	4861	broad.mit.edu	37	19	47527756	47527757	+	Intron	INS	-	AAC	AAC	rs139834878	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47527756_47527757insAAC	uc002pfw.2	+						NPAS1_uc002pfx.2_Intron|NPAS1_uc002pfy.2_Intron	NM_002517	NP_002508			neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)														---	---	---	---
SLC8A2	6543	broad.mit.edu	37	19	47950110	47950111	+	Intron	INS	-	T	T	rs141720064	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47950110_47950111insT	uc002pgx.2	-						SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Intron	NM_015063	NP_055878			solute carrier family 8 member 2 precursor						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	48462733	48462734	+	IGR	DEL	AT	-	-	rs140996859		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48462733_48462734delAT								SNAR-C3 (9062 upstream) : BSPH1 (8569 downstream)																																			---	---	---	---
NTN5	126147	broad.mit.edu	37	19	49173217	49173218	+	Intron	INS	-	CAT	CAT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173217_49173218insCAT	uc002pkb.2	-						SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Intron	NM_145807	NP_665806			netrin 5 precursor							extracellular region				large_intestine(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	49524922	49524925	+	IGR	DEL	AGAG	-	-	rs71698135		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49524922_49524925delAGAG								LHB (4575 upstream) : CGB (1202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	50342983	50342983	+	RNA	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50342983delA	uc002ppy.3	-	4		c.1068delT								Homo sapiens cDNA FLJ34894 fis, clone NT2NE2017982.																														---	---	---	---
ZNF845	91664	broad.mit.edu	37	19	53852685	53852685	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53852685delT	uc010ydv.1	+						ZNF845_uc010ydw.1_Intron	NM_138374	NP_612383			zinc finger protein 845						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF765	91661	broad.mit.edu	37	19	53894803	53894803	+	Intron	DEL	A	-	-	rs112965799		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53894803delA	uc010ydx.1	+							NM_001040185	NP_001035275			zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54008542	54008547	+	IGR	DEL	TGTTTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54008542_54008547delTGTTTT								ZNF813 (1594 upstream) : ZNF331 (15630 downstream)																																			---	---	---	---
ZNF331	55422	broad.mit.edu	37	19	54073789	54073790	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54073789_54073790insT	uc002qbx.1	+						ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron|ZNF331_uc002qca.1_Intron|ZNF331_uc010eqr.1_Intron|ZNF331_uc002qcb.1_Intron|ZNF331_uc002qcc.1_Intron|ZNF331_uc002qcd.1_Intron	NM_018555	NP_061025			zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)				T	?	follicular thyroid adenoma								---	---	---	---
KIR2DL3	3804	broad.mit.edu	37	19	55279373	55279374	+	Intron	INS	-	GTG	GTG	rs140276261	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55279373_55279374insGTG	uc010erw.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_5'Flank|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_5'Flank|KIR2DL1_uc002qhb.1_5'Flank	NM_015868	NP_056952			killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)														---	---	---	---
SHISA7	729956	broad.mit.edu	37	19	55955235	55955236	+	5'Flank	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55955235_55955236delCT	uc002qkz.3	-							NM_001145176	NP_001138648			shisa homolog 7 precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	56275814	56275814	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56275814delC								RFPL4A (1275 upstream) : NLRP11 (20956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	56995653	56995656	+	Intron	DEL	TGTC	-	-	rs140187988		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56995653_56995656delTGTC	uc002qnf.2	+						uc002qng.2_Intron					Homo sapiens cDNA clone IMAGE:5753168.																														---	---	---	---
ZNF805	390980	broad.mit.edu	37	19	57770427	57770427	+	3'UTR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57770427delT	uc010ygt.1	+	4					ZNF805_uc010ygu.1_3'UTR	NM_001023563	NP_001018857			zinc finger protein 805 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
MGC2752	65996	broad.mit.edu	37	19	59091243	59091244	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59091243_59091244insT	uc010eux.2	+						MGC2752_uc010euw.2_Intron	NR_026052				Homo sapiens cDNA FLJ20820 fis, clone ADSE00490.												0																		---	---	---	---
DEFB127	140850	broad.mit.edu	37	20	138564	138565	+	Intron	DEL	AT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:138564_138565delAT	uc002wcy.1	+							NM_139074	NP_620713			defensin, beta 127 preproprotein						defense response to bacterium|innate immune response	extracellular region					0		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	688170	688170	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:688170delA								SRXN1 (31347 upstream) : C20orf54 (52555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	783249	783250	+	IGR	INS	-	A	A	rs79534383		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:783249_783250insA								C20orf54 (34021 upstream) : FAM110A (31106 downstream)																																			---	---	---	---
RSPO4	343637	broad.mit.edu	37	20	950471	950471	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:950471delG	uc002wej.2	-						RSPO4_uc002wek.2_Intron	NM_001029871	NP_001025042			R-spondin family, member 4 isoform 1 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	1242440	1242441	+	IGR	INS	-	T	T	rs138811103		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1242440_1242441insT								RAD21L1 (7295 upstream) : SNPH (4519 downstream)																																			---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3551093	3551093	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3551093delT	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
MAVS	57506	broad.mit.edu	37	20	3835071	3835072	+	Intron	INS	-	A	A	rs143700590		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3835071_3835072insA	uc002wjw.3	+						MAVS_uc002wjv.2_Intron|MAVS_uc010zqn.1_Intron|MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_5'Flank	NM_020746	NP_065797			virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	4600001	4600001	+	IGR	DEL	A	-	-	rs67983500		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4600001delA								ADRA1D (370342 upstream) : PRNP (66796 downstream)																																			---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4979253	4979257	+	Intron	DEL	TGAGG	-	-	rs145964903		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4979253_4979257delTGAGG	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron|SLC23A2_uc002wlj.1_Intron	NM_005116	NP_005107			solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5599884	5599884	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5599884delA								GPCPD1 (8212 upstream) : C20orf196 (131159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	5697171	5697171	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5697171delT								GPCPD1 (105499 upstream) : C20orf196 (33872 downstream)																																			---	---	---	---
CRLS1	54675	broad.mit.edu	37	20	6013010	6013011	+	Intron	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6013010_6013011delTT	uc002wmn.3	+						CRLS1_uc010gbq.2_Intron|CRLS1_uc010gbr.2_Intron	NM_019095	NP_061968			cardiolipin synthase 1 isoform 1						phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0																		---	---	---	---
FERMT1	55612	broad.mit.edu	37	20	6068752	6068753	+	Intron	INS	-	AAATC	AAATC	rs143362093	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6068752_6068753insAAATC	uc002wmr.2	-						FERMT1_uc002wmq.2_Intron|FERMT1_uc010gbt.2_Intron|FERMT1_uc002wms.2_Intron	NM_017671	NP_060141			kindlin-1						cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	6193770	6193771	+	IGR	DEL	GA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6193770_6193771delGA								FERMT1 (89579 upstream) : BMP2 (554974 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8700064	8700064	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8700064delA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	9023935	9023936	+	IGR	INS	-	AACAAACGACAAC	AACAAACGACAAC	rs148595485		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9023935_9023936insAACAAACGACAAC								PLCB1 (158390 upstream) : PLCB4 (25765 downstream)																																			---	---	---	---
PAK7	57144	broad.mit.edu	37	20	9741226	9741226	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9741226delA	uc002wnl.2	-						PAK7_uc002wnk.2_Intron|PAK7_uc002wnj.2_Intron|PAK7_uc010gby.1_Intron	NM_020341	NP_065074			p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)															---	---	---	---
SNAP25	6616	broad.mit.edu	37	20	10204086	10204086	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10204086delC	uc002wnq.1	+						SNAP25_uc002wnr.1_Intron|SNAP25_uc002wns.1_Intron|SNAP25_uc010gca.1_Intron|SNAP25_uc010gcb.1_Intron|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824			synaptosomal-associated protein 25 isoform						energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	10829290	10829291	+	IGR	INS	-	ATAC	ATAC	rs142915327	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10829290_10829291insATAC								JAG1 (174596 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11692055	11692055	+	IGR	DEL	C	-	-	rs5840444		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11692055delC								None (None upstream) : BTBD3 (179422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11774691	11774692	+	IGR	INS	-	GT	GT	rs140582846	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11774691_11774692insGT								None (None upstream) : BTBD3 (96785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11996671	11996671	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11996671delG								BTBD3 (89429 upstream) : SPTLC3 (992956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12032923	12032923	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12032923delG								BTBD3 (125681 upstream) : SPTLC3 (956704 downstream)																																			---	---	---	---
ESF1	51575	broad.mit.edu	37	20	13721639	13721639	+	Intron	DEL	T	-	-	rs78440205		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13721639delT	uc002woj.2	-							NM_016649	NP_057733			ABT1-associated protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	13814245	13814245	+	IGR	DEL	T	-	-	rs79700436		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13814245delT								C20orf7 (16373 upstream) : SEL1L2 (15807 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15459199	15459200	+	Intron	DEL	TG	-	-	rs11467897		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15459199_15459200delTG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
KIF16B	55614	broad.mit.edu	37	20	16499473	16499474	+	Intron	INS	-	CA	CA	rs149652340	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16499473_16499474insCA	uc002wpg.1	-						KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980			kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8																OREG0025786	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	20	17066940	17066940	+	IGR	DEL	G	-	-	rs10709297		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17066940delG								OTOR (334132 upstream) : PCSK2 (139812 downstream)																																			---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17492118	17492118	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17492118delC	uc002wpo.2	-						BFSP1_uc002wpp.2_Intron|BFSP1_uc010zrn.1_Intron|BFSP1_uc010zro.1_Intron	NM_001195	NP_001186			filensin isoform 1							cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
DTD1	92675	broad.mit.edu	37	20	18636423	18636423	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18636423delT	uc002wrf.3	+							NM_080820	NP_543010			D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	19854706	19854707	+	IGR	DEL	GT	-	-	rs143702549		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19854706_19854707delGT								SLC24A3 (151166 upstream) : RIN2 (15503 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21071821	21071822	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21071821_21071822delCA								RALGAPA2 (378555 upstream) : PLK1S1 (34802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21766864	21766878	+	IGR	DEL	ACTTGAGAACTGAGG	-	-	rs6147322		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21766864_21766878delACTTGAGAACTGAGG								PAX1 (70244 upstream) : LOC284788 (614093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24397341	24397341	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24397341delG								GGTLC1 (427925 upstream) : TMEM90B (52494 downstream)																																			---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24472812	24472813	+	Intron	INS	-	CA	CA	rs147257578	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24472812_24472813insCA	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24528927	24528927	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24528927delA	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25742238	25742239	+	IGR	INS	-	GAC	GAC			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25742238_25742239insGAC								ZNF337 (64769 upstream) : FAM182B (1863 downstream)																																			---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25846024	25846027	+	Intron	DEL	AGAT	-	-	rs71332665		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25846024_25846027delAGAT	uc002wvd.1	-						FAM182B_uc002wve.2_5'Flank					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25903695	25903695	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25903695delA								FAM182B (54909 upstream) : LOC100134868 (86740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25926945	25926945	+	IGR	DEL	C	-	-	rs111545946		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25926945delC								FAM182B (78159 upstream) : LOC100134868 (63490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26248685	26248685	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26248685delC								MIR663 (59771 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26248741	26248742	+	IGR	DEL	TC	-	-	rs112845257		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26248741_26248742delTC								MIR663 (59827 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26280949	26280950	+	IGR	INS	-	A	A	rs149574497		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26280949_26280950insA								MIR663 (92035 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29421009	29421009	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29421009delA								None (None upstream) : FRG1B (190870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29464193	29464194	+	IGR	INS	-	T	T	rs150514541	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29464193_29464194insT								None (None upstream) : FRG1B (147685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29583385	29583385	+	IGR	DEL	T	-	-	rs112099758		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29583385delT								None (None upstream) : FRG1B (28494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29595455	29595456	+	IGR	INS	-	C	C	rs142091532	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29595455_29595456insC								None (None upstream) : FRG1B (16423 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29617419	29617420	+	Intron	INS	-	T	T	rs147393502	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29617419_29617420insT	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0																		---	---	---	---
KIF3B	9371	broad.mit.edu	37	20	30901504	30901505	+	Intron	INS	-	TTTTG	TTTTG	rs143173730	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30901504_30901505insTTTTG	uc002wxq.2	+						KIF3B_uc010ztw.1_Intron	NM_004798	NP_004789			kinesin family member 3B						anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
C20orf186	149954	broad.mit.edu	37	20	31681641	31681644	+	Intron	DEL	CATC	-	-	rs148116551		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31681641_31681644delCATC	uc010zue.1	+							NM_182519	NP_872325			antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	32977925	32977926	+	Intron	INS	-	A	A	rs76322339		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32977925_32977926insA	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
PIGU	128869	broad.mit.edu	37	20	33155607	33155608	+	Intron	DEL	CT	-	-	rs137859705		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33155607_33155608delCT	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0																		---	---	---	---
PIGU	128869	broad.mit.edu	37	20	33172484	33172486	+	Intron	DEL	TTG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33172484_33172486delTTG	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0																		---	---	---	---
NCOA6	23054	broad.mit.edu	37	20	33408922	33408922	+	5'UTR	DEL	T	-	-	rs11475657		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33408922delT	uc002xav.2	-	1					NCOA6_uc002xaw.2_Intron	NM_014071	NP_054790			nuclear receptor coactivator 6						brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7																		---	---	---	---
C20orf173	140873	broad.mit.edu	37	20	34109438	34109438	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34109438delT	uc010gff.2	-							NM_001145350				hypothetical protein LOC140873												0																		---	---	---	---
CPNE1	8904	broad.mit.edu	37	20	34225519	34225520	+	Intron	INS	-	AAG	AAG	rs150879302	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34225519_34225520insAAG	uc002xdf.2	-						CPNE1_uc010zvj.1_Intron|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron	NM_152931	NP_690908			copine I isoform a						lipid metabolic process|vesicle-mediated transport		calcium-dependent phospholipid binding|phosphatidylserine binding|transporter activity			upper_aerodigestive_tract(1)	1	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)															---	---	---	---
MYL9	10398	broad.mit.edu	37	20	35172965	35172965	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35172965delC	uc002xfl.1	+						uc002xfk.3_Intron|MYL9_uc002xfm.1_Intron	NM_006097	NP_006088			myosin regulatory light chain 9 isoform a						axon guidance|muscle contraction|regulation of muscle contraction	cytosol|muscle myosin complex	calcium ion binding|structural constituent of muscle				0	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35767486	35767487	+	Intron	INS	-	C	C	rs144409643	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35767486_35767487insC	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron|C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
VSTM2L	128434	broad.mit.edu	37	20	36557551	36557551	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36557551delG	uc002xhk.3	+							NM_080607	NP_542174			V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
SNHG11	128439	broad.mit.edu	37	20	37072975	37072975	+	5'Flank	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37072975delA	uc002xiq.1	+						SNHG11_uc002xir.1_5'Flank|SNHG11_uc002xis.1_5'Flank|SNHG11_uc002xit.1_5'Flank|SNHG11_uc002xiu.1_5'Flank	NR_003239				Homo sapiens hypothetical protein mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	37098060	37098067	+	IGR	DEL	CATCCATC	-	-	rs112410222		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37098060_37098067delCATCCATC								SNHG11 (18496 upstream) : RALGAPB (3419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38931320	38931320	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38931320delA								None (None upstream) : MAFB (383199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	40298970	40298970	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40298970delG								CHD6 (51837 upstream) : PTPRT (402423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	40584080	40584081	+	IGR	INS	-	T	T	rs148924217	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40584080_40584081insT								CHD6 (336947 upstream) : PTPRT (117312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42389965	42389966	+	IGR	INS	-	A	A	rs78787071		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42389965_42389966insA								GTSF1L (34323 upstream) : TOX2 (153526 downstream)																																			---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	43019236	43019236	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43019236delA	uc010zwo.1	+	2	192	c.4delA	c.(4-6)AAGfs	p.K2fs	HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|uc002xlw.1_Intron|uc002xlx.2_Intron			P41235	HNF4A_HUMAN	Homo sapiens NR2A1 mRNA for hepatocyte nuclear factor 4, alpha, complete cds.	Error:Variant_position_missing_in_P41235_after_alignment					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
TTPAL	79183	broad.mit.edu	37	20	43111360	43111360	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43111360delT	uc002xmc.1	+						TTPAL_uc002xmd.1_Intron|TTPAL_uc010ggr.1_Intron	NM_024331	NP_077307			tocopherol (alpha) transfer protein-like							intracellular	transporter activity			breast(1)	1																		---	---	---	---
ADA	100	broad.mit.edu	37	20	43252393	43252393	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43252393delT	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013			adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)									Adenosine_Deaminase_Deficiency				---	---	---	---
Unknown	0	broad.mit.edu	37	20	44633169	44633170	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44633169_44633170delTG								ZNF335 (32336 upstream) : MMP9 (4377 downstream)																																			---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45232630	45232631	+	Intron	DEL	AA	-	-	rs78794647		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45232630_45232631delAA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	45404562	45404563	+	IGR	DEL	GA	-	-	rs11469416		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45404562_45404563delGA								SLC2A10 (39579 upstream) : EYA2 (118700 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45573756	45573756	+	Intron	DEL	A	-	-	rs72147704		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45573756delA	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	46716142	46716142	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46716142delT								SULF2 (300782 upstream) : LOC284749 (272512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46797863	46797876	+	IGR	DEL	CTGGTCTCAAACTC	-	-	rs72093439		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46797863_46797876delCTGGTCTCAAACTC								SULF2 (382503 upstream) : LOC284749 (190778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48391574	48391575	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48391574_48391575delAC								B4GALT5 (61153 upstream) : SLC9A8 (37675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50521884	50521886	+	IGR	DEL	AAA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50521884_50521886delAAA								SALL4 (102836 upstream) : ZFP64 (178665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50910096	50910097	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50910096_50910097delAC								ZFP64 (101572 upstream) : TSHZ2 (678780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51220777	51220777	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51220777delT								ZFP64 (412253 upstream) : TSHZ2 (368100 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51630300	51630300	+	Intron	DEL	C	-	-	rs34346315		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51630300delC	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52400090	52400090	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52400090delA								ZNF217 (189289 upstream) : SUMO1P1 (90952 downstream)																																			---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52658391	52658392	+	Intron	INS	-	TGTGCCAC	TGTGCCAC	rs138707079	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52658391_52658392insTGTGCCAC	uc002xws.2	-						BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron|BCAS1_uc010zzc.1_Intron	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52819154	52819155	+	IGR	INS	-	T	T	rs149568939	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52819154_52819155insT								CYP24A1 (28638 upstream) : PFDN4 (5347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53768260	53768271	+	IGR	DEL	CTCCTCCTCCTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53768260_53768271delCTCCTCCTCCTC								DOK5 (500551 upstream) : CBLN4 (804226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54517079	54517079	+	IGR	DEL	T	-	-	rs76721978		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54517079delT								None (None upstream) : CBLN4 (55418 downstream)																																			---	---	---	---
BMP7	655	broad.mit.edu	37	20	55794053	55794054	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55794053_55794054insT	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710			bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)															---	---	---	---
PMEPA1	56937	broad.mit.edu	37	20	56258609	56258610	+	Intron	DEL	GC	-	-	rs56747812	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56258609_56258610delGC	uc002xyq.2	-						PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron	NM_020182	NP_064567			transmembrane prostate androgen-induced protein						androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	56463514	56463514	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56463514delG								PMEPA1 (176973 upstream) : C20orf85 (262469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57521526	57521527	+	IGR	INS	-	T	T	rs113457016		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57521526_57521527insT								GNAS (35277 upstream) : TH1L (34784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	58061206	58061206	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58061206delT								EDN3 (160160 upstream) : PHACTR3 (91358 downstream)																																			---	---	---	---
PHACTR3	116154	broad.mit.edu	37	20	58332518	58332518	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58332518delC	uc002yau.2	+						PHACTR3_uc002yat.2_Intron|PHACTR3_uc010zzw.1_Intron|PHACTR3_uc002yav.2_Intron|PHACTR3_uc002yaw.2_Intron|PHACTR3_uc002yax.2_Intron	NM_080672	NP_542403			phosphatase and actin regulator 3 isoform 1							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	58735353	58735353	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58735353delA	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59121290	59121291	+	Intron	INS	-	T	T	rs144863751	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59121290_59121291insT	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59609044	59609045	+	IGR	INS	-	TTTA	TTTA	rs113890575		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59609044_59609045insTTTA								MIR646 (725419 upstream) : CDH4 (218514 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60297250	60297251	+	Intron	INS	-	T	T	rs140064343	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60297250_60297251insT	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron|uc002ybq.1_5'Flank	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
OGFR	11054	broad.mit.edu	37	20	61441528	61441529	+	Intron	DEL	AA	-	-	rs113243158		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61441528_61441529delAA	uc002ydj.2	+						OGFR_uc002ydk.2_Intron|OGFR_uc002ydl.2_Intron	NM_007346	NP_031372			opioid growth factor receptor						regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	61746635	61746644	+	IGR	DEL	ACACACAGAT	-	-	rs11470824		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61746635_61746644delACACACAGAT								HAR1A (10898 upstream) : MIR124-3 (63208 downstream)																																			---	---	---	---
CHRNA4	1137	broad.mit.edu	37	20	61989017	61989017	+	Intron	DEL	G	-	-	rs11322780		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61989017delG	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_Intron|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735			cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)													---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62131247	62131247	+	5'Flank	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62131247delC	uc002yfd.1	-						EEF1A2_uc002yfe.1_5'Flank|EEF1A2_uc010gkg.1_5'Flank	NM_001958	NP_001949			eukaryotic translation elongation factor 1 alpha							nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62658153	62658153	+	Intron	DEL	A	-	-	rs66797782		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62658153delA	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601			PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62783394	62783395	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62783394_62783395delTG	uc002yih.2	+							NM_004535	NP_004526			myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9669140	9669140	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9669140delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10196308	10196309	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10196308_10196309insA								None (None upstream) : TPTE (710434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10371638	10371639	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10371638_10371639insT								None (None upstream) : TPTE (535104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10470453	10470453	+	Intron	DEL	A	-	-	rs74637560		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10470453delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10503272	10503273	+	Intron	DEL	AA	-	-	rs71255876		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10503272_10503273delAA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10545062	10545065	+	Intron	DEL	ATAC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10545062_10545065delATAC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10579688	10579693	+	Intron	DEL	AAACTG	-	-	rs71272792		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10579688_10579693delAAACTG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10731178	10731179	+	IGR	DEL	AA	-	-	rs146936303		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10731178_10731179delAA								None (None upstream) : TPTE (175564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10775664	10775668	+	IGR	DEL	TGGAG	-	-	rs149220640		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10775664_10775668delTGGAG								None (None upstream) : TPTE (131075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10778036	10778037	+	IGR	INS	-	GTGAT	GTGAT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10778036_10778037insGTGAT								None (None upstream) : TPTE (128706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10820190	10820194	+	IGR	DEL	CCAAA	-	-	rs142638062		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10820190_10820194delCCAAA								None (None upstream) : TPTE (86549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10834177	10834181	+	IGR	DEL	GAATG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10834177_10834181delGAATG								None (None upstream) : TPTE (72562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10888777	10888779	+	IGR	DEL	CTT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10888777_10888779delCTT								None (None upstream) : TPTE (17964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11114453	11114455	+	IGR	DEL	TAA	-	-	rs55649022		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114453_11114455delTAA								BAGE (15516 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14359936	14359939	+	IGR	DEL	TCAG	-	-	rs113039060		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14359936_14359939delTCAG								None (None upstream) : C21orf99 (50548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14839863	14839864	+	IGR	INS	-	A	A	rs112421158		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14839863_14839864insA								C21orf99 (349294 upstream) : POTED (142634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	15441841	15441842	+	Intron	INS	-	AAG	AAG			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15441841_15441842insAAG	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																														---	---	---	---
NRIP1	8204	broad.mit.edu	37	21	16355534	16355534	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16355534delA	uc002yjx.2	-							NM_003489	NP_003480			nuclear receptor interacting protein 1						androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	16680444	16680445	+	IGR	INS	-	AAAGA	AAAGA	rs143344897	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16680444_16680445insAAAGA								NRIP1 (243318 upstream) : USP25 (422051 downstream)																																			---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17958625	17958626	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17958625_17958626delTG	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	18792365	18792365	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18792365delT								C21orf34 (810271 upstream) : CXADR (92965 downstream)																																			---	---	---	---
C21orf91	54149	broad.mit.edu	37	21	19167322	19167322	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19167322delA	uc002yko.3	-						C21orf91_uc002ykm.2_5'Flank|C21orf91_uc002ykn.2_5'Flank|C21orf91_uc002ykq.3_Intron|C21orf91_uc002ykp.3_Intron	NM_001100420	NP_001093890			early undifferentiated retina and lens isoform											ovary(1)	1				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20916302	20916302	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20916302delT								None (None upstream) : None (None downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22397208	22397208	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22397208delA	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23072894	23072894	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23072894delA								NCAM2 (161680 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24587609	24587618	+	IGR	DEL	ATGGCAAGAG	-	-	rs112828913		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24587609_24587618delATGGCAAGAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26020893	26020896	+	IGR	DEL	TTCC	-	-	rs67729072		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26020893_26020896delTTCC								None (None upstream) : NCRNA00158 (737238 downstream)																																			---	---	---	---
JAM2	58494	broad.mit.edu	37	21	27053142	27053144	+	Intron	DEL	AGG	-	-	rs66489024		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27053142_27053144delAGG	uc002ylp.1	+						JAM2_uc011ace.1_Intron|JAM2_uc002ylq.1_Intron|JAM2_uc011acf.1_Intron|JAM2_uc010glh.1_Intron|JAM2_uc002ylr.1_Intron|JAM2_uc010gli.1_Intron	NM_021219	NP_067042			junctional adhesion molecule 2 precursor						blood coagulation|cell-cell adhesion|leukocyte migration	integral to plasma membrane|tight junction					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	28471588	28471588	+	IGR	DEL	T	-	-	rs80078219		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28471588delT								ADAMTS5 (132149 upstream) : NCRNA00113 (623110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29511268	29511268	+	Intron	DEL	A	-	-	rs71335018		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29511268delA	uc002yml.2	-											Homo sapiens cDNA clone IMAGE:5541115, partial cds.																														---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32587905	32587906	+	Intron	DEL	AG	-	-	rs71311074		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32587905_32587906delAG	uc002yow.1	-						TIAM1_uc011adk.1_Intron|TIAM1_uc011adl.1_Intron|TIAM1_uc002yox.1_Intron	NM_003253	NP_003244			T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	33004953	33004953	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33004953delA								TIAM1 (72663 upstream) : SOD1 (26982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33416089	33416090	+	IGR	INS	-	GT	GT	rs138329750	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33416089_33416090insGT								HUNK (39713 upstream) : NCRNA00159 (36539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	35429033	35429033	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35429033delA								ATP5O (140875 upstream) : MRPS6 (16790 downstream)																																			---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36405419	36405420	+	Intron	INS	-	TCAT	TCAT	rs148784714	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36405419_36405420insTCAT	uc010gmu.2	-						RUNX1_uc002yut.1_Intron|RUNX1_uc010gmv.2_Intron|RUNX1_uc002yuj.3_Intron|RUNX1_uc002yuk.3_Intron|RUNX1_uc002yum.1_Intron|RUNX1_uc010gmw.1_Intron	NM_001754	NP_001745			runt-related transcription factor 1 isoform						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36824451	36824451	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36824451delG	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
CHAF1B	8208	broad.mit.edu	37	21	37782972	37782973	+	Intron	INS	-	T	T	rs113341085		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37782972_37782973insT	uc002yvj.2	+							NM_005441	NP_005432			chromatin assembly factor 1 subunit B						cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|cytoplasm	chromatin binding|histone binding|unfolded protein binding			ovary(1)|skin(1)	2																		---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37892031	37892032	+	Intron	INS	-	AAA	AAA	rs145072045	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37892031_37892032insAAA	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550			claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
DSCR4	10281	broad.mit.edu	37	21	39493079	39493080	+	Intron	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39493079_39493080delAC	uc002ywp.2	-						DSCR8_uc002ywt.3_5'Flank|DSCR8_uc010gnp.2_5'Flank|DSCR8_uc010gnq.2_5'Flank|DSCR8_uc010gnr.2_5'Flank|DSCR8_uc010gns.2_5'Flank	NM_005867	NP_005858			Down syndrome critical region protein 4											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	39728425	39728426	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39728425_39728426delAC								KCNJ15 (54681 upstream) : ERG (23526 downstream)																																	OREG0026215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	21	40043540	40043540	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40043540delT								ERG (9836 upstream) : NCRNA00114 (67339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	40384785	40384786	+	IGR	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40384785_40384786delCA								ETS2 (187909 upstream) : PSMG1 (162604 downstream)																																			---	---	---	---
MX2	4600	broad.mit.edu	37	21	42756579	42756579	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42756579delA	uc002yzf.1	+						MX2_uc011aer.1_Intron	NM_002463	NP_002454			myxovirus resistance protein 2						response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)																---	---	---	---
SLC37A1	54020	broad.mit.edu	37	21	43940073	43940074	+	Intron	DEL	TT	-	-	rs59285718		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43940073_43940074delTT	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837			solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	44057448	44057449	+	IGR	DEL	CA	-	-	rs145296123		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44057448_44057449delCA								SLC37A1 (55899 upstream) : PDE9A (16413 downstream)																																			---	---	---	---
PDE9A	5152	broad.mit.edu	37	21	44090268	44090269	+	Intron	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44090268_44090269delCA	uc002zbm.2	+						PDE9A_uc002zbn.2_Intron|PDE9A_uc002zbo.2_Intron|PDE9A_uc002zbp.2_Intron|PDE9A_uc002zbq.2_Intron|PDE9A_uc002zbs.2_Intron|PDE9A_uc002zbr.2_Intron|PDE9A_uc002zbt.2_Intron|PDE9A_uc002zbu.2_Intron|PDE9A_uc002zbv.2_Intron|PDE9A_uc002zbw.2_Intron|PDE9A_uc002zbx.2_Intron|PDE9A_uc002zby.2_Intron|PDE9A_uc002zbz.2_Intron|PDE9A_uc002zca.2_Intron|PDE9A_uc002zcb.2_Intron|PDE9A_uc002zcc.2_Intron|PDE9A_uc002zcd.2_Intron|PDE9A_uc002zce.2_Intron|PDE9A_uc002zcf.2_Intron|PDE9A_uc002zcg.2_Intron	NM_002606	NP_002597			phosphodiesterase 9A isoform a						platelet activation|signal transduction	cytosol|endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm|ruffle membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	46404972	46404972	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46404972delG								C21orf70 (8085 upstream) : NCRNA00162 (14157 downstream)																																			---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47834369	47834370	+	Intron	INS	-	CCTCCTCCT	CCTCCTCCT	rs149797187	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47834369_47834370insCCTCCTCCT	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022			pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	48086040	48086041	+	IGR	INS	-	T	T	rs74333024		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48086040_48086041insT								PRMT2 (1178 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17234181	17234198	+	IGR	DEL	GAGGACATGAGGTTTGGA	-	-	rs78859400	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17234181_17234198delGAGGACATGAGGTTTGGA								psiTPTE22 (54660 upstream) : XKR3 (30115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17497615	17497615	+	IGR	DEL	T	-	-	rs138517316		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17497615delT								GAB4 (8503 upstream) : CECR7 (19845 downstream)																																			---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18509245	18509246	+	5'Flank	DEL	CA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18509245_18509246delCA	uc002zng.3	-						MICAL3_uc002znh.2_5'Flank|MICAL3_uc010grf.2_5'Flank|MICAL3_uc011agm.1_5'Flank|FLJ41941_uc002zno.1_5'Flank	NM_015241	NP_056056			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)														---	---	---	---
PI4KA	5297	broad.mit.edu	37	22	21136877	21136877	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21136877delA	uc002zsz.3	-						SERPIND1_uc002ztb.1_Intron|SERPIND1_uc002ztc.2_Intron	NM_058004	NP_477352			phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)															---	---	---	---
MAPK1	5594	broad.mit.edu	37	22	22130078	22130079	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22130078_22130079insT	uc002zvn.2	-						MAPK1_uc002zvo.2_Intron|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736			mitogen-activated protein kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)													---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22865909	22865909	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22865909delT	uc011aim.1	+						ZNF280B_uc002zwc.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23867305	23867305	+	IGR	DEL	T	-	-	rs34168486		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23867305delT								ZDHHC8P1 (122506 upstream) : IGLL1 (48010 downstream)																																			---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24510026	24510028	+	Intron	DEL	TTG	-	-	rs34074073		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24510026_24510028delTTG	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron	NM_012295	NP_036427			calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
SGSM1	129049	broad.mit.edu	37	22	25234896	25234897	+	Intron	INS	-	AAA	AAA	rs142881964	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25234896_25234897insAAA	uc003abg.2	+						SGSM1_uc003abh.2_Intron|SGSM1_uc010guu.1_Intron|SGSM1_uc003abj.2_Intron|SGSM1_uc003abf.2_Intron	NM_001039948	NP_001035037			RUN and TBC1 domain containing 2 isoform 1							Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5																		---	---	---	---
SGSM1	129049	broad.mit.edu	37	22	25283075	25283076	+	Intron	DEL	TG	-	-	rs60431385		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25283075_25283076delTG	uc003abg.2	+						SGSM1_uc003abh.2_Intron|SGSM1_uc010guu.1_Intron|SGSM1_uc003abj.2_Intron|SGSM1_uc003abi.1_Intron	NM_001039948	NP_001035037			RUN and TBC1 domain containing 2 isoform 1							Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27034301	27034302	+	IGR	INS	-	AAGA	AAGA	rs141753986	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27034301_27034302insAAGA								CRYBA4 (7666 upstream) : MIAT (19182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27847110	27847111	+	IGR	INS	-	A	A	rs146952778		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27847110_27847111insA								MIAT (732161 upstream) : MN1 (297155 downstream)																																			---	---	---	---
ZNRF3	84133	broad.mit.edu	37	22	29374972	29374972	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29374972delC	uc003aeg.2	+							NM_032173	NP_115549			zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1																		---	---	---	---
NIPSNAP1	8508	broad.mit.edu	37	22	29969758	29969758	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29969758delA	uc003afx.3	-						NIPSNAP1_uc011akp.1_Intron	NM_003634	NP_003625			nipsnap homolog 1									p.?(1)		skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	30655500	30655500	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30655500delA								LIF (12704 upstream) : OSM (3321 downstream)																																			---	---	---	---
RNF185	91445	broad.mit.edu	37	22	31559283	31559283	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31559283delA	uc003akb.2	+						RNF185_uc010gwh.2_Intron|RNF185_uc011alm.1_Intron|RNF185_uc003akc.2_Intron|RNF185_uc003ake.2_Intron	NM_152267	NP_689480			ring finger protein 185 isoform 1							integral to membrane	zinc ion binding				0																		---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33159129	33159131	+	Intron	DEL	TTG	-	-	rs112454689		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33159129_33159131delTTG	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
LARGE	9215	broad.mit.edu	37	22	33862357	33862358	+	Intron	DEL	CT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33862357_33862358delCT	uc003and.3	-						LARGE_uc011amd.1_Intron|LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron|LARGE_uc010gwq.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	34546545	34546545	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34546545delT								LARGE (227961 upstream) : ISX (915584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35547911	35547912	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35547911_35547912insT								ISX (64533 upstream) : HMGXB4 (105533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	37758595	37758595	+	5'Flank	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37758595delG	uc003arp.2	-						uc003arq.1_5'Flank|uc003ars.2_5'Flank|uc003art.2_5'Flank|uc003aru.2_5'Flank|uc011anb.1_5'Flank|uc003arv.2_5'Flank					DQ570980																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	38404865	38404865	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38404865delA								POLR2F (20524 upstream) : PICK1 (48397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	39292755	39292757	+	IGR	DEL	CTT	-	-	rs10556006		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39292755_39292757delCTT								CBX6 (24497 upstream) : APOBEC3A (60770 downstream)																																			---	---	---	---
ENTHD1	150350	broad.mit.edu	37	22	40152293	40152294	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40152293_40152294delTC	uc003ayg.2	-							NM_152512	NP_689725			ENTH domain containing 1											ovary(2)|skin(1)	3	Melanoma(58;0.0749)																	---	---	---	---
XRCC6	2547	broad.mit.edu	37	22	42028665	42028666	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42028665_42028666insA	uc003bao.1	+						XRCC6_uc003bap.1_Intron|XRCC6_uc011apc.1_Intron|XRCC6_uc003baq.1_Intron|XRCC6_uc003bar.1_Intron|XRCC6_uc003bas.1_Intron	NM_001469	NP_001460			ATP-dependent DNA helicase II, 70 kDa subunit						DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5													Direct_reversal_of_damage|NHEJ					---	---	---	---
WBP2NL	164684	broad.mit.edu	37	22	42317581	42317582	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42317581_42317582insA	uc011ape.1	+						LOC339674_uc003bba.1_Intron	NM_152613	NP_689826			WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2																		---	---	---	---
WBP2NL	164684	broad.mit.edu	37	22	42318675	42318675	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42318675delG	uc011ape.1	+						LOC339674_uc003bba.1_Intron	NM_152613	NP_689826			WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	42497903	42497903	+	Intron	DEL	T	-	-	rs111797650		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42497903delT	uc003bcc.1	+						uc003bcd.1_Intron					Homo sapiens cDNA FLJ41636 fis, clone FEBRA1000022.																														---	---	---	---
PHF21B	112885	broad.mit.edu	37	22	45279996	45279997	+	Intron	INS	-	CAC	CAC	rs142366383		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45279996_45279997insCAC	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron	NM_138415	NP_612424			PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	49552106	49552135	+	IGR	DEL	CACAGCCCCTCCTACTCTGCACACAATTCA	-	-	rs139758927	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49552106_49552135delCACAGCCCCTCCTACTCTGCACACAATTCA								FAM19A5 (404364 upstream) : C22orf34 (256041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49683593	49683594	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49683593_49683594delTG								FAM19A5 (535851 upstream) : C22orf34 (124582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	50346330	50346331	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50346330_50346331delTG								CRELD2 (25144 upstream) : PIM3 (7812 downstream)																																			---	---	---	---
MIOX	55586	broad.mit.edu	37	22	50926878	50926879	+	Intron	INS	-	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50926878_50926879insC	uc003bll.1	+						MIOX_uc003blm.1_Intron|MIOX_uc003bln.1_Intron	NM_017584	NP_060054			myo-inositol oxygenase						inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	397164	397165	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:397164_397165delAA								PPP2R3B (49537 upstream) : SHOX (187914 downstream)																																			---	---	---	---
SHOX	6473	broad.mit.edu	37	X	590127	590128	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:590127_590128delTC	uc004cph.1	+						SHOX_uc004cpi.2_Intron	NM_000451	NP_000442			short stature homeobox isoform SHOXa						skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	951476	951487	+	IGR	DEL	TCTCTCTCTCTC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:951476_951487delTCTCTCTCTCTC								SHOX (331331 upstream) : CRLF2 (363400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1251002	1251003	+	IGR	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1251002_1251003insA								SHOX (630857 upstream) : CRLF2 (63884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2030642	2030643	+	IGR	DEL	AC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2030642_2030643delAC								ASMT (268669 upstream) : DHRSX (106914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2735160	2735163	+	IGR	DEL	AAGA	-	-	rs112472775		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2735160_2735163delAAGA								XG (621 upstream) : GYG2 (11700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	3442824	3442829	+	IGR	DEL	CATCAT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3442824_3442829delCATCAT								MXRA5 (178140 upstream) : PRKX (79584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	6360794	6360794	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6360794delG								NLGN4X (214088 upstream) : VCX3A (90866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	7310654	7310654	+	IGR	DEL	T	-	-	rs75499953		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7310654delT								STS (37974 upstream) : VCX (499649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	9310069	9310069	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9310069delA								FAM9B (177422 upstream) : TBL1X (121266 downstream)																																			---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10033358	10033361	+	Intron	DEL	GTGT	-	-	rs35144812		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10033358_10033361delGTGT	uc004csx.3	+						WWC3_uc010nds.2_Intron	NM_015691	NP_056506			WWC family member 3											ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	10903382	10903382	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10903382delA								MID1 (51573 upstream) : HCCS (226033 downstream)																																			---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12433520	12433520	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12433520delA	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	14076593	14076593	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14076593delG								GEMIN8 (28558 upstream) : GLRA2 (470827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	19282322	19282322	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19282322delT								GPR64 (141645 upstream) : PDHA1 (79689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	21107343	21107343	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21107343delC								RPS6KA3 (821820 upstream) : CNKSR2 (285637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	22662848	22662849	+	IGR	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22662848_22662849delTG								ZNF645 (370274 upstream) : DDX53 (355238 downstream)																																			---	---	---	---
ZFX	7543	broad.mit.edu	37	X	24181338	24181339	+	Intron	DEL	GT	-	-	rs67981259		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24181338_24181339delGT	uc004dbf.2	+						ZFX_uc004dbd.1_Intron|ZFX_uc010nfx.1_Intron|ZFX_uc004dbe.2_Intron|ZFX_uc011mjv.1_Intron	NM_003410	NP_003401			zinc finger protein, X-linked						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	24415586	24415586	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24415586delT								FAM48B1 (32046 upstream) : PDK3 (67758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	25179811	25179811	+	IGR	DEL	T	-	-	rs35637587		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25179811delT								ARX (145746 upstream) : MAGEB18 (976652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	28216635	28216636	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28216635_28216636insT								DCAF8L1 (217069 upstream) : IL1RAPL1 (389045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	28392651	28392651	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28392651delA								DCAF8L1 (393085 upstream) : IL1RAPL1 (213030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	28497769	28497769	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:28497769delT								DCAF8L1 (498203 upstream) : IL1RAPL1 (107912 downstream)																																			---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29439725	29439725	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29439725delA	uc004dby.2	+							NM_014271	NP_055086			interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	30336456	30336457	+	IGR	DEL	GT	-	-	rs72056807		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30336456_30336457delGT								NR0B1 (8961 upstream) : CXorf21 (240484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	30457238	30457239	+	IGR	DEL	GT	-	-	rs72458241		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30457238_30457239delGT								NR0B1 (129743 upstream) : CXorf21 (119702 downstream)																																			---	---	---	---
GK	2710	broad.mit.edu	37	X	30688716	30688716	+	Intron	DEL	T	-	-	rs148330109		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30688716delT	uc004dch.3	+						GK_uc010ngj.2_Intron|GK_uc004dci.3_Intron|GK_uc011mjz.1_Intron|GK_uc011mka.1_Intron|GK_uc010ngk.2_Intron	NM_203391	NP_976325			glycerol kinase isoform a						glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	30811605	30811606	+	IGR	INS	-	CTTTT	CTTTT			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30811605_30811606insCTTTT								GK (62881 upstream) : TAB3 (33954 downstream)																																			---	---	---	---
DMD	1756	broad.mit.edu	37	X	32631557	32631558	+	Intron	INS	-	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32631557_32631558insA	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
DMD	1756	broad.mit.edu	37	X	33044791	33044791	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33044791delG	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	34419677	34419677	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34419677delA								FAM47A (269249 upstream) : TMEM47 (225506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39036115	39036118	+	IGR	DEL	AAAG	-	-	rs67502315		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39036115_39036118delAAAG								MID1IP1 (370334 upstream) : BCOR (874383 downstream)																																			---	---	---	---
MED14	9282	broad.mit.edu	37	X	40552264	40552264	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40552264delA	uc004dex.3	-							NM_004229	NP_004220			mediator complex subunit 14						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	40663678	40663678	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40663678delT								MED14 (68542 upstream) : LOC100132831 (26792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	41294619	41294623	+	IGR	DEL	AAACA	-	-	rs67273123		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41294619_41294623delAAACA								DDX3X (70895 upstream) : NYX (12090 downstream)																																			---	---	---	---
CXorf36	79742	broad.mit.edu	37	X	45037218	45037218	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45037218delA	uc004dgg.2	-						CXorf36_uc004dgi.3_Intron	NM_176819	NP_789789			hypothetical protein LOC79742 isoform 1							extracellular region				lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	46010929	46010929	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46010929delC								MIR222 (404399 upstream) : ZNF673 (295695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	46292836	46292836	+	IGR	DEL	T	-	-	rs111797405		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46292836delT								MIR222 (686306 upstream) : ZNF673 (13788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	47404650	47404650	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47404650delA								ZNF41 (62040 upstream) : ARAF (15928 downstream)																																			---	---	---	---
SHROOM4	57477	broad.mit.edu	37	X	50530226	50530226	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50530226delA	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron	NM_020717	NP_065768			shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	56385309	56385309	+	IGR	DEL	T	-	-	rs67622363		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56385309delT								KLF8 (70989 upstream) : UBQLN2 (204751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61714751	61714751	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61714751delA								None (None upstream) : SPIN4 (852357 downstream)																																			---	---	---	---
AR	367	broad.mit.edu	37	X	66839158	66839159	+	Intron	DEL	TC	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66839158_66839159delTC	uc004dwu.1	+						AR_uc011mpd.1_Intron|AR_uc011mpe.1_Intron|AR_uc011mpf.1_Intron|AR_uc004dwv.1_Intron	NM_000044	NP_000035			androgen receptor isoform 1						cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)									Androgen_Insensitivity_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	X	68411834	68411834	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68411834delG	uc004dxj.1	+											RecName: Full=Putative uncharacterized protein CXorf62;																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	71018156	71018157	+	IGR	DEL	TT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71018156_71018157delTT								BCYRN1 (69194 upstream) : NHSL2 (112781 downstream)																																			---	---	---	---
FLJ44635	392490	broad.mit.edu	37	X	71368691	71368700	+	Intron	DEL	TGTGTGTGTG	-	-	rs72267702		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71368691_71368700delTGTGTGTGTG	uc004eal.1	+							NM_207422	NP_997305			hypothetical protein LOC392490											lung(1)	1	Renal(35;0.156)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	71540808	71540808	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71540808delT								CITED1 (13771 upstream) : HDAC8 (8559 downstream)																																			---	---	---	---
PHKA1	5255	broad.mit.edu	37	X	71847098	71847099	+	Intron	INS	-	AGAC	AGAC	rs141521839		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71847098_71847099insAGAC	uc004eax.3	-						PHKA1_uc004eay.3_Intron|PHKA1_uc011mqi.1_Intron	NM_002637	NP_002628			phosphorylase kinase, alpha 1 (muscle) isoform						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	75716727	75716727	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75716727delA								MAGEE1 (64983 upstream) : MIR384 (422971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	75996647	75996647	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75996647delC	uc010nlv.1	-											Homo sapiens cDNA FLJ25017 fis, clone CBL01605.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	77881149	77881149	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77881149delC								CYSLTR1 (298062 upstream) : ZCCHC5 (30417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	79422358	79422358	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79422358delT								TBX22 (135090 upstream) : FAM46D (168645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	79540275	79540275	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79540275delT	uc004edk.1	-											Homo sapiens cDNA FLJ26841 fis, clone PRS07619.																														---	---	---	---
DACH2	117154	broad.mit.edu	37	X	85439897	85439897	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85439897delT	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron	NM_053281	NP_444511			dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	88459869	88459869	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88459869delC								CPXCR1 (450086 upstream) : TGIF2LX (717071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	95275386	95275387	+	IGR	DEL	AC	-	-	rs146505754		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95275386_95275387delAC								MIR548M (957161 upstream) : LOC643486 (316699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	97012010	97012011	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97012010_97012011insT								DIAPH2 (156414 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	99669115	99669115	+	IGR	DEL	T	-	-	rs35928915		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99669115delT								PCDH19 (3844 upstream) : TNMD (170675 downstream)																																			---	---	---	---
NXF5	55998	broad.mit.edu	37	X	101093049	101093049	+	Intron	DEL	A	-	-	rs66689050		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093049delA	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564			nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	101199382	101199383	+	IGR	INS	-	T	T	rs145225900		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101199382_101199383insT								ZMAT1 (12382 upstream) : TCEAL2 (181277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	101359755	101359755	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101359755delG								ZMAT1 (172755 upstream) : TCEAL2 (20905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	101797484	101797484	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101797484delT								TMSB15A (25785 upstream) : NXF4 (7409 downstream)																																			---	---	---	---
NXF3	56000	broad.mit.edu	37	X	102340060	102340060	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102340060delT	uc004eju.2	-						NXF3_uc010noi.1_5'Flank|NXF3_uc011mrw.1_Intron|NXF3_uc011mrx.1_Intron	NM_022052	NP_071335			nuclear RNA export factor 3							cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	102953513	102953513	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102953513delA								MORF4L2 (10427 upstream) : GLRA4 (8760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	105724458	105724459	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105724458_105724459insT								MUM1L1 (271510 upstream) : CXorf57 (130701 downstream)																																			---	---	---	---
RBM41	55285	broad.mit.edu	37	X	106352233	106352233	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106352233delA	uc004emz.2	-						RBM41_uc004emy.1_Intron	NM_018301	NP_060771			RNA binding motif protein 41								nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	106864463	106864464	+	IGR	DEL	AA	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106864463_106864464delAA								CXorf41 (376991 upstream) : PRPS1 (7190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	109120812	109120812	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109120812delA								ACSL4 (144191 upstream) : TMEM164 (125051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	109744104	109744105	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109744104_109744105insT								RGAG1 (44543 upstream) : TDGF3 (19435 downstream)																																			---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111607091	111607091	+	Intron	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111607091delC	uc004epo.1	+							NM_001004308	NP_001004308			zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	111807285	111807285	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111807285delC								ZCCHC16 (106812 upstream) : LHFPL1 (66595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	114591847	114591847	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114591847delT								LUZP4 (49728 upstream) : PLS3 (203359 downstream)																																			---	---	---	---
PLS3	5358	broad.mit.edu	37	X	114844800	114844800	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114844800delT	uc004eqd.2	+						PLS3_uc010nqf.2_Intron|PLS3_uc010nqg.2_Intron|PLS3_uc011mtf.1_Intron|PLS3_uc004eqe.2_Intron|PLS3_uc011mtg.1_Intron|PLS3_uc011mth.1_Intron	NM_005032	NP_005023			plastin 3							cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2																		---	---	---	---
SLC6A14	11254	broad.mit.edu	37	X	115568476	115568477	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115568476_115568477insT	uc004eqi.2	+						SLC6A14_uc011mtm.1_Intron	NM_007231	NP_009162			solute carrier family 6 (amino acid						cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)													---	---	---	---
WDR44	54521	broad.mit.edu	37	X	117521145	117521146	+	Intron	DEL	AA	-	-	rs72146401		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117521145_117521146delAA	uc004eqn.2	+						WDR44_uc004eqo.2_Intron|WDR44_uc011mtr.1_Intron	NM_019045	NP_061918			WD repeat domain 44 protein							cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	118046889	118046889	+	IGR	DEL	T	-	-	rs144081469		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118046889delT								ZCCHC12 (85959 upstream) : LONRF3 (61824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118888062	118888063	+	IGR	INS	-	C	C	rs140577717		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118888062_118888063insC								SEPT6 (60729 upstream) : ANKRD58 (4513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118908022	118908023	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118908022_118908023insT								ANKRD58 (13858 upstream) : RPL39 (12446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	119777108	119777108	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119777108delT								C1GALT1C1 (13167 upstream) : CT47B1 (229346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	121235610	121235610	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:121235610delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	123075653	123075653	+	IGR	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123075653delT								XIAP (27832 upstream) : STAG2 (18822 downstream)																																			---	---	---	---
STAG2	10735	broad.mit.edu	37	X	123108086	123108087	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123108086_123108087insT	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594			stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
ODZ1	10178	broad.mit.edu	37	X	123691173	123691173	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123691173delG	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068			odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23																		---	---	---	---
LOC286467	286467	broad.mit.edu	37	X	130928305	130928306	+	Intron	DEL	TG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130928305_130928306delTG	uc004ewi.2	-						LOC286467_uc004ewj.1_Intron	NR_026975				Homo sapiens cDNA FLJ40592 fis, clone THYMU2010192.												0																		---	---	---	---
GPC3	2719	broad.mit.edu	37	X	132676623	132676623	+	Intron	DEL	T	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132676623delT	uc004exe.1	-						GPC3_uc004exd.1_Intron|GPC3_uc010nrn.1_Intron|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron	NM_004484	NP_004475			glypican 3 isoform 2 precursor							extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)							T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				---	---	---	---
GPC3	2719	broad.mit.edu	37	X	132851282	132851282	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132851282delA	uc004exe.1	-						GPC3_uc004exd.1_Intron|GPC3_uc010nrn.1_Intron|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron|GPC3_uc010nrp.1_Intron	NM_004484	NP_004475			glypican 3 isoform 2 precursor							extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)							T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	X	136487523	136487526	+	IGR	DEL	GTGT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136487523_136487526delGTGT								GPR101 (373690 upstream) : ZIC3 (160820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	136489083	136489083	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136489083delA								GPR101 (375250 upstream) : ZIC3 (159263 downstream)																																			---	---	---	---
FGF13	2258	broad.mit.edu	37	X	138089068	138089068	+	Intron	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138089068delA	uc004faq.2	-						FGF13_uc004far.2_Intron|FGF13_uc011mwj.1_Intron|FGF13_uc011mwk.1_Intron	NM_001139502	NP_001132974			fibroblast growth factor 13 isoform 3						cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	139784692	139784692	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139784692delA								SOX3 (197467 upstream) : RP1-177G6.2 (7240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	140710928	140710929	+	Intron	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140710928_140710929insT	uc004fbm.1	+											Homo sapiens cDNA FLJ36186 fis, clone TESTI2027013.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	140837597	140837597	+	IGR	DEL	G	-	-	rs66579018		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140837597delG								SPANXE (50942 upstream) : MAGEC3 (88505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142733595	142733595	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142733595delA								SLITRK4 (9999 upstream) : SPANXN2 (61461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145137683	145137684	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145137683_145137684insT								MIR891A (28293 upstream) : CXorf51 (753618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145581355	145581356	+	IGR	DEL	GT	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145581355_145581356delGT								MIR891A (471965 upstream) : CXorf51 (309946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145765655	145765656	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145765655_145765656insT								MIR891A (656265 upstream) : CXorf51 (125646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146803574	146803575	+	IGR	DEL	TG	-	-	rs142849739		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146803574_146803575delTG								MIR514-3 (437328 upstream) : ASFMR1 (187374 downstream)																																			---	---	---	---
AFF2	2334	broad.mit.edu	37	X	147724679	147724679	+	Intron	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147724679delG	uc004fcp.2	+						AFF2_uc004fco.2_Intron|AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron	NM_002025	NP_002016			fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	150851666	150851667	+	IGR	INS	-	A	A	rs34661054		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150851666_150851667insA								PASD1 (6457 upstream) : PRRG3 (15112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	152851730	152851731	+	IGR	INS	-	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152851730_152851731insT								ATP2B3 (3343 upstream) : FAM58A (1654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9951836	9951837	+	IGR	INS	-	GTAA	GTAA			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9951836_9951837insGTAA								TTTY22 (300982 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9976636	9976636	+	IGR	DEL	A	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9976636delA								TTTY22 (325782 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13269495	13269495	+	IGR	DEL	G	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13269495delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13410352	13410352	+	IGR	DEL	C	-	-	rs140676082		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13410352delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13430917	13430918	+	IGR	INS	-	AA	AA			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13430917_13430918insAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13483709	13483709	+	IGR	DEL	A	-	-	rs75512249		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13483709delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13820270	13820274	+	IGR	DEL	TAACC	-	-	rs78125867		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13820270_13820274delTAACC								None (None upstream) : TTTY15 (954024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28586809	28586809	+	IGR	DEL	C	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28586809delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58972663	58972667	+	IGR	DEL	TCAAG	-	-			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58972663_58972667delTCAAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58981952	58981956	+	IGR	DEL	TCGAC	-	-	rs62607375		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58981952_58981956delTCGAC								None (None upstream) : None (None downstream)																																			---	---	---	---
CA6	765	broad.mit.edu	37	1	9027761	9027761	+	Silent	SNP	G	T	T	rs151137875		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9027761G>T	uc001apm.2	+	6	639	c.615G>T	c.(613-615)CTG>CTT	p.L205L	CA6_uc009vmn.2_Silent_p.L145L	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	205					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11319454	11319454	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11319454C>A	uc001asd.2	-	2	134	c.13G>T	c.(13-15)GGA>TGA	p.G5*		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	5					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24411016	24411016	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24411016G>T	uc001bin.3	-	16	2075	c.1912C>A	c.(1912-1914)CGG>AGG	p.R638R	MYOM3_uc001bim.3_Silent_p.R295R|MYOM3_uc001bio.2_Silent_p.R638R|MYOM3_uc001bip.1_Silent_p.R295R	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	638	Fibronectin type-III 3.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27105631	27105631	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27105631G>T	uc001bmv.1	+	20	5615	c.5242G>T	c.(5242-5244)GGG>TGG	p.G1748W	ARID1A_uc001bmu.1_Missense_Mutation_p.G1531W|ARID1A_uc001bmx.1_Missense_Mutation_p.G594W|ARID1A_uc009vsm.1_Missense_Mutation_p.G76W|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1748					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39823056	39823056	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39823056C>A	uc010oiu.1	+	9	6885	c.6754C>A	c.(6754-6756)CAA>AAA	p.Q2252K	MACF1_uc010ois.1_Missense_Mutation_p.Q1750K|MACF1_uc001cda.1_Missense_Mutation_p.Q1658K|MACF1_uc001cdc.1_Missense_Mutation_p.Q837K|MACF1_uc001cdb.1_Missense_Mutation_p.Q837K	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3817					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158646014	158646014	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158646014C>A	uc001fst.1	-	8	1228	c.1029G>T	c.(1027-1029)GAG>GAT	p.E343D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	343	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161017576	161017576	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161017576G>T	uc001fxl.2	-	12	3581	c.3235C>A	c.(3235-3237)CTG>ATG	p.L1079M	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Missense_Mutation_p.L868M|ARHGAP30_uc001fxm.2_Missense_Mutation_p.L925M|ARHGAP30_uc009wtx.2_Missense_Mutation_p.L752M	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	1079					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161018396	161018396	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161018396C>A	uc001fxl.2	-	12	2761	c.2415G>T	c.(2413-2415)AAG>AAT	p.K805N	USF1_uc001fxi.2_5'Flank|USF1_uc001fxj.2_5'Flank|ARHGAP30_uc001fxk.2_Intron|ARHGAP30_uc001fxm.2_Missense_Mutation_p.K651N|ARHGAP30_uc009wtx.2_Missense_Mutation_p.K478N	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	805	Glu-rich.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
TADA1	117143	broad.mit.edu	37	1	166829516	166829516	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166829516C>T	uc001gdw.2	-	6	783	c.599G>A	c.(598-600)CGA>CAA	p.R200Q	TADA1_uc001gdv.2_Missense_Mutation_p.R58Q	NM_053053	NP_444281	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1-like	200					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(1)	1																		---	---	---	---
SELE	6401	broad.mit.edu	37	1	169699697	169699697	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169699697C>A	uc001ggm.3	-	5	748	c.591G>T	c.(589-591)CTG>CTT	p.L197L	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	197	Sushi 1.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)																	---	---	---	---
CACNA1E	777	broad.mit.edu	37	1	181695296	181695296	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181695296C>T	uc001gow.2	+	18	2403	c.2238C>T	c.(2236-2238)ATC>ATT	p.I746I	CACNA1E_uc009wxs.2_Silent_p.I653I	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	746	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---
CACNA1E	777	broad.mit.edu	37	1	181724463	181724463	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181724463G>A	uc001gow.2	+	28	4084	c.3919G>A	c.(3919-3921)GCA>ACA	p.A1307T	CACNA1E_uc009wxs.2_Missense_Mutation_p.A1195T|CACNA1E_uc001gox.1_Missense_Mutation_p.A533T|CACNA1E_uc009wxt.2_Missense_Mutation_p.A533T	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1307	III.|Helical; Name=S5 of repeat III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---
LRRN2	10446	broad.mit.edu	37	1	204587180	204587180	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204587180C>T	uc001hbe.1	-	3	2329	c.1941G>A	c.(1939-1941)GCG>GCA	p.A647A	MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Silent_p.A647A|LRRN2_uc009xbf.1_Silent_p.A647A|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor	647	Helical; (Potential).				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)															---	---	---	---
CR1	1378	broad.mit.edu	37	1	207680071	207680071	+	Missense_Mutation	SNP	G	A	A	rs56102840		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207680071G>A	uc001hfy.2	+	3	454	c.314G>A	c.(313-315)CGT>CAT	p.R105H	CR1_uc009xcl.1_Missense_Mutation_p.R105H|CR1_uc001hfx.2_Missense_Mutation_p.R105H|CR1_uc010psg.1_Missense_Mutation_p.R105H|CR1_uc009xcj.1_Missense_Mutation_p.R105H|CR1_uc009xck.1_Missense_Mutation_p.R105H	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	105	Extracellular (Potential).|Sushi 2.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
OR6F1	343169	broad.mit.edu	37	1	247875662	247875662	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875662G>A	uc001idj.1	-	1	396	c.396C>T	c.(394-396)TAC>TAT	p.Y132Y		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	132	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457952	248457952	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457952T>G	uc010pzj.1	-	1	929	c.929A>C	c.(928-930)AAA>ACA	p.K310T		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	310	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
ALLC	55821	broad.mit.edu	37	2	3749215	3749215	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3749215C>T	uc010ewt.2	+	11	1125	c.964C>T	c.(964-966)CCA>TCA	p.P322S	ALLC_uc002qyf.2_Missense_Mutation_p.P93S	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	341							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)											HNSCC(21;0.051)			---	---	---	---
FAM179A	165186	broad.mit.edu	37	2	29268228	29268228	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29268228C>T	uc010ezl.2	+	19	3025	c.2674C>T	c.(2674-2676)CGT>TGT	p.R892C	FAM179A_uc010ymm.1_Missense_Mutation_p.R837C|FAM179A_uc002rmr.3_Missense_Mutation_p.R419C|FAM179A_uc002rms.1_Missense_Mutation_p.R190C	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	892							binding			ovary(3)|skin(1)	4																		---	---	---	---
POLR1A	25885	broad.mit.edu	37	2	86308050	86308050	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86308050C>T	uc002sqs.2	-	9	1354	c.975G>A	c.(973-975)ACG>ACA	p.T325T	POLR1A_uc002sqv.2_Silent_p.T325T	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	325					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89292023	89292023	+	RNA	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89292023C>A	uc010ytr.1	-	82		c.7183G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
ZC3H6	376940	broad.mit.edu	37	2	113089990	113089990	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113089990C>A	uc002thq.1	+	12	3889	c.3495C>A	c.(3493-3495)CCC>CCA	p.P1165P		NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6	1165							nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128922385	128922385	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128922385T>G	uc002tps.2	+	26	3085	c.2907T>G	c.(2905-2907)TTT>TTG	p.F969L	UGGT1_uc010fme.1_Missense_Mutation_p.F844L|UGGT1_uc002tpr.2_Missense_Mutation_p.F945L	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	969					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179424587	179424587	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179424587T>C	uc010zfg.1	-	275	78792	c.78568A>G	c.(78568-78570)AGT>GGT	p.S26190G	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S19885G|TTN_uc010zfi.1_Missense_Mutation_p.S19818G|TTN_uc010zfj.1_Missense_Mutation_p.S19693G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27117							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
FN1	2335	broad.mit.edu	37	2	216285422	216285422	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216285422C>A	uc002vfa.2	-	11	1915	c.1649G>T	c.(1648-1650)CGG>CTG	p.R550L	FN1_uc002vfb.2_Missense_Mutation_p.R550L|FN1_uc002vfc.2_Missense_Mutation_p.R550L|FN1_uc002vfd.2_Missense_Mutation_p.R550L|FN1_uc002vfe.2_Missense_Mutation_p.R550L|FN1_uc002vff.2_Missense_Mutation_p.R550L|FN1_uc002vfg.2_Missense_Mutation_p.R550L|FN1_uc002vfh.2_Missense_Mutation_p.R550L|FN1_uc002vfi.2_Missense_Mutation_p.R550L|FN1_uc002vfj.2_Missense_Mutation_p.R550L|FN1_uc002vfl.2_Missense_Mutation_p.R550L	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	550	Collagen-binding.|Fibronectin type-I 8.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
STK36	27148	broad.mit.edu	37	2	219566588	219566588	+	Splice_Site	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219566588G>T	uc002viu.2	+	27	4071	c.3805_splice	c.e27-1	p.V1269_splice	STK36_uc002viv.2_Splice_Site_p.V1248_splice|STK36_uc002viw.2_Splice_Site_p.V447_splice|STK36_uc002vix.2_Splice_Site_p.V314_splice	NM_015690	NP_056505			serine/threonine kinase 36						cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)														---	---	---	---
RFTN1	23180	broad.mit.edu	37	3	16419352	16419352	+	Silent	SNP	G	T	T	rs61739728	byFrequency;by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16419352G>T	uc003cay.2	-	5	981	c.699C>A	c.(697-699)CTC>CTA	p.L233L	RFTN1_uc010hes.2_Silent_p.L197L	NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein	233						plasma membrane				ovary(3)|central_nervous_system(1)	4																		---	---	---	---
RARB	5915	broad.mit.edu	37	3	25637920	25637920	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25637920G>C	uc011awl.1	+	8	1247	c.1181G>C	c.(1180-1182)CGT>CCT	p.R394P	RARB_uc003cdi.1_Missense_Mutation_p.R275P|RARB_uc003cdh.2_Missense_Mutation_p.R387P	NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2	394	Ligand-binding.				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
TRAK1	22906	broad.mit.edu	37	3	42264466	42264466	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42264466G>A	uc003cky.2	+	16	2315	c.2099G>A	c.(2098-2100)AGC>AAC	p.S700N	TRAK1_uc011azi.1_Missense_Mutation_p.S679N	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	700					endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1																		---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48629354	48629354	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48629354C>T	uc003ctz.2	-	10	1335	c.1334G>A	c.(1333-1335)CGG>CAG	p.R445Q		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	445	Nonhelical region (NC1).|Fibronectin type-III 3.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
LAMB2	3913	broad.mit.edu	37	3	49159423	49159423	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49159423C>T	uc003cwe.2	-	29	5176	c.4877G>A	c.(4876-4878)CGG>CAG	p.R1626Q	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1626	Potential.|Domain I.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity	p.R1626P(1)		ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
ITIH1	3697	broad.mit.edu	37	3	52824909	52824909	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52824909G>A	uc003dfs.2	+	20	2490	c.2466G>A	c.(2464-2466)CGG>CGA	p.R822R	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Silent_p.R423R|ITIH1_uc010hmo.1_Silent_p.R376R|ITIH1_uc003dfu.2_Silent_p.R188R	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	822	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)														---	---	---	---
PCCB	5096	broad.mit.edu	37	3	135979378	135979378	+	Splice_Site	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135979378G>T	uc003eqy.1	+	4	480	c.429_splice	c.e4+1	p.K143_splice	PCCB_uc003eqz.1_Splice_Site_p.K143_splice|PCCB_uc011bmc.1_Splice_Site_p.K163_splice|PCCB_uc011bmd.1_Splice_Site_p.K60_splice	NM_000532	NP_000523			propionyl Coenzyme A carboxylase, beta						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|propionyl-CoA carboxylase activity				0					Biotin(DB00121)|L-Valine(DB00161)													---	---	---	---
ECE2	9718	broad.mit.edu	37	3	184002898	184002898	+	Intron	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184002898G>T	uc003fni.3	+						ECE2_uc011brh.1_Intron|ECE2_uc003fnl.3_Intron|ECE2_uc003fnm.3_Intron|ECE2_uc003fnk.3_Intron|ECE2_uc011bri.1_Intron|ECE2_uc010hxv.2_Intron	NM_014693	NP_055508			endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)													OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TP63	8626	broad.mit.edu	37	3	189612028	189612028	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189612028C>T	uc003fry.2	+	14	1869	c.1780C>T	c.(1780-1782)CGA>TGA	p.R594*	TP63_uc003frz.2_3'UTR|TP63_uc010hzc.1_3'UTR|TP63_uc003fsc.2_Nonsense_Mutation_p.R500*|TP63_uc003fsd.2_3'UTR|TP63_uc010hzd.1_Nonsense_Mutation_p.R415*	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	594	SAM.				anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
FAM193A	8603	broad.mit.edu	37	4	2701829	2701829	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2701829C>A	uc010icl.2	+	17	3408	c.3057C>A	c.(3055-3057)CCC>CCA	p.P1019P	FAM193A_uc010ick.2_Silent_p.P1219P|FAM193A_uc003gfd.2_Silent_p.P1019P|FAM193A_uc011bvm.1_Silent_p.P1041P|FAM193A_uc011bvn.1_Silent_p.P1019P|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Silent_p.P873P	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	1019										ovary(3)	3																		---	---	---	---
MTTP	4547	broad.mit.edu	37	4	100540242	100540242	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100540242C>A	uc003hvc.3	+	17	2585	c.2329C>A	c.(2329-2331)CGA>AGA	p.R777R	MTTP_uc011cej.1_Silent_p.R804R	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	777					lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)													---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13753659	13753659	+	Splice_Site	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13753659C>A	uc003jfd.2	-	63	10598	c.10556_splice	c.e63-1	p.G3519_splice	DNAH5_uc003jfc.2_Splice_Site	NM_001369	NP_001360			dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
KDM3B	51780	broad.mit.edu	37	5	137761248	137761248	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137761248G>T	uc003lcy.1	+	17	4588	c.4388G>T	c.(4387-4389)TGG>TTG	p.W1463L	KDM3B_uc010jew.1_Missense_Mutation_p.W1119L|KDM3B_uc011cys.1_Missense_Mutation_p.W495L	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1463					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11																		---	---	---	---
PCDHB3	56132	broad.mit.edu	37	5	140482254	140482254	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140482254C>A	uc003lio.2	+	1	2021	c.2021C>A	c.(2020-2022)CCG>CAG	p.P674Q	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	674	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB4	56131	broad.mit.edu	37	5	140502903	140502903	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502903C>A	uc003lip.1	+	1	1323	c.1323C>A	c.(1321-1323)TCC>TCA	p.S441S		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	441	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB7	56129	broad.mit.edu	37	5	140553745	140553745	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553745C>T	uc003lit.2	+	1	1503	c.1329C>T	c.(1327-1329)GAC>GAT	p.D443D		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	443	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHGC3	5098	broad.mit.edu	37	5	140856587	140856587	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140856587G>T	uc003lkv.1	+	1	1019	c.904G>T	c.(904-906)GGG>TGG	p.G302W	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lku.1_Missense_Mutation_p.G302W|PCDHGC3_uc003lkw.1_Intron	NM_002588	NP_002579	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3 isoform 1	302	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
STK10	6793	broad.mit.edu	37	5	171520875	171520875	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171520875C>T	uc003mbo.1	-	9	1395	c.1095G>A	c.(1093-1095)CCG>CCA	p.P365P		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	365							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
ATF6B	1388	broad.mit.edu	37	6	32095883	32095883	+	Intron	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32095883C>A	uc003nzn.2	-						ATF6B_uc003nzo.2_Intron|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_Intron	NM_004381	NP_004372			activating transcription factor 6 beta isoform						response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
TMEM63B	55362	broad.mit.edu	37	6	44115129	44115129	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44115129G>T	uc003owr.2	+	12	943	c.879G>T	c.(877-879)CGG>CGT	p.R293R	TMEM63B_uc003owq.1_Silent_p.R293R|TMEM63B_uc003ows.2_Silent_p.R196R|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	293						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)															---	---	---	---
TNFRSF21	27242	broad.mit.edu	37	6	47253910	47253910	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47253910C>A	uc003oyv.2	-	2	951	c.518G>T	c.(517-519)CGG>CTG	p.R173L		NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,	173	Extracellular (Potential).|TNFR-Cys 4.				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)															---	---	---	---
RAET1E	135250	broad.mit.edu	37	6	150211239	150211239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150211239G>A	uc003qnl.1	-	2	188	c.128C>T	c.(127-129)TCC>TTC	p.S43F	uc003qni.1_Intron|RAET1E_uc003qnj.2_Missense_Mutation_p.S43F|RAET1E_uc003qnk.1_Intron|RAET1E_uc010kih.1_RNA	NM_139165	NP_631904	Q8TD07	N2DL4_HUMAN	retinoic acid early transcript 1E precursor	43	MHC class I alpha-1 like.|Extracellular (Potential).				antigen processing and presentation|immune response|regulation of immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)														---	---	---	---
CRHR2	1395	broad.mit.edu	37	7	30695259	30695259	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30695259G>A	uc003tbn.2	-	10	1234	c.990C>T	c.(988-990)CCC>CCT	p.P330P	CRHR2_uc010kvw.1_Silent_p.P330P|CRHR2_uc010kvx.1_Silent_p.P329P|CRHR2_uc010kvy.1_Silent_p.P166P|CRHR2_uc003tbo.2_Silent_p.P316P|CRHR2_uc003tbp.2_Silent_p.P357P	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	330	Helical; Name=6; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4																		---	---	---	---
PKD1L1	168507	broad.mit.edu	37	7	47930282	47930282	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47930282C>T	uc003tny.1	-	16	2533	c.2533G>A	c.(2533-2535)GCG>ACG	p.A845T		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	845	Extracellular (Potential).|REJ.				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11																		---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100679711	100679711	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100679711C>A	uc003uxp.1	+	3	5067	c.5014C>A	c.(5014-5016)CCT>ACT	p.P1672T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1672	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|26.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
LRRC4	64101	broad.mit.edu	37	7	127670639	127670639	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127670639G>A	uc003vmk.2	-	2	192	c.55C>T	c.(55-57)CTC>TTC	p.L19F	SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron	NM_022143	NP_071426	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4 precursor	19						cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4				Lung(243;0.124)														---	---	---	---
ATP6V0A4	50617	broad.mit.edu	37	7	138447716	138447716	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138447716C>T	uc003vuf.2	-	5	584	c.346G>A	c.(346-348)GCC>ACC	p.A116T	ATP6V0A4_uc003vug.2_Missense_Mutation_p.A116T|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.A116T	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	116	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1																		---	---	---	---
DENND2A	27147	broad.mit.edu	37	7	140301583	140301583	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301583C>A	uc010lnj.2	-	1	760	c.615G>T	c.(613-615)CTG>CTT	p.L205L	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Silent_p.L205L|DENND2A_uc003vvw.2_Silent_p.L205L|DENND2A_uc003vvx.2_Silent_p.L205L	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	205										ovary(3)|breast(1)	4	Melanoma(164;0.00956)																	---	---	---	---
ABCB8	11194	broad.mit.edu	37	7	150733666	150733666	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150733666C>A	uc003wil.3	+	10	1291	c.1198C>A	c.(1198-1200)CTT>ATT	p.L400I	ABCB8_uc003wii.2_Missense_Mutation_p.L420I|ABCB8_uc003wij.3_Missense_Mutation_p.L383I|ABCB8_uc010lpw.1_Missense_Mutation_p.P283H|ABCB8_uc010lpx.2_Missense_Mutation_p.L383I|ABCB8_uc011kvd.1_Missense_Mutation_p.L295I|ABCB8_uc003wim.3_Missense_Mutation_p.L178I|ABCB8_uc003wik.3_Missense_Mutation_p.L383I	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8	400	ABC transmembrane type-1.|Helical; (Potential).					ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
CTSB	1508	broad.mit.edu	37	8	11704610	11704610	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11704610G>T	uc003wum.2	-	10	1068	c.744C>A	c.(742-744)CCC>CCA	p.P248P	CTSB_uc003wul.2_Silent_p.P185P|CTSB_uc011kxl.1_Silent_p.P169P|CTSB_uc003wun.2_Silent_p.P248P|CTSB_uc003wuo.2_Silent_p.P248P|CTSB_uc003wup.2_Silent_p.P248P|CTSB_uc003wuq.2_Silent_p.P248P|CTSB_uc010lsc.2_Silent_p.P124P|CTSB_uc003wur.2_Silent_p.P248P|CTSB_uc003wus.1_Silent_p.P248P|CTSB_uc003wut.1_Silent_p.P248P|CTSB_uc003wuu.2_Silent_p.P104P	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein	248					proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)														---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52252243	52252243	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52252243G>T	uc003xqu.3	-	21	4188	c.4087C>A	c.(4087-4089)CAA>AAA	p.Q1363K	PXDNL_uc003xqt.3_Intron	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	1363					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
ZHX2	22882	broad.mit.edu	37	8	123965535	123965535	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123965535G>T	uc003ypk.1	+	3	2352	c.1785G>T	c.(1783-1785)ATG>ATT	p.M595I		NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	595						cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
RANBP6	26953	broad.mit.edu	37	9	6015394	6015394	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6015394C>T	uc003zjr.2	-	1	225	c.214G>A	c.(214-216)GCA>ACA	p.A72T	RANBP6_uc011lmf.1_Intron|RANBP6_uc003zjs.2_Intron	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	72					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)														---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82320813	82320813	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82320813G>T	uc004ald.2	+	10	1567	c.718G>T	c.(718-720)GGT>TGT	p.G240C	TLE4_uc004alc.2_Missense_Mutation_p.G247C|TLE4_uc010mpr.2_Missense_Mutation_p.G126C|TLE4_uc004ale.2_5'UTR|TLE4_uc011lsq.1_Missense_Mutation_p.G215C|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Missense_Mutation_p.G186C	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
GARNL3	84253	broad.mit.edu	37	9	130152979	130152979	+	Silent	SNP	C	A	A	rs143165320	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130152979C>A	uc011mae.1	+	27	3204	c.2803C>A	c.(2803-2805)CGG>AGG	p.R935R	GARNL3_uc011mad.1_Silent_p.R913R|GARNL3_uc010mxi.2_Silent_p.R165R	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	935					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
SPTAN1	6709	broad.mit.edu	37	9	131344156	131344156	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131344156G>T	uc004bvl.3	+	12	1670	c.1557G>T	c.(1555-1557)CAG>CAT	p.Q519H	SPTAN1_uc011mbg.1_Missense_Mutation_p.Q519H|SPTAN1_uc011mbh.1_Missense_Mutation_p.Q531H|SPTAN1_uc004bvm.3_Missense_Mutation_p.Q519H|SPTAN1_uc004bvn.3_Missense_Mutation_p.Q519H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	519	Spectrin 6.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10																		---	---	---	---
C9orf139	401563	broad.mit.edu	37	9	139927513	139927513	+	5'UTR	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139927513G>T	uc004ckp.1	+	2					FUT7_uc004ckq.2_5'Flank	NM_207511	NP_997394			hypothetical protein LOC401563												0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)														---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30318363	30318363	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30318363G>T	uc001iux.2	-	2	773	c.714C>A	c.(712-714)CCC>CCA	p.P238P	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Silent_p.P100P|KIAA1462_uc009xle.1_Silent_p.P238P	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	238										ovary(4)	4																		---	---	---	---
LIPF	8513	broad.mit.edu	37	10	90438318	90438318	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90438318C>A	uc001kfg.1	+	10	1243	c.1077C>A	c.(1075-1077)CCC>CCA	p.P359P	LIPF_uc001kfh.1_Silent_p.P336P|LIPF_uc010qmt.1_Silent_p.P369P|LIPF_uc010qmu.1_Silent_p.P326P	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor	359					lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)														---	---	---	---
OSBPL5	114879	broad.mit.edu	37	11	3114795	3114795	+	Silent	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3114795C>T	uc001lxk.2	-	17	2066	c.1908G>A	c.(1906-1908)ACG>ACA	p.T636T	OSBPL5_uc010qxq.1_Silent_p.T547T|OSBPL5_uc009ydw.2_Silent_p.T568T|OSBPL5_uc001lxl.2_Silent_p.T568T|OSBPL5_uc009ydx.2_Silent_p.T660T|OSBPL5_uc001lxj.2_Silent_p.T90T	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform	636					cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)														---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16340111	16340111	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16340111C>T	uc001mme.2	-	3	398	c.365G>A	c.(364-366)CGT>CAT	p.R122H	SOX6_uc001mmd.2_Missense_Mutation_p.R112H|SOX6_uc001mmf.2_Missense_Mutation_p.R109H|SOX6_uc001mmg.2_Missense_Mutation_p.R109H|SOX6_uc001mmh.1_RNA|SOX6_uc009ygs.2_RNA|SOX6_uc001mmi.3_Missense_Mutation_p.R109H|SOX6_uc001mmj.2_Missense_Mutation_p.R109H	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	109					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16816154	16816154	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16816154G>T	uc001mmo.2	-	19	2641	c.2626C>A	c.(2626-2628)CCT>ACT	p.P876T	PLEKHA7_uc010rcu.1_Missense_Mutation_p.P876T|PLEKHA7_uc001mmm.2_5'Flank|PLEKHA7_uc010rcv.1_Missense_Mutation_p.P450T|PLEKHA7_uc001mmn.2_Missense_Mutation_p.P584T	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	876	Pro-rich.				epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
TRIM48	79097	broad.mit.edu	37	11	55036746	55036746	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55036746C>A	uc010rid.1	+	5	693	c.607C>A	c.(607-609)CAG>AAG	p.Q203K		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	187						intracellular	zinc ion binding				0																		---	---	---	---
OR5R1	219479	broad.mit.edu	37	11	56184928	56184928	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184928G>T	uc010rji.1	-	1	781	c.781C>A	c.(781-783)CAG>AAG	p.Q261K		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
EHBP1L1	254102	broad.mit.edu	37	11	65350742	65350742	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65350742C>T	uc001oeo.3	+	9	2864	c.2599C>T	c.(2599-2601)CGT>TGT	p.R867C	EHBP1L1_uc001oep.1_Intron	NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	867	Glu-rich.									central_nervous_system(1)	1																		---	---	---	---
CLCF1	23529	broad.mit.edu	37	11	67133090	67133090	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67133090C>A	uc001okq.2	-	3	391	c.195G>T	c.(193-195)CTG>CTT	p.L65L	LOC100130987_uc010rpo.1_Intron|CLCF1_uc010rpp.1_Silent_p.L55L	NM_013246	NP_037378	Q9UBD9	CLCF1_HUMAN	cardiotrophin-like cytokine factor 1 precursor	65					B cell differentiation|cytokine-mediated signaling pathway|JAK-STAT cascade|negative regulation of neuron apoptosis|positive regulation of astrocyte differentiation|positive regulation of B cell proliferation|positive regulation of immunoglobulin production|positive regulation of isotype switching to IgE isotypes|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	ciliary neurotrophic factor receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity				0			BRCA - Breast invasive adenocarcinoma(15;2.39e-06)															---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92531125	92531125	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92531125C>A	uc001pdj.3	+	9	4963	c.4946C>A	c.(4945-4947)CCG>CAG	p.P1649Q		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1649	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115080343	115080343	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115080343G>T	uc001ppi.3	-	8	1158	c.1029C>A	c.(1027-1029)ACC>ACA	p.T343T	CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001pph.3_Silent_p.T95T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	343	Extracellular (Potential).			PPTTIPPPTTTTTTTTTTTTTILTIIT -> TTATTEPAVH GLTQLPNSAEELDSEDLS (in Ref. 3; BAC11657).	adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
ARHGAP32	9743	broad.mit.edu	37	11	128843239	128843239	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128843239G>T	uc009zcp.2	-	21	3120	c.3120C>A	c.(3118-3120)GCC>GCA	p.A1040A	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Silent_p.A691A	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1040					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5																		---	---	---	---
ACSM4	341392	broad.mit.edu	37	12	7475048	7475048	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7475048G>A	uc001qsx.1	+	7	1036	c.1036G>A	c.(1036-1038)GGA>AGA	p.G346R		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	346					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0																		---	---	---	---
EPS8	2059	broad.mit.edu	37	12	15835839	15835839	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15835839G>T	uc009zif.2	-	2	141	c.47C>A	c.(46-48)CCA>CAA	p.P16Q	EPS8_uc001rdb.2_Missense_Mutation_p.P16Q|EPS8_uc009zig.2_5'UTR	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	16					cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)														---	---	---	---
OVCH1	341350	broad.mit.edu	37	12	29630302	29630302	+	Silent	SNP	G	T	T	rs144867067	by1000genomes	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29630302G>T	uc001rix.1	-	11	1218	c.1218C>A	c.(1216-1218)ACC>ACA	p.T406T		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	406	CUB 1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)																	---	---	---	---
ADAMTS20	80070	broad.mit.edu	37	12	43833818	43833818	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43833818G>A	uc010skx.1	-	17	2345	c.2345C>T	c.(2344-2346)ACG>ATG	p.T782M	ADAMTS20_uc001rno.1_5'Flank|ADAMTS20_uc001rnp.1_5'Flank	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	782	Spacer.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)														---	---	---	---
ANO6	196527	broad.mit.edu	37	12	45795715	45795715	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45795715G>A	uc001roo.2	+	13	1859	c.1524G>A	c.(1522-1524)ACG>ACA	p.T508T	ANO6_uc010sld.1_Silent_p.T508T|ANO6_uc010sle.1_Silent_p.T508T|ANO6_uc010slf.1_Silent_p.T529T|ANO6_uc010slg.1_Silent_p.T490T	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	508	Extracellular (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2																		---	---	---	---
KRT74	121391	broad.mit.edu	37	12	52967140	52967140	+	Missense_Mutation	SNP	C	A	A	rs148593059		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967140C>A	uc001sap.1	-	1	470	c.422G>T	c.(421-423)CGG>CTG	p.R141L		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	141	Coil 1A.|Rod.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)														---	---	---	---
CNPY2	10330	broad.mit.edu	37	12	56705033	56705033	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56705033G>T	uc001sku.1	-	4	911	c.370C>A	c.(370-372)CGA>AGA	p.R124R		NM_014255	NP_055070	Q9Y2B0	CNPY2_HUMAN	canopy 2 homolog precursor	124	Saposin B-type.					endoplasmic reticulum|integral to plasma membrane	protein binding				0																		---	---	---	---
C12orf66	144577	broad.mit.edu	37	12	64588259	64588259	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64588259C>A	uc001srw.3	-	3	760	c.701G>T	c.(700-702)CGG>CTG	p.R234L	C12orf66_uc009zql.2_Missense_Mutation_p.R181L	NM_152440	NP_689653	Q96MD2	CL066_HUMAN	hypothetical protein LOC144577	234										ovary(1)	1																		---	---	---	---
NUPL1	9818	broad.mit.edu	37	13	25882091	25882091	+	Intron	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25882091G>T	uc001uqi.2	+						NUPL1_uc001uqg.1_Intron|NUPL1_uc001uqj.2_Intron	NM_014089	NP_054808			nucleoporin like 1 isoform a						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)														---	---	---	---
FRY	10129	broad.mit.edu	37	13	32745282	32745282	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32745282G>A	uc001utx.2	+	18	2522	c.2026G>A	c.(2026-2028)GAT>AAT	p.D676N	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	676					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
PRKD1	5587	broad.mit.edu	37	14	30107739	30107739	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30107739G>T	uc001wqh.2	-	6	1122	c.941C>A	c.(940-942)CCG>CAG	p.P314Q		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	314	Phorbol-ester/DAG-type 2.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)														---	---	---	---
WDHD1	11169	broad.mit.edu	37	14	55474071	55474071	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55474071A>C	uc001xbm.1	-	7	605	c.527T>G	c.(526-528)CTG>CGG	p.L176R	WDHD1_uc001xbn.1_Missense_Mutation_p.L53R	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	176						cytoplasm|nucleoplasm	DNA binding			skin(1)	1																		---	---	---	---
OTX2	5015	broad.mit.edu	37	14	57268588	57268588	+	Silent	SNP	A	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57268588A>C	uc001xcp.2	-	3	906	c.735T>G	c.(733-735)GCT>GCG	p.A245A	OTX2_uc010aou.2_Silent_p.A245A|OTX2_uc001xcq.2_Silent_p.A253A	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	245					axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)																	---	---	---	---
SIX6	4990	broad.mit.edu	37	14	60976532	60976532	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60976532C>T	uc001xfa.3	+	1	595	c.416C>T	c.(415-417)ACG>ATG	p.T139M		NM_007374	NP_031400	O95475	SIX6_HUMAN	SIX homeobox 6	139	Homeobox.				organ morphogenesis|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.088)														---	---	---	---
DCAF5	8816	broad.mit.edu	37	14	69589026	69589026	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69589026G>T	uc001xkp.2	-	2	485	c.266C>A	c.(265-267)TCC>TAC	p.S89Y	DCAF5_uc001xkq.2_Missense_Mutation_p.S89Y|DCAF5_uc001xkr.3_Missense_Mutation_p.S89Y|DCAF5_uc001xks.2_Missense_Mutation_p.S89Y	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	89	WD 1.					CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ADAM21	8747	broad.mit.edu	37	14	70925416	70925416	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925416G>T	uc001xmd.2	+	1	1200	c.1200G>T	c.(1198-1200)TTG>TTT	p.L400F		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	400	Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)														---	---	---	---
FLRT2	23768	broad.mit.edu	37	14	86088177	86088177	+	Missense_Mutation	SNP	C	A	A	rs117507441	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088177C>A	uc001xvr.2	+	2	1086	c.319C>A	c.(319-321)CTT>ATT	p.L107I	FLRT2_uc010atd.2_Missense_Mutation_p.L107I	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	107	Extracellular (Potential).|LRR 2.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)														---	---	---	---
SERPINA1	5265	broad.mit.edu	37	14	94844886	94844886	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94844886G>T	uc001ycx.3	-	5	1418	c.1157C>A	c.(1156-1158)CCC>CAC	p.P386H	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Missense_Mutation_p.P386H|SERPINA1_uc010aux.2_Missense_Mutation_p.P386H|SERPINA1_uc001ycy.3_Missense_Mutation_p.P386H|SERPINA1_uc010auy.2_Missense_Mutation_p.P386H|SERPINA1_uc001ycz.3_Missense_Mutation_p.P386H|SERPINA1_uc010auz.2_Missense_Mutation_p.P386H|SERPINA1_uc010ava.2_Missense_Mutation_p.P386H|SERPINA1_uc001ydb.3_Missense_Mutation_p.P386H|SERPINA1_uc010avb.2_Missense_Mutation_p.P386H|SERPINA1_uc001ydc.3_Missense_Mutation_p.P386H	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	386	RCL.		P -> H (in Sao Tome).|P -> T (in L-Offenbach).		acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)									Alpha-1-Antitrypsin_Deficiency				---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25972389	25972389	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25972389G>A	uc010ayu.2	-	4	871	c.765C>T	c.(763-765)GCC>GCT	p.A255A		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	255	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
APBA2	321	broad.mit.edu	37	15	29400522	29400522	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29400522C>A	uc001zck.2	+	12	2174	c.1967C>A	c.(1966-1968)CCG>CAG	p.P656Q	APBA2_uc010azj.2_Missense_Mutation_p.P644Q|APBA2_uc010uat.1_Missense_Mutation_p.P644Q|APBA2_uc001zcl.2_Missense_Mutation_p.P644Q	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	656					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)														---	---	---	---
DNAJC17	55192	broad.mit.edu	37	15	41068454	41068454	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41068454C>A	uc001zms.1	-	6	429	c.418G>T	c.(418-420)GAG>TAG	p.E140*	DNAJC17_uc010bbz.1_RNA|DNAJC17_uc010bca.1_RNA|DNAJC17_uc010bcb.1_RNA	NM_018163	NP_060633	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	140					protein folding		heat shock protein binding|nucleotide binding|RNA binding|unfolded protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)														---	---	---	---
CIB2	10518	broad.mit.edu	37	15	78398116	78398116	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78398116G>A	uc002bdb.1	-	5	828	c.507C>T	c.(505-507)TTC>TTT	p.F169F	CIB2_uc002bdc.1_Silent_p.F126F|CIB2_uc010ums.1_Silent_p.F169F	NM_006383	NP_006374	O75838	CIB2_HUMAN	DNA-dependent protein kinase catalytic	169	EF-hand 3.						calcium ion binding				0																		---	---	---	---
BNC1	646	broad.mit.edu	37	15	83933367	83933367	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83933367A>T	uc002bjt.1	-	4	724	c.636T>A	c.(634-636)AGT>AGA	p.S212R	BNC1_uc010uos.1_Missense_Mutation_p.S200R	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	212					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ZNF213	7760	broad.mit.edu	37	16	3188968	3188968	+	Intron	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3188968C>A	uc010uws.1	+						ZNF213_uc002cud.2_Intron|ZNF213_uc010btf.2_3'UTR|ZNF213_uc010bth.2_Intron|ZNF213_uc010uwt.1_Intron	NM_004220	NP_004211			zinc finger protein 213						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
HMOX2	3163	broad.mit.edu	37	16	4557024	4557024	+	Intron	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4557024C>A	uc010bts.2	+						HMOX2_uc002cwr.3_Intron|HMOX2_uc002cwq.3_Intron|HMOX2_uc002cws.3_Intron|HMOX2_uc010btt.2_Intron|HMOX2_uc002cwt.2_Intron	NM_001127206	NP_001120678			heme oxygenase (decyclizing) 2						cellular iron ion homeostasis|heme catabolic process|heme oxidation|response to hypoxia|transmembrane transport	endoplasmic reticulum membrane|microsome|plasma membrane	electron carrier activity|heme oxygenase (decyclizing) activity|metal ion binding|protein binding				0					NADH(DB00157)											OREG0023582	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
NTAN1	123803	broad.mit.edu	37	16	15141761	15141761	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15141761C>A	uc002ddd.2	-	3	206	c.201G>T	c.(199-201)CTG>CTT	p.L67L	PDXDC1_uc002ddc.2_Intron|NTAN1_uc010uzo.1_5'UTR	NM_173474	NP_775745	Q96AB6	NTAN1_HUMAN	N-terminal Asn amidase	67						cytoplasm					0																		---	---	---	---
NOD2	64127	broad.mit.edu	37	16	50765701	50765701	+	Missense_Mutation	SNP	G	T	T	rs147874812	byFrequency	TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50765701G>T	uc002egm.1	+	12	3199	c.3094G>T	c.(3094-3096)GGC>TGC	p.G1032C	NOD2_uc010vgq.1_Missense_Mutation_p.G77C	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	1032	LRR 9.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)																---	---	---	---
CETP	1071	broad.mit.edu	37	16	57003848	57003848	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57003848G>T	uc002eki.2	+	5	519	c.462G>T	c.(460-462)CGG>CGT	p.R154R	CETP_uc002ekj.2_Silent_p.R154R	NM_000078	NP_000069	P11597	CETP_HUMAN	cholesteryl ester transfer protein, plasma	154					cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|lipoprotein metabolic process|low-density lipoprotein particle remodeling|phosphatidylcholine metabolic process|phospholipid homeostasis|receptor-mediated endocytosis|regulation of cholesterol efflux|triglyceride homeostasis|triglyceride metabolic process|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle|vesicle	cholesterol binding|cholesterol transporter activity|phosphatidylcholine binding|phospholipid transporter activity|triglyceride binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
OR1E1	8387	broad.mit.edu	37	17	3301695	3301695	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3301695G>T	uc002fvj.1	-	1	10	c.10C>A	c.(10-12)CAA>AAA	p.Q4K		NM_003553	NP_003544	P30953	OR1E1_HUMAN	olfactory receptor, family 1, subfamily E,	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578370C>T	uc002gim.2	-	5	753	c.559_splice	c.e5+1	p.G187_splice	TP53_uc002gig.1_Splice_Site_p.G187_splice|TP53_uc002gih.2_Splice_Site_p.G187_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Intron|TP53_uc010cng.1_Intron|TP53_uc002gii.1_Intron|TP53_uc010cnh.1_Splice_Site_p.G187_splice|TP53_uc010cni.1_Splice_Site_p.G187_splice|TP53_uc002gij.2_Splice_Site_p.G187_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Splice_Site_p.G94_splice|TP53_uc002gio.2_Splice_Site_p.G55_splice|TP53_uc010vug.1_Splice_Site_p.G148_splice	NM_001126112	NP_001119584			tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(24)|p.0?(7)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
MYH8	4626	broad.mit.edu	37	17	10318665	10318665	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10318665G>T	uc002gmm.2	-	8	780	c.685C>A	c.(685-687)CTA>ATA	p.L229I	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	229	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11														Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				---	---	---	---
MYH2	4620	broad.mit.edu	37	17	10428137	10428137	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10428137G>A	uc010coi.2	-	34	5036	c.4908C>T	c.(4906-4908)AAC>AAT	p.N1636N	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.N1636N|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1636	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14																		---	---	---	---
AMAC1	146861	broad.mit.edu	37	17	33520469	33520469	+	Silent	SNP	T	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33520469T>C	uc002hjd.2	-	1	944	c.858A>G	c.(856-858)CTA>CTG	p.L286L		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	286	DUF6 2.|Helical; (Potential).					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)														---	---	---	---
TAF15	8148	broad.mit.edu	37	17	34171133	34171133	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34171133C>A	uc002hkd.2	+	13	1145	c.1059C>A	c.(1057-1059)CCC>CCA	p.P353P	TAF15_uc010ctw.1_RNA|TAF15_uc002hkc.2_Silent_p.P350P	NM_139215	NP_631961	Q92804	RBP56_HUMAN	TBP-associated factor 15 isoform 1	353	Arg/Gly-rich.				positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)				T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								---	---	---	---
CACNB1	782	broad.mit.edu	37	17	37331634	37331634	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37331634C>A	uc002hrm.1	-	14	1762	c.1609G>T	c.(1609-1611)GGG>TGG	p.G537W	CACNB1_uc002hrl.1_Missense_Mutation_p.G309W	NM_000723	NP_000714	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1	537					axon guidance	voltage-gated calcium channel complex				large_intestine(1)|ovary(1)	2					Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Verapamil(DB00661)											OREG0024371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FKBP10	60681	broad.mit.edu	37	17	39969539	39969539	+	Intron	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39969539C>A	uc002hxv.2	+						SC65_uc002hxt.2_5'Flank|SC65_uc002hxu.2_5'Flank	NM_021939	NP_068758			FK506 binding protein 10 precursor						protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)														---	---	---	---
MKS1	54903	broad.mit.edu	37	17	56293543	56293543	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56293543C>T	uc002ivr.1	-	4	398	c.323G>A	c.(322-324)CGT>CAT	p.R108H	MKS1_uc010wnq.1_5'UTR|MKS1_uc002ivs.1_Missense_Mutation_p.R108H	NM_017777	NP_060247	Q9NXB0	MKS1_HUMAN	Meckel syndrome type 1 protein isoform 1	108					cilium assembly	centrosome|cilium|microtubule basal body	protein binding			ovary(1)	1																		---	---	---	---
MPO	4353	broad.mit.edu	37	17	56350133	56350133	+	Missense_Mutation	SNP	G	A	A	rs142082076		TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56350133G>A	uc002ivu.1	-	10	1945	c.1768C>T	c.(1768-1770)CGC>TGC	p.R590C		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	590					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)													---	---	---	---
DHX40	79665	broad.mit.edu	37	17	57656897	57656897	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57656897C>A	uc002ixn.1	+	9	1285	c.1138C>A	c.(1138-1140)CTG>ATG	p.L380M	DHX40_uc010woe.1_Missense_Mutation_p.L303M	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	380	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)																	---	---	---	---
MRC2	9902	broad.mit.edu	37	17	60741986	60741986	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60741986C>A	uc002jad.2	+	2	598	c.196C>A	c.(196-198)CCG>ACG	p.P66T	MRC2_uc002jac.2_Missense_Mutation_p.P66T	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	66	Extracellular (Potential).|Ricin B-type lectin.				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13049261	13049261	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13049261C>T	uc010xac.1	+	16	2551	c.2471C>T	c.(2470-2472)CCG>CTG	p.P824L	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.P349L|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Missense_Mutation_p.P565L	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	824										ovary(4)|pancreas(1)	5																		---	---	---	---
RIT2	6014	broad.mit.edu	37	18	40503581	40503581	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40503581G>T	uc002lav.2	-	4	555	c.382C>A	c.(382-384)CTG>ATG	p.L128M	RIT2_uc010dnf.2_Missense_Mutation_p.L128M	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	128					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
CDH20	28316	broad.mit.edu	37	18	59195390	59195390	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59195390C>A	uc010dps.1	+	6	1220	c.1208C>A	c.(1207-1209)GCG>GAG	p.A403E	CDH20_uc002lif.2_Missense_Mutation_p.A397E	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	403	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)																---	---	---	---
C19orf21	126353	broad.mit.edu	37	19	757262	757262	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:757262C>T	uc002lpo.2	+	2	399	c.316C>T	c.(316-318)CGT>TGT	p.R106C		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	106										upper_aerodigestive_tract(1)	1		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CHAF1A	10036	broad.mit.edu	37	19	4423868	4423868	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4423868C>A	uc002mal.2	+	7	1474	c.1374C>A	c.(1372-1374)CCC>CCA	p.P458P		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	458					cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)									Chromatin_Structure					---	---	---	---
RFX2	5990	broad.mit.edu	37	19	6026240	6026240	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6026240C>T	uc002meb.2	-	6	800	c.531G>A	c.(529-531)ATG>ATA	p.M177I	RFX2_uc002mec.2_Intron	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a	177					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6																		---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8176646	8176646	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8176646C>A	uc002mjf.2	-	31	3991	c.3970G>T	c.(3970-3972)GAA>TAA	p.E1324*		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1324	EGF-like 20; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11																		---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40384037	40384037	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40384037G>A	uc002omp.3	-	21	9581	c.9573C>T	c.(9571-9573)GAC>GAT	p.D3191D		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3191	TIL 7.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
PSG8	440533	broad.mit.edu	37	19	43258502	43258502	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43258502A>T	uc002ouo.2	-	5	1324	c.1226T>A	c.(1225-1227)ATG>AAG	p.M409K	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_RNA|PSG8_uc002oui.2_Missense_Mutation_p.M248K|PSG8_uc002ouh.2_Missense_Mutation_p.M409K|PSG8_uc010ein.2_Missense_Mutation_p.M287K|PSG8_uc002ouj.3_Missense_Mutation_p.M191K|PSG8_uc002ouk.3_Missense_Mutation_p.M248K|PSG8_uc002oul.3_Missense_Mutation_p.M409K|PSG8_uc002oum.3_Missense_Mutation_p.M316K|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.M316K	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	409	Ig-like C2-type 3.					extracellular region					0		Prostate(69;0.00899)																---	---	---	---
MIR520E	574461	broad.mit.edu	37	19	54178979	54178979	+	RNA	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54178979C>T	hsa-mir-520e|MI0003143	+			c.15C>T																				0																		---	---	---	---
CACNG6	59285	broad.mit.edu	37	19	54502911	54502911	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54502911A>G	uc002qct.2	+	3	1020	c.430A>G	c.(430-432)ATA>GTA	p.I144V	CACNG6_uc002qcu.2_Intron|CACNG6_uc002qcv.2_Intron	NM_145814	NP_665813	Q9BXT2	CCG6_HUMAN	voltage-dependent calcium channel gamma-6	144	Helical; (Potential).					voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(2)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)														---	---	---	---
LILRB1	10859	broad.mit.edu	37	19	55143396	55143396	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55143396C>A	uc002qgj.2	+	6	709	c.369C>A	c.(367-369)ATC>ATA	p.I123I	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Silent_p.I123I|LILRB1_uc002qgk.2_Silent_p.I123I|LILRB1_uc002qgm.2_Silent_p.I123I|LILRB1_uc010erq.2_Silent_p.I123I|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	123	Ig-like C2-type 2.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)											HNSCC(37;0.09)			---	---	---	---
ADAM33	80332	broad.mit.edu	37	20	3652984	3652984	+	Intron	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3652984G>T	uc002wit.2	-						ADAM33_uc002wiq.1_5'Flank|ADAM33_uc002wir.1_Intron|ADAM33_uc002wis.2_Intron|ADAM33_uc002wiu.2_Intron|uc002wiv.1_5'Flank|ADAM33_uc002wiw.1_Intron|ADAM33_uc010gba.1_Intron|ADAM33_uc010gbb.1_Intron	NM_025220	NP_079496			ADAM metallopeptidase domain 33 isoform alpha						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|ovary(1)|skin(1)	4																		---	---	---	---
HCK	3055	broad.mit.edu	37	20	30681784	30681784	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30681784G>T	uc002wxh.2	+	11	1382	c.1211G>T	c.(1210-1212)CGG>CTG	p.R404L	HCK_uc010gdy.2_Missense_Mutation_p.R383L|HCK_uc002wxi.2_Missense_Mutation_p.R382L	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	404	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
DIDO1	11083	broad.mit.edu	37	20	61513050	61513050	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61513050C>T	uc002ydr.1	-	16	4522	c.4258G>A	c.(4258-4260)GAG>AAG	p.E1420K	DIDO1_uc002yds.1_Missense_Mutation_p.E1420K	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	1420					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)																	---	---	---	---
SFRS15	57466	broad.mit.edu	37	21	33060663	33060663	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33060663G>T	uc002ypd.2	-	16	2426	c.2000C>A	c.(1999-2001)CCT>CAT	p.P667H	SFRS15_uc002ype.2_Missense_Mutation_p.P667H|SFRS15_uc010glu.2_Missense_Mutation_p.P652H|SFRS15_uc002ypf.1_Missense_Mutation_p.P341H	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	667						nucleus	nucleotide binding|RNA binding				0																		---	---	---	---
UFD1L	7353	broad.mit.edu	37	22	19445627	19445627	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19445627G>A	uc002zpm.2	-	7	661	c.531C>T	c.(529-531)GAC>GAT	p.D177D	UFD1L_uc002zpo.2_Silent_p.D177D|UFD1L_uc011agy.1_Silent_p.D177D|UFD1L_uc002zpp.2_Silent_p.D130D	NM_005659	NP_005650	Q92890	UFD1_HUMAN	ubiquitin fusion degradation 1-like isoform A	177					skeletal system development|ubiquitin-dependent protein catabolic process	cytosol|nucleus	protein binding|ubiquitin-specific protease activity				0	Colorectal(54;0.0993)																	---	---	---	---
PI4KA	5297	broad.mit.edu	37	22	21098946	21098946	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21098946G>T	uc002zsz.3	-	30	3483	c.3252C>A	c.(3250-3252)TCC>TCA	p.S1084S		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1084					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)															---	---	---	---
PISD	23761	broad.mit.edu	37	22	32017095	32017095	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32017095A>G	uc003alm.3	-	6	738	c.731T>C	c.(730-732)GTC>GCC	p.V244A	PISD_uc003alk.2_Missense_Mutation_p.V210A|PISD_uc003all.2_Missense_Mutation_p.V209A|PISD_uc011alr.1_Missense_Mutation_p.V209A|PISD_uc003aln.3_Missense_Mutation_p.V244A	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase	244					phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			central_nervous_system(2)|ovary(1)	3					Phosphatidylserine(DB00144)											OREG0003530	type=REGULATORY REGION|Gene=PISD|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
SREBF2	6721	broad.mit.edu	37	22	42271622	42271622	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42271622A>G	uc003bbi.2	+	7	1449	c.1280A>G	c.(1279-1281)AAT>AGT	p.N427S	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_RNA	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	427	Interaction with LMNA (By similarity).|Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3228705	3228705	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3228705G>A	uc004crg.3	-	7	7696	c.7539C>T	c.(7537-7539)TCC>TCT	p.S2513S		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2513	Ig-like C2-type 9.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3229245	3229245	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3229245G>A	uc004crg.3	-	7	7156	c.6999C>T	c.(6997-6999)GAC>GAT	p.D2333D		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2333	Ig-like C2-type 7.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
SH3KBP1	30011	broad.mit.edu	37	X	19725084	19725084	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19725084C>T	uc004czm.2	-	4	621	c.305G>A	c.(304-306)CGG>CAG	p.R102Q	SH3KBP1_uc004czl.2_Missense_Mutation_p.R65Q	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a	102	SH3 2.				apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0																		---	---	---	---
FAM48B2	170067	broad.mit.edu	37	X	24331336	24331336	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24331336C>A	uc011mjw.1	-	1	97	c.97G>T	c.(97-99)GGA>TGA	p.G33*		NM_001136233	NP_001129705	P0C7V6	F48B2_HUMAN	family with sequence similarity 48, member B2	33											0																		---	---	---	---
FAM47C	442444	broad.mit.edu	37	X	37027911	37027911	+	Silent	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027911G>T	uc004ddl.1	+	1	1442	c.1428G>T	c.(1426-1428)CCG>CCT	p.P476P		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	476										ovary(3)	3																		---	---	---	---
XK	7504	broad.mit.edu	37	X	37587541	37587541	+	Silent	SNP	C	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37587541C>A	uc004ddq.2	+	3	1243	c.1161C>A	c.(1159-1161)GGC>GGA	p.G387G		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	387	Cytoplasmic (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)																---	---	---	---
MAGEE2	139599	broad.mit.edu	37	X	75004861	75004861	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75004861C>T	uc004ecj.1	-	1	211	c.26G>A	c.(25-27)CGC>CAC	p.R9H		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	9										ovary(1)|skin(1)	2																		---	---	---	---
BRWD3	254065	broad.mit.edu	37	X	79975125	79975125	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79975125C>T	uc004edt.2	-	18	2170	c.1907G>A	c.(1906-1908)GGG>GAG	p.G636E	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.G232E|BRWD3_uc004edp.2_Missense_Mutation_p.G465E|BRWD3_uc004edq.2_Missense_Mutation_p.G232E|BRWD3_uc010nmj.1_Missense_Mutation_p.G232E|BRWD3_uc004edr.2_Missense_Mutation_p.G306E|BRWD3_uc004eds.2_Missense_Mutation_p.G232E|BRWD3_uc004edu.2_Missense_Mutation_p.G306E|BRWD3_uc004edv.2_Missense_Mutation_p.G232E|BRWD3_uc004edw.2_Missense_Mutation_p.G232E|BRWD3_uc004edx.2_Missense_Mutation_p.G232E|BRWD3_uc004edy.2_Missense_Mutation_p.G232E|BRWD3_uc004edz.2_Missense_Mutation_p.G306E|BRWD3_uc004eea.2_Missense_Mutation_p.G306E|BRWD3_uc004eeb.2_Missense_Mutation_p.G232E	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	636										ovary(4)	4																		---	---	---	---
CHM	1121	broad.mit.edu	37	X	85166351	85166351	+	Intron	SNP	G	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85166351G>C	uc004eet.2	-						CHM_uc011mqz.1_Intron	NM_000390	NP_000381			choroideremia isoform a						intracellular protein transport|protein geranylgeranylation|response to stimulus|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(1)	1		all_lung(315;5.41e-06)																---	---	---	---
NAP1L3	4675	broad.mit.edu	37	X	92926799	92926799	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92926799T>G	uc004efq.2	-	1	1810	c.1505A>C	c.(1504-1506)AAG>ACG	p.K502T	FAM133A_uc004efr.1_5'Flank	NM_004538	NP_004529	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	502					nucleosome assembly	chromatin assembly complex				ovary(1)|skin(1)	2																		---	---	---	---
LAMP2	3920	broad.mit.edu	37	X	119575715	119575715	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119575715C>G	uc004est.3	-	8	1143	c.963G>C	c.(961-963)TGG>TGC	p.W321C	LAMP2_uc004ess.3_Missense_Mutation_p.W321C|LAMP2_uc011mtz.1_Missense_Mutation_p.W210C|LAMP2_uc011mua.1_Missense_Mutation_p.W274C|LAMP2_uc010nqp.1_Missense_Mutation_p.W321C	NM_002294	NP_002285	P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2 isoform	321	Lumenal (Potential).|Second lumenal domain.		W -> R (in DAND).		platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane				ovary(1)	1																		---	---	---	---
FRMD7	90167	broad.mit.edu	37	X	131212786	131212786	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131212786T>C	uc004ewn.2	-	12	1437	c.1259A>G	c.(1258-1260)GAC>GGC	p.D420G	FRMD7_uc011muy.1_Missense_Mutation_p.D405G	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	420					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
ARHGEF6	9459	broad.mit.edu	37	X	135764986	135764986	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135764986G>T	uc004fab.2	-	13	1872	c.1410C>A	c.(1408-1410)TAC>TAA	p.Y470*	ARHGEF6_uc011mwd.1_Nonsense_Mutation_p.Y343*|ARHGEF6_uc011mwe.1_Nonsense_Mutation_p.Y316*	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	470	PH.				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
IDS	3423	broad.mit.edu	37	X	148568478	148568478	+	Silent	SNP	G	A	A			TCGA-BR-4183-01	TCGA-BR-4183-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148568478G>A	uc011mxe.1	-	8	1356	c.1158C>T	c.(1156-1158)TCC>TCT	p.S386S	IDS_uc011mxd.1_Intron|IDS_uc011mxf.1_Silent_p.S296S|IDS_uc011mxg.1_Silent_p.S175S|IDS_uc010nsu.1_5'UTR|IDS_uc004fcw.3_Silent_p.S175S	NM_000202	NP_000193	P22304	IDS_HUMAN	iduronate-2-sulfatase isoform a precursor	386						lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)																	---	---	---	---
