Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
UBE2J2	118424	broad.mit.edu	37	1	1200945	1200946	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1200945_1200946delGT	uc001adn.2	-						UBE2J2_uc001adm.2_Intron|UBE2J2_uc001ado.2_Intron|UBE2J2_uc001adp.2_Intron|UBE2J2_uc001adq.2_Intron|UBE2J2_uc001adr.2_Intron|UBE2J2_uc001ads.2_Intron	NM_194458	NP_919440			ubiquitin conjugating enzyme E2, J2 isoform 3						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2628714	2628715	+	IGR	DEL	CA	-	-	rs113191758	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2628714_2628715delCA								MMEL1 (64233 upstream) : ACTRT2 (309331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4125156	4125156	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4125156delC								LOC100133612 (291279 upstream) : LOC284661 (346955 downstream)																																			---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4820304	4820305	+	Intron	INS	-	GA	GA	rs144653842	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4820304_4820305insGA	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
RERE	473	broad.mit.edu	37	1	8807417	8807417	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8807417delG	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234			atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9522319	9522319	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9522319delT								SPSB1 (92731 upstream) : SLC25A33 (77209 downstream)																																			---	---	---	---
DFFA	1676	broad.mit.edu	37	1	10526723	10526723	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10526723delA	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392			DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)														---	---	---	---
SRM	6723	broad.mit.edu	37	1	11116558	11116559	+	Intron	INS	-	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11116558_11116559insG	uc001arz.1	-						SRM_uc001ary.1_Intron	NM_003132	NP_003123			spermidine synthase						spermidine biosynthetic process	cytosol	protein homodimerization activity|spermidine synthase activity				0	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)|Spermine(DB00127)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	14267703	14267704	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14267703_14267704insA								PRDM2 (116131 upstream) : KAZ (657509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	16832433	16832434	+	IGR	INS	-	AC	AC	rs35968981		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16832433_16832434insAC								CROCCL2 (13237 upstream) : NBPF1 (57978 downstream)																																			---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16944979	16944981	+	RNA	DEL	AAG	-	-	rs142983965		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16944979_16944981delAAG	uc010ocf.1	-	4		c.1176_1178delCTT			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17198109	17198109	+	Intron	DEL	T	-	-	rs66599829		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17198109delT	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17452951	17452952	+	IGR	INS	-	CATGCACACATGTGCATG	CATGCACACATGTGCATG	rs142821763	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17452951_17452952insCATGCACACATGTGCATG								PADI2 (7003 upstream) : PADI1 (78669 downstream)																																			---	---	---	---
KIAA0090	23065	broad.mit.edu	37	1	19553536	19553536	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19553536delA	uc001bbo.2	-						KIAA0090_uc001bbp.2_Intron|KIAA0090_uc001bbq.2_Intron|KIAA0090_uc001bbr.2_Intron	NM_015047	NP_055862			hypothetical protein LOC23065 precursor							integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
DDOST	1650	broad.mit.edu	37	1	20986941	20986941	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20986941delT	uc001bdo.1	-						DDOST_uc009vpw.1_Intron|DDOST_uc010odd.1_Intron|DDOST_uc010ode.1_Intron	NM_005216	NP_005207			dolichyl-diphosphooligosaccharide-protein						innate immune response|post-translational protein modification|response to cytokine stimulus|T cell activation	integral to membrane|microsome|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
NBPF3	84224	broad.mit.edu	37	1	21774824	21774825	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21774824_21774825insT	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640			neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
ALPL	249	broad.mit.edu	37	1	21854043	21854043	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21854043delT	uc001bet.2	+						ALPL_uc010odn.1_Intron|ALPL_uc010odo.1_Intron|ALPL_uc010odp.1_Intron	NM_000478	NP_000469			tissue-nonspecific alkaline phosphatase						response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)													---	---	---	---
RAP1GAP	5909	broad.mit.edu	37	1	21981879	21981880	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21981879_21981880delAC	uc001bex.2	-						RAP1GAP_uc001bey.2_Intron	NM_002885	NP_002876			RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)														---	---	---	---
USP48	84196	broad.mit.edu	37	1	22061930	22061930	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22061930delA	uc001bfb.2	-						USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfe.1_Intron|USP48_uc001bff.2_Intron	NM_032236	NP_115612			ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)														---	---	---	---
USP48	84196	broad.mit.edu	37	1	22090163	22090163	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22090163delC	uc001bfb.2	-						USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfe.1_Intron|USP48_uc001bff.2_Intron	NM_032236	NP_115612			ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	22290845	22290846	+	IGR	INS	-	T	T	rs143469456	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22290845_22290846insT								HSPG2 (27095 upstream) : CELA3B (12572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	22478517	22478518	+	IGR	INS	-	CCTC	CCTC	rs141927675	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22478517_22478518insCCTC								WNT4 (8132 upstream) : ZBTB40 (299826 downstream)																																			---	---	---	---
EPHB2	2048	broad.mit.edu	37	1	23077513	23077513	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23077513delT	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145			ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)										Hereditary_Prostate_Cancer				---	---	---	---
EPHB2	2048	broad.mit.edu	37	1	23091225	23091225	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23091225delA	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145			ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)										Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	1	23575512	23575512	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23575512delG								HTR1D (54290 upstream) : HNRNPR (60765 downstream)																																			---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24382908	24382908	+	3'UTR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24382908delT	uc001bin.3	-	37					MYOM3_uc001bil.3_3'UTR|MYOM3_uc001bim.3_3'UTR	NM_152372	NP_689585			myomesin family, member 3											skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27012227	27012228	+	IGR	INS	-	A	A	rs75982056		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27012227_27012228insA								RPS6KA1 (110707 upstream) : ARID1A (10294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	27372758	27372759	+	IGR	INS	-	T	T	rs5773174		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27372758_27372759insT								FAM46B (33425 upstream) : SLC9A1 (52542 downstream)																																	OREG0013276	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TMEM39B	55116	broad.mit.edu	37	1	32549596	32549597	+	Intron	DEL	AC	-	-	rs59029097		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32549596_32549597delAC	uc010ogv.1	+						TMEM39B_uc010ogt.1_Intron|TMEM39B_uc010ogu.1_Intron|TMEM39B_uc001bue.3_Intron|TMEM39B_uc001buf.3_Intron|TMEM39B_uc010ogw.1_Intron	NM_018056	NP_060526			transmembrane protein 39B							integral to membrane					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)																---	---	---	---
HDAC1	3065	broad.mit.edu	37	1	32798056	32798056	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32798056delT	uc001bvb.1	+						HDAC1_uc010ohf.1_Intron|HDAC1_uc001bvc.1_Intron	NM_004964	NP_004955			histone deacetylase 1						anti-apoptosis|blood coagulation|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|histone H3 deacetylation|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of androgen receptor signaling pathway|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytosol|NuRD complex|Sin3 complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|identical protein binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|RNA polymerase II transcription corepressor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)	3		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)													---	---	---	---
ZBTB8B	728116	broad.mit.edu	37	1	32950333	32950333	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32950333delT	uc001bvl.3	+						ZBTB8A_uc001bvk.2_Intron	NM_001145720	NP_001139192			zinc finger and BTB domain containing 8B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	35200092	35200092	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35200092delT								MIR552 (64797 upstream) : GJB5 (20629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37536345	37536346	+	IGR	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37536345_37536346delGT								GRIK3 (36501 upstream) : ZC3H12A (403773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37581907	37581908	+	IGR	INS	-	T	T	rs147840050		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37581907_37581908insT								GRIK3 (82063 upstream) : ZC3H12A (358211 downstream)																																			---	---	---	---
RLF	6018	broad.mit.edu	37	1	40644360	40644360	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40644360delT	uc001cfc.3	+							NM_012421	NP_036553			rearranged L-myc fusion						chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)															---	---	---	---
ZMPSTE24	10269	broad.mit.edu	37	1	40752400	40752401	+	Intron	INS	-	T	T	rs34496576		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40752400_40752401insT	uc001cfg.2	+							NM_005857	NP_005848			zinc metallopeptidase STE24							endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40892541	40892542	+	IGR	INS	-	A	A	rs141703648	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40892541_40892542insA								SMAP2 (3549 upstream) : ZNF643 (23237 downstream)																																			---	---	---	---
SCMH1	22955	broad.mit.edu	37	1	41648566	41648566	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41648566delT	uc001cgs.2	-						SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron	NM_012236	NP_036368			sex comb on midleg 1 isoform 2						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42399395	42399396	+	Intron	INS	-	T	T	rs150071344	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42399395_42399396insT	uc001chb.1	-											Homo sapiens kappa B and V(D)J recombination signal sequences binding protein (KRC) mRNA, complete cds.						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
ZMYND12	84217	broad.mit.edu	37	1	42905859	42905859	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42905859delA	uc001chj.2	-						ZMYND12_uc010ojt.1_Intron	NM_032257	NP_115633			zinc finger, MYND-type containing 12 isoform 1							intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
CMPK1	51727	broad.mit.edu	37	1	47823155	47823155	+	Intron	DEL	T	-	-	rs67311976		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47823155delT	uc001cri.2	+						CMPK1_uc010omp.1_Intron|CMPK1_uc010omq.1_Intron|CMPK1_uc001crh.2_Intron	NM_016308	NP_057392			UMP-CMP kinase 1 isoform a						nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)													---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49235034	49235034	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49235034delA	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron|BEND5_uc001crx.3_Intron|BEND5_uc001crw.3_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
SCP2	6342	broad.mit.edu	37	1	53455859	53455861	+	Intron	DEL	CAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53455859_53455861delCAA	uc001cur.1	+						SCP2_uc001cus.1_Intron|SCP2_uc010ono.1_Intron|SCP2_uc010onp.1_Intron|SCP2_uc009vzi.1_Intron|SCP2_uc001cuq.1_Intron	NM_002979	NP_002970			sterol carrier protein 2 isoform 1 proprotein						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|lipid transport	mitochondrion|nucleus|peroxisomal matrix	propanoyl-CoA C-acyltransferase activity|propionyl-CoA C2-trimethyltridecanoyltransferase activity|protein binding|sterol binding			breast(1)	1																		---	---	---	---
ACOT11	26027	broad.mit.edu	37	1	55097723	55097723	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55097723delA	uc001cxm.1	+							NM_015547	NP_056362			thioesterase, adipose associated isoform BFIT1						fatty acid metabolic process|intracellular signal transduction|response to cold		acyl-CoA thioesterase activity|carboxylesterase activity			central_nervous_system(1)	1																		---	---	---	---
PPAP2B	8613	broad.mit.edu	37	1	57039591	57039591	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57039591delG	uc001cyj.1	-							NM_177414	NP_803133			phosphatidic acid phosphatase type 2B						canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62576951	62576951	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62576951delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
ALG6	29929	broad.mit.edu	37	1	63839019	63839020	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63839019_63839020insT	uc010oow.1	+						ALG6_uc001daz.2_Intron|ALG6_uc009waj.2_Intron	NM_013339	NP_037471			dolichyl pyrophosphate Man9GlcNAc2						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity				0																		---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70495179	70495180	+	Intron	INS	-	A	A	rs146576120	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70495179_70495180insA	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	74475978	74475978	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74475978delT								None (None upstream) : LRRIQ3 (15726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	76504067	76504067	+	IGR	DEL	C	-	-	rs78048172		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76504067delC								ASB17 (105951 upstream) : ST6GALNAC3 (36322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	77166673	77166673	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77166673delA								ST6GALNAC3 (70004 upstream) : ST6GALNAC5 (166513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	78603687	78603687	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78603687delT								GIPC2 (576 upstream) : MGC27382 (91596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	78691646	78691646	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78691646delT								GIPC2 (88535 upstream) : MGC27382 (3637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79486342	79486342	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79486342delA								ELTD1 (13847 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79487525	79487526	+	IGR	INS	-	AC	AC	rs143695287	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79487525_79487526insAC								ELTD1 (15030 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	81110801	81110801	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81110801delG								None (None upstream) : LPHN2 (661044 downstream)																																			---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82189511	82189512	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82189511_82189512insT	uc001dit.3	+						LPHN2_uc001dis.2_Intron	NM_012302	NP_036434			latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	83466982	83466982	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83466982delT								None (None upstream) : TTLL7 (868077 downstream)																																			---	---	---	---
CNN3	1266	broad.mit.edu	37	1	95382586	95382586	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95382586delT	uc010otw.1	-						CNN3_uc010otv.1_Intron|CNN3_uc001dqz.3_Intron|CNN3_uc010otx.1_Intron	NM_001839	NP_001830			calponin 3						actomyosin structure organization|smooth muscle contraction		actin binding|calmodulin binding|tropomyosin binding|troponin C binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	96110990	96110990	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96110990delG								RWDD3 (398217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	96775018	96775018	+	IGR	DEL	T	-	-	rs35194073		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96775018delT								None (None upstream) : PTBP2 (412157 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	97541309	97541310	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97541309_97541310insT								PTBP2 (260710 upstream) : DPYD (1992 downstream)																																			---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98283735	98283735	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98283735delT	uc001drv.2	-						DPYD_uc010oub.1_Intron|DPYD_uc001drw.2_Intron	NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	104820070	104820071	+	IGR	INS	-	AC	AC	rs59511070		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104820070_104820071insAC								AMY1A (612898 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105963782	105963783	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105963782_105963783insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	107389326	107389327	+	IGR	INS	-	TTT	TTT	rs145259134	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107389326_107389327insTTT								None (None upstream) : PRMT6 (209940 downstream)																																			---	---	---	---
SLC25A24	29957	broad.mit.edu	37	1	108718312	108718312	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108718312delA	uc001dvn.3	-						SLC25A24_uc001dvm.2_Intron	NM_013386	NP_037518			solute carrier family 25 member 24 isoform 1						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	110626268	110626269	+	IGR	DEL	AG	-	-	rs143920625		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110626268_110626269delAG								ALX3 (12946 upstream) : UBL4B (28793 downstream)																																			---	---	---	---
DENND2C	163259	broad.mit.edu	37	1	115065842	115065843	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115065842_115065843insT	uc001eez.2	-							NM_198459				DENN/MADD domain containing 2C											skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143418339	143418340	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143418339_143418340delCT								None (None upstream) : LOC100286793 (229299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143474835	143474835	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143474835delT								None (None upstream) : LOC100286793 (172804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143516178	143516178	+	IGR	DEL	G	-	-	rs61824581		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143516178delG								None (None upstream) : LOC100286793 (131461 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144596452	144596452	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144596452delG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|uc001elc.2_RNA|NBPF9_uc009wif.1_Intron|uc001ele.2_RNA	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144843165	144843166	+	Intron	DEL	GG	-	-	rs150481179		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144843165_144843166delGG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144943601	144943602	+	Intron	INS	-	AATATA	AATATA	rs138603977	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144943601_144943602insAATATA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145003430	145003430	+	Intron	DEL	G	-	-	rs67113988		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145003430delG	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emi.3_5'Flank	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145054268	145054269	+	Intron	INS	-	G	G	rs149978567		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054268_145054269insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145077026	145077026	+	Intron	DEL	T	-	-	rs144410779		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145077026delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'Flank|PDE4DIP_uc001emh.2_5'Flank|PDE4DIP_uc001emk.2_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
SEC22B	9554	broad.mit.edu	37	1	145116193	145116193	+	3'UTR	DEL	G	-	-	rs66989703		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116193delG	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883			SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145197035	145197036	+	Intron	INS	-	G	G	rs142617464	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145197035_145197036insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145417799	145417799	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145417799delA	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	147215605	147215605	+	IGR	DEL	A	-	-	rs67810856		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147215605delA								ACP6 (72971 upstream) : GJA5 (12727 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	147720385	147720385	+	Intron	DEL	T	-	-	rs111322116		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147720385delT	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148855840	148855842	+	IGR	DEL	GGT	-	-	rs60282471		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855840_148855842delGGT								NBPF16 (97529 upstream) : LOC645166 (72444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148924626	148924628	+	IGR	DEL	AAC	-	-	rs60245226		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148924626_148924628delAAC								NBPF16 (166315 upstream) : LOC645166 (3658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150190239	150190239	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150190239delA								PLEKHO1 (58423 upstream) : ANP32E (479 downstream)																																			---	---	---	---
RPRD2	23248	broad.mit.edu	37	1	150394651	150394652	+	Intron	DEL	AC	-	-	rs66493922		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150394651_150394652delAC	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018			Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	151459787	151459787	+	IGR	DEL	C	-	-	rs4043746		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151459787delC								POGZ (27855 upstream) : CGN (24075 downstream)																																			---	---	---	---
TUFT1	7286	broad.mit.edu	37	1	151513711	151513711	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151513711delG	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512			tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152518931	152518932	+	IGR	INS	-	TT	TT	rs139821566	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152518931_152518932insTT								CRCT1 (30451 upstream) : LCE3E (19199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152976752	152976755	+	IGR	DEL	CACG	-	-	rs3054151	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152976752_152976755delCACG								SPRR3 (420 upstream) : SPRR1B (26924 downstream)																																			---	---	---	---
S100A13	6284	broad.mit.edu	37	1	153597349	153597349	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153597349delG	uc001fcf.3	-						S100A13_uc001fcg.2_Intron|S100A13_uc009woh.2_Intron|S100A13_uc001fch.2_Intron|S100A13_uc001fci.2_Intron|S100A13_uc001fcj.2_Intron	NM_001024213	NP_001019384			S100 calcium binding protein A13						interleukin-1 alpha secretion|mast cell degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|extracellular space|nucleus|perinuclear region of cytoplasm	calcium ion binding|copper ion binding|fibroblast growth factor 1 binding|lipid binding|protein homodimerization activity|RAGE receptor binding|zinc ion binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	153646636	153646637	+	IGR	INS	-	G	G	rs141120852	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153646636_153646637insG								ILF2 (3157 upstream) : NPR1 (4527 downstream)																																			---	---	---	---
NUP210L	91181	broad.mit.edu	37	1	154005427	154005436	+	Intron	DEL	AAGAAAAGAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154005427_154005436delAAGAAAAGAA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191			nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)															---	---	---	---
NUP210L	91181	broad.mit.edu	37	1	154096711	154096712	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154096711_154096712insA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191			nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)															---	---	---	---
TPM3	7170	broad.mit.edu	37	1	154165865	154165865	+	5'Flank	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154165865delG	uc001fec.1	-							NM_152263	NP_689476			tropomyosin 3 isoform 1						cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)							T	NTRK1|ALK	papillary thyroid|ALCL								---	---	---	---
Unknown	0	broad.mit.edu	37	1	157053351	157053351	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157053351delC								ARHGEF11 (38189 upstream) : ETV3L (8485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158254499	158254500	+	IGR	INS	-	A	A	rs115668044		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158254499_158254500insA								CD1A (26443 upstream) : CD1C (5063 downstream)																																			---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158625368	158625369	+	Intron	INS	-	G	G	rs144194628	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158625368_158625369insG	uc001fst.1	-							NM_003126	NP_003117			spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
PYHIN1	149628	broad.mit.edu	37	1	158921899	158921899	+	Intron	DEL	T	-	-	rs147431854		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158921899delT	uc001ftb.2	+						PYHIN1_uc001ftc.2_Intron|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	NM_152501	NP_689714			pyrin and HIN domain family, member 1 alpha 1						cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)																	---	---	---	---
CADM3	57863	broad.mit.edu	37	1	159151878	159151879	+	Intron	INS	-	CA	CA	rs148374819	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159151878_159151879insCA	uc001ftl.2	+						CADM3_uc009wsx.1_Intron|CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Intron	NM_001127173	NP_001120645			cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	159400430	159400431	+	Intron	INS	-	GTGTGTGT	GTGTGTGT	rs145412362	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159400430_159400431insGTGTGTGT	uc001fts.3	-											Homo sapiens, clone IMAGE:3917623, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	159421332	159421335	+	Intron	DEL	AAAC	-	-	rs147442559		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159421332_159421335delAAAC	uc001fts.3	-											Homo sapiens, clone IMAGE:3917623, mRNA.																														---	---	---	---
PFDN2	5202	broad.mit.edu	37	1	161074825	161074825	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161074825delA	uc001fxu.2	-							NM_012394	NP_036526			prefoldin subunit 2						'de novo' posttranslational protein folding	prefoldin complex	unfolded protein binding				0	all_cancers(52;1.84e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)															---	---	---	---
B4GALT3	8703	broad.mit.edu	37	1	161149935	161149937	+	5'Flank	DEL	TTT	-	-	rs71842637		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161149935_161149937delTTT	uc001fyq.1	-						B4GALT3_uc001fyr.1_5'Flank|B4GALT3_uc001fys.1_5'Flank|B4GALT3_uc009wud.1_5'Flank	NM_003779	NP_003770			UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|metal ion binding|N-acetyllactosamine synthase activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)													---	---	---	---
PCP4L1	654790	broad.mit.edu	37	1	161241977	161241977	+	Intron	DEL	T	-	-	rs11365328		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161241977delT	uc001gad.2	+							NM_001102566	NP_001096036			Purkinje cell protein 4 like 1												0	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)															---	---	---	---
C1orf110	339512	broad.mit.edu	37	1	162799404	162799405	+	Intron	INS	-	TT	TT	rs111533213		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162799404_162799405insTT	uc009wuw.1	-											Homo sapiens cDNA, FLJ99661.												0																		---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164847914	164847914	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164847914delA	uc010pkw.1	+							NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174955741	174955741	+	Intron	DEL	G	-	-	rs763244	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174955741delG	uc001gkd.3	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkh.3_Intron|uc010pmv.1_Intron					RecName: Full=RAB GTPase-activating protein 1-like;						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
XPR1	9213	broad.mit.edu	37	1	180752469	180752469	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180752469delG	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727			xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	182173112	182173112	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182173112delC								ZNF648 (142265 upstream) : GLUL (178557 downstream)																																			---	---	---	---
RGSL1	353299	broad.mit.edu	37	1	182429296	182429297	+	Intron	DEL	TG	-	-	rs10572829		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182429296_182429297delTG	uc009wxw.2	+						RGSL1_uc010pnu.1_Intron	NM_001137669	NP_001131141			regulator of G-protein signaling like 1							integral to membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183360180	183360180	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183360180delG	uc001gqc.1	-							NM_015039	NP_055854			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	187065921	187065921	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187065921delA								PLA2G4A (107816 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189112803	189112812	+	IGR	DEL	ACACACACAT	-	-	rs5779464		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189112803_189112812delACACACACAT								None (None upstream) : FAM5C (953985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189374703	189374703	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189374703delT								None (None upstream) : FAM5C (692094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194187882	194187883	+	IGR	INS	-	CACACACACA	CACACACACA	rs142018742	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194187882_194187883insCACACACACA								CDC73 (963942 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194326092	194326093	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194326092_194326093delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194534372	194534372	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194534372delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195572222	195572222	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195572222delA								None (None upstream) : KCNT2 (622691 downstream)																																			---	---	---	---
TMEM9	252839	broad.mit.edu	37	1	201106600	201106603	+	Intron	DEL	ACAC	-	-	rs148711090		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201106600_201106603delACAC	uc001gvw.2	-						TMEM9_uc001gvx.2_Intron|TMEM9_uc001gvy.2_Intron|TMEM9_uc010ppo.1_Intron|TMEM9_uc001gvz.2_Intron|TMEM9_uc001gwa.2_Intron	NM_016456	NP_057540			transmembrane protein 9 precursor						transport	integral to membrane|late endosome membrane|lysosomal membrane					0		Breast(1374;0.000301)																---	---	---	---
SNRPE	6635	broad.mit.edu	37	1	203834005	203834014	+	Intron	DEL	AAAAAAAAAA	-	-	rs72275752		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203834005_203834014delAAAAAAAAAA	uc001hai.2	+						SNRPE_uc010pqn.1_Intron	NM_003094	NP_003085			small nuclear ribonucleoprotein polypeptide E						histone mRNA metabolic process|ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nucleoplasm|U12-type spliceosomal complex|U7 snRNP	protein binding|RNA binding				0	all_cancers(21;0.103)		BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204668299	204668300	+	Intron	INS	-	CACACA	CACACA	rs10653435		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204668299_204668300insCACACA	uc001hbd.1	+							NM_002393				mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208317075	208317075	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208317075delT	uc001hgz.2	-							NM_025179	NP_079455			plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
LAMB3	3914	broad.mit.edu	37	1	209799950	209799951	+	Intron	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209799950_209799951delCT	uc001hhg.2	-						LAMB3_uc009xco.2_Intron|LAMB3_uc001hhh.2_Intron|LAMB3_uc010psl.1_Intron	NM_001017402	NP_001017402			laminin, beta 3 precursor						cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	217488854	217488854	+	IGR	DEL	G	-	-	rs74500851		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217488854delG								ESRRG (177757 upstream) : GPATCH2 (114980 downstream)																																			---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218594715	218594716	+	Intron	INS	-	T	T	rs74337722		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218594715_218594716insT	uc001hlm.2	+						TGFB2_uc001hln.2_Intron|TGFB2_uc010pue.1_Intron|TGFB2_uc001hlo.2_Intron	NM_003238	NP_003229			transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	221998377	221998377	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221998377delG								DUSP10 (82916 upstream) : HHIPL2 (697225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224262236	224262237	+	IGR	INS	-	CCTC	CCTC	rs60087320	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224262236_224262237insCCTC								TP53BP2 (228562 upstream) : FBXO28 (39554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	225986868	225986869	+	IGR	INS	-	GTT	GTT	rs150620971	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225986868_225986869insGTT								SRP9 (8703 upstream) : EPHX1 (10928 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	227705515	227705515	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227705515delC								CDC42BPA (199689 upstream) : ZNF678 (45729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231497201	231497201	+	IGR	DEL	A	-	-	rs35139664		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231497201delA								C1orf124 (7213 upstream) : EGLN1 (2296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232520303	232520303	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232520303delT								DISC1 (343287 upstream) : SIPA1L2 (13411 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233420241	233420241	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233420241delA	uc001hvl.2	-							NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	234961092	234961092	+	IGR	DEL	A	-	-	rs33930548		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234961092delA								IRF2BP2 (215821 upstream) : TOMM20 (311568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	235066679	235066679	+	IGR	DEL	T	-	-	rs36041139		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235066679delT								IRF2BP2 (321408 upstream) : TOMM20 (205981 downstream)																																			---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235407551	235407552	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235407551_235407552insT	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235438309	235438310	+	Intron	DEL	TG	-	-	rs72168611		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235438309_235438310delTG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236630723	236630724	+	Intron	DEL	CG	-	-	rs147959498	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236630723_236630724delCG	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	238159380	238159380	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238159380delA								LOC100130331 (67763 upstream) : LOC339535 (484306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238531382	238531383	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238531382_238531383insT								LOC100130331 (439765 upstream) : LOC339535 (112303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239546358	239546359	+	IGR	INS	-	TCTCTT	TCTCTT	rs141811679	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239546358_239546359insTCTCTT								LOC339535 (897041 upstream) : CHRM3 (3506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	240216315	240216315	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240216315delG								CHRM3 (143600 upstream) : FMN2 (38870 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240618339	240618340	+	Intron	INS	-	A	A	rs150822042		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240618339_240618340insA	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron|FMN2_uc001hyr.2_5'Flank	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	240789333	240789333	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240789333delA								GREM2 (13871 upstream) : RGS7 (142222 downstream)																																			---	---	---	---
OPN3	23596	broad.mit.edu	37	1	241800257	241800258	+	Intron	INS	-	A	A	rs35279473		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241800257_241800258insA	uc001hza.2	-						OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron|CHML_uc001hzd.2_5'Flank	NM_014322	NP_055137			opsin 3						phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245662548	245662549	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245662548_245662549delTG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
TRIM58	25893	broad.mit.edu	37	1	248032236	248032237	+	Intron	INS	-	T	T	rs35237755		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248032236_248032237insT	uc001ido.2	+						OR2W3_uc001idp.1_Intron	NM_015431	NP_056246			tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	248820758	248820759	+	IGR	INS	-	AC	AC	rs143117041	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248820758_248820759insAC								OR2T27 (6573 upstream) : OR14I1 (23911 downstream)																																			---	---	---	---
TPO	7173	broad.mit.edu	37	2	1520111	1520111	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1520111delC	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron|TPO_uc002qwy.1_Intron|TPO_uc002qwz.2_Intron	NM_000547	NP_000538			thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	4459675	4459675	+	IGR	DEL	G	-	-	rs34387264		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4459675delG								ALLC (709417 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6573740	6573740	+	IGR	DEL	A	-	-	rs62110036		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6573740delA								LOC400940 (445376 upstream) : CMPK2 (406763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7629391	7629395	+	IGR	DEL	GGAAG	-	-	rs74171460	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7629391_7629395delGGAAG								RNF144A (445084 upstream) : LOC339788 (433163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	9844105	9844105	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9844105delG								YWHAQ (72999 upstream) : TAF1B (139466 downstream)																																			---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10485028	10485028	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10485028delT	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16771337	16771338	+	Intron	DEL	CA	-	-	rs72172136		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16771337_16771338delCA	uc010exm.1	-						FAM49A_uc002rck.1_Intron	NM_030797	NP_110424			family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	17017024	17017024	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17017024delT								FAM49A (169928 upstream) : RAD51AP2 (674962 downstream)																																			---	---	---	---
MATN3	4148	broad.mit.edu	37	2	20204466	20204466	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20204466delC	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372			matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	20586847	20586848	+	IGR	INS	-	T	T	rs138375521	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20586847_20586848insT								PUM2 (36384 upstream) : RHOB (59987 downstream)																																			---	---	---	---
BRE	9577	broad.mit.edu	37	2	28437045	28437046	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28437045_28437046delTG	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28969188	28969189	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28969188_28969189insT								PLB1 (102575 upstream) : PPP1CB (5423 downstream)																																			---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31337142	31337142	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31337142delA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
SPAST	6683	broad.mit.edu	37	2	32332310	32332310	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32332310delT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761			spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---
SPAST	6683	broad.mit.edu	37	2	32340026	32340027	+	Intron	INS	-	T	T	rs67016851		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32340026_32340027insT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761			spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33317261	33317262	+	Intron	DEL	CG	-	-	rs113961167		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33317261_33317262delCG	uc002ros.2	+							NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35715652	35715652	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35715652delT								None (None upstream) : CRIM1 (867745 downstream)																																			---	---	---	---
VIT	5212	broad.mit.edu	37	2	36959678	36959679	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36959678_36959679insT	uc002rpl.2	+						VIT_uc002rpk.2_Intron|VIT_uc010ynf.1_Intron|VIT_uc002rpm.2_Intron|VIT_uc010ezv.2_Intron|VIT_uc010ezw.2_Intron	NM_053276	NP_444506			vitrin							proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	37986761	37986762	+	IGR	INS	-	T	T	rs76056468		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37986761_37986762insT								CDC42EP3 (87435 upstream) : FAM82A1 (165700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	40172009	40172010	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40172009_40172010delAC	uc002rrw.2	+											Homo sapiens cDNA clone IMAGE:5223469, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	44326769	44326770	+	IGR	INS	-	TGTC	TGTC	rs145775534	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44326769_44326770insTGTC								LRPPRC (103625 upstream) : PPM1B (69230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45027771	45027772	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45027771_45027772insA								C2orf34 (28042 upstream) : SIX3 (141265 downstream)																																			---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46063892	46063892	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46063892delA	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
RHOQ	23433	broad.mit.edu	37	2	46800843	46800843	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46800843delT	uc002rva.2	+						uc002rvb.2_Intron	NM_012249	NP_036381			ras-like protein TC10 precursor						cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
CRIPT	9419	broad.mit.edu	37	2	46852210	46852210	+	3'UTR	DEL	G	-	-	rs58414633		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46852210delG	uc002rve.2	+	5						NM_014171	NP_054890			postsynaptic protein CRIPT							cell junction|cytoplasm|dendritic spine					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
LOC100134259	100134259	broad.mit.edu	37	2	47080330	47080330	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47080330delG	uc002rvi.3	+						LOC100134259_uc002rvj.1_Intron	NR_024452				Homo sapiens cDNA FLJ35178 fis, clone PLACE6014043.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	52903662	52903663	+	IGR	DEL	TC	-	-	rs71640188		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52903662_52903663delTC								None (None upstream) : ASB3 (993455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	58832659	58832659	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58832659delC	uc002rzy.2	+											Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
PUS10	150962	broad.mit.edu	37	2	61175718	61175719	+	Intron	INS	-	T	T	rs150025954	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61175718_61175719insT	uc010fci.2	-						PUS10_uc002sao.2_Intron|PUS10_uc010ypk.1_Intron	NM_144709	NP_653310			pseudouridylate synthase 10						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	62127531	62127531	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62127531delA								CCT4 (11740 upstream) : COMMD1 (5272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	65716789	65716789	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65716789delA	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	66955301	66955302	+	IGR	INS	-	TG	TG	rs150247136	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66955301_66955302insTG								MEIS1 (155411 upstream) : ETAA1 (669140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67472036	67472036	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67472036delA	uc002sdx.2	+											Homo sapiens, clone IMAGE:5541055, mRNA.																														---	---	---	---
PPP3R1	5534	broad.mit.edu	37	2	68439220	68439221	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68439220_68439221insT	uc002sei.1	-							NM_000945	NP_000936			protein phosphatase 3, regulatory subunit B,						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)													---	---	---	---
PPP3R1	5534	broad.mit.edu	37	2	68459574	68459574	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68459574delA	uc002sei.1	-							NM_000945	NP_000936			protein phosphatase 3, regulatory subunit B,						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)													---	---	---	---
GMCL1	64395	broad.mit.edu	37	2	70095880	70095880	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70095880delG	uc002sfu.2	+							NM_178439	NP_848526			germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3																		---	---	---	---
ZNF638	27332	broad.mit.edu	37	2	71611433	71611433	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71611433delA	uc002shx.2	+						ZNF638_uc010fec.2_Intron|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Intron|ZNF638_uc002shy.2_Intron|ZNF638_uc002shz.2_Intron|ZNF638_uc002sia.2_Intron|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron	NM_014497	NP_055312			zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	74198605	74198606	+	IGR	INS	-	A	A	rs144671678	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74198605_74198606insA								DGUOK (12519 upstream) : TET3 (74844 downstream)																																			---	---	---	---
PLGLB2	5342	broad.mit.edu	37	2	87238032	87238032	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87238032delA	uc002ssd.2	-	4					RMND5A_uc002srs.3_Intron|RGPD1_uc010fgv.2_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_002665	NP_002656			plasminogen-like B2 precursor							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90417245	90417247	+	Intron	DEL	GAG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417245_90417247delGAG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90462415	90462415	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90462415delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90470953	90470953	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90470953delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91810371	91810374	+	Intron	DEL	TAAC	-	-	rs58393245		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91810371_91810374delTAAC	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91812484	91812487	+	Intron	DEL	TAAC	-	-	rs57297686		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91812484_91812487delTAAC	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	91852212	91852213	+	IGR	INS	-	T	T	rs141351604	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91852212_91852213insT								LOC654342 (4237 upstream) : GGT8P (111155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92267837	92267839	+	IGR	DEL	GAG	-	-	rs75775700		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92267837_92267839delGAG								FKSG73 (137343 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92306369	92306370	+	IGR	INS	-	T	T	rs62146369		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92306369_92306370insT								FKSG73 (175875 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95893532	95893532	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95893532delT								ZNF2 (43470 upstream) : PROM2 (46669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96598318	96598322	+	Intron	DEL	TTTTA	-	-	rs78942076		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96598318_96598322delTTTTA	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	96610787	96610788	+	5'Flank	INS	-	A	A	rs148448972	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96610787_96610788insA	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	97057829	97057830	+	IGR	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97057829_97057830delGT								NCAPH (16555 upstream) : NEURL3 (105555 downstream)																																			---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97595068	97595068	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97595068delA	uc002sxl.3	-						FAM178B_uc002sxk.3_Intron	NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97827818	97827819	+	Intron	INS	-	T	T	rs34725305		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97827818_97827819insT	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_5'Flank	NM_001164315	NP_001157787			ankyrin repeat domain 36												0																		---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98833448	98833449	+	Intron	INS	-	CCCG	CCCG	rs62156666	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98833448_98833449insCCCG	uc002syo.2	+						VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron|VWA3B_uc002syq.1_Intron|VWA3B_uc002syr.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
C2orf55	343990	broad.mit.edu	37	2	99491997	99492000	+	Intron	DEL	GACA	-	-	rs140647558		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99491997_99492000delGACA	uc002szf.1	-							NM_207362	NP_997245			hypothetical protein LOC343990												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102177230	102177233	+	IGR	DEL	ACAT	-	-	rs10595170	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102177230_102177233delACAT								RFX8 (86065 upstream) : MAP4K4 (137255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106296930	106296931	+	IGR	DEL	GG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106296930_106296931delGG								FHL2 (241700 upstream) : NCK2 (64423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	112387210	112387211	+	IGR	DEL	AA	-	-	rs145332133		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112387210_112387211delAA								LOC541471 (134518 upstream) : ANAPC1 (139430 downstream)																																			---	---	---	---
WASH2P	375260	broad.mit.edu	37	2	114344982	114344982	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114344982delG	uc002tka.2	+						WASH2P_uc002tkb.2_Intron|WASH2P_uc010fkx.1_5'Flank|WASH2P_uc002tkd.2_5'Flank	NR_024077				Homo sapiens cDNA FLJ75027 complete cds, highly similar to Homo sapiens CXYorf1-related protein (MGC52000), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114762998	114762999	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114762998_114762999insT	uc002tkz.1	+											full-length cDNA clone CS0DI083YD04 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115203112	115203119	+	Intron	DEL	TGTGTGTG	-	-	rs72327044		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115203112_115203119delTGTGTGTG	uc002tla.1	+							NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
EPB41L5	57669	broad.mit.edu	37	2	120920280	120920280	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120920280delA	uc002tmg.2	+						EPB41L5_uc010fll.2_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960			erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	122855067	122855067	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122855067delT								TSN (329641 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126033125	126033126	+	IGR	DEL	TG	-	-	rs72022574		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126033125_126033126delTG								CNTNAP5 (360264 upstream) : None (None downstream)																																			---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128874108	128874108	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128874108delT	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505			UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	131010945	131010946	+	IGR	DEL	GG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131010945_131010946delGG								TUBA3E (54911 upstream) : CCDC115 (84870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132775689	132775690	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132775689_132775690insC								C2orf27B (216455 upstream) : NCRNA00164 (129474 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133007618	133007618	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133007618delA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133016676	133016677	+	5'Flank	INS	-	TGTC	TGTC	rs67307110		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133016676_133016677insTGTC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133105872	133105873	+	IGR	INS	-	G	G	rs144074690	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133105872_133105873insG								NCRNA00164 (90330 upstream) : GPR39 (68274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	136993870	136993870	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136993870delC								CXCR4 (118145 upstream) : THSD7B (529245 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	137869933	137869934	+	Intron	INS	-	A	A	rs138244965	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137869933_137869934insA	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138428805	138428806	+	Intron	INS	-	T	T	rs75376579		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138428805_138428806insT	uc002tva.1	+							NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	145672579	145672580	+	Intron	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145672579_145672580delGA	uc002twc.2	+											Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	151210560	151210560	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151210560delC								MMADHC (766230 upstream) : RND3 (114152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151580440	151580440	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151580440delA								RND3 (236260 upstream) : RBM43 (524289 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152589616	152589616	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152589616delT	uc010fnx.2	-							NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	153085727	153085727	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153085727delT								STAM2 (53221 upstream) : FMNL2 (106024 downstream)																																			---	---	---	---
ACVR1	90	broad.mit.edu	37	2	158649863	158649864	+	Intron	INS	-	A	A	rs141062281	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158649863_158649864insA	uc002tzm.3	-						ACVR1_uc002tzn.3_Intron|ACVR1_uc010fog.2_Intron	NM_001111067	NP_001104537			activin A receptor, type I precursor						BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	158771137	158771137	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158771137delG								ACVR1 (38763 upstream) : UPP2 (80554 downstream)																																			---	---	---	---
CCDC148	130940	broad.mit.edu	37	2	159299678	159299679	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159299678_159299679insA	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158			coiled-coil domain containing 148											ovary(2)	2																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160562595	160562596	+	Intron	INS	-	AC	AC	rs147779538	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160562595_160562596insAC	uc002uau.1	-						uc002uaw.2_Intron					SubName: Full=Putative uncharacterized protein DKFZp686H10114;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	163822293	163822294	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163822293_163822294insT								KCNH7 (127053 upstream) : FIGN (641824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164600700	164600702	+	IGR	DEL	GAG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164600700_164600702delGAG								FIGN (8187 upstream) : GRB14 (748631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	165533198	165533199	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165533198_165533199insC								GRB14 (54838 upstream) : COBLL1 (8061 downstream)																																			---	---	---	---
CSRNP3	80034	broad.mit.edu	37	2	166523334	166523343	+	Intron	DEL	AAGGAAGGAC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166523334_166523343delAAGGAAGGAC	uc002udf.2	+						CSRNP3_uc002udg.2_Intron	NM_024969	NP_079245			cysteine-serine-rich nuclear protein 3						apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	168736694	168736695	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168736694_168736695insA								B3GALT1 (9328 upstream) : STK39 (73836 downstream)																																			---	---	---	---
STK39	27347	broad.mit.edu	37	2	168991763	168991764	+	Intron	INS	-	AA	AA			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168991763_168991764insAA	uc002uea.2	-							NM_013233	NP_037365			serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
STK39	27347	broad.mit.edu	37	2	169051104	169051104	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169051104delA	uc002uea.2	-							NM_013233	NP_037365			serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
C2orf77	129881	broad.mit.edu	37	2	170540932	170540932	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170540932delT	uc002ufe.2	-							NM_001085447	NP_001078916			hypothetical protein LOC129881												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171018776	171018777	+	IGR	DEL	GG	-	-	rs58466025		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171018776_171018777delGG								UBR3 (78139 upstream) : MYO3B (15878 downstream)																																			---	---	---	---
METTL8	79828	broad.mit.edu	37	2	172231362	172231362	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172231362delT	uc010zdo.1	-						METTL8_uc002ugu.3_Intron|METTL8_uc002ugv.3_Intron|METTL8_uc002ugt.3_Intron|METTL8_uc002ugs.3_Intron|METTL8_uc010zdp.1_Intron	NM_024770	NP_079046			methyltransferase like 8								methyltransferase activity			ovary(1)	1																		---	---	---	---
NFE2L2	4780	broad.mit.edu	37	2	178220638	178220638	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178220638delT	uc002uli.3	-						LOC100130691_uc002ulk.1_Intron	NM_001145412	NP_001138884			nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178731537	178731537	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178731537delC	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
Unknown	0	broad.mit.edu	37	2	186496190	186496190	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186496190delA								ZNF804A (691978 upstream) : ZC3H15 (854695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187936788	187936789	+	IGR	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187936788_187936789delGA								ZSWIM2 (222891 upstream) : CALCRL (271062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	190885894	190885894	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190885894delT								PMS1 (143540 upstream) : MSTN (34533 downstream)																																			---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196783511	196783511	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196783511delG	uc002utj.3	-							NM_018897	NP_061720			dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	200906715	200906715	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200906715delC								C2orf47 (77870 upstream) : SPATS2L (263889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	208249113	208249114	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208249113_208249114delAG								MIR1302-4 (114965 upstream) : CREB1 (145502 downstream)																																			---	---	---	---
CREB1	1385	broad.mit.edu	37	2	208393108	208393108	+	5'Flank	DEL	T	-	-	rs34317727		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208393108delT	uc002vcc.2	+						CREB1_uc010ziz.1_5'Flank|CREB1_uc002vcd.2_5'Flank	NM_134442	NP_604391			cAMP responsive element binding protein 1						activation of phospholipase C activity|axon guidance|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway		protein dimerization activity|transcription cofactor activity		EWSR1/CREB1(42)	soft_tissue(42)|breast(1)|central_nervous_system(1)	44				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Bromocriptine(DB01200)|Naloxone(DB01183)			T	EWSR1	clear cell sarcoma|angiomatoid fibrous histiocytoma								---	---	---	---
UNC80	285175	broad.mit.edu	37	2	210738702	210738703	+	Intron	DEL	TG	-	-	rs72342895		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210738702_210738703delTG	uc010zjc.1	+						UNC80_uc002vdk.2_Intron	NM_032504	NP_115893			chromosome 2 open reading frame 21 isoform 1							integral to membrane					0																		---	---	---	---
ARPC2	10109	broad.mit.edu	37	2	219079871	219079878	+	5'Flank	DEL	AAGAAAGG	-	-	rs75916142	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219079871_219079878delAAGAAAGG	uc002vhd.2	+						ARPC2_uc002vhe.2_5'Flank	NM_152862	NP_690601			actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)														---	---	---	---
ARPC2	10109	broad.mit.edu	37	2	219079875	219079878	+	5'Flank	DEL	AAGG	-	-	rs34155345	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219079875_219079878delAAGG	uc002vhd.2	+						ARPC2_uc002vhe.2_5'Flank	NM_152862	NP_690601			actin related protein 2/3 complex subunit 2						cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220616716	220616717	+	IGR	INS	-	G	G	rs141954356	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220616716_220616717insG								SLC4A3 (110015 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221561151	221561152	+	IGR	INS	-	AA	AA	rs111300442		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221561151_221561152insAA								None (None upstream) : EPHA4 (721597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222652623	222652626	+	IGR	DEL	GTGC	-	-	rs5838907		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222652623_222652626delGTGC								EPHA4 (213701 upstream) : PAX3 (411981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225082467	225082467	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225082467delA								SERPINE2 (178431 upstream) : FAM124B (160949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225987996	225987998	+	IGR	DEL	CTT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225987996_225987998delCTT								DOCK10 (80666 upstream) : KIAA1486 (277604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229760328	229760329	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229760328_229760329insT								SPHKAP (713967 upstream) : PID1 (128361 downstream)																																			---	---	---	---
PID1	55022	broad.mit.edu	37	2	229933858	229933861	+	Intron	DEL	TTTG	-	-	rs3083812		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229933858_229933861delTTTG	uc002vpr.3	-						PID1_uc002vps.3_Intron|PID1_uc002vpt.3_Intron|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288			phosphotyrosine interaction domain containing 1							cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
DNER	92737	broad.mit.edu	37	2	230525939	230525940	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230525939_230525940delTG	uc002vpv.2	-							NM_139072	NP_620711			delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
PSMD1	5707	broad.mit.edu	37	2	231945156	231945156	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231945156delT	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron	NM_002807	NP_002798			proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)													---	---	---	---
DGKD	8527	broad.mit.edu	37	2	234276495	234276497	+	Intron	DEL	TTC	-	-	rs71058551		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234276495_234276497delTTC	uc002vui.1	+							NM_152879	NP_690618			diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)													---	---	---	---
DGKD	8527	broad.mit.edu	37	2	234337520	234337521	+	Intron	INS	-	TTG	TTG	rs147754732	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234337520_234337521insTTG	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyh.1_Intron	NM_152879	NP_690618			diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)													---	---	---	---
UGT1A5	54579	broad.mit.edu	37	2	234631593	234631595	+	Intron	DEL	GAG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234631593_234631595delGAG	uc002vuw.2	+						UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron	NM_019078	NP_061951			UDP glycosyltransferase 1 family, polypeptide A5						xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	236318249	236318250	+	IGR	INS	-	T	T	rs144863761	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236318249_236318250insT								SH3BP4 (353893 upstream) : AGAP1 (84486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237087439	237087439	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237087439delG								GBX2 (10787 upstream) : ASB18 (16077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239131747	239131748	+	IGR	INS	-	T	T	rs138655337	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239131747_239131748insT								ILKAP (19423 upstream) : LOC151174 (2006 downstream)																																			---	---	---	---
CHL1	10752	broad.mit.edu	37	3	372637	372638	+	Intron	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:372637_372638delTC	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	510691	510692	+	IGR	INS	-	TG	TG	rs72985304		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:510691_510692insTG								CHL1 (59596 upstream) : CNTN6 (623928 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1032577	1032580	+	IGR	DEL	CATA	-	-	rs10582752		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1032577_1032580delCATA								CHL1 (581482 upstream) : CNTN6 (102040 downstream)																																			---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	3914602	3914602	+	Intron	DEL	C	-	-	rs111410508		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3914602delC	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4668855	4668855	+	Intron	DEL	A	-	-	rs112129945		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4668855delA	uc003bqa.2	+						ITPR1_uc010hbz.2_Intron|ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	8388303	8388304	+	Intron	DEL	AC	-	-	rs112900273		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8388303_8388304delAC	uc003bqp.2	-											Homo sapiens cDNA FLJ42094 fis, clone TESOP2002489.																														---	---	---	---
OXTR	5021	broad.mit.edu	37	3	8799118	8799119	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8799118_8799119insA	uc003brc.2	-							NM_000916	NP_000907			oxytocin receptor						female pregnancy|lactation|muscle contraction	integral to plasma membrane	oxytocin receptor activity|vasopressin receptor activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.15)	Carbetocin(DB01282)													---	---	---	---
RAD18	56852	broad.mit.edu	37	3	8936444	8936444	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8936444delT	uc003brd.2	-						RAD18_uc003bre.2_Intron	NM_020165	NP_064550			postreplication repair protein hRAD18p						DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding			skin(3)|ovary(2)	5				OV - Ovarian serous cystadenocarcinoma(96;0.0552)									Rad6_pathway					---	---	---	---
SETD5	55209	broad.mit.edu	37	3	9504619	9504619	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9504619delT	uc003brt.2	+						SETD5_uc003brs.1_Intron|SETD5_uc003bru.2_Intron|SETD5_uc003brv.2_Intron|SETD5_uc010hck.2_Intron|SETD5_uc003brx.2_Intron	NM_001080517	NP_001073986			SET domain containing 5											ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	11818454	11818454	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11818454delT								VGLL4 (56234 upstream) : C3orf31 (13466 downstream)																																			---	---	---	---
RAF1	5894	broad.mit.edu	37	3	12691089	12691092	+	Intron	DEL	CACA	-	-	rs148998208		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12691089_12691092delCACA	uc003bxf.3	-						RAF1_uc011auu.1_Intron	NM_002880	NP_002871			v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				---	---	---	---
FBLN2	2199	broad.mit.edu	37	3	13570826	13570829	+	5'Flank	DEL	TCCG	-	-	rs2655231	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13570826_13570829delTCCG	uc011auz.1	+							NM_001998	NP_001989			fibulin 2 isoform b precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)															---	---	---	---
LOC285375	285375	broad.mit.edu	37	3	13728041	13728047	+	Intron	DEL	GGTGAGC	-	-	rs66658975		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13728041_13728047delGGTGAGC	uc003byd.1	+							NR_027103				Homo sapiens, clone IMAGE:5742174, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	13941747	13941748	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13941747_13941748delTG								WNT7A (20129 upstream) : TPRXL (37059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	15145432	15145433	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15145432_15145433insA								ZFYVE20 (4777 upstream) : DVWA (61436 downstream)																																			---	---	---	---
ANKRD28	23243	broad.mit.edu	37	3	15766458	15766458	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15766458delA	uc003caj.1	-						ANKRD28_uc003cai.1_Intron|ANKRD28_uc011avz.1_Intron|ANKRD28_uc003cak.1_Intron|ANKRD28_uc011awa.1_Intron|ANKRD28_uc003cal.1_Intron|ANKRD28_uc003cam.2_Intron	NM_015199	NP_056014			ankyrin repeat domain 28							nucleoplasm	protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	17998459	17998460	+	IGR	INS	-	GT	GT	rs56865422		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17998459_17998460insGT								TBC1D5 (214219 upstream) : SATB1 (390806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	19823805	19823813	+	IGR	DEL	GCAGGGCAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19823805_19823813delGCAGGGCAA								KCNH8 (246670 upstream) : EFHB (97155 downstream)																																			---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20117399	20117400	+	Intron	INS	-	A	A	rs148559450		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20117399_20117400insA	uc003cbq.2	+							NM_003884	NP_003875			K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22308908	22308908	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22308908delA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	23194544	23194544	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23194544delA								ZNF385D (780421 upstream) : UBE2E2 (50109 downstream)																																			---	---	---	---
RARB	5915	broad.mit.edu	37	3	25370257	25370257	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25370257delT	uc011awl.1	+							NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
NGLY1	55768	broad.mit.edu	37	3	25824343	25824343	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25824343delA	uc003cdl.2	-						NGLY1_uc010hfg.2_Intron|NGLY1_uc003cdm.2_Intron|NGLY1_uc011awo.1_Intron	NM_018297	NP_060767			N-glycanase 1 isoform 1						glycoprotein catabolic process	cytoplasm	metal ion binding|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity|protein binding			breast(1)	1																		---	---	---	---
LRRC3B	116135	broad.mit.edu	37	3	26749268	26749270	+	Intron	DEL	TTT	-	-	rs34846911		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26749268_26749270delTTT	uc003cdp.2	+						LRRC3B_uc003cdq.2_Intron	NM_052953	NP_443185			leucine rich repeat containing 3B precursor							integral to membrane				pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	27957428	27957429	+	IGR	DEL	GT	-	-	rs71669094		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27957428_27957429delGT								EOMES (193222 upstream) : CMC1 (325695 downstream)																																			---	---	---	---
STT3B	201595	broad.mit.edu	37	3	31649244	31649245	+	Intron	INS	-	GTT	GTT	rs148085023	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31649244_31649245insGTT	uc011axe.1	+						STT3B_uc010hft.1_Intron|STT3B_uc003cer.1_Intron|STT3B_uc003cet.2_Intron	NM_178862	NP_849193			source of immunodominant MHC-associated						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0																		---	---	---	---
CMTM8	152189	broad.mit.edu	37	3	32314824	32314825	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32314824_32314825delAC	uc003cex.2	+						CMTM8_uc010hfu.2_Intron	NM_178868	NP_849199			CKLF-like MARVEL transmembrane domain containing						chemotaxis	extracellular space|integral to membrane	cytokine activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	32677111	32677112	+	IGR	INS	-	A	A	rs57104538		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32677111_32677112insA								DYNC1LI1 (64761 upstream) : CNOT10 (49586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	34289938	34289939	+	IGR	DEL	GG	-	-	rs113178067		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34289938_34289939delGG								PDCD6IP (378744 upstream) : None (None downstream)																																			---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35789603	35789606	+	Intron	DEL	AAGA	-	-	rs71082213		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35789603_35789606delAAGA	uc003cgb.2	+						ARPP21_uc003cga.2_Intron|ARPP21_uc011axy.1_Intron|ARPP21_uc003cgf.2_Intron|ARPP21_uc003cgg.2_Intron	NM_016300	NP_057384			cyclic AMP-regulated phosphoprotein, 21 kD							cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	36977987	36977987	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36977987delA								TRANK1 (75576 upstream) : EPM2AIP1 (49371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	44045892	44045893	+	IGR	INS	-	GT	GT	rs139070807	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44045892_44045893insGT								ABHD5 (281676 upstream) : MIR138-1 (109811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45369795	45369795	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45369795delG								TMEM158 (101981 upstream) : LARS2 (60280 downstream)																																			---	---	---	---
FYCO1	79443	broad.mit.edu	37	3	46039660	46039663	+	5'Flank	DEL	AGAC	-	-	rs72101642		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46039660_46039663delAGAC	uc003cpb.3	-							NM_024513	NP_078789			FYVE and coiled-coil domain containing 1						transport	integral to membrane	metal ion binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)														---	---	---	---
QRICH1	54870	broad.mit.edu	37	3	49127891	49127892	+	Intron	INS	-	A	A	rs33942736		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49127891_49127892insA	uc010hkq.2	-						QRICH1_uc003cvu.2_Intron|QRICH1_uc003cvv.2_Intron	NM_198880	NP_942581			glutamine-rich 1											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)														---	---	---	---
CACNA2D2	9254	broad.mit.edu	37	3	50402965	50402965	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50402965delC	uc003daq.2	-						CACNA2D2_uc003dap.2_Intron|CACNA2D2_uc003dao.2_Intron	NM_006030	NP_006021			calcium channel, voltage-dependent, alpha						energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)													---	---	---	---
TWF2	11344	broad.mit.edu	37	3	52272945	52272946	+	Intron	INS	-	G	G	rs140204155	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52272945_52272946insG	uc003ddd.2	-						TWF2_uc010hmc.2_Intron|uc003dde.2_5'Flank	NM_007284	NP_009215			twinfilin-like protein							cytoskeleton|perinuclear region of cytoplasm	actin binding|ATP binding			stomach(1)|ovary(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53174748	53174749	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53174748_53174749delTG								RFT1 (10278 upstream) : PRKCD (20474 downstream)																																			---	---	---	---
CACNA1D	776	broad.mit.edu	37	3	53619057	53619058	+	Intron	INS	-	T	T	rs35767566		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53619057_53619058insT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron	NM_001128840	NP_001122312			calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)													---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54250161	54250162	+	Intron	INS	-	GT	GT	rs144892808	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54250161_54250162insGT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	59645518	59645518	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59645518delA								C3orf67 (609760 upstream) : FHIT (89520 downstream)																																			---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69475473	69475474	+	Intron	DEL	GT	-	-	rs67450042		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69475473_69475474delGT	uc003dnw.2	-											Homo sapiens mRNA for KIAA1013 protein, partial cds.							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	72505621	72505621	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72505621delA								RYBP (9847 upstream) : SHQ1 (292809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74079843	74079843	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74079843delA								PDZRN3 (405771 upstream) : CNTN3 (231879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75700187	75700188	+	IGR	INS	-	TG	TG	rs57863739		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75700187_75700188insTG								MIR1324 (20178 upstream) : ZNF717 (58606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	78068540	78068541	+	IGR	INS	-	T	T	rs66816101		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78068540_78068541insT								ROBO2 (371879 upstream) : ROBO1 (577847 downstream)																																			---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
Unknown	0	broad.mit.edu	37	3	88426647	88426647	+	IGR	DEL	T	-	-	rs71866147		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88426647delT								C3orf38 (219534 upstream) : EPHA3 (730027 downstream)																																			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89449787	89449788	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89449787_89449788delGT	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90461098	90461099	+	IGR	INS	-	T	T	rs138982312		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90461098_90461099insT								EPHA3 (929816 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96333012	96333012	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96333012delA								None (None upstream) : EPHA6 (200413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99185757	99185757	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99185757delG								DCBLD2 (565224 upstream) : COL8A1 (171697 downstream)																																			---	---	---	---
TMEM45A	55076	broad.mit.edu	37	3	100221908	100221909	+	Intron	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100221908_100221909delTC	uc003dtz.1	+							NM_018004	NP_060474			transmembrane protein 45A							integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100330092	100330093	+	Intron	INS	-	TTCT	TTCT	rs143346795	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330092_100330093insTTCT	uc003duc.2	+							NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	108599624	108599624	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108599624delT								TRAT1 (25910 upstream) : GUCA1C (27018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110461756	110461756	+	IGR	DEL	G	-	-	rs138887248		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110461756delG								None (None upstream) : PVRL3 (329109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	113421307	113421308	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113421307_113421308insT								KIAA2018 (5814 upstream) : NAA50 (16533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	113828012	113828013	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113828012_113828013insA								QTRTD1 (20746 upstream) : DRD3 (19544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	114939992	114939992	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114939992delT								ZBTB20 (73865 upstream) : GAP43 (402159 downstream)																																			---	---	---	---
GAP43	2596	broad.mit.edu	37	3	115342811	115342811	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115342811delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036			growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	116798740	116798749	+	IGR	DEL	AAAAGAAAAG	-	-	rs72297969		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116798740_116798749delAAAAGAAAAG								LOC285194 (362855 upstream) : None (None downstream)																																			---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121264053	121264054	+	Intron	INS	-	A	A	rs138502563	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121264053_121264054insA	uc003eee.3	-							NM_199420	NP_955452			DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
Unknown	0	broad.mit.edu	37	3	127210115	127210116	+	Intron	DEL	GC	-	-	rs66566224		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127210115_127210116delGC	uc003ejk.2	-											Homo sapiens cDNA FLJ25806 fis, clone TST07194.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	128916526	128916527	+	IGR	DEL	TG	-	-	rs71620048		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128916526_128916527delTG								CNBP (13716 upstream) : COPG (51926 downstream)																																			---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131256127	131256128	+	Intron	INS	-	TT	TT	rs74985864		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131256127_131256128insTT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron|CPNE4_uc003eoj.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
TOPBP1	11073	broad.mit.edu	37	3	133322173	133322173	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133322173delA	uc003eps.2	-							NM_007027	NP_008958			topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7													Other_conserved_DNA_damage_response_genes					---	---	---	---
PIK3CB	5291	broad.mit.edu	37	3	138402351	138402351	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138402351delA	uc011bmq.1	-						PIK3CB_uc011bmn.1_Intron|PIK3CB_uc011bmo.1_Intron|PIK3CB_uc011bmp.1_Intron	NM_006219	NP_006210			catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144298027	144298028	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144298027_144298028delCA								C3orf58 (586818 upstream) : None (None downstream)																																			---	---	---	---
CPB1	1360	broad.mit.edu	37	3	148562685	148562685	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562685delA	uc003ewl.2	+							NM_001871	NP_001862			pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	152740705	152740712	+	IGR	DEL	AAGGAAGG	-	-	rs12330574		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152740705_152740712delAAGGAAGG								P2RY1 (184864 upstream) : RAP2B (139317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	154621418	154621418	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154621418delG								GPR149 (473914 upstream) : MME (120495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	156380469	156380469	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156380469delT								SSR3 (107534 upstream) : LOC100287227 (10495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	158548156	158548157	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158548156_158548157delCT								MFSD1 (652 upstream) : SCHIP1 (238960 downstream)																																			---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160769162	160769163	+	Intron	DEL	AC	-	-	rs145618379		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160769162_160769163delAC	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	165423800	165423800	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165423800delC								SLITRK3 (509331 upstream) : BCHE (66894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165562372	165562373	+	IGR	INS	-	TG	TG	rs148832186	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165562372_165562373insTG								BCHE (7119 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166005941	166005941	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166005941delT								BCHE (450688 upstream) : ZBBX (952140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166702952	166702952	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166702952delT								None (None upstream) : ZBBX (255129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168682035	168682036	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168682035_168682036insT								C3orf50 (133663 upstream) : MECOM (119251 downstream)																																			---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171123962	171123962	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171123962delC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171177464	171177465	+	Intron	INS	-	ACACACACACAC	ACACACACACAC	rs142709083	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171177464_171177465insACACACACACAC	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
YEATS2	55689	broad.mit.edu	37	3	183453484	183453485	+	Intron	INS	-	T	T	rs142248664	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183453484_183453485insT	uc003fly.2	+							NM_018023	NP_060493			YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	184259728	184259728	+	IGR	DEL	G	-	-	rs34100025	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184259728delG								CHRD (152109 upstream) : EPHB3 (19859 downstream)																																			---	---	---	---
LIPH	200879	broad.mit.edu	37	3	185270030	185270030	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185270030delT	uc003fpm.2	-						LIPH_uc010hyh.2_Intron	NM_139248	NP_640341			lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	188849604	188849604	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188849604delA	uc003frv.1	+							NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	189012592	189012593	+	Intron	INS	-	AC	AC	rs151153242	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189012592_189012593insAC	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	190410207	190410209	+	IGR	DEL	TTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190410207_190410209delTTG								IL1RAP (34364 upstream) : LOC647309 (160317 downstream)																																			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192341471	192341471	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192341471delA	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193077174	193077175	+	Intron	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193077174_193077175delTC	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193425575	193425577	+	IGR	DEL	TTC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193425575_193425577delTTC								OPA1 (9976 upstream) : LOC100128023 (285307 downstream)																																			---	---	---	---
C3orf21	152002	broad.mit.edu	37	3	194792394	194792395	+	Intron	INS	-	TGAT	TGAT	rs146386411	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194792394_194792395insTGAT	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744			hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)														---	---	---	---
MUC20	200958	broad.mit.edu	37	3	195447641	195447642	+	5'Flank	DEL	AG	-	-	rs139325922		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195447641_195447642delAG	uc010hzo.2	+							NM_152673	NP_689886			mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195487440	195487440	+	Intron	DEL	G	-	-	rs60152956		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195487440delG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	196192590	196192590	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196192590delT								UBXN7 (33245 upstream) : RNF168 (6039 downstream)																																			---	---	---	---
DLG1	1739	broad.mit.edu	37	3	196795255	196795255	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196795255delA	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
ZNF876P	642280	broad.mit.edu	37	4	212869	212869	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:212869delT	uc010iba.2	+							NR_027481				Homo sapiens cDNA clone IMAGE:4828836.												0																		---	---	---	---
ADD1	118	broad.mit.edu	37	4	2895009	2895009	+	Intron	DEL	A	-	-	rs13146376		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2895009delA	uc003gfr.2	+						ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Intron|ADD1_uc003gfo.2_Intron|ADD1_uc003gfp.2_Intron|ADD1_uc003gfq.2_Intron|ADD1_uc003gfs.2_Intron|ADD1_uc003gft.3_Intron|ADD1_uc003gfu.2_Intron	NM_001119	NP_001110			adducin 1 (alpha) isoform a						actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
DOK7	285489	broad.mit.edu	37	4	3496140	3496141	+	3'UTR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3496140_3496141insT	uc003ghd.2	+	7					DOK7_uc003ghe.2_3'UTR|DOK7_uc003ghf.2_3'UTR|DOK7_uc003ghg.1_Intron	NM_173660	NP_775931			downstream of tyrosine kinase 7 isoform 1						positive regulation of protein tyrosine kinase activity	cell junction|synapse	insulin receptor binding|protein kinase binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3607920	3607923	+	IGR	DEL	TGAG	-	-	rs142808248		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607920_3607923delTGAG								LRPAP1 (73696 upstream) : ADRA2C (160152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3627485	3627486	+	IGR	INS	-	T	T	rs141784691	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3627485_3627486insT								LRPAP1 (93261 upstream) : ADRA2C (140589 downstream)																																			---	---	---	---
AFAP1	60312	broad.mit.edu	37	4	7782370	7782371	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7782370_7782371insT	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997			actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0																		---	---	---	---
HTRA3	94031	broad.mit.edu	37	4	8290686	8290686	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8290686delT	uc003gla.2	+						HTRA3_uc003gkz.2_Intron	NM_053044	NP_444272			HtrA serine peptidase 3 precursor						proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	14771174	14771175	+	Intron	INS	-	TGGATGGA	TGGATGGA	rs139658503	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14771174_14771175insTGGATGGA	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																														---	---	---	---
FAM184B	27146	broad.mit.edu	37	4	17636507	17636508	+	Intron	INS	-	T	T	rs145284461	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17636507_17636508insT	uc003gpm.3	-							NM_015688	NP_056503			hypothetical protein LOC27146											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	18915469	18915470	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18915469_18915470delCA								LCORL (892084 upstream) : None (None downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21513788	21513811	+	Intron	DEL	GGAGGGAGGAAGGAAGGAACGAAC	-	-	rs68124536		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21513788_21513811delGGAGGGAGGAAGGAAGGAACGAAC	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	25538101	25538101	+	IGR	DEL	T	-	-	rs111257421		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25538101delT								ANAPC4 (117982 upstream) : SLC34A2 (119334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26041005	26041005	+	IGR	DEL	T	-	-	rs71748950		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26041005delT								C4orf52 (109505 upstream) : RBPJ (280327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26267654	26267654	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26267654delA								C4orf52 (336154 upstream) : RBPJ (53678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27930358	27930359	+	IGR	INS	-	TGTG	TGTG	rs150841644	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27930358_27930359insTGTG								STIM2 (904550 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28512595	28512595	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28512595delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29356276	29356277	+	IGR	INS	-	CTTCAC	CTTCAC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29356276_29356277insCTTCAC								None (None upstream) : None (None downstream)																																			---	---	---	---
PCDH7	5099	broad.mit.edu	37	4	31007126	31007127	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31007126_31007127insA	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580			protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	34913946	34913946	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34913946delA								None (None upstream) : None (None downstream)																																			---	---	---	---
APBB2	323	broad.mit.edu	37	4	40920719	40920726	+	Intron	DEL	CTTCCTTC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40920719_40920726delCTTCCTTC	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	43345436	43345439	+	IGR	DEL	TCCT	-	-	rs71970504		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43345436_43345439delTCCT								GRXCR1 (312763 upstream) : KCTD8 (830483 downstream)																																			---	---	---	---
CORIN	10699	broad.mit.edu	37	4	47678534	47678534	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47678534delG	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Intron|CORIN_uc011bzi.1_Intron	NM_006587	NP_006578			corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SLAIN2	57606	broad.mit.edu	37	4	48420185	48420186	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48420185_48420186insT	uc003gya.3	+							NM_020846	NP_065897			SLAIN motif family, member 2							centrosome					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49581656	49581657	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49581656_49581657insT								CWH43 (517563 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49645331	49645335	+	IGR	DEL	AATGG	-	-	rs113425721		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49645331_49645335delAATGG								CWH43 (581238 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49646415	49646419	+	IGR	DEL	TGGAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49646415_49646419delTGGAA								CWH43 (582322 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53661752	53661765	+	IGR	DEL	AAGAAAGAGAGAGA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53661752_53661765delAAGAAAGAGAGAGA								KIAA0114 (81447 upstream) : RASL11B (66730 downstream)																																			---	---	---	---
NMU	10874	broad.mit.edu	37	4	56483674	56483675	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56483674_56483675delAC	uc003hbc.2	-						NMU_uc003hbd.1_Intron|NMU_uc010igv.1_Intron|NMU_uc010igw.1_Intron|NMU_uc010igx.1_Intron	NM_006681	NP_006672			neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	58868998	58868999	+	IGR	DEL	AT	-	-	rs35329828		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58868998_58868999delAT								IGFBP7 (892459 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	58959164	58959164	+	IGR	DEL	T	-	-	rs34456699		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58959164delT								IGFBP7 (982625 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60502736	60502737	+	IGR	INS	-	A	A	rs142054123	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60502736_60502737insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65560323	65560324	+	IGR	INS	-	T	T	rs146206550	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65560323_65560324insT								TECRL (285145 upstream) : EPHA5 (624958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67731335	67731338	+	IGR	DEL	TGTC	-	-	rs76474299		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67731335_67731338delTGTC								MIR1269 (588689 upstream) : CENPC1 (606651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67980415	67980415	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67980415delT								MIR1269 (837769 upstream) : CENPC1 (357574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	69307161	69307161	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69307161delA								YTHDC1 (91337 upstream) : UGT2B15 (205155 downstream)																																			---	---	---	---
AMTN	401138	broad.mit.edu	37	4	71382970	71382971	+	5'Flank	INS	-	TT	TT	rs151205930	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71382970_71382971insTT	uc003hfk.1	+						AMTN_uc010ihy.1_5'Flank	NM_212557	NP_997722			amelotin precursor						biomineral tissue development|cell adhesion|odontogenesis of dentine-containing tooth	basal lamina|cell-cell junction				large_intestine(1)|central_nervous_system(1)	2			Lung(101;0.235)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	71477514	71477514	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71477514delT								AMBN (4512 upstream) : ENAM (16947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72023815	72023820	+	IGR	DEL	TGTGTG	-	-	rs34168555		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72023815_72023820delTGTGTG								DCK (127188 upstream) : SLC4A4 (29183 downstream)																																			---	---	---	---
SLC4A4	8671	broad.mit.edu	37	4	72383604	72383604	+	Intron	DEL	C	-	-	rs35571079		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72383604delC	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron	NM_001098484	NP_001091954			solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)															---	---	---	---
MTHFD2L	441024	broad.mit.edu	37	4	74993749	74993749	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74993749delC	uc003hhn.1	+						MTHFD2L_uc011cbj.1_Intron|MTHFD2L_uc003hho.2_Intron	NM_001144978	NP_001138450			methylenetetrahydrofolate dehydrogenase 2-like						folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)															---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79250495	79250495	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79250495delC	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc003hkz.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	80208849	80208850	+	Intron	DEL	GA	-	-	rs62310543		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80208849_80208850delGA	uc003hlr.1	+						uc003hls.2_Intron					Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	82732717	82732718	+	IGR	INS	-	AC	AC	rs6148546		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82732717_82732718insAC								RASGEF1B (339656 upstream) : HNRNPD (541749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86132086	86132087	+	IGR	INS	-	G	G	rs144768939	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86132086_86132087insG								C4orf12 (203918 upstream) : ARHGAP24 (264197 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	89235618	89235618	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89235618delA	uc003hro.2	+											Homo sapiens, clone IMAGE:5199401, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	95027936	95027944	+	IGR	DEL	TTTGTTTTG	-	-	rs113371796		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95027936_95027944delTTTGTTTTG								ATOH1 (276794 upstream) : SMARCAD1 (100815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	97569639	97569640	+	IGR	INS	-	GAAA	GAAA	rs139420746	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97569639_97569640insGAAA								PDHA2 (807015 upstream) : C4orf37 (910394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	111640047	111640047	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111640047delT								PITX2 (76930 upstream) : MIR297 (141691 downstream)																																			---	---	---	---
C4orf21	55345	broad.mit.edu	37	4	113532306	113532306	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113532306delC	uc003iau.2	-						C4orf21_uc003iaw.2_Intron	NM_018392	NP_060862			prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	113705362	113705362	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113705362delT								LARP7 (126621 upstream) : ANK2 (33877 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116067333	116067336	+	IGR	DEL	TAAA	-	-	rs145091755		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116067333_116067336delTAAA								NDST4 (32301 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116375476	116375476	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116375476delA								NDST4 (340444 upstream) : MIR1973 (845405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117348337	117348337	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117348337delT								MIR1973 (127413 upstream) : TRAM1L1 (656379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117512298	117512299	+	IGR	INS	-	GT	GT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117512298_117512299insGT								MIR1973 (291374 upstream) : TRAM1L1 (492417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120324547	120324549	+	Intron	DEL	CTC	-	-	rs59446710		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120324547_120324549delCTC	uc003icx.1	+											Homo sapiens cDNA FLJ40382 fis, clone TESTI2035775.																														---	---	---	---
PDE5A	8654	broad.mit.edu	37	4	120466172	120466173	+	Intron	INS	-	AAC	AAC	rs148559266	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120466172_120466173insAAC	uc003idh.2	-						uc003ide.3_Intron|PDE5A_uc003idf.2_Intron|PDE5A_uc003idg.2_Intron|uc003idi.3_Intron	NM_001083	NP_001074			phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	122957281	122957282	+	IGR	DEL	TT	-	-	rs111366732		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122957281_122957282delTT								TRPC3 (84372 upstream) : KIAA1109 (134476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	124542416	124542416	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124542416delT								SPRY1 (217509 upstream) : LOC285419 (29006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	132615564	132615564	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132615564delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135238062	135238063	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135238062_135238063insA	uc003ihc.1	-											Homo sapiens cDNA clone IMAGE:5266053.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	137617593	137617594	+	IGR	INS	-	T	T	rs112662905		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137617593_137617594insT								None (None upstream) : PCDH18 (822482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141421256	141421256	+	5'Flank	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141421256delT	uc003iij.1	-											Homo sapiens similar to RIKEN cDNA 4933434I20, mRNA (cDNA clone IMAGE:5267198).																														---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143198819	143198820	+	Intron	INS	-	AT	AT	rs147721382	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143198819_143198820insAT	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	146902382	146902382	+	IGR	DEL	A	-	-	rs35743399		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146902382delA								ZNF827 (42775 upstream) : LSM6 (194453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	146929307	146929308	+	IGR	INS	-	TCCT	TCCT	rs148952414	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146929307_146929308insTCCT								ZNF827 (69700 upstream) : LSM6 (167527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	158790561	158790561	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158790561delA								LOC340017 (293266 upstream) : FAM198B (255172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	164112154	164112155	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164112154_164112155insT								NAF1 (24081 upstream) : NPY1R (132962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168357211	168357212	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168357211_168357212delTG								SPOCK3 (201470 upstream) : ANXA10 (656495 downstream)																																			---	---	---	---
DDX60L	91351	broad.mit.edu	37	4	169317285	169317285	+	Intron	DEL	A	-	-	rs33917581		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169317285delA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985			DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	172272551	172272552	+	IGR	INS	-	G	G	rs147621563	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172272551_172272552insG								None (None upstream) : GALNTL6 (462023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	182705313	182705314	+	IGR	INS	-	T	T	rs11428985		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182705313_182705314insT								None (None upstream) : MGC45800 (354845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184287114	184287114	+	IGR	DEL	A	-	-	rs150123912		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184287114delA								WWC2 (45187 upstream) : CDKN2AIP (78675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	185765895	185765896	+	RNA	INS	-	T	T	rs71591670		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185765895_185765896insT	uc003iwy.1	-	3		c.473_474insA								Homo sapiens hypothetical protein LOC731424, mRNA (cDNA clone IMAGE:4133286), with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	186501255	186501256	+	IGR	INS	-	CTT	CTT	rs148116639	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186501255_186501256insCTT								PDLIM3 (44543 upstream) : SORBS2 (5343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188430817	188430818	+	IGR	INS	-	TG	TG	rs141602041	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188430817_188430818insTG								FAT1 (782967 upstream) : ZFP42 (486107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190283784	190283785	+	IGR	DEL	TC	-	-	rs145668449		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190283784_190283785delTC								None (None upstream) : FRG1 (578189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190825682	190825683	+	Intron	INS	-	T	T	rs138468383		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190825682_190825683insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
SDHA	6389	broad.mit.edu	37	5	249540	249540	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:249540delC	uc003jao.3	+						SDHA_uc011clv.1_Intron|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Intron|SDHA_uc003jar.3_Intron	NM_004168	NP_004159			succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)									Familial_Paragangliomas				---	---	---	---
Unknown	0	broad.mit.edu	37	5	1196834	1196846	+	IGR	DEL	GGGTACTGTGGGA	-	-	rs56000953		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1196834_1196846delGGGTACTGTGGGA								SLC12A7 (84662 upstream) : SLC6A19 (4864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1459643	1459644	+	IGR	INS	-	TG	TG	rs147005939		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1459643_1459644insTG								SLC6A3 (14105 upstream) : LPCAT1 (1900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1459888	1459891	+	IGR	DEL	TGTG	-	-	rs145645730		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1459888_1459891delTGTG								SLC6A3 (14350 upstream) : LPCAT1 (1653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2584554	2584577	+	IGR	DEL	ATGATTAAGTGGATGGATGAATGA	-	-	rs62330875		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2584554_2584577delATGATTAAGTGGATGGATGAATGA								IRX4 (701674 upstream) : IRX2 (161704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2787380	2787380	+	IGR	DEL	T	-	-	rs78759235		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2787380delT								C5orf38 (31868 upstream) : IRX1 (808788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2921669	2921670	+	IGR	INS	-	TTCA	TTCA	rs143477212	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2921669_2921670insTTCA								C5orf38 (166157 upstream) : IRX1 (674498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4031783	4031784	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4031783_4031784insT								IRX1 (430267 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4296510	4296511	+	IGR	INS	-	TG	TG	rs142141320	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4296510_4296511insTG								IRX1 (694994 upstream) : LOC340094 (737961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4425634	4425634	+	IGR	DEL	C	-	-	rs76748112		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4425634delC								IRX1 (824118 upstream) : LOC340094 (608838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4444503	4444512	+	IGR	DEL	ACACACACAG	-	-	rs34288649		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4444503_4444512delACACACACAG								IRX1 (842987 upstream) : LOC340094 (589960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5132139	5132140	+	IGR	INS	-	AA	AA	rs35967581		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5132139_5132140insAA								LOC340094 (62030 upstream) : ADAMTS16 (8303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5501832	5501832	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5501832delA								KIAA0947 (11495 upstream) : FLJ33360 (808722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5820677	5820678	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5820677_5820678delTG								KIAA0947 (330340 upstream) : FLJ33360 (489876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7190354	7190357	+	IGR	DEL	TCTG	-	-	rs111803167		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7190354_7190357delTCTG								PAPD7 (433193 upstream) : ADCY2 (205986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7303259	7303260	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7303259_7303260delAC	uc003jdy.1	-											Homo sapiens cDNA FLJ42124 fis, clone TESTI2009477, weakly  similar to TRICHOHYALIN.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	7372641	7372649	+	IGR	DEL	CCACCATCA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7372641_7372649delCCACCATCA								PAPD7 (615480 upstream) : ADCY2 (23694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7975213	7975213	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7975213delT								MTRR (73980 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8936472	8936473	+	IGR	INS	-	TGT	TGT	rs140170821	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8936472_8936473insTGT								None (None upstream) : SEMA5A (98665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10112163	10112164	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10112163_10112164insA								LOC285692 (208227 upstream) : FAM173B (114274 downstream)																																			---	---	---	---
CCT5	22948	broad.mit.edu	37	5	10250036	10250047	+	5'Flank	DEL	AAAAAAAAAAAC	-	-	rs57941186	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10250036_10250047delAAAAAAAAAAAC	uc003jeq.2	+						FAM173B_uc003jeo.2_5'Flank|FAM173B_uc003jep.2_5'Flank|FAM173B_uc010itr.2_5'Flank|CCT5_uc011cmq.1_5'Flank|CCT5_uc003jer.2_5'Flank|CCT5_uc010its.2_5'Flank|CCT5_uc011cmr.1_5'Flank|CCT5_uc011cms.1_5'Flank|CCT5_uc011cmt.1_5'Flank	NM_012073	NP_036205			chaperonin containing TCP1, subunit 5 (epsilon)						'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2																		---	---	---	---
DAP	1611	broad.mit.edu	37	5	10729227	10729227	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10729227delT	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385			death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)																---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11382711	11382712	+	Intron	INS	-	TA	TA	rs10642664		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11382711_11382712insTA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11592349	11592364	+	Intron	DEL	TGCCTTCCTGCCTGCT	-	-	rs57837328		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11592349_11592364delTGCCTTCCTGCCTGCT	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11865542	11865543	+	Intron	INS	-	A	A	rs149935367	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11865542_11865543insA	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	13412316	13412317	+	IGR	INS	-	CA	CA	rs140901966	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13412316_13412317insCA								None (None upstream) : DNAH5 (278120 downstream)																																			---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13774025	13774025	+	Intron	DEL	G	-	-	rs113662489		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13774025delG	uc003jfd.2	-							NM_001369	NP_001360			dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14233871	14233871	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14233871delT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14416404	14416405	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14416404_14416405insT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	15248108	15248109	+	IGR	INS	-	AAG	AAG	rs138478585	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15248108_15248109insAAG								ANKH (376221 upstream) : FBXL7 (252196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	15376177	15376177	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15376177delT								ANKH (504290 upstream) : FBXL7 (124128 downstream)																																			---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15501442	15501442	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15501442delG	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15728265	15728265	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15728265delA	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	16377417	16377418	+	IGR	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16377417_16377418delGT								MARCH11 (197520 upstream) : ZNF622 (74211 downstream)																																			---	---	---	---
LOC285696	285696	broad.mit.edu	37	5	17171711	17171712	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17171711_17171712delAC	uc003jfw.2	-							NR_027253				Homo sapiens cDNA FLJ34047 fis, clone FCBBF3000001.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	20475140	20475141	+	IGR	DEL	TG	-	-	rs140419334		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20475140_20475141delTG								CDH18 (486833 upstream) : GUSBP1 (866801 downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21345071	21345071	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21345071delA	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21527831	21527832	+	Intron	INS	-	AT	AT	rs149030219	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21527831_21527832insAT	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22036653	22036654	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22036653_22036654delGT	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22546036	22546038	+	Intron	DEL	TTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22546036_22546038delTTG	uc003jgk.2	-							NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22567249	22567249	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22567249delT	uc003jgk.2	-							NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23313398	23313399	+	IGR	INS	-	TG	TG	rs144222494	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23313398_23313399insTG								CDH12 (459667 upstream) : PRDM9 (194325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23456981	23456981	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23456981delG								CDH12 (603250 upstream) : PRDM9 (50743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24330270	24330270	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24330270delT								PRDM9 (801566 upstream) : CDH10 (156940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24387793	24387793	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24387793delG								PRDM9 (859089 upstream) : CDH10 (99417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25014087	25014087	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25014087delA								CDH10 (369176 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26090641	26090641	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26090641delA								None (None upstream) : CDH9 (790068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27808817	27808818	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27808817_27808818insT								CDH9 (770128 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28398410	28398410	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28398410delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29843303	29843306	+	IGR	DEL	GATA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29843303_29843306delGATA								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH6	1004	broad.mit.edu	37	5	31293937	31293938	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31293937_31293938insA	uc003jhe.1	+						CDH6_uc003jhd.1_Intron	NM_004932	NP_004923			cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32223266	32223267	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32223266_32223267delCA								GOLPH3 (48841 upstream) : MTMR12 (3845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	32559282	32559283	+	IGR	INS	-	ACAC	ACAC	rs139904190	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32559282_32559283insACAC								ZFR (114438 upstream) : SUB1 (26322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	32564626	32564639	+	IGR	DEL	CACACACACACACG	-	-	rs59728165		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32564626_32564639delCACACACACACACG								ZFR (119782 upstream) : SUB1 (20966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	33095927	33095928	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33095927_33095928insT								C5orf23 (304108 upstream) : TARS (344874 downstream)																																			---	---	---	---
RAI14	26064	broad.mit.edu	37	5	34660884	34660884	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34660884delT	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron	NM_015577	NP_056392			retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)																	---	---	---	---
RAI14	26064	broad.mit.edu	37	5	34759374	34759374	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34759374delA	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392			retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)																	---	---	---	---
DNAJC21	134218	broad.mit.edu	37	5	34948968	34948968	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34948968delA	uc003jjc.2	+						DNAJC21_uc003jjb.2_Intron|DNAJC21_uc010iuu.1_Intron|DNAJC21_uc003jjd.2_Intron	NM_001012339	NP_001012339			DnaJ homology subfamily A member 5 isoform 2						protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	35234713	35234713	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35234713delT								PRLR (3919 upstream) : SPEF2 (383276 downstream)																																			---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35647441	35647442	+	Intron	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35647441_35647442delGA	uc003jjo.2	+						SPEF2_uc003jjn.1_Intron|SPEF2_uc003jjq.3_Intron	NM_024867	NP_079143			KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	36389562	36389563	+	IGR	DEL	TA	-	-	rs72362795		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36389562_36389563delTA								RANBP3L (87551 upstream) : SLC1A3 (216894 downstream)																																			---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	36921994	36921995	+	Intron	INS	-	T	T	rs71868741		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36921994_36921995insT	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron	NM_133433	NP_597677			delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	39539568	39539568	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39539568delT								DAB2 (114233 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	39718630	39718630	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39718630delG								DAB2 (293295 upstream) : PTGER4 (961402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	40335984	40335984	+	IGR	DEL	A	-	-	rs35595037		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40335984delA								DAB2 (910649 upstream) : PTGER4 (344048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41591495	41591496	+	IGR	INS	-	A	A	rs141813110	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41591495_41591496insA								PLCXD3 (80765 upstream) : OXCT1 (138672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41996872	41996873	+	IGR	INS	-	CC	CC	rs146154296	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41996872_41996873insCC								FBXO4 (55209 upstream) : GHR (427153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	43818633	43818636	+	IGR	DEL	TTTC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43818633_43818636delTTTC								NNT (112966 upstream) : FGF10 (486461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44087873	44087873	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44087873delG								NNT (382206 upstream) : FGF10 (217224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44428205	44428206	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44428205_44428206insA								FGF10 (39421 upstream) : MRPS30 (380821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44606660	44606661	+	IGR	INS	-	T	T	rs138234588	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44606660_44606661insT								FGF10 (217876 upstream) : MRPS30 (202366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46341233	46341233	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46341233delA								HCN1 (645013 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46397980	46397981	+	IGR	INS	-	T	T	rs111272605		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46397980_46397981insT								HCN1 (701760 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49622050	49622050	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49622050delT								None (None upstream) : EMB (69983 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55025847	55025848	+	IGR	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55025847_55025848delGA								SLC38A9 (17293 upstream) : DDX4 (7997 downstream)																																			---	---	---	---
ADAMTS6	11174	broad.mit.edu	37	5	64469162	64469162	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64469162delT	uc003jtp.2	-						ADAMTS6_uc003jto.2_Intron|ADAMTS6_uc003jtq.2_Intron	NM_197941	NP_922932			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	67646280	67646280	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67646280delG								PIK3R1 (48633 upstream) : SLC30A5 (743538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74436114	74436114	+	IGR	DEL	G	-	-	rs71961024		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74436114delG								GCNT4 (109390 upstream) : ANKRD31 (6948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	82096338	82096338	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82096338delT								ATP6AP1L (482192 upstream) : TMEM167A (252329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	84159381	84159381	+	IGR	DEL	C	-	-	rs116388363	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84159381delC								EDIL3 (478770 upstream) : None (None downstream)																																			---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90022642	90022642	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90022642delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjv.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	90516887	90516888	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90516887_90516888insA								GPR98 (56855 upstream) : ARRDC3 (147653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	90999064	90999065	+	IGR	INS	-	CCTT	CCTT	rs143285985	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90999064_90999065insCCTT								LOC100129716 (282533 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101933723	101933724	+	IGR	INS	-	A	A	rs146034110	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101933723_101933724insA								SLCO6A1 (99003 upstream) : PAM (267803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	102184051	102184051	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102184051delG								SLCO6A1 (349331 upstream) : PAM (17476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105309250	105309251	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105309250_105309251delTC								RAB9BP1 (873452 upstream) : None (None downstream)																																			---	---	---	---
FBXL17	64839	broad.mit.edu	37	5	107389205	107389205	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107389205delA	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787			F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)														---	---	---	---
FBXL17	64839	broad.mit.edu	37	5	107531083	107531083	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107531083delG	uc011cvc.1	-						FBXL17_uc003kon.3_Intron	NM_001163315	NP_001156787			F-box and leucine-rich repeat protein 17												0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	122968665	122968665	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122968665delA								CSNK1G3 (16203 upstream) : None (None downstream)																																			---	---	---	---
MARCH3	115123	broad.mit.edu	37	5	126250459	126250460	+	Intron	INS	-	AC	AC	rs58386463		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126250459_126250460insAC	uc003kuf.2	-							NM_178450	NP_848545			membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)														---	---	---	---
LYRM7	90624	broad.mit.edu	37	5	130506852	130506853	+	Intron	INS	-	G	G	rs148615767	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130506852_130506853insG	uc003kvg.1	+							NM_181705	NP_859056			Lyrm7 homolog												0		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130787912	130787913	+	Intron	INS	-	A	A	rs75498361		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130787912_130787913insA	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
AFF4	27125	broad.mit.edu	37	5	132225028	132225028	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132225028delA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron	NM_014423	NP_055238			ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	132382429	132382429	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132382429delT								ZCCHC10 (20189 upstream) : HSPA4 (5233 downstream)																																			---	---	---	---
PKD2L2	27039	broad.mit.edu	37	5	137228563	137228563	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137228563delA	uc003lby.2	+						PKD2L2_uc010jep.1_Intron|PKD2L2_uc003lbw.1_Intron|PKD2L2_uc003lbx.2_Intron	NM_014386	NP_055201			polycystic kidney disease 2-like 2							integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
SIL1	64374	broad.mit.edu	37	5	138449291	138449291	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138449291delT	uc003ldm.2	-						SIL1_uc003ldn.2_Intron|SIL1_uc003ldo.2_Intron|SIL1_uc003ldp.2_Intron	NM_022464	NP_071909			SIL1 protein precursor						intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)											Marinesco-Sj_gren_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	5	140490953	140490954	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140490953_140490954insT								PCDHB3 (7548 upstream) : PCDHB4 (10627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141141228	141141229	+	IGR	INS	-	GG	GG			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141141228_141141229insGG								ARAP3 (79428 upstream) : PCDH1 (91454 downstream)																																			---	---	---	---
DPYSL3	1809	broad.mit.edu	37	5	146840181	146840181	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146840181delA	uc003loo.2	-							NM_001387	NP_001378			dihydropyrimidinase-like 3						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
GLRA1	2741	broad.mit.edu	37	5	151243701	151243702	+	Intron	DEL	TG	-	-	rs35457752		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151243701_151243702delTG	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512			glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	152552260	152552261	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152552260_152552261insT								NMUR2 (767420 upstream) : GRIA1 (316914 downstream)																																			---	---	---	---
SGCD	6444	broad.mit.edu	37	5	155616703	155616703	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155616703delA	uc003lwa.1	+							NM_172244	NP_758447			delta-sarcoglycan isoform 2						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
PPP1R2P3	153743	broad.mit.edu	37	5	156278397	156278397	+	3'UTR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156278397delC	uc003lwf.1	+	1						NR_002168				RecName: Full=Putative protein phosphatase inhibitor 2-like protein 3; AltName: Full=Protein phosphatase 1, regulatory subunit 2 pseudogene 3;												0																		---	---	---	---
ADAM19	8728	broad.mit.edu	37	5	156879656	156879656	+	Intron	DEL	T	-	-	rs11320185		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156879656delT	uc003lww.1	-											SubName: Full=cDNA FLJ34145 fis, clone FCBBF3011867, highly similar to ADAM 19 (EC 3.4.24.-);						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	159578934	159578934	+	IGR	DEL	T	-	-	rs113242402		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159578934delT								PWWP2A (32482 upstream) : FABP6 (35440 downstream)																																			---	---	---	---
CCNJL	79616	broad.mit.edu	37	5	159730730	159730735	+	Intron	DEL	TGTGTC	-	-	rs111954504		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159730730_159730735delTGTGTC	uc003lyb.1	-						CCNJL_uc011dee.1_Intron|CCNJL_uc003lyc.1_Intron|CCNJL_uc011def.1_Intron	NM_024565	NP_078841			cyclin J-like							nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	162750905	162750906	+	IGR	DEL	AG	-	-	rs35112677		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162750905_162750906delAG								None (None upstream) : CCNG1 (113671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	163323577	163323578	+	IGR	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163323577_163323578delGT								MAT2B (377244 upstream) : None (None downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167576513	167576514	+	Intron	INS	-	G	G	rs143093732	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167576513_167576514insG	uc010jjd.2	+						ODZ2_uc003lzr.3_Intron|ODZ2_uc003lzt.3_Intron|ODZ2_uc010jje.2_Intron|uc003lzs.1_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167826232	167826233	+	Intron	INS	-	CCT	CCT	rs150292943	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167826232_167826233insCCT	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	171997981	171998000	+	IGR	DEL	GGAAGGAAGGAGGGAAGGAA	-	-	rs72075870		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171997981_171998000delGGAAGGAAGGAGGGAAGGAA								SH3PXD2B (116454 upstream) : NEURL1B (70276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	172204703	172204703	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172204703delT								DUSP1 (6500 upstream) : ERGIC1 (56520 downstream)																																			---	---	---	---
ERGIC1	57222	broad.mit.edu	37	5	172289310	172289311	+	Intron	INS	-	AA	AA	rs79368661		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172289310_172289311insAA	uc003mbw.3	+							NM_001031711	NP_001026881			endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	174230728	174230728	+	IGR	DEL	T	-	-	rs112221033		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174230728delT								MSX2 (72827 upstream) : DRD1 (636948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174520531	174520532	+	IGR	INS	-	AG	AG	rs140394080	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174520531_174520532insAG								MSX2 (362630 upstream) : DRD1 (347144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174757626	174757626	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174757626delA								MSX2 (599725 upstream) : DRD1 (110050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174812028	174812047	+	IGR	DEL	AAGGAAAGAAGGAAGGAAGA	-	-	rs111559272		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174812028_174812047delAAGGAAAGAAGGAAGGAAGA								MSX2 (654127 upstream) : DRD1 (55629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	175847185	175847186	+	IGR	INS	-	A	A	rs113182141		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175847185_175847186insA								CLTB (3645 upstream) : FAF2 (28170 downstream)																																			---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177746888	177746889	+	Intron	INS	-	CGCCCTAT	CGCCCTAT	rs146607015	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177746888_177746889insCGCCCTAT	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	1542474	1542475	+	IGR	INS	-	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1542474_1542475insG								FOXF2 (146643 upstream) : FOXC1 (68206 downstream)																																			---	---	---	---
LY86	9450	broad.mit.edu	37	6	6624488	6624488	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6624488delT	uc003mwy.1	+						LOC285780_uc003mww.3_5'Flank|LOC285780_uc003mwx.2_5'Flank	NM_004271	NP_004262			MD-1, RP105-associated precursor						apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)																	---	---	---	---
BMP6	654	broad.mit.edu	37	6	7861438	7861439	+	Intron	INS	-	T	T	rs72542856		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7861438_7861439insT	uc003mxu.3	+							NM_001718	NP_001709			bone morphogenetic protein 6 preproprotein						BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)																	---	---	---	---
EEF1E1	9521	broad.mit.edu	37	6	8089179	8089179	+	Intron	DEL	A	-	-	rs146466842		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8089179delA	uc003mxz.2	-						EEF1E1_uc011dic.1_Intron|SCARNA27_uc010jod.1_5'Flank	NM_004280	NP_004271			eukaryotic translation elongation factor 1						negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of DNA damage response, signal transduction by p53 class mediator|tRNA aminoacylation for protein translation	cytosol|nucleus					0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	8323263	8323264	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs139963481	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323263_8323264insTTCCTTCT								EEF1E1 (220435 upstream) : SLC35B3 (88469 downstream)																																			---	---	---	---
GFOD1	54438	broad.mit.edu	37	6	13465094	13465109	+	Intron	DEL	GTGTGTGTGTGTGTGT	-	-	rs66709637		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13465094_13465109delGTGTGTGTGTGTGTGT	uc003nat.1	-						GFOD1_uc003nas.1_Intron	NM_018988	NP_061861			glucose-fructose oxidoreductase domain							extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	16035984	16035985	+	IGR	INS	-	AAG	AAG	rs11334468		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16035984_16035985insAAG								DTNBP1 (372713 upstream) : MYLIP (93332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	16871830	16871831	+	IGR	DEL	GT	-	-	rs71673782		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16871830_16871831delGT								ATXN1 (110109 upstream) : RBM24 (409978 downstream)																																			---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17686385	17686388	+	Intron	DEL	AAAG	-	-	rs113476730		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17686385_17686388delAAAG	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115			nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	19806486	19806487	+	5'Flank	INS	-	TTCTGATG	TTCTGATG	rs147778915	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19806486_19806487insTTCTGATG	uc003ncv.1	-											Homo sapiens cDNA FLJ35222 fis, clone PROST2000835.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	21249675	21249675	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21249675delA								CDKAL1 (17043 upstream) : SOX4 (344297 downstream)																																			---	---	---	---
KIAA0319	9856	broad.mit.edu	37	6	24613908	24613908	+	Intron	DEL	A	-	-	rs71739209		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24613908delA	uc011djo.1	-						KIAA0319_uc011djp.1_Intron|KIAA0319_uc003neh.1_Intron|KIAA0319_uc011djq.1_Intron|KIAA0319_uc011djr.1_Intron	NM_014809	NP_055624			KIAA0319 precursor						negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25948458	25948459	+	IGR	DEL	TG	-	-	rs11757088	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25948458_25948459delTG								SLC17A2 (17619 upstream) : TRIM38 (14612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27410560	27410561	+	IGR	INS	-	GAAAGGAA	GAAAGGAA			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27410560_27410561insGAAAGGAA								ZNF391 (41333 upstream) : ZNF184 (7961 downstream)																																			---	---	---	---
TRIM39	56658	broad.mit.edu	37	6	30302084	30302085	+	Intron	INS	-	TTCT	TTCT	rs149883294	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30302084_30302085insTTCT	uc010jrz.2	+						TRIM39_uc003npz.2_Intron|TRIM39_uc003nqb.2_Intron|TRIM39_uc003nqc.2_Intron|TRIM39_uc010jsa.1_Intron	NM_021253	NP_067076			tripartite motif-containing 39 isoform 1						apoptosis	cytosol|mitochondrion	identical protein binding|zinc ion binding			ovary(3)	3																		---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31275455	31275456	+	Intron	INS	-	AGG	AGG	rs147714295	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31275455_31275456insAGG	uc003ntf.2	-						HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron					SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
C6orf10	10665	broad.mit.edu	37	6	32295576	32295576	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32295576delT	uc011dpy.1	-							NM_006781	NP_006772			chromosome 6 open reading frame 10							integral to membrane				skin(1)	1																		---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32516417	32516418	+	Intron	INS	-	G	G	rs149288376	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32516417_32516418insG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32543838	32543838	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32543838delA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	34124736	34124749	+	IGR	DEL	CCTTCACCTGGGTG	-	-	rs71677484		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34124736_34124749delCCTTCACCTGGGTG								GRM4 (10867 upstream) : HMGA1 (79828 downstream)																																			---	---	---	---
PNPLA1	285848	broad.mit.edu	37	6	36265642	36265643	+	Intron	INS	-	ACAC	ACAC	rs138743503		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36265642_36265643insACAC	uc010jwf.2	+						PNPLA1_uc003olw.1_Intron|PNPLA1_uc010jwe.1_Intron	NM_001145717	NP_001139189			patatin-like phospholipase domain containing 1						lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4																		---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38370885	38370886	+	Intron	INS	-	AAGGAAAGAA	AAGGAAAGAA	rs142073451	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38370885_38370886insAAGGAAAGAA	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	41592387	41592387	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41592387delT								FOXP4 (22266 upstream) : MDFI (12543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	42496008	42496008	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42496008delA								TRERF1 (76143 upstream) : UBR2 (36050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	44478875	44478875	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44478875delG								CDC5L (64096 upstream) : SUPT3H (298179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	44495662	44495663	+	IGR	INS	-	A	A	rs140359755	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44495662_44495663insA								CDC5L (80883 upstream) : SUPT3H (281391 downstream)																																			---	---	---	---
SUPT3H	8464	broad.mit.edu	37	6	45051439	45051439	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45051439delA	uc003oxo.2	-						SUPT3H_uc003oxn.1_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|SUPT3H_uc011dvw.1_Intron	NM_181356	NP_852001			suppressor of Ty 3 homolog isoform 2						histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3																		---	---	---	---
CYP39A1	51302	broad.mit.edu	37	6	46581411	46581411	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46581411delA	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677			cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	47183248	47183248	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47183248delT								GPR110 (173166 upstream) : TNFRSF21 (16021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49321409	49321410	+	IGR	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49321409_49321410delAA								None (None upstream) : MUT (77584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50880256	50880257	+	IGR	INS	-	G	G	rs139906809		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50880256_50880257insG								TFAP2B (64931 upstream) : PKHD1 (599888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51113453	51113453	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51113453delG								TFAP2B (298128 upstream) : PKHD1 (366692 downstream)																																			---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51669756	51669757	+	Intron	INS	-	A	A	rs141901115	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51669756_51669757insA	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51854699	51854700	+	Intron	INS	-	A	A	rs144773405	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51854699_51854700insA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	53316878	53316878	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53316878delT								ELOVL5 (102936 upstream) : GCLC (45262 downstream)																																			---	---	---	---
LRRC1	55227	broad.mit.edu	37	6	53784268	53784269	+	Intron	INS	-	T	T	rs142498215		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53784268_53784269insT	uc003pcd.1	+							NM_018214	NP_060684			leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---
C6orf142	90523	broad.mit.edu	37	6	53955492	53955493	+	Intron	DEL	AA	-	-	rs148755535	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53955492_53955493delAA	uc003pcg.3	+						C6orf142_uc003pcf.2_Intron|C6orf142_uc003pch.3_Intron	NM_138569	NP_612636			hypothetical protein LOC90523							nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	54507914	54507914	+	IGR	DEL	T	-	-	rs35893137		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54507914delT								TINAG (252964 upstream) : FAM83B (203655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	55758988	55758989	+	IGR	INS	-	T	T	rs34793812		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55758988_55758989insT								BMP5 (18613 upstream) : COL21A1 (162400 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57291450	57291451	+	Intron	INS	-	CTCA	CTCA	rs147993020	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57291450_57291451insCTCA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57301626	57301626	+	Intron	DEL	G	-	-	rs5010466	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57301626delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57406989	57406989	+	Intron	DEL	G	-	-	rs63038463		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57406989delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57411440	57411441	+	Intron	INS	-	A	A	rs11391617		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57411440_57411441insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57486246	57486246	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57486246delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57547561	57547561	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57547561delC								PRIM2 (34186 upstream) : GUSBL2 (698598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57564640	57564641	+	IGR	INS	-	A	A	rs142934734		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564640_57564641insA								PRIM2 (51265 upstream) : GUSBL2 (681518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57960013	57960013	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57960013delA								PRIM2 (446638 upstream) : GUSBL2 (286146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	62195705	62195706	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62195705_62195706insT								None (None upstream) : KHDRBS2 (194159 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62648167	62648169	+	Intron	DEL	ACA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62648167_62648169delACA	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62896519	62896520	+	Intron	INS	-	A	A	rs147113899	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62896519_62896520insA	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	63097855	63097856	+	IGR	DEL	GT	-	-	rs150780168	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63097855_63097856delGT								KHDRBS2 (101755 upstream) : LGSN (888001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63226946	63226946	+	IGR	DEL	T	-	-	rs71795978		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63226946delT								KHDRBS2 (230846 upstream) : LGSN (758911 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64944152	64944152	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64944152delT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	69091780	69091781	+	IGR	INS	-	T	T	rs138783854	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69091780_69091781insT								None (None upstream) : BAI3 (253851 downstream)																																			---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75840088	75840088	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75840088delT	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	77549417	77549417	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77549417delA								IMPG1 (767082 upstream) : HTR1B (622531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78481394	78481394	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78481394delA								HTR1B (308274 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78815516	78815517	+	IGR	DEL	AG	-	-	rs71546096		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78815516_78815517delAG								HTR1B (642396 upstream) : IRAK1BP1 (761672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82825553	82825553	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82825553delC								FAM46A (363125 upstream) : IBTK (54403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	86366569	86366569	+	IGR	DEL	A	-	-	rs71551494		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86366569delA								SYNCRIP (13526 upstream) : SNHG5 (20157 downstream)																																			---	---	---	---
RNGTT	8732	broad.mit.edu	37	6	89323505	89323505	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89323505delA	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron	NM_003800	NP_003791			RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	106198657	106198657	+	IGR	DEL	G	-	-	rs67741550		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106198657delG								PREP (347688 upstream) : PRDM1 (335538 downstream)																																			---	---	---	---
PPIL6	285755	broad.mit.edu	37	6	109714425	109714425	+	Intron	DEL	T	-	-	rs68007009		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109714425delT	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943			peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	110833832	110833834	+	IGR	DEL	AAG	-	-	rs71562234		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110833832_110833834delAAG								SLC22A16 (35988 upstream) : CDK19 (97347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	126710805	126710806	+	Intron	DEL	TG	-	-	rs71691748		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126710805_126710806delTG	uc003qaq.1	-						CENPW_uc003qap.3_Intron					Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128844417	128844417	+	5'Flank	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128844417delG	uc003qbk.2	-						PTPRK_uc003qbj.2_5'Flank|PTPRK_uc010kfc.2_5'Flank|PTPRK_uc011ebu.1_5'Flank|PTPRK_uc011ebv.1_5'Flank|PTPRK_uc003qbm.3_5'Flank	NM_002844	NP_002835			protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
ARHGAP18	93663	broad.mit.edu	37	6	130011269	130011270	+	Intron	INS	-	GT	GT	rs142057840	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130011269_130011270insGT	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050			Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)														---	---	---	---
TMEM200A	114801	broad.mit.edu	37	6	130730007	130730008	+	Intron	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130730007_130730008insC	uc003qca.2	+						TMEM200A_uc010kfh.2_Intron	NM_052913	NP_443145			transmembrane protein 200A							integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130813266	130813266	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130813266delT								TMEM200A (49058 upstream) : LOC285733 (335058 downstream)																																			---	---	---	---
ALDH8A1	64577	broad.mit.edu	37	6	135247651	135247651	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135247651delA	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090			aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	137435410	137435410	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137435410delA								IL20RA (69112 upstream) : IL22RA2 (29548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	137679069	137679069	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137679069delC								IFNGR1 (138502 upstream) : OLIG3 (134267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138153833	138153833	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138153833delT	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																														---	---	---	---
TNFAIP3	7128	broad.mit.edu	37	6	138190514	138190517	+	Intron	DEL	GGAC	-	-	rs71009567		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138190514_138190517delGGAC	uc003qhr.2	+						uc003qhq.1_5'Flank|TNFAIP3_uc003qhs.2_Intron	NM_006290	NP_006281			tumor necrosis factor, alpha-induced protein 3						anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)				D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								---	---	---	---
Unknown	0	broad.mit.edu	37	6	138297765	138297765	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138297765delC								TNFAIP3 (93320 upstream) : PERP (111877 downstream)																																			---	---	---	---
NHSL1	57224	broad.mit.edu	37	6	138791066	138791066	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138791066delG	uc003qhx.2	-						NHSL1_uc011edp.1_Intron|NHSL1_uc003qhy.2_Intron	NM_020464	NP_065197			NHS-like 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	148617263	148617264	+	IGR	INS	-	TTG	TTG	rs141110755	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148617263_148617264insTTG								SAMD5 (726106 upstream) : SASH1 (46465 downstream)																																			---	---	---	---
RGS17	26575	broad.mit.edu	37	6	153380664	153380664	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153380664delG	uc003qpm.2	-							NM_012419	NP_036551			regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)										Lung_Cancer_Familial_Clustering_of				---	---	---	---
LPAL2	80350	broad.mit.edu	37	6	160908671	160908671	+	Intron	DEL	T	-	-	rs67496857		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160908671delT	uc003qtj.2	-						LPAL2_uc011efy.1_Intron	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	163750378	163750379	+	IGR	INS	-	G	G	rs145729964	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163750378_163750379insG								LOC285796 (4884 upstream) : QKI (85296 downstream)																																			---	---	---	---
QKI	9444	broad.mit.edu	37	6	163852098	163852098	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163852098delA	uc003qui.2	+						QKI_uc003que.2_Intron|QKI_uc003quf.2_Intron|QKI_uc003qug.2_Intron|QKI_uc003quh.2_Intron|QKI_uc003quj.2_Intron	NM_006775	NP_006766			quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	165557243	165557244	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165557243_165557244insT								None (None upstream) : C6orf118 (135911 downstream)																																			---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	167268918	167268920	+	Intron	DEL	GAA	-	-	rs13215333		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167268918_167268920delGAA	uc003qvd.1	-						RPS6KA2_uc003qvc.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168319289	168319290	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168319289_168319290delTG	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
EIF3B	8662	broad.mit.edu	37	7	2403105	2403106	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2403105_2403106insA	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003slz.1_Intron|EIF3B_uc003sma.2_Intron	NM_003751	NP_003742			eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3410917	3410917	+	Intron	DEL	G	-	-	rs35285638		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3410917delG	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	6328215	6328218	+	IGR	DEL	TCCT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6328215_6328218delTCCT								CYTH3 (15973 upstream) : C7orf70 (40823 downstream)																																			---	---	---	---
DAGLB	221955	broad.mit.edu	37	7	6511016	6511016	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6511016delG	uc003sqd.3	-						KDELR2_uc003sqe.3_Intron|KDELR2_uc003sqf.3_Intron	NM_139179	NP_631918			diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	10462410	10462410	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10462410delA								PER4 (786963 upstream) : NDUFA4 (510405 downstream)																																			---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11122914	11122914	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11122914delC	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	14152910	14152910	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14152910delG								ETV1 (121860 upstream) : DGKB (31765 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14514252	14514255	+	Intron	DEL	AATA	-	-	rs35488258		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14514252_14514255delAATA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	16861319	16861319	+	IGR	DEL	T	-	-	rs5882582		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16861319delT								AGR2 (16581 upstream) : AGR3 (37712 downstream)																																			---	---	---	---
SNX13	23161	broad.mit.edu	37	7	17959833	17959833	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17959833delA	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron|SNX13_uc003stx.1_Intron|SNX13_uc003sty.2_Intron					SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)																	---	---	---	---
ITGB8	3696	broad.mit.edu	37	7	20380307	20380307	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20380307delT	uc003suu.2	+						ITGB8_uc011jyh.1_Intron|ITGB8_uc003sut.2_Intron	NM_002214	NP_002205			integrin, beta 8 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	27294033	27294034	+	IGR	INS	-	T	T	rs144279337		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27294033_27294034insT								EVX1 (7841 upstream) : HIBADH (271029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	28264832	28264833	+	Intron	INS	-	AC	AC	rs147393971	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28264832_28264833insAC	uc011jzq.1	+											SubName: Full=cDNA FLJ59585;																														---	---	---	---
SCRN1	9805	broad.mit.edu	37	7	29976506	29976507	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29976506_29976507insA	uc010kvp.2	-						SCRN1_uc011jzy.1_Intron|SCRN1_uc003tak.2_Intron|SCRN1_uc011jzz.1_Intron|SCRN1_uc011kaa.1_Intron|SCRN1_uc011jzw.1_Intron|SCRN1_uc011jzx.1_Intron	NM_001145515	NP_001138987			secernin 1 isoform c						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	30563339	30563339	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30563339delA	uc003tbd.2	-											Homo sapiens full length insert cDNA clone ZC66C07.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	31479686	31479686	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31479686delG								NEUROD6 (99148 upstream) : CCDC129 (73999 downstream)																																			---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33468997	33468997	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33468997delT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Intron|BBS9_uc003tds.1_Intron|BBS9_uc003tdt.2_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
BMPER	168667	broad.mit.edu	37	7	33989213	33989214	+	Intron	INS	-	T	T	rs112376084		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33989213_33989214insT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
AAA1	404744	broad.mit.edu	37	7	34430864	34430865	+	Intron	INS	-	CTTTCTTT	CTTTCTTT	rs35340451		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34430864_34430865insCTTTCTTT	uc010kwo.1	-						AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron					Homo sapiens AAA1 variant IA mRNA, complete cds; alternatively spliced.												0																		---	---	---	---
TBX20	57057	broad.mit.edu	37	7	35245146	35245146	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35245146delA	uc011kas.1	-							NM_001077653	NP_001071121			T-box transcription factor TBX20							nucleus	DNA binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	35624378	35624385	+	IGR	DEL	AAGAAAGA	-	-	rs71739701	by1000genomes;by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35624378_35624385delAAGAAAGA								TBX20 (331136 upstream) : HERPUD2 (47887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36147582	36147585	+	IGR	DEL	ACAG	-	-	rs138692905		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36147582_36147585delACAG								SEPT7 (202667 upstream) : EEPD1 (45251 downstream)																																			---	---	---	---
AOAH	313	broad.mit.edu	37	7	36561286	36561286	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36561286delT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628			acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1																		---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37887565	37887573	+	5'Flank	DEL	GAGGAGGAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37887565_37887573delGAGGAGGAA	uc003tfn.2	+							NM_016616	NP_057700			thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	38051199	38051203	+	IGR	DEL	AGAAG	-	-	rs67804827		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38051199_38051203delAGAAG								EPDR1 (59660 upstream) : STARD3NL (166730 downstream)																																			---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38945953	38945954	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38945953_38945954insT	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211			vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43562597	43562600	+	Intron	DEL	TTGT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43562597_43562600delTTGT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|uc003tig.1_5'Flank	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
BLVRA	644	broad.mit.edu	37	7	43830026	43830027	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43830026_43830027delAC	uc003tir.2	+						BLVRA_uc010kxv.2_Intron	NM_000712	NP_000703			biliverdin reductase A precursor						heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
POLR2J4	84820	broad.mit.edu	37	7	44005656	44005656	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44005656delC	uc003tjd.2	-						POLR2J4_uc003tjc.2_Intron					Homo sapiens cDNA FLJ58900 complete cds, weakly similar to Uroplakin-3B precursor.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	46466756	46466757	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46466756_46466757insA								IGFBP3 (505885 upstream) : TNS3 (847996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48824781	48824786	+	IGR	DEL	TATCTA	-	-	rs71713963		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48824781_48824786delTATCTA								ABCA13 (137690 upstream) : CDC14C (139371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49605468	49605468	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49605468delA								CDC14C (638419 upstream) : VWC2 (207789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51441016	51441017	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51441016_51441017insA								COBL (56501 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52016050	52016050	+	IGR	DEL	C	-	-	rs6963466	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52016050delC								COBL (631535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53483323	53483324	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53483323_53483324delCA								POM121L12 (378706 upstream) : HPVC1 (785593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56984785	56984785	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56984785delA								DKFZp434L192 (419808 upstream) : ZNF479 (202543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57717759	57717759	+	IGR	DEL	A	-	-	rs111548755		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57717759delA								ZNF716 (184494 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57977439	57977439	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57977439delG								ZNF716 (444174 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58041777	58041777	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58041777delT								ZNF716 (508512 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61513863	61513864	+	IGR	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61513863_61513864delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61755271	61755272	+	IGR	INS	-	G	G	rs150943146		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61755271_61755272insG								None (None upstream) : LOC643955 (996400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61761545	61761545	+	IGR	DEL	T	-	-	rs113286717		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61761545delT								None (None upstream) : LOC643955 (990127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64954146	64954148	+	IGR	DEL	GAG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64954146_64954148delGAG								ZNF92 (88149 upstream) : INTS4L2 (158629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68623284	68623285	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68623284_68623285insT								None (None upstream) : AUTS2 (440620 downstream)																																			---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71498238	71498238	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71498238delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	71954541	71954542	+	IGR	INS	-	A	A	rs140065753	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71954541_71954542insA								CALN1 (42405 upstream) : TYW1B (69187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	72010141	72010144	+	IGR	DEL	AAGA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72010141_72010144delAAGA								CALN1 (98005 upstream) : TYW1B (13585 downstream)																																			---	---	---	---
GTF2IRD1	9569	broad.mit.edu	37	7	74004032	74004033	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74004032_74004033insA	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412			GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4																		---	---	---	---
CCL26	10344	broad.mit.edu	37	7	75419475	75419476	+	5'Flank	INS	-	CCTT	CCTT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419475_75419476insCCTT	uc003udt.1	-							NM_006072	NP_006063			chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0																		---	---	---	---
CCL26	10344	broad.mit.edu	37	7	75419536	75419537	+	5'Flank	INS	-	CTTC	CTTC	rs11277771		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419536_75419537insCTTC	uc003udt.1	-							NM_006072	NP_006063			chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0																		---	---	---	---
PMS2L11	441263	broad.mit.edu	37	7	76627268	76627270	+	Intron	DEL	GTG	-	-	rs149196473	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76627268_76627270delGTG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
RSBN1L	222194	broad.mit.edu	37	7	77363810	77363811	+	Intron	DEL	TT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77363810_77363811delTT	uc010ldt.1	+						RSBN1L_uc003ugm.2_Intron	NM_198467	NP_940869			round spermatid basic protein 1-like							nucleus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	81134804	81134804	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81134804delC								SEMA3C (583129 upstream) : HGF (196641 downstream)																																			---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81931727	81931728	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81931727_81931728insT	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
SEMA3E	9723	broad.mit.edu	37	7	83214454	83214454	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83214454delG	uc003uhy.1	-							NM_012431	NP_036563			semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	85394627	85394628	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85394627_85394628insA								SEMA3D (578456 upstream) : GRM3 (878602 downstream)																																			---	---	---	---
STEAP4	79689	broad.mit.edu	37	7	87935098	87935099	+	Intron	INS	-	TAGA	TAGA	rs143157615	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87935098_87935099insTAGA	uc003ujs.2	-						STEAP4_uc010lek.2_Intron|STEAP4_uc003ujt.2_Intron	NM_024636	NP_078912			tumor necrosis factor, alpha-induced protein 9						fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	90075990	90075993	+	IGR	DEL	TCTT	-	-	rs66462972		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90075990_90075993delTCTT								CLDN12 (30724 upstream) : CDK14 (19745 downstream)																																			---	---	---	---
ASB4	51666	broad.mit.edu	37	7	95146914	95146914	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95146914delA	uc011kij.1	+						ASB4_uc003unx.2_Intron	NM_016116	NP_057200			ankyrin repeat and SOCS box-containing protein 4						intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)															---	---	---	---
SLC25A13	10165	broad.mit.edu	37	7	95810428	95810428	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95810428delA	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066			solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	96934788	96934788	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96934788delA								ACN9 (123715 upstream) : TAC1 (426483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	99538312	99538313	+	IGR	INS	-	A	A	rs35614445		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99538312_99538313insA								GJC3 (11069 upstream) : AZGP1 (26039 downstream)																																			---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101175058	101175058	+	Intron	DEL	T	-	-	rs113708597		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101175058delT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	101414117	101414117	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101414117delT								MYL10 (141541 upstream) : CUX1 (45175 downstream)																																			---	---	---	---
PRKRIP1	79706	broad.mit.edu	37	7	102038655	102038655	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102038655delA	uc003uzh.2	+						PRKRIP1_uc003uzf.2_Intron|PRKRIP1_uc003uzg.2_Intron|PRKRIP1_uc011kkq.1_Intron|PRKRIP1_uc011kkr.1_Intron	NM_024653	NP_078929			PRKR interacting protein 1 (IL11 inducible)							nucleolus				ovary(1)	1																		---	---	---	---
RASA4	10156	broad.mit.edu	37	7	102331240	102331241	+	Intron	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102331240_102331241insC	uc011kld.1	-											Homo sapiens mRNA for KIAA0538 protein, partial cds.						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103487316	103487317	+	Intron	INS	-	GAT	GAT	rs140173501	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103487316_103487317insGAT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104292531	104292531	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104292531delT	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104310145	104310146	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104310145_104310146insT	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
CBLL1	79872	broad.mit.edu	37	7	107392891	107392892	+	Intron	INS	-	TG	TG	rs138759049	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107392891_107392892insTG	uc003veq.2	+						CBLL1_uc011kme.1_Intron|CBLL1_uc011kmf.1_Intron	NM_024814	NP_079090			Cas-Br-M (murine) ecotropic retroviral						cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	110393807	110393808	+	Intron	DEL	GG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110393807_110393808delGG	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	110591595	110591596	+	Intron	DEL	GT	-	-	rs34436953		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110591595_110591596delGT	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	114227276	114227276	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114227276delT	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	115314988	115314991	+	IGR	DEL	TGTG	-	-	rs71898535		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115314988_115314991delTGTG								MDFIC (655725 upstream) : TFEC (260211 downstream)																																			---	---	---	---
TES	26136	broad.mit.edu	37	7	115850185	115850188	+	5'Flank	DEL	TCTC	-	-	rs143397873		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115850185_115850188delTCTC	uc003vho.2	+						TES_uc011kmx.1_5'Flank|TES_uc011kmy.1_5'Flank|uc003vhn.1_RNA	NM_015641	NP_056456			testin isoform 1						negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)													OREG0003441	type=REGULATORY REGION|Gene=TES|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
CAV1	857	broad.mit.edu	37	7	116057919	116057920	+	Intron	DEL	AC	-	-	rs72015675		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116057919_116057920delAC	uc010lkd.1	+						CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_Intron|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_Intron|CAV2_uc003via.2_Intron|CAV1_uc010lke.1_Intron	NM_001753	NP_001744			caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	116590324	116590335	+	IGR	DEL	CTCCTTCCTTCA	-	-	rs148256377		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116590324_116590335delCTCCTTCCTTCA								CAPZA2 (31012 upstream) : ST7OT1 (2168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121835691	121835698	+	IGR	DEL	AAAGGAAC	-	-	rs11279754	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121835691_121835698delAAAGGAAC								AASS (51347 upstream) : FEZF1 (105751 downstream)																																			---	---	---	---
SND1	27044	broad.mit.edu	37	7	127458945	127458945	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127458945delT	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129650644	129650644	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129650644delT								UBE2H (57855 upstream) : ZC3HC1 (7483 downstream)																																	OREG0018311	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	7	129975110	129975110	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129975110delA								CPA4 (11091 upstream) : CPA5 (9520 downstream)																																			---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130326044	130326045	+	Intron	INS	-	A	A	rs34617870		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130326044_130326045insA	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	136426402	136426403	+	IGR	DEL	AC	-	-	rs35899596		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136426402_136426403delAC								LUZP6 (764198 upstream) : CHRM2 (126996 downstream)																																			---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137167437	137167437	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137167437delT	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
UBN2	254048	broad.mit.edu	37	7	138965339	138965339	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138965339delT	uc011kqr.1	+							NM_173569	NP_775840			ubinuclein 2											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	140128479	140128479	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140128479delG								RAB19 (2429 upstream) : MKRN1 (24361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	141559034	141559035	+	IGR	INS	-	T	T	rs140478683	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141559034_141559035insT								PRSS37 (17749 upstream) : OR9A4 (59641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142199784	142199785	+	Intron	INS	-	A	A	rs35705395		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142199784_142199785insA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011ksb.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	142890925	142890925	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142890925delC								TAS2R39 (9398 upstream) : TAS2R40 (28247 downstream)																																			---	---	---	---
FAM115A	9747	broad.mit.edu	37	7	143602084	143602085	+	5'Flank	DEL	TG	-	-	rs34079754		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143602084_143602085delTG	uc003wdo.1	-						FAM115A_uc003wdp.1_5'Flank	NM_014719	NP_055534			hypothetical protein LOC9747												0	Melanoma(164;0.0903)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	144848636	144848637	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144848636_144848637delTC								TPK1 (315490 upstream) : CNTNAP2 (964816 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	145939629	145939630	+	Intron	INS	-	A	A	rs75094030		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145939629_145939630insA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146162227	146162228	+	Intron	DEL	CA	-	-	rs71525953		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146162227_146162228delCA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146718913	146718913	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146718913delA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	152856631	152856631	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152856631delC								ACTR3B (304168 upstream) : DPP6 (727788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	154951743	154951744	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154951743_154951744delAC								HTR5A (74284 upstream) : INSIG1 (137742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155727564	155727566	+	IGR	DEL	TCC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155727564_155727566delTCC								SHH (122597 upstream) : C7orf4 (605619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2206105	2206106	+	IGR	INS	-	T	T	rs149024644		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2206105_2206106insT								MYOM2 (112726 upstream) : CSMD1 (586770 downstream)																																			---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10281441	10281444	+	Intron	DEL	ATTA	-	-	rs77523487		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10281441_10281444delATTA	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	11431559	11431560	+	IGR	DEL	AC	-	-	rs150791488		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11431559_11431560delAC								BLK (9452 upstream) : GATA4 (102908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11494920	11494935	+	IGR	DEL	GTGTGTGTATGTGAGG	-	-	rs55998074		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11494920_11494935delGTGTGTGTATGTGAGG								BLK (72813 upstream) : GATA4 (39533 downstream)																																			---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13014436	13014436	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13014436delT	uc003wwm.2	-						DLC1_uc003wwl.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	19106002	19106002	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19106002delT								PSD3 (234806 upstream) : SH2D4A (65205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21123817	21123818	+	IGR	DEL	CA	-	-	rs111718311		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21123817_21123818delCA								None (None upstream) : GFRA2 (425712 downstream)																																			---	---	---	---
GFRA2	2675	broad.mit.edu	37	8	21594881	21594881	+	Intron	DEL	A	-	-	rs79713947		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21594881delA	uc003wzu.1	-						GFRA2_uc003wzv.1_Intron|GFRA2_uc003wzw.1_Intron|DOK2_uc003wzx.1_Intron	NM_001495	NP_001486			GDNF family receptor alpha 2 isoform a							anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity				0				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)														---	---	---	---
GFRA2	2675	broad.mit.edu	37	8	21605636	21605636	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21605636delT	uc003wzu.1	-						GFRA2_uc003wzv.1_Intron|GFRA2_uc003wzw.1_Intron|DOK2_uc003wzx.1_Intron	NM_001495	NP_001486			GDNF family receptor alpha 2 isoform a							anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity				0				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)														---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	29093388	29093388	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29093388delC	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron|KIF13B_uc003xhk.2_Intron	NM_015254	NP_056069			kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29488147	29488147	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29488147delC								DUSP4 (279962 upstream) : C8orf75 (90631 downstream)																																			---	---	---	---
MAK16	84549	broad.mit.edu	37	8	33354873	33354873	+	Intron	DEL	C	-	-	rs68152666		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33354873delC	uc003xjj.2	+						C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898			MAK16 homolog							nucleolus				ovary(1)	1																		---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35632445	35632445	+	Intron	DEL	A	-	-	rs71994799		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35632445delA	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron|UNC5D_uc003xju.1_Intron	NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
ADAM5P	255926	broad.mit.edu	37	8	39210723	39210724	+	Intron	INS	-	A	A	rs146238973	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39210723_39210724insA	uc003xmx.1	+						ADAM5P_uc003xmy.1_Intron|ADAM5P_uc003xmz.1_Intron|ADAM5P_uc010lwt.1_Intron|ADAM5P_uc003xna.2_Intron|ADAM5P_uc003xnb.2_Intron|ADAM5P_uc003xnc.2_Intron	NR_001448				Homo sapiens mRNA for tMDC II, isoform [a].												0																		---	---	---	---
ANK1	286	broad.mit.edu	37	8	41641136	41641141	+	Intron	DEL	GAGACT	-	-	rs68174435		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41641136_41641141delGAGACT	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209			ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)															---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48871297	48871297	+	Intron	DEL	T	-	-	rs35991452		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48871297delT	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron|MCM4_uc003xqk.1_5'Flank|MCM4_uc003xql.1_5'Flank|MCM4_uc011ldi.1_5'Flank|MCM4_uc010lxw.1_5'Flank	NM_006904	NP_008835			protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
Unknown	0	broad.mit.edu	37	8	53334137	53334137	+	IGR	DEL	T	-	-	rs11301368		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53334137delT								ST18 (11698 upstream) : FAM150A (112461 downstream)																																			---	---	---	---
NSMAF	8439	broad.mit.edu	37	8	59500894	59500894	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59500894delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron	NM_003580	NP_003571			neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)																---	---	---	---
TOX	9760	broad.mit.edu	37	8	59867920	59867922	+	Intron	DEL	AAG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59867920_59867922delAAG	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	60908277	60908277	+	IGR	DEL	T	-	-	rs143412611	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60908277delT								TOX (876510 upstream) : CA8 (193146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61070371	61070372	+	IGR	INS	-	A	A	rs140976909	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61070371_61070372insA								None (None upstream) : CA8 (31051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61272187	61272187	+	IGR	DEL	A	-	-	rs36021757		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61272187delA								CA8 (78233 upstream) : RAB2A (157372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61970191	61970191	+	IGR	DEL	A	-	-	rs77533377		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61970191delA								CHD7 (190728 upstream) : CLVS1 (230334 downstream)																																			---	---	---	---
CLVS1	157807	broad.mit.edu	37	8	62255492	62255492	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62255492delG	uc003xuh.2	+						CLVS1_uc003xug.2_Intron|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Intron	NM_173519	NP_775790			retinaldehyde binding protein 1-like 1						lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69030590	69030591	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69030590_69030591insA	uc003xxv.1	+							NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73840917	73840920	+	Intron	DEL	ACAC	-	-	rs71566831		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73840917_73840920delACAC	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	74683513	74683516	+	IGR	DEL	ATAT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74683513_74683516delATAT								STAU2 (23570 upstream) : UBE2W (8816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75524309	75524310	+	Intron	INS	-	A	A	rs142746022	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75524309_75524310insA	uc003yaj.1	+											Homo sapiens cDNA FLJ39080 fis, clone NT2RP7018197.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	80796047	80796050	+	IGR	DEL	TCTC	-	-	rs67217941	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80796047_80796050delTCTC								HEY1 (115949 upstream) : MRPS28 (35046 downstream)																																			---	---	---	---
TPD52	7163	broad.mit.edu	37	8	81064410	81064410	+	Intron	DEL	C	-	-	rs35354946		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81064410delC	uc003ybs.1	-						TPD52_uc010lzs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025253	NP_001020424			tumor protein D52 isoform 2						anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	81170257	81170257	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81170257delC								TPD52 (86421 upstream) : ZBTB10 (227597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81490863	81490877	+	IGR	DEL	CCCCTTCTCCCTGCT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81490863_81490877delCCCCTTCTCCCTGCT								ZBTB10 (56255 upstream) : ZNF704 (59892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81508156	81508156	+	IGR	DEL	T	-	-	rs112489078		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81508156delT								ZBTB10 (73548 upstream) : ZNF704 (42613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83130376	83130376	+	IGR	DEL	T	-	-	rs34051699		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83130376delT								SNX16 (375855 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83616087	83616088	+	IGR	INS	-	TG	TG	rs150170594	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83616087_83616088insTG								SNX16 (861566 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84830203	84830204	+	IGR	INS	-	A	A	rs144409100	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84830203_84830204insA								None (None upstream) : RALYL (265249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84895519	84895519	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84895519delA								None (None upstream) : RALYL (199934 downstream)																																			---	---	---	---
CA1	759	broad.mit.edu	37	8	86250862	86250889	+	Intron	DEL	TTTCTTTCTTTCTTTCTTTCTTTCTTTC	-	-	rs56255763	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86250862_86250889delTTTCTTTCTTTCTTTCTTTCTTTCTTTC	uc003ydh.2	-						CA13_uc003ydf.1_Intron|CA1_uc010mae.1_Intron|CA1_uc003ydi.2_Intron	NM_001738	NP_001729			carbonic anhydrase I						one-carbon metabolic process	Golgi apparatus	carbonate dehydratase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dichlorphenamide(DB01144)|Ethinamate(DB01031)|Ethoxzolamide(DB00311)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Levetiracetam(DB01202)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Verapamil(DB00661)|Zonisamide(DB00909)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	87103992	87103995	+	IGR	DEL	GGAA	-	-	rs72136292		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87103992_87103995delGGAA								PSKH2 (22141 upstream) : ATP6V0D2 (7144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	87330650	87330651	+	IGR	INS	-	A	A	rs149448081	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87330650_87330651insA								SLC7A13 (88041 upstream) : WWP1 (24343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92106476	92106476	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92106476delG								OTUD6B (7154 upstream) : LRRC69 (8371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92781716	92781716	+	IGR	DEL	T	-	-	rs67635409		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92781716delT								SLC26A7 (371336 upstream) : RUNX1T1 (189436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94470802	94470803	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94470802_94470803delCA								C8orf83 (440901 upstream) : FAM92A1 (241970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	98472566	98472566	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98472566delA								TSPYL5 (182390 upstream) : MTDH (183841 downstream)																																			---	---	---	---
MATN2	4147	broad.mit.edu	37	8	98902122	98902123	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98902122_98902123delAC	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron	NM_002380	NP_002371			matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)															---	---	---	---
STK3	6788	broad.mit.edu	37	8	99642896	99642898	+	Intron	DEL	AGG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99642896_99642898delAGG	uc003yip.2	-						STK3_uc003yio.2_Intron|STK3_uc010mbm.1_Intron	NM_006281	NP_006272			serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)														---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100642973	100642973	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100642973delA	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100815002	100815002	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100815002delT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	101854459	101854460	+	IGR	DEL	GT	-	-	rs112961275		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101854459_101854460delGT								PABPC1 (120144 upstream) : YWHAZ (76344 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102762451	102762451	+	Intron	DEL	C	-	-	rs5893583		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102762451delC	uc003yke.2	-						NCALD_uc003ykf.2_Intron|NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_032041	NP_114430			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
NCALD	83988	broad.mit.edu	37	8	103044534	103044535	+	Intron	INS	-	GG	GG			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103044534_103044535insGG	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103434563	103434565	+	IGR	DEL	AAG	-	-	rs77287590		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103434563_103434565delAAG								UBR5 (10068 upstream) : ODF1 (129283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	103595903	103595904	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103595903_103595904delCT								ODF1 (22658 upstream) : KLF10 (65101 downstream)																																			---	---	---	---
AZIN1	51582	broad.mit.edu	37	8	103861871	103861872	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103861871_103861872insA	uc003ykx.2	-						AZIN1_uc003yky.2_Intron	NM_015878	NP_056962			ornithine decarboxylase antizyme inhibitor						polyamine biosynthetic process|regulation of cellular amino acid metabolic process	cytosol	catalytic activity|protein binding				0	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)															---	---	---	---
LRP12	29967	broad.mit.edu	37	8	105527714	105527714	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105527714delT	uc003yma.2	-						LRP12_uc003ymb.2_Intron|LRP12_uc003ymc.3_Intron	NM_013437	NP_038465			low density lipoprotein-related protein 12						endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	106924617	106924617	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106924617delA								ZFPM2 (107852 upstream) : OXR1 (357856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	107855276	107855277	+	IGR	DEL	TC	-	-	rs61122220		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107855276_107855277delTC								ABRA (72804 upstream) : ANGPT1 (406434 downstream)																																			---	---	---	---
EIF3E	3646	broad.mit.edu	37	8	109230412	109230413	+	Intron	DEL	TC	-	-	rs139994379		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109230412_109230413delTC	uc003ymu.2	-						EIF3E_uc003ymt.2_Intron|EIF3E_uc003ymv.2_Intron|EIF3E_uc010mci.1_Intron	NM_001568	NP_001559			eukaryotic translation initiation factor 3,						negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	110055203	110055206	+	IGR	DEL	TTTC	-	-	rs113929841		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110055203_110055206delTTTC								TMEM74 (255433 upstream) : TRHR (44533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110064866	110064866	+	IGR	DEL	A	-	-	rs34402246		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110064866delA								TMEM74 (265096 upstream) : TRHR (34873 downstream)																																			---	---	---	---
SYBU	55638	broad.mit.edu	37	8	110668345	110668345	+	Intron	DEL	A	-	-	rs34271632		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110668345delA	uc010mct.2	-						SYBU_uc010mcs.2_Intron|SYBU_uc010mcu.2_Intron|SYBU_uc003ynp.3_Intron|SYBU_uc010mcv.2_Intron	NM_001099745	NP_001093215			Golgi-localized syntaphilin-related protein							cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	110948437	110948440	+	IGR	DEL	AGGA	-	-	rs147604132	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110948437_110948440delAGGA								SYBU (244417 upstream) : KCNV1 (30795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111799444	111799445	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111799444_111799445delAC								KCNV1 (811368 upstream) : None (None downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113424591	113424593	+	Intron	DEL	GTG	-	-	rs148136851		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113424591_113424593delGTG	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114766009	114766009	+	IGR	DEL	A	-	-	rs78788946		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114766009delA								CSMD3 (316767 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115604325	115604325	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115604325delA								None (None upstream) : TRPS1 (816400 downstream)																																			---	---	---	---
EIF3H	8667	broad.mit.edu	37	8	117722194	117722194	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117722194delT	uc003yoa.2	-						EIF3H_uc003yob.2_Intron|EIF3H_uc011lhz.1_Intron	NM_003756	NP_003747			eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)																	---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118993947	118993947	+	Intron	DEL	A	-	-	rs71569753		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118993947delA	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119467508	119467509	+	Intron	DEL	CT	-	-	rs113092622		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119467508_119467509delCT	uc003yom.2	-						SAMD12_uc010mda.1_Intron|SAMD12_uc010mdb.1_Intron	NM_207506	NP_997389			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	121877257	121877258	+	IGR	INS	-	TGATGA	TGATGA	rs142535259	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121877257_121877258insTGATGA								SNTB1 (52948 upstream) : HAS2 (748013 downstream)																																			---	---	---	---
ZHX2	22882	broad.mit.edu	37	8	123941881	123941882	+	Intron	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123941881_123941882delAA	uc003ypk.1	+							NM_014943	NP_055758			zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
C8orf76	84933	broad.mit.edu	37	8	124236657	124236657	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124236657delG	uc003yqc.1	-							NM_032847	NP_116236			hypothetical protein LOC84933								binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	125272505	125272505	+	IGR	DEL	A	-	-	rs56280913		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125272505delA								FER1L6 (140204 upstream) : TMEM65 (50656 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125574169	125574170	+	Intron	INS	-	C	C	rs148862516	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125574169_125574170insC	uc003yrk.2	-						NDUFB9_uc011lim.1_Intron|MTSS1_uc011lin.1_Intron|MTSS1_uc011lio.1_Intron|MTSS1_uc003yri.2_Intron|MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125657068	125657069	+	Intron	INS	-	AGTA	AGTA	rs145352831	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125657068_125657069insAGTA	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	128235830	128235830	+	IGR	DEL	A	-	-	rs72537298		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128235830delA								FAM84B (665364 upstream) : LOC727677 (66232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128614993	128614994	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128614993_128614994insT								LOC727677 (120609 upstream) : MYC (132771 downstream)																																			---	---	---	---
MYC	4609	broad.mit.edu	37	8	128750457	128750458	+	Intron	INS	-	TTGA	TTGA			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128750457_128750458insTTGA	uc003ysh.1	+						MYC_uc003ysi.2_Intron	NM_002467	NP_002458			myc proto-oncogene protein						branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)			3	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PVT1	5820	broad.mit.edu	37	8	128832949	128832949	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128832949delT	uc003ysj.2	+						PVT1_uc010mdq.2_Intron|PVT1_uc010mdp.1_Intron					Human proto-oncogene myc mRNA, 5' end, clone DMmyc.												0																		---	---	---	---
PVT1	5820	broad.mit.edu	37	8	129012568	129012568	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129012568delA	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	129191386	129191387	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129191386_129191387delCA								MIR1208 (28952 upstream) : None (None downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131303976	131303976	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131303976delG	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
TG	7038	broad.mit.edu	37	8	134052224	134052225	+	Intron	DEL	AT	-	-	rs34759687		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134052224_134052225delAT	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc011ljd.1_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	134630643	134630644	+	IGR	DEL	AG	-	-	rs34018204		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134630643_134630644delAG								ST3GAL1 (46460 upstream) : ZFAT (859389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136065805	136065806	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136065805_136065806delAG								MIR30D (248617 upstream) : LOC286094 (180568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138703946	138703948	+	IGR	DEL	CTT	-	-	rs146175842		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138703946_138703948delCTT								None (None upstream) : FAM135B (438320 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140954926	140954926	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140954926delT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141276663	141276664	+	Intron	INS	-	AC	AC	rs149944422	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141276663_141276664insAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141935788	141935788	+	5'UTR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141935788delG	uc003yvu.2	-	2					PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_5'UTR	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142396827	142396827	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142396827delC								GPR20 (19462 upstream) : PTP4A3 (5294 downstream)																																	OREG0019030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	9	2986435	2986435	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2986435delT								KIAA0020 (142305 upstream) : RFX3 (238214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	6110293	6110293	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6110293delC								RANBP6 (94653 upstream) : IL33 (105514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	7914487	7914488	+	IGR	INS	-	C	C	rs149064935	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7914487_7914488insC								C9orf123 (114688 upstream) : PTPRD (399759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11892237	11892237	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11892237delT								None (None upstream) : TYRP1 (801149 downstream)																																			---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14803313	14803314	+	Intron	INS	-	TCCCCTCCCC	TCCCCTCCCC	rs141611687	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14803313_14803314insTCCCCTCCCC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18832393	18832393	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18832393delA	uc003zne.3	+						ADAMTSL1_uc003znf.3_Intron	NM_001040272	NP_001035362			ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18876299	18876300	+	Intron	INS	-	GT	GT	rs141814102	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18876299_18876300insGT	uc003zne.3	+						ADAMTSL1_uc003znf.3_Intron	NM_001040272	NP_001035362			ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	19975734	19975734	+	IGR	DEL	T	-	-	rs111493257		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19975734delT								SLC24A2 (186926 upstream) : MLLT3 (369234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26744192	26744192	+	IGR	DEL	A	-	-	rs35284952		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26744192delA								None (None upstream) : C9orf82 (96492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32117020	32117020	+	IGR	DEL	A	-	-	rs66675723		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32117020delA								None (None upstream) : ACO1 (267581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32718414	32718414	+	IGR	DEL	C	-	-	rs71504294		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32718414delC								TAF1L (82747 upstream) : TMEM215 (65083 downstream)																																			---	---	---	---
GLIPR2	152007	broad.mit.edu	37	9	36161516	36161516	+	Intron	DEL	C	-	-	rs12335862	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36161516delC	uc003zyz.2	+						GLIPR2_uc010mlf.1_Intron|GLIPR2_uc003zza.2_Intron|GLIPR2_uc003zyy.1_Intron	NM_022343	NP_071738			GLI pathogenesis-related 2							extracellular region|Golgi membrane				skin(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	36798123	36798124	+	IGR	INS	-	GA	GA	rs141540642	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36798123_36798124insGA								MELK (120445 upstream) : PAX5 (40407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	37387297	37387298	+	IGR	DEL	TC	-	-	rs57997068		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37387297_37387298delTC								ZCCHC7 (29154 upstream) : GRHPR (35383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	37387298	37387298	+	IGR	DEL	C	-	-	rs57997068		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37387298delC								ZCCHC7 (29155 upstream) : GRHPR (35383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	42994001	42994001	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:42994001delA								AQP7P3 (100866 upstream) : LOC642929 (146538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44984841	44984841	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44984841delG								None (None upstream) : FAM27C (5395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66254365	66254366	+	IGR	INS	-	T	T	rs150354878		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66254365_66254366insT								FAM74A4 (759979 upstream) : LOC442421 (242104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66524314	66524315	+	Intron	DEL	TT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66524314_66524315delTT	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66821802	66821802	+	IGR	DEL	A	-	-	rs139407349		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66821802delA								LOC442421 (318775 upstream) : AQP7P1 (432465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66840357	66840358	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66840357_66840358insT								LOC442421 (337330 upstream) : AQP7P1 (413909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	67899001	67899002	+	IGR	INS	-	A	A	rs141025418		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67899001_67899002insA								FAM27B (104812 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68330988	68330988	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68330988delT								FAM27B (536799 upstream) : MIR1299 (671251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68390793	68390794	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68390793_68390794delCT								FAM27B (596604 upstream) : MIR1299 (611445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68455615	68455616	+	IGR	INS	-	C	C	rs145310874		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455615_68455616insC								FAM27B (661426 upstream) : MIR1299 (546623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68480277	68480277	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68480277delA								FAM27B (686088 upstream) : MIR1299 (521962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	73127064	73127064	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73127064delT								KLF9 (97491 upstream) : TRPM3 (22904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74201547	74201556	+	IGR	DEL	TGTGTGTGTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74201547_74201556delTGTGTGTGTG								TRPM3 (139727 upstream) : TMEM2 (96726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74657673	74657674	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74657673_74657674insT								C9orf85 (58283 upstream) : C9orf57 (8624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74876590	74876591	+	IGR	INS	-	TCC	TCC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74876590_74876591insTCC								GDA (8113 upstream) : ZFAND5 (89750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74886513	74886513	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74886513delA								GDA (18036 upstream) : ZFAND5 (79828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	75131236	75131236	+	IGR	DEL	A	-	-	rs67078938		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75131236delA								ZFAND5 (151073 upstream) : TMC1 (5481 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78773156	78773156	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78773156delT	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	79146552	79146552	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79146552delC								GCNT1 (24222 upstream) : PRUNE2 (79741 downstream)																																			---	---	---	---
GNA14	9630	broad.mit.edu	37	9	80079268	80079269	+	Intron	DEL	TG	-	-	rs35743834		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80079268_80079269delTG	uc004aku.2	-							NM_004297	NP_004288			G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	82825449	82825450	+	IGR	INS	-	T	T	rs148044542	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82825449_82825450insT								TLE4 (483792 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83402008	83402008	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83402008delA								None (None upstream) : TLE1 (796592 downstream)																																			---	---	---	---
UBQLN1	29979	broad.mit.edu	37	9	86277985	86277986	+	Intron	INS	-	A	A	rs10642853		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86277985_86277986insA	uc004amv.2	-						UBQLN1_uc004amw.2_Intron	NM_013438	NP_038466			ubiquilin 1 isoform 1						apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0																		---	---	---	---
UBQLN1	29979	broad.mit.edu	37	9	86288254	86288254	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86288254delG	uc004amv.2	-						UBQLN1_uc004amw.2_Intron	NM_013438	NP_038466			ubiquilin 1 isoform 1						apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	87863393	87863398	+	IGR	DEL	TATGTG	-	-	rs34898546		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87863393_87863398delTATGTG								NTRK2 (224888 upstream) : AGTPBP1 (298057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	88039055	88039056	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88039055_88039056insC								NTRK2 (400550 upstream) : AGTPBP1 (122399 downstream)																																			---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90221608	90221611	+	Intron	DEL	TCCT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90221608_90221611delTCCT	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929			death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	9	90412036	90412037	+	IGR	INS	-	TTG	TTG	rs147014635	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90412036_90412037insTTG								CTSL3 (10237 upstream) : C9orf79 (85704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91488210	91488211	+	IGR	INS	-	AGAG	AGAG	rs142995395	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91488210_91488211insAGAG								LOC286238 (221135 upstream) : C9orf47 (117567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	92507527	92507527	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92507527delA								LOC100129066 (172853 upstream) : DIRAS2 (864587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93180735	93180736	+	IGR	INS	-	T	T	rs147307955	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93180735_93180736insT								LOC100129066 (846061 upstream) : DIRAS2 (191378 downstream)																																			---	---	---	---
SYK	6850	broad.mit.edu	37	9	93617294	93617295	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93617294_93617295delAC	uc004aqz.2	+						SYK_uc004aqy.2_Intron|SYK_uc004ara.2_Intron|SYK_uc004arb.2_Intron|SYK_uc004arc.2_Intron|SYK_uc011ltr.1_Intron|SYK_uc011lts.1_Intron|SYK_uc011ltt.1_Intron	NM_003177	NP_003168			spleen tyrosine kinase isoform 1						cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5								T	ETV6|ITK	MDS|peripheral T-cell lymphoma								---	---	---	---
Unknown	0	broad.mit.edu	37	9	94134358	94134358	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94134358delT								AUH (10152 upstream) : NFIL3 (36971 downstream)																																			---	---	---	---
ZNF169	169841	broad.mit.edu	37	9	97054922	97054923	+	Intron	INS	-	GC	GC	rs74578608	byFrequency	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97054922_97054923insGC	uc004aum.1	+						ZNF169_uc004aun.2_Intron|ZNF169_uc004auo.2_Intron	NM_194320	NP_919301			zinc finger protein 169							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)																---	---	---	---
C9orf3	84909	broad.mit.edu	37	9	97555960	97555961	+	Intron	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97555960_97555961delAA	uc004ava.2	+						C9orf3_uc004aux.1_Intron|C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron	NM_032823	NP_116212			aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	101687551	101687551	+	IGR	DEL	G	-	-	rs76851621		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101687551delG								GALNT12 (75193 upstream) : COL15A1 (18587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	101950837	101950837	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101950837delT								TGFBR1 (34366 upstream) : ALG2 (27871 downstream)																																			---	---	---	---
STX17	55014	broad.mit.edu	37	9	102701149	102701149	+	Intron	DEL	G	-	-	rs5899398		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102701149delG	uc004bal.3	+						STX17_uc004bak.2_Intron|STX17_uc010msx.2_Intron|STX17_uc011lvd.1_Intron	NM_017919	NP_060389			syntaxin 17						intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum|integral to membrane|nucleolus	SNAP receptor activity			large_intestine(1)	1		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	104150666	104150666	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104150666delT								BAAT (3379 upstream) : MRPL50 (457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	107235752	107235752	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107235752delC								SMC2 (332059 upstream) : OR13F1 (30792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	107979097	107979098	+	IGR	INS	-	GTGT	GTGT	rs143987222	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107979097_107979098insGTGT								ABCA1 (288661 upstream) : SLC44A1 (27831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112268750	112268751	+	IGR	INS	-	CCTT	CCTT	rs142108809	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112268750_112268751insCCTT								PTPN3 (8157 upstream) : PALM2 (134321 downstream)																																			---	---	---	---
PALM2	114299	broad.mit.edu	37	9	112531613	112531613	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112531613delC	uc004beg.2	+						PALM2_uc004bef.2_Intron	NM_001037293	NP_001032370			paralemmin 2 isoform b						regulation of cell shape	plasma membrane				ovary(2)	2																		---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113210409	113210410	+	Intron	INS	-	TG	TG	rs143871165	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113210409_113210410insTG	uc010mtz.2	-						SVEP1_uc010mua.1_Intron	NM_153366	NP_699197			polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
DNAJC25-GNG10	552891	broad.mit.edu	37	9	114421510	114421511	+	Intron	INS	-	ACAC	ACAC	rs34430395		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114421510_114421511insACAC	uc004bfn.2	+						GNG10_uc011lws.1_5'Flank|GNG10_uc004bfp.2_5'Flank	NM_004125	NP_004116			DNAJC25-GNG10 protein						protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114935691	114935692	+	Intron	INS	-	C	C	rs148402123	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114935691_114935692insC	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	115800353	115800356	+	IGR	DEL	GGGT	-	-	rs58799514		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115800353_115800356delGGGT								ZNF883 (25881 upstream) : ZFP37 (3818 downstream)																																			---	---	---	---
ZNF618	114991	broad.mit.edu	37	9	116817862	116817862	+	3'UTR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116817862delC	uc004bid.2	+	15					ZNF618_uc004bic.2_3'UTR|ZNF618_uc011lxi.1_3'UTR|ZNF618_uc011lxj.1_3'UTR|ZNF618_uc010mvb.2_3'UTR	NM_133374	NP_588615			zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	118270436	118270436	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118270436delA								DEC1 (105513 upstream) : C9orf27 (380110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118690574	118690574	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118690574delT								C9orf27 (3197 upstream) : PAPPA (225497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	120882084	120882084	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120882084delC								TLR4 (402320 upstream) : None (None downstream)																																			---	---	---	---
DBC1	1620	broad.mit.edu	37	9	122108900	122108900	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122108900delA	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433			deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	122798503	122798503	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122798503delA								DBC1 (666764 upstream) : MIR147 (208754 downstream)																																			---	---	---	---
TTLL11	158135	broad.mit.edu	37	9	124723517	124723518	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124723517_124723518insA	uc011lyl.1	-						TTLL11_uc004blr.2_Intron|uc004bls.1_Intron	NM_001139442	NP_001132914			tubulin tyrosine ligase-like family, member 11						protein modification process	cilium|microtubule basal body	tubulin-tyrosine ligase activity				0																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126376477	126376477	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126376477delC	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128747446	128747447	+	IGR	INS	-	TCG	TCG	rs111684629		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128747446_128747447insTCG								PBX3 (17793 upstream) : FAM125B (341681 downstream)																																			---	---	---	---
PIP5KL1	138429	broad.mit.edu	37	9	130688505	130688506	+	Intron	INS	-	T	T	rs5900779		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130688505_130688506insT	uc011mao.1	-						PIP5KL1_uc004bsu.2_Intron	NM_001135219	NP_001128691			phosphatidylinositol-4-phosphate 5-kinase-like 1							cytoplasm|membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			lung(1)|kidney(1)	2																		---	---	---	---
ENDOG	2021	broad.mit.edu	37	9	131578360	131578361	+	5'Flank	INS	-	T	T	rs140657654	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131578360_131578361insT	uc004bwc.2	+							NM_004435	NP_004426			endonuclease G precursor							mitochondrion	endonuclease activity|metal ion binding|nucleic acid binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	135882348	135882355	+	IGR	DEL	TGGATGGA	-	-	rs34250496		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135882348_135882355delTGGATGGA								GFI1B (15265 upstream) : GTF3C5 (23707 downstream)																																			---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136637757	136637762	+	Intron	DEL	CAGACA	-	-	rs5901027		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136637757_136637762delCAGACA	uc004ces.2	-						VAV2_uc004cer.2_Intron|VAV2_uc004cet.1_Intron	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138016583	138016586	+	IGR	DEL	AAGG	-	-	rs72035885	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138016583_138016586delAAGG								OLFM1 (3552 upstream) : KIAA0649 (355062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	139673308	139673308	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139673308delC								LCN15 (14343 upstream) : TMEM141 (12469 downstream)																																			---	---	---	---
ABCA2	20	broad.mit.edu	37	9	139917547	139917548	+	Intron	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139917547_139917548delGA	uc011mem.1	-						ABCA2_uc011mel.1_Intron|ABCA2_uc004ckl.1_Intron|ABCA2_uc004ckm.1_Intron|ABCA2_uc004cko.1_5'Flank|ABCA2_uc010nca.2_5'UTR	NM_001606	NP_001597			ATP-binding cassette, sub-family A, member 2						cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	141035186	141035187	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141035186_141035187delTG								CACNA1B (16111 upstream) : TUBBP5 (9378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3800853	3800853	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3800853delG								PITRM1 (585850 upstream) : KLF6 (17336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6855833	6855833	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6855833delG	uc001ijm.2	+											Homo sapiens cDNA FLJ36835 fis, clone ASTRO2010996.																														---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7319603	7319603	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7319603delA	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	11746470	11746471	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11746470_11746471delAG								USP6NL (92791 upstream) : ECHDC3 (37885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	16036507	16036508	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16036507_16036508insA								FAM188A (133988 upstream) : PTER (442459 downstream)																																			---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18705095	18705095	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18705095delT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18848411	18848412	+	Intron	INS	-	GAATG	GAATG			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18848411_18848412insGAATG	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	20634164	20634165	+	IGR	INS	-	A	A	rs146987606	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20634164_20634165insA								PLXDC2 (65049 upstream) : NEBL (434740 downstream)																																			---	---	---	---
MLLT10	8028	broad.mit.edu	37	10	22006646	22006651	+	Intron	DEL	TCCTCC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22006646_22006651delTCCTCC	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001ira.2_Intron|MLLT10_uc001irb.2_Intron	NM_004641	NP_004632			myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2								T	MLL|PICALM|CDK6	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	10	23445776	23445795	+	IGR	DEL	GGAGAAGGAAAGAAAGGAAA	-	-	rs66514059		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23445776_23445795delGGAGAAGGAAAGAAAGGAAA								MSRB2 (34835 upstream) : PTF1A (35665 downstream)																																			---	---	---	---
MASTL	84930	broad.mit.edu	37	10	27472199	27472201	+	Intron	DEL	TTG	-	-	rs147321879		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27472199_27472201delTTG	uc001itm.2	+						MASTL_uc001itl.2_Intron|MASTL_uc009xkw.1_Intron|MASTL_uc009xkx.1_Intron	NM_032844	NP_116233			microtubule associated serine/threonine						cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27953966	27953967	+	IGR	INS	-	TC	TC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27953966_27953967insTC								RAB18 (124869 upstream) : MKX (7837 downstream)																																			---	---	---	---
MKX	283078	broad.mit.edu	37	10	28004860	28004861	+	Intron	INS	-	TT	TT	rs140928326	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28004860_28004861insTT	uc001ity.3	-						MKX_uc001itx.3_Intron	NM_173576	NP_775847			mohawk homeobox						muscle organ development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29555878	29555879	+	IGR	INS	-	TG	TG	rs141820989	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29555878_29555879insTG								BAMBI (584010 upstream) : LYZL1 (22111 downstream)																																			---	---	---	---
LOC387647	387647	broad.mit.edu	37	10	29719948	29719949	+	Intron	INS	-	TTCC	TTCC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29719948_29719949insTTCC	uc001iuo.1	+						LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron					Homo sapiens cDNA FLJ31518 fis, clone NT2RI2000064.												0																		---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29874590	29874591	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29874590_29874591delAC	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506			supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30362576	30362577	+	Intron	INS	-	TCCT	TCCT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362576_30362577insTCCT	uc001iuz.2	-											RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4																		---	---	---	---
LYZL2	119180	broad.mit.edu	37	10	30903321	30903321	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30903321delC	uc001ivk.2	-							NM_183058	NP_898881			lysozyme-like 2						cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)																---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34810553	34810553	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34810553delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixt.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35397396	35397396	+	IGR	DEL	G	-	-	rs11597184	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35397396delG								CUL2 (17850 upstream) : CREM (18405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36597752	36597752	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36597752delA								FZD8 (667390 upstream) : ANKRD30A (817033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37019020	37019021	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37019020_37019021insT								None (None upstream) : ANKRD30A (395764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39112081	39112085	+	IGR	DEL	ATTTT	-	-	rs113815747		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39112081_39112085delATTTT								LOC399744 (371001 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39130336	39130337	+	IGR	INS	-	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39130336_39130337insG								LOC399744 (389256 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42747391	42747393	+	IGR	DEL	TTT	-	-	rs147603349	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42747391_42747393delTTT								None (None upstream) : LOC441666 (79922 downstream)																																			---	---	---	---
ZNF33B	7582	broad.mit.edu	37	10	43087379	43087380	+	3'UTR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43087379_43087380delCA	uc001jaf.1	-	5					ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_3'UTR|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886			zinc finger protein 33B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44242348	44242348	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44242348delA								ZNF32 (98022 upstream) : HNRNPA3P1 (40512 downstream)																																			---	---	---	---
CHAT	1103	broad.mit.edu	37	10	50889289	50889289	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50889289delG	uc010qgs.1	+						C10orf53_uc001jib.2_Intron|C10orf53_uc001jic.1_Intron|C10orf53_uc001jid.1_Intron	NM_020986	NP_066266			choline acetyltransferase isoform 1						neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	54203362	54203362	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54203362delT								DKK1 (125946 upstream) : MBL2 (321779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59369604	59369604	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59369604delA								None (None upstream) : IPMK (586014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	60173349	60173349	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60173349delA								TFAM (17453 upstream) : BICC1 (99555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	60195615	60195616	+	IGR	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60195615_60195616delAA								TFAM (39719 upstream) : BICC1 (77288 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60323020	60323021	+	Intron	INS	-	C	C	rs149128220	by1000genomes;by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60323020_60323021insC	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60379640	60379641	+	Intron	DEL	AT	-	-	rs7894636	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60379640_60379641delAT	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	69621377	69621378	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69621377_69621378insC								DNAJC12 (23440 upstream) : SIRT1 (23049 downstream)																																			---	---	---	---
HKDC1	80201	broad.mit.edu	37	10	71022170	71022170	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71022170delT	uc001jpf.3	+						HKDC1_uc010qje.1_Intron|HKDC1_uc009xqb.2_Intron	NM_025130	NP_079406			hexokinase domain containing 1						glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	72043100	72043101	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72043100_72043101delTC								NPFFR1 (16952 upstream) : LRRC20 (15628 downstream)																																			---	---	---	---
UNC5B	219699	broad.mit.edu	37	10	73059407	73059408	+	3'UTR	INS	-	T	T	rs143825225	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73059407_73059408insT	uc001jro.2	+	17					UNC5B_uc001jrp.2_3'UTR|UNC5B_uc001jrq.1_5'Flank	NM_170744	NP_734465			unc-5 homolog B precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3																		---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74230853	74230853	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74230853delT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79138689	79138689	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79138689delA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79251473	79251474	+	Intron	DEL	AC	-	-	rs113834879		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79251473_79251474delAC	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
DLG5	9231	broad.mit.edu	37	10	79561177	79561177	+	Intron	DEL	A	-	-	rs34431478		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79561177delA	uc001jzk.2	-						DLG5_uc001jzi.2_Intron|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_Intron	NM_004747	NP_004738			discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	85739470	85739471	+	IGR	INS	-	AG	AG	rs142307727	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85739470_85739471insAG								NRG3 (992535 upstream) : GHITM (159714 downstream)																																			---	---	---	---
PAPSS2	9060	broad.mit.edu	37	10	89506373	89506373	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89506373delA	uc001kex.2	+	12					PAPSS2_uc001kew.2_3'UTR	NM_004670	NP_004661			3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity			central_nervous_system(1)|skin(1)	2		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)														---	---	---	---
ATAD1	84896	broad.mit.edu	37	10	89541711	89541711	+	Intron	DEL	T	-	-	rs71721929		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89541711delT	uc001key.1	-						ATAD1_uc010qmr.1_Intron|ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199			ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)														---	---	---	---
PIK3AP1	118788	broad.mit.edu	37	10	98397070	98397071	+	Intron	INS	-	TCAC	TCAC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98397070_98397071insTCAC	uc001kmq.2	-						PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522			phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)														---	---	---	---
PIK3AP1	118788	broad.mit.edu	37	10	98421550	98421554	+	Intron	DEL	AGGAC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98421550_98421554delAGGAC	uc001kmq.2	-						PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522			phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100317361	100317361	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100317361delA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	101009897	101009898	+	IGR	INS	-	T	T	rs71494097		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101009897_101009898insT								HPSE2 (14278 upstream) : CNNM1 (78958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	101244990	101244991	+	IGR	INS	-	A	A	rs143092129	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101244990_101244991insA								GOT1 (54460 upstream) : NKX2-3 (47699 downstream)																																			---	---	---	---
ERLIN1	10613	broad.mit.edu	37	10	101913721	101913721	+	Intron	DEL	T	-	-	rs67153027		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101913721delT	uc001kqn.3	-						ERLIN1_uc001kqm.3_Intron|ERLIN1_uc001kqo.3_Intron|ERLIN1_uc010qpm.1_Intron	NM_006459	NP_006450			ER lipid raft associated 1						ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding				0		Colorectal(252;0.234)		Epithelial(162;3.85e-10)|all cancers(201;3.25e-08)														---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103292507	103292508	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103292507_103292508insTGTGTG	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
TMEM180	79847	broad.mit.edu	37	10	104235833	104235833	+	3'UTR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104235833delT	uc001kvt.2	+	10					TMEM180_uc010qql.1_3'UTR|TMEM180_uc010qqm.1_Intron	NM_024789	NP_079065			transmembrane protein 180							integral to membrane				ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
ITPRIP	85450	broad.mit.edu	37	10	106080113	106080113	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106080113delT	uc001kye.2	-						ITPRIP_uc001kyf.2_Intron|ITPRIP_uc001kyg.2_Intron	NM_033397	NP_203755			inositol 1,4,5-triphosphate receptor interacting							plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	107791839	107791840	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107791839_107791840delAG								SORCS3 (766846 upstream) : SORCS1 (541582 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108925050	108925051	+	5'Flank	INS	-	GTGT	GTGT	rs142789907	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108925050_108925051insGTGT	uc001kym.2	-						SORCS1_uc001kyl.2_5'Flank|SORCS1_uc009xxs.2_5'Flank|SORCS1_uc001kyn.1_5'Flank|SORCS1_uc001kyo.2_5'Flank	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	110445586	110445586	+	IGR	DEL	G	-	-	rs144990096		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110445586delG								None (None upstream) : None (None downstream)																																			---	---	---	---
RBM20	282996	broad.mit.edu	37	10	112542551	112542552	+	Intron	INS	-	T	T	rs139732321	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112542551_112542552insT	uc001kzf.2	+							NM_001134363	NP_001127835			RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	112922924	112922924	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112922924delT								ADRA2A (82264 upstream) : GPAM (986698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	114585778	114585778	+	RNA	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114585778delG	uc001laa.2	+	1		c.2524delG								Homo sapiens mRNA; cDNA DKFZp586N1918 (from clone DKFZp586N1918).																														---	---	---	---
AFAP1L2	84632	broad.mit.edu	37	10	116148046	116148047	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116148046_116148047delAC	uc001lbn.2	-						AFAP1L2_uc001lbo.2_Intron|AFAP1L2_uc010qse.1_Intron|AFAP1L2_uc001lbp.2_Intron|AFAP1L2_uc001lbr.1_Intron	NM_001001936	NP_001001936			KIAA1914 protein isoform 1						inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)														---	---	---	---
HSPA12A	259217	broad.mit.edu	37	10	118491839	118491840	+	Intron	INS	-	AAAG	AAAG	rs146087365	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118491839_118491840insAAAG	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291			heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)														---	---	---	---
PDZD8	118987	broad.mit.edu	37	10	119066757	119066757	+	Intron	DEL	T	-	-	rs138996448		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119066757delT	uc001lde.1	-							NM_173791	NP_776152			PDZ domain containing 8						intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120226549	120226549	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120226549delT								C10orf84 (124710 upstream) : PRLHR (126367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120750221	120750222	+	IGR	INS	-	A	A	rs143460708		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120750221_120750222insA								C10orf46 (235463 upstream) : NANOS1 (39006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122880589	122880590	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122880589_122880590delAC								WDR11 (211554 upstream) : FGFR2 (357255 downstream)																																			---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123911190	123911191	+	Intron	INS	-	T	T	rs146685929	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123911190_123911191insT	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron|TACC2_uc001lfy.2_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
PSTK	118672	broad.mit.edu	37	10	124741382	124741382	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124741382delG	uc001lgy.1	+							NM_153336	NP_699167			phosphoseryl-tRNA kinase								ATP binding|kinase activity			liver(1)	1		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)														---	---	---	---
CHST15	51363	broad.mit.edu	37	10	125790229	125790229	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125790229delT	uc001lhl.2	-						CHST15_uc001lhm.2_Intron|CHST15_uc001lhn.2_Intron|CHST15_uc010que.1_Intron|CHST15_uc001lho.2_Intron	NM_015892	NP_056976			B cell RAG associated protein						hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1																		---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126711047	126711083	+	Intron	DEL	GGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	-	-	rs57308644		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126711047_126711083delGGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126749033	126749034	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126749033_126749034delGT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127892509	127892510	+	Intron	DEL	GT	-	-	rs67731332		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127892509_127892510delGT	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	128584632	128584632	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128584632delT								C10orf90 (225553 upstream) : DOCK1 (9391 downstream)																																			---	---	---	---
FOXI2	399823	broad.mit.edu	37	10	129538328	129538333	+	3'UTR	DEL	ACTCAT	-	-	rs58745852	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129538328_129538333delACTCAT	uc009yas.2	+	2						NM_207426	NP_997309			forkhead box I2						epidermal cell fate specification|otic placode formation|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	130233910	130233921	+	IGR	DEL	TGACACATTGGC	-	-	rs67822135		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130233910_130233921delTGACACATTGGC								MKI67 (309442 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130250580	130250580	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130250580delT								MKI67 (326112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130936829	130936830	+	IGR	INS	-	T	T	rs79167590		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130936829_130936830insT								None (None upstream) : MGMT (328624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134802092	134802092	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134802092delG								C10orf93 (46028 upstream) : GPR123 (82341 downstream)																																			---	---	---	---
PAOX	196743	broad.mit.edu	37	10	135202325	135202359	+	Intron	DEL	GTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	-	-	rs144417516	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135202325_135202359delGTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	uc001lmv.2	+						PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_Intron|PAOX_uc001lna.2_Intron|PAOX_uc001lnb.2_Intron|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875			polyamine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	179247	179248	+	Intron	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:179247_179248delAA	uc001lnz.2	-											Homo sapiens mRNA; cDNA DKFZp434B2016 (from clone DKFZp434B2016).																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	3210325	3210325	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3210325delT								OSBPL5 (22356 upstream) : C11orf36 (29237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	4982466	4982466	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4982466delA								OR51A2 (5523 upstream) : MMP26 (26958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	6619120	6619121	+	IGR	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6619120_6619121delAA								DNHD1 (25868 upstream) : RRP8 (2033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	6853920	6853921	+	IGR	INS	-	A	A	rs144994062	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6853920_6853921insA								OR6A2 (36781 upstream) : OR10A5 (12993 downstream)																																			---	---	---	---
NAV2	89797	broad.mit.edu	37	11	20028504	20028504	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20028504delT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	21747095	21747104	+	IGR	DEL	TTTGTGTGTT	-	-	rs71034542		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21747095_21747104delTTTGTGTGTT								NELL1 (149868 upstream) : ANO5 (467618 downstream)																																			---	---	---	---
GAS2	2620	broad.mit.edu	37	11	22691941	22691941	+	Intron	DEL	A	-	-	rs35109801		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22691941delA	uc009yie.2	+						GAS2_uc001mqm.2_Intron|GAS2_uc001mqn.2_Intron	NM_001143830	NP_001137302			growth arrest-specific 2						cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2																		---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24889776	24889777	+	Intron	INS	-	AG	AG	rs140733387	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24889776_24889777insAG	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	25092092	25092092	+	Intron	DEL	T	-	-	rs5790451		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25092092delT	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	25222376	25222377	+	IGR	INS	-	AA	AA	rs149986726	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25222376_25222377insAA								LUZP2 (118194 upstream) : ANO3 (988452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29091674	29091675	+	IGR	INS	-	AT	AT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29091674_29091675insAT								METT5D1 (736620 upstream) : KCNA4 (940091 downstream)																																			---	---	---	---
CD59	966	broad.mit.edu	37	11	33758782	33758787	+	5'Flank	DEL	ACACAC	-	-	rs71857868		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33758782_33758787delACACAC	uc001mut.3	-						CD59_uc009yka.2_5'Flank|CD59_uc001muu.3_5'Flank|CD59_uc001muv.3_5'Flank|CD59_uc001mux.3_5'Flank	NM_203330	NP_976075			CD59 antigen preproprotein						blood coagulation|cell surface receptor linked signaling pathway	anchored to external side of plasma membrane|extracellular region|membrane fraction					0																		---	---	---	---
NAT10	55226	broad.mit.edu	37	11	34162954	34162955	+	Intron	INS	-	TC	TC	rs141705432		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34162954_34162955insTC	uc001mvk.2	+						NAT10_uc010ren.1_Intron	NM_024662	NP_078938			N-acetyltransferase 10 isoform a							nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	34443455	34443455	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34443455delT								ABTB2 (64653 upstream) : CAT (17023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37355418	37355419	+	IGR	DEL	GC	-	-	rs111571452		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37355418_37355419delGC								C11orf74 (659028 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37495357	37495357	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37495357delT								C11orf74 (798967 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42359045	42359046	+	IGR	INS	-	ACACACACAC	ACACACACAC	rs10638782		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42359045_42359046insACACACACAC								LRRC4C (877722 upstream) : API5 (974459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45697658	45697659	+	IGR	INS	-	A	A	rs139519164	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45697658_45697659insA								CHST1 (10486 upstream) : DKFZp779M0652 (95324 downstream)																																			---	---	---	---
CREB3L1	90993	broad.mit.edu	37	11	46316275	46316275	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46316275delC	uc001ncf.2	+							NM_052854	NP_443086			cAMP responsive element binding protein 3-like						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8				GBM - Glioblastoma multiforme(35;0.0285)				T	FUS	myxofibrosarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	11	48694593	48694593	+	IGR	DEL	A	-	-	rs75637845		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48694593delA								OR4A47 (183321 upstream) : FOLH1 (473595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	49517636	49517636	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49517636delA								FOLH1 (287414 upstream) : LOC440040 (62444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50650228	50650228	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50650228delC								LOC646813 (270425 upstream) : OR4A5 (761220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56543948	56543948	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56543948delC								OR9G4 (32661 upstream) : OR5AK2 (212441 downstream)																																			---	---	---	---
RTN4RL2	349667	broad.mit.edu	37	11	57235787	57235788	+	Intron	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57235787_57235788delCT	uc010rjt.1	+							NM_178570	NP_848665			reticulon 4 receptor-like 2 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0																		---	---	---	---
SERPING1	710	broad.mit.edu	37	11	57370707	57370707	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57370707delA	uc001nkp.1	+						SERPING1_uc001nkq.1_Intron|SERPING1_uc010rju.1_Intron|SERPING1_uc010rjv.1_Intron|SERPING1_uc001nkr.1_Intron|SERPING1_uc009ymi.1_Intron|SERPING1_uc009ymj.1_Intron|SERPING1_uc001nks.1_Intron	NM_000062	NP_000053			serpin peptidase inhibitor, clade G, member 1						blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1														Hereditary_Angioedema				---	---	---	---
Unknown	0	broad.mit.edu	37	11	57598719	57598720	+	IGR	DEL	AC	-	-	rs36020242		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57598719_57598720delAC								CTNND1 (12068 upstream) : OR9Q1 (192633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57765423	57765423	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57765423delT								CTNND1 (178772 upstream) : OR9Q1 (25930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58040234	58040235	+	IGR	DEL	GT	-	-	rs66596067		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58040234_58040235delGT								OR10W1 (4502 upstream) : OR5B17 (85365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58260506	58260506	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58260506delG								OR5B12 (52882 upstream) : OR5B21 (14145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	59066135	59066136	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs36130299		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066135_59066136insGGAAGGAA								MPEG1 (85641 upstream) : OR5AN1 (65796 downstream)																																			---	---	---	---
STX3	6809	broad.mit.edu	37	11	59550472	59550472	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59550472delA	uc001nog.2	+						STX3_uc010rkx.1_Intron|STX3_uc010rky.1_Intron	NM_004177	NP_004168			syntaxin 3						cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity			ovary(2)	2																		---	---	---	---
GIF	2694	broad.mit.edu	37	11	59601784	59601785	+	Intron	INS	-	CTTC	CTTC	rs509950	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59601784_59601785insCTTC	uc001noi.2	-							NM_005142	NP_005133			gastric intrinsic factor (vitamin B synthesis)						cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2																		---	---	---	---
MS4A8B	83661	broad.mit.edu	37	11	60479023	60479023	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60479023delT	uc001npv.2	+							NM_031457	NP_113645			membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	60860791	60860797	+	IGR	DEL	GGGCAAG	-	-	rs11279354	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60860791_60860797delGGGCAAG								CD6 (72945 upstream) : CD5 (9133 downstream)																																			---	---	---	---
VPS37C	55048	broad.mit.edu	37	11	60911888	60911888	+	Intron	DEL	C	-	-	rs35603547		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60911888delC	uc001nqv.1	-						VPS37C_uc001nqw.1_Intron	NM_017966	NP_060436			vacuolar protein sorting 37C						cellular membrane organization|endosome transport|protein transport	late endosome membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	61142430	61142433	+	IGR	DEL	AAAC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61142430_61142433delAAAC								TMEM138 (5750 upstream) : TMEM216 (17399 downstream)																																			---	---	---	---
FADS2	9415	broad.mit.edu	37	11	61614185	61614185	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61614185delC	uc001nsl.1	+						FADS2_uc001nsj.2_Intron|FADS2_uc010rlo.1_Intron|FADS2_uc001nsk.2_Intron	NM_004265	NP_004256			fatty acid desaturase 2						electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)													---	---	---	---
TUT1	64852	broad.mit.edu	37	11	62351600	62351600	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62351600delT	uc001nto.2	-							NM_022830	NP_073741			terminal uridylyl transferase 1, U6						mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	63539389	63539394	+	IGR	DEL	AGGAGA	-	-	rs523291		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63539389_63539394delAGGAGA								C11orf95 (3276 upstream) : C11orf84 (41529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	66374422	66374423	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66374422_66374423insT								CCS (933 upstream) : RBM14 (9630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	67538259	67538260	+	IGR	INS	-	A	A	rs117105384		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67538259_67538260insA								ALDH3B2 (89574 upstream) : LOC645332 (20980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	67714805	67714806	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67714805_67714806insA								LOC645332 (141998 upstream) : UNC93B1 (43769 downstream)																																			---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68257019	68257020	+	Intron	DEL	TT	-	-	rs60973933		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68257019_68257020delTT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68301439	68301439	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68301439delT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	68412201	68412201	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412201delA								SAPS3 (29402 upstream) : GAL (39782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	68784345	68784355	+	Intron	DEL	CATCCATCCAT	-	-	rs12364803	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68784345_68784355delCATCCATCCAT	uc001ooq.2	+											Homo sapiens, clone IMAGE:5587905, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	69300871	69300872	+	IGR	INS	-	C	C	rs149665624	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69300871_69300872insC								MYEOV (144422 upstream) : CCND1 (155001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69605295	69605296	+	IGR	INS	-	A	A	rs150417564	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69605295_69605296insA								FGF4 (15124 upstream) : FGF3 (19441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69638021	69638022	+	IGR	INS	-	G	G	rs146789226	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69638021_69638022insG								FGF3 (3829 upstream) : ANO1 (286386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71091621	71091622	+	IGR	INS	-	GGGC	GGGC	rs72550567		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71091621_71091622insGGGC								SHANK2 (155813 upstream) : DHCR7 (53837 downstream)																																			---	---	---	---
NUMA1	4926	broad.mit.edu	37	11	71736458	71736459	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71736458_71736459insA	uc001orl.1	-						NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Intron|NUMA1_uc009ysx.1_Intron|NUMA1_uc001oro.1_Intron|NUMA1_uc009ysy.1_Intron|NUMA1_uc001orp.2_Intron|NUMA1_uc001orq.2_Intron	NM_006185	NP_006176			nuclear mitotic apparatus protein 1						G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8								T	RARA	APL								---	---	---	---
Unknown	0	broad.mit.edu	37	11	72245056	72245057	+	IGR	INS	-	A	A	rs113134325		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72245056_72245057insA								CLPB (99372 upstream) : PDE2A (42129 downstream)																																			---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73268435	73268436	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73268435_73268436insT	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73796187	73796188	+	Intron	INS	-	T	T	rs74787473		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73796187_73796188insT	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346			C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	74154372	74154372	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74154372delT								PGM2L1 (44870 upstream) : KCNE3 (11516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	74396723	74396724	+	IGR	INS	-	AA	AA	rs7111167	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74396723_74396724insAA								POLD3 (42958 upstream) : CHRDL2 (10751 downstream)																																			---	---	---	---
RNF169	254225	broad.mit.edu	37	11	74533074	74533075	+	Intron	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74533074_74533075delGA	uc001ovl.3	+						XRRA1_uc001ovm.2_Intron	NM_001098638	NP_001092108			ring finger protein 169								zinc ion binding			ovary(1)	1																		---	---	---	---
C11orf30	56946	broad.mit.edu	37	11	76169590	76169590	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76169590delT	uc001oxl.2	+						C11orf30_uc001oxk.2_3'UTR|C11orf30_uc009yuj.1_Intron|C11orf30_uc010rsa.1_Intron|C11orf30_uc001oxm.2_Intron|C11orf30_uc010rsb.1_Intron|C11orf30_uc010rsc.1_Intron|C11orf30_uc001oxn.2_Intron|C11orf30_uc010rsd.1_Intron	NM_020193	NP_064578			EMSY protein						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	76560094	76560095	+	IGR	INS	-	GCTT	GCTT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76560094_76560095insGCTT								TSKU (50897 upstream) : ACER3 (11822 downstream)																																			---	---	---	---
PAK1	5058	broad.mit.edu	37	11	77150744	77150744	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77150744delC	uc001oyh.3	-						PAK1_uc001oyg.3_Intron	NM_002576	NP_002567			p21-activated kinase 1 isoform 2						apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	79611279	79611279	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79611279delT								ODZ4 (459584 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	79950367	79950368	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79950367_79950368insA								ODZ4 (798672 upstream) : None (None downstream)																																			---	---	---	---
RAB30	27314	broad.mit.edu	37	11	82765223	82765223	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82765223delT	uc001ozu.2	-						RAB30_uc010rst.1_Intron|RAB30_uc001ozv.2_Intron	NM_014488	NP_055303			RAB30, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83235469	83235470	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83235469_83235470insT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83936019	83936019	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83936019delT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	86736406	86736406	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736406delG								FZD4 (69973 upstream) : TMEM135 (12659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87811139	87811141	+	IGR	DEL	TCA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87811139_87811141delTCA								TMEM135 (776571 upstream) : RAB38 (35290 downstream)																																			---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88245425	88245431	+	Intron	DEL	ATGGCCA	-	-	rs56689466		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88245425_88245431delATGGCCA	uc001pcq.2	-						GRM5_uc009yvm.2_Intron	NM_001143831	NP_001137303			glutamate receptor, metabotropic 5 isoform a						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	89385933	89385937	+	Intron	DEL	TATTT	-	-	rs148851366		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89385933_89385937delTATTT	uc001pcz.2	+											Homo sapiens mRNA for hypothetical protein, partial cds, clone:Hsa11-digit35-15-11-R.																														---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92470687	92470688	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92470687_92470688delGT	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
MED17	9440	broad.mit.edu	37	11	93535276	93535276	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93535276delT	uc001pem.3	+							NM_004268	NP_004259			mediator complex subunit 17						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	96552637	96552637	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96552637delT								JRKL (425910 upstream) : None (None downstream)																																			---	---	---	---
ARHGAP42	143872	broad.mit.edu	37	11	100776388	100776388	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100776388delT	uc001pge.2	+							NM_152432	NP_689645			Rho-type GTPase-activating protein FLJ32810						filopodium assembly|signal transduction	intracellular	cytoskeletal adaptor activity|GTPase activator activity|SH3 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	101473673	101473674	+	IGR	INS	-	TG	TG	rs150562927	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101473673_101473674insTG								TRPC6 (19014 upstream) : ANGPTL5 (287732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	102727511	102727512	+	IGR	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102727511_102727512delAA								MMP3 (13169 upstream) : MMP12 (5953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	105109863	105109864	+	IGR	INS	-	GTTT	GTTT	rs147717911	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105109863_105109864insGTTT								CARD18 (100057 upstream) : GRIA4 (370936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109717445	109717445	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109717445delA								C11orf87 (417607 upstream) : ZC3H12C (246481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109935339	109935340	+	IGR	DEL	CT	-	-	rs35175498		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109935339_109935340delCT								C11orf87 (635501 upstream) : ZC3H12C (28586 downstream)																																			---	---	---	---
RDX	5962	broad.mit.edu	37	11	110049066	110049066	+	Intron	DEL	G	-	-	rs34198814		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110049066delG	uc009yxx.1	-							NM_002906				radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)														---	---	---	---
BCO2	83875	broad.mit.edu	37	11	112044171	112044171	+	5'Flank	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112044171delT	uc001pnf.2	+						BCO2_uc001pne.1_5'Flank|BCO2_uc001png.2_5'Flank|BCO2_uc001pnh.2_5'Flank|BCO2_uc010rwt.1_5'Flank|BCO2_uc009yyn.2_5'Flank|BCO2_uc001pni.2_5'Flank	NM_031938	NP_114144			beta-carotene dioxygenase 2 isoform a						carotene metabolic process|retinal metabolic process|retinoic acid metabolic process		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115355665	115355666	+	Intron	INS	-	A	A	rs113318647		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115355665_115355666insA	uc001ppi.3	-						CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_Intron|CADM1_uc001ppj.3_Intron|CADM1_uc001ppl.2_Intron	NM_014333	NP_055148			immunoglobulin superfamily, member 4D isoform 1						adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	115800961	115800962	+	IGR	INS	-	GA	GA	rs3050348		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115800961_115800962insGA								CADM1 (425720 upstream) : BUD13 (817926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116007686	116007687	+	IGR	DEL	GT	-	-	rs72325913		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116007686_116007687delGT								CADM1 (632445 upstream) : BUD13 (611201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116143371	116143376	+	IGR	DEL	GTGTAG	-	-	rs34837859		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116143371_116143376delGTGTAG								CADM1 (768130 upstream) : BUD13 (475512 downstream)																																			---	---	---	---
SIK3	23387	broad.mit.edu	37	11	116855422	116855423	+	Intron	INS	-	A	A	rs142331310	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116855422_116855423insA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440			serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	123572461	123572461	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123572461delC								SCN3B (47146 upstream) : ZNF202 (22536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	124292958	124292959	+	IGR	DEL	AC	-	-	rs111818010		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124292958_124292959delAC								OR8B2 (16312 upstream) : OR8B4 (881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128142225	128142236	+	IGR	DEL	GTGTGTGTGTGC	-	-	rs71051502	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128142225_128142236delGTGTGTGTGTGC								None (None upstream) : ETS1 (186420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128257705	128257705	+	IGR	DEL	T	-	-	rs144699216	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128257705delT								None (None upstream) : ETS1 (70951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129350871	129350871	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129350871delA								BARX2 (28698 upstream) : TMEM45B (334870 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131393676	131393677	+	Intron	INS	-	A	A	rs67460990		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131393676_131393677insA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133010718	133010719	+	Intron	INS	-	GACGAC	GACGAC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133010718_133010719insGACGAC	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133010754	133010755	+	Intron	INS	-	GAG	GAG	rs139420572	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133010754_133010755insGAG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133286085	133286085	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133286085delA	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	133763919	133763919	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133763919delG								SPATA19 (48527 upstream) : LOC283174 (2411 downstream)																																			---	---	---	---
B3GAT1	27087	broad.mit.edu	37	11	134266519	134266519	+	Intron	DEL	A	-	-	rs5795883		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134266519delA	uc001qhq.2	-						B3GAT1_uc001qhr.2_Intron	NM_018644	NP_061114			beta-1,3-glucuronyltransferase 1						carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	134708457	134708457	+	IGR	DEL	A	-	-	rs71464023		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134708457delA								B3GAT1 (426645 upstream) : None (None downstream)																																			---	---	---	---
IQSEC3	440073	broad.mit.edu	37	12	272405	272407	+	Intron	DEL	CCC	-	-	rs147252456		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:272405_272407delCCC	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047			IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)														---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	402523	402523	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:402523delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068			retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3								T 	NUP98	AML								---	---	---	---
NINJ2	4815	broad.mit.edu	37	12	697356	697364	+	Intron	DEL	GGGACGGAG	-	-	rs74475206		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:697356_697364delGGGACGGAG	uc001qil.2	-						NINJ2_uc010sdr.1_Intron|NINJ2_uc010sds.1_Intron	NM_016533	NP_057617			ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)															---	---	---	---
NINJ2	4815	broad.mit.edu	37	12	730639	730639	+	Intron	DEL	A	-	-	rs11310736		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:730639delA	uc001qil.2	-						NINJ2_uc010sdr.1_Intron|NINJ2_uc010sds.1_Intron	NM_016533	NP_057617			ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)															---	---	---	---
WNK1	65125	broad.mit.edu	37	12	967360	967361	+	Intron	INS	-	TT	TT	rs112141810		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:967360_967361insTT	uc001qio.3	+						WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_5'Flank	NM_018979	NP_061852			WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
RAD52	5893	broad.mit.edu	37	12	1035497	1035497	+	Intron	DEL	A	-	-	rs111614370		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1035497delA	uc001qis.1	-						RAD52_uc001qit.1_Intron|RAD52_uc010sdt.1_Intron|RAD52_uc001qiu.1_Intron|RAD52_uc001qiv.1_Intron|RAD52_uc001qiw.1_Intron|RAD52_uc010sdu.1_Intron|RAD52_uc001qix.1_Intron	NM_134424	NP_602296			RAD52 homolog						DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)										Homologous_recombination					---	---	---	---
ADIPOR2	79602	broad.mit.edu	37	12	1888704	1888705	+	Intron	INS	-	AT	AT	rs148907341	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1888704_1888705insAT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827			adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	4058013	4058020	+	IGR	DEL	TCCCTCCC	-	-	rs606595		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4058013_4058020delTCCCTCCC								PARP11 (75405 upstream) : CCND2 (324882 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5737834	5737835	+	Intron	DEL	GT	-	-	rs72150450		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5737834_5737835delGT	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5858037	5858038	+	Intron	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5858037_5858038delAA	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
VWF	7450	broad.mit.edu	37	12	6221994	6221995	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6221994_6221995delAC	uc001qnn.1	-						VWF_uc010set.1_Intron|VWF_uc001qno.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	7601287	7601288	+	IGR	DEL	GA	-	-	rs71450201		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7601287_7601288delGA								CD163L1 (4538 upstream) : CD163 (22124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9406971	9406971	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9406971delA								MIR1244 (14824 upstream) : LOC642846 (29282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9544574	9544575	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9544574_9544575delTG	uc009zgp.2	+											Homo sapiens cDNA clone IMAGE:4838157.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	10046306	10046306	+	IGR	DEL	C	-	-	rs11343028		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10046306delC								CLEC2B (23848 upstream) : CLEC2A (4966 downstream)																																			---	---	---	---
KLRC1	3821	broad.mit.edu	37	12	10607606	10607606	+	5'Flank	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10607606delC	uc001qyl.2	-						KLRC1_uc009zhm.1_5'Flank|KLRC1_uc001qym.2_5'Flank|KLRC1_uc001qyn.2_5'Flank|KLRC1_uc001qyo.2_5'Flank	NM_002259	NP_002250			killer cell lectin-like receptor subfamily C,						cell surface receptor linked signaling pathway|regulation of immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0																		---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11043438	11043438	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11043438delT	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
EMP1	2012	broad.mit.edu	37	12	13365997	13365997	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13365997delT	uc001rbr.2	+						EMP1_uc009zhy.2_Intron|EMP1_uc010shr.1_Intron	NM_001423	NP_001414			epithelial membrane protein 1						cell growth|cell proliferation|epidermis development	integral to membrane|membrane fraction					0		Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	13504271	13504272	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13504271_13504272delAG								EMP1 (134564 upstream) : C12orf36 (19751 downstream)																																			---	---	---	---
ARHGDIB	397	broad.mit.edu	37	12	15106753	15106754	+	Intron	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15106753_15106754delCT	uc001rcq.1	-							NM_001175	NP_001166			Rho GDP dissociation inhibitor (GDI) beta						actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0																		---	---	---	---
EPS8	2059	broad.mit.edu	37	12	15883129	15883130	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15883129_15883130delAC	uc001rdb.2	-						EPS8_uc009zig.2_Intron	NM_004447	NP_004438			epidermal growth factor receptor pathway						cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	17206657	17206657	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17206657delT								LMO3 (443899 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	20906492	20906492	+	IGR	DEL	T	-	-	rs139931559		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20906492delT								SLCO1C1 (174 upstream) : SLCO1B3 (57146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22265519	22265520	+	IGR	DEL	CC	-	-	rs59945872		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22265519_22265520delCC								CMAS (46918 upstream) : ST8SIA1 (80806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22908682	22908683	+	IGR	INS	-	G	G	rs147114733	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22908682_22908683insG								ETNK1 (65075 upstream) : SOX5 (776549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23475198	23475199	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs11615549		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23475198_23475199insTTCCTTCC								ETNK1 (631591 upstream) : SOX5 (210033 downstream)																																			---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24626192	24626192	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24626192delA	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
RASSF8	11228	broad.mit.edu	37	12	26179837	26179837	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26179837delA	uc001rgx.2	+						RASSF8_uc001rgy.2_Intron|RASSF8_uc001rgz.2_Intron|RASSF8_uc009zjd.1_Intron|RASSF8_uc001rgw.1_Intron	NM_007211	NP_009142			Ras association (RalGDS/AF-6) domain family						signal transduction						0	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	26445093	26445094	+	IGR	INS	-	C	C	rs147961442	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26445093_26445094insC								SSPN (39240 upstream) : ITPR2 (43193 downstream)																																			---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26807626	26807627	+	Intron	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26807626_26807627delCT	uc001rhg.2	-							NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27348804	27348804	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27348804delA								C12orf71 (113349 upstream) : STK38L (48274 downstream)																																			---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29822900	29822901	+	Intron	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29822900_29822901insC	uc001rjb.2	-						TMTC1_uc001rja.2_Intron|TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057			transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29938502	29938505	+	5'Flank	DEL	TGTA	-	-	rs149862177		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29938502_29938505delTGTA	uc001rjb.2	-						TMTC1_uc001rjc.1_5'Flank	NM_175861	NP_787057			transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	29948550	29948550	+	IGR	DEL	T	-	-	rs35011118		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29948550delT								TMTC1 (10858 upstream) : IPO8 (833373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30058647	30058649	+	IGR	DEL	TCC	-	-	rs138658621		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30058647_30058649delTCC								TMTC1 (120955 upstream) : IPO8 (723274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31006770	31006770	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31006770delC								CAPRIN2 (99322 upstream) : TSPAN11 (72592 downstream)																																			---	---	---	---
TSPAN11	441631	broad.mit.edu	37	12	31100390	31100390	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31100390delG	uc010sju.1	+						TSPAN11_uc001rjp.2_Intron|TSPAN11_uc010sjv.1_Intron	NM_001080509	NP_001073978			tetraspanin 11							integral to membrane					0	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	32633090	32633091	+	IGR	INS	-	T	T	rs11052020		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32633090_32633091insT								BICD1 (101950 upstream) : FGD4 (5815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33520423	33520423	+	IGR	DEL	T	-	-	rs150035994		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33520423delT								PKP2 (470643 upstream) : SYT10 (7925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38016536	38016537	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38016536_38016537delAC								None (None upstream) : ALG10B (694020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38124015	38124016	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38124015_38124016insT								None (None upstream) : ALG10B (586541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38197232	38197233	+	IGR	INS	-	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38197232_38197233insG								None (None upstream) : ALG10B (513324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43548118	43548121	+	IGR	DEL	GAAA	-	-	rs72453061		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43548118_43548121delGAAA								PRICKLE1 (564546 upstream) : ADAMTS20 (199892 downstream)																																			---	---	---	---
TMEM117	84216	broad.mit.edu	37	12	44396626	44396629	+	Intron	DEL	AAAG	-	-	rs113766986		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44396626_44396629delAAAG	uc001rod.2	+						TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Intron	NM_032256	NP_115632			transmembrane protein 117							endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)														---	---	---	---
HDAC7	51564	broad.mit.edu	37	12	48180779	48180780	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48180779_48180780delTG	uc010slo.1	-						HDAC7_uc009zku.2_Intron|HDAC7_uc001rqe.2_Intron|HDAC7_uc001rqj.3_Intron|HDAC7_uc001rqk.3_Intron|HDAC7_uc010slp.1_Intron	NM_015401	NP_056216			histone deacetylase 7 isoform a						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)														---	---	---	---
VDR	7421	broad.mit.edu	37	12	48237736	48237736	+	3'UTR	DEL	A	-	-	rs78783628		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48237736delA	uc001rqm.2	-	11					VDR_uc001rql.2_3'UTR|VDR_uc001rqn.2_3'UTR|VDR_uc010slq.1_3'UTR	NM_001017535	NP_001017535			vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	52273192	52273196	+	IGR	DEL	AAAAC	-	-	rs10531779		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52273192_52273196delAAAAC								FIGNL2 (56984 upstream) : ANKRD33 (8597 downstream)																																			---	---	---	---
STAT6	6778	broad.mit.edu	37	12	57519174	57519174	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57519174delA	uc009zpg.2	-							NM_003153	NP_003144			signal transducer and activator of transcription						regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58902023	58902024	+	IGR	INS	-	TG	TG	rs142937595	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58902023_58902024insTG								XRCC6BP1 (550972 upstream) : LRIG3 (363914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59568185	59568185	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59568185delT								LRIG3 (253923 upstream) : SLC16A7 (421663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59621976	59621976	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59621976delG								LRIG3 (307714 upstream) : SLC16A7 (367872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	61976258	61976259	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61976258_61976259delAG								None (None upstream) : FAM19A2 (125784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63503159	63503159	+	IGR	DEL	T	-	-	rs112810405		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63503159delT								PPM1H (174244 upstream) : AVPR1A (37057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69243181	69243182	+	IGR	DEL	TG	-	-	rs66580822		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69243181_69243182delTG								MDM2 (3970 upstream) : CPM (1776 downstream)																																			---	---	---	---
CPM	1368	broad.mit.edu	37	12	69312197	69312197	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69312197delC	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079			carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)															---	---	---	---
LGR5	8549	broad.mit.edu	37	12	71948158	71948158	+	Intron	DEL	A	-	-	rs111744216		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71948158delA	uc001swl.2	+						LGR5_uc001swm.2_Intron|LGR5_uc001swn.1_Intron	NM_003667	NP_003658			leucine-rich repeat-containing G protein-coupled							integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	72639024	72639025	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72639024_72639025delTG								TPH2 (212803 upstream) : LOC283392 (17303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74666547	74666547	+	Intron	DEL	C	-	-	rs140773289	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74666547delC	uc009zrx.1	-						uc001sxc.2_Intron					Homo sapiens cDNA clone IMAGE:3926153, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	74915842	74915851	+	IGR	DEL	TGTGTGTGTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74915842_74915851delTGTGTGTGTG								None (None upstream) : ATXN7L3B (15700 downstream)																																			---	---	---	---
ZDHHC17	23390	broad.mit.edu	37	12	77168114	77168115	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77168114_77168115delAC	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151			huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	82299770	82299770	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82299770delT								PPFIA2 (146661 upstream) : CCDC59 (446320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89589389	89589390	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89589389_89589390delTC								KITLG (615151 upstream) : DUSP6 (152449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89720763	89720763	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89720763delA								KITLG (746525 upstream) : DUSP6 (21076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	95193261	95193261	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95193261delT								TMCC3 (148937 upstream) : MIR492 (34913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	95982948	95982948	+	IGR	DEL	A	-	-	rs76522846		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95982948delA								USP44 (37685 upstream) : NTN4 (68636 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100122304	100122304	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100122304delG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	105988618	105988619	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105988618_105988619delCT								C12orf75 (223323 upstream) : NUAK1 (468506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	107563362	107563369	+	IGR	DEL	ACACACAG	-	-	rs67897383		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107563362_107563369delACACACAG								CRY1 (75764 upstream) : BTBD11 (148828 downstream)																																			---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107781725	107781726	+	Intron	INS	-	CTC	CTC	rs149452400	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107781725_107781726insCTC	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108643948	108643949	+	3'UTR	INS	-	GT	GT	rs10665482		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108643948_108643949insGT	uc001tms.2	+	9					WSCD2_uc001tmt.2_3'UTR|WSCD2_uc001tmu.2_3'UTR	NM_014653	NP_055468			WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	109301833	109301834	+	IGR	INS	-	T	T	rs146883048	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109301833_109301834insT								DAO (7124 upstream) : SVOP (2824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	109814307	109814308	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109814307_109814308insT								FOXN4 (67282 upstream) : MYO1H (12216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	111818811	111818812	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111818811_111818812delAC								FAM109A (11886 upstream) : SH2B3 (24940 downstream)																																			---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112721760	112721760	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112721760delT	uc009zwc.2	-							NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	115055185	115055185	+	IGR	DEL	G	-	-	rs111796867		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115055185delG								TBX5 (208938 upstream) : TBX3 (52874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115299082	115299082	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115299082delT								TBX3 (177113 upstream) : None (None downstream)																																			---	---	---	---
TCTN2	79867	broad.mit.edu	37	12	124172778	124172779	+	Intron	INS	-	A	A	rs58689399		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124172778_124172779insA	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085			tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124371042	124371043	+	Intron	DEL	GT	-	-	rs67952135		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124371042_124371043delGT	uc001uft.3	+							NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125806022	125806022	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125806022delC								AACS (178150 upstream) : TMEM132B (5140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131880191	131880199	+	IGR	DEL	TGATGATGA	-	-	rs150166007		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131880191_131880199delTGATGATGA								LOC116437 (182716 upstream) : SFRS8 (315436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131962206	131962207	+	IGR	INS	-	ATA	ATA	rs147362464		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131962206_131962207insATA								LOC116437 (264731 upstream) : SFRS8 (233428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133053710	133053710	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133053710delC								GALNT9 (147805 upstream) : FBRSL1 (13447 downstream)																																			---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19643738	19643738	+	Intron	DEL	A	-	-	rs112391429		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19643738delA	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	24031544	24031544	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24031544delC								SACS (23703 upstream) : TNFRSF19 (113179 downstream)																																			---	---	---	---
ATP12A	479	broad.mit.edu	37	13	25258253	25258253	+	Intron	DEL	C	-	-	rs35009651		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25258253delC	uc001upp.2	+						ATP12A_uc010aaa.2_Intron	NM_001676	NP_001667			hydrogen/potassium-exchanging ATPase 12A						ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)											OREG0022297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	13	25783907	25783907	+	IGR	DEL	T	-	-	rs9507480	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25783907delT								FAM123A (37602 upstream) : MTMR6 (18400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	27782771	27782771	+	IGR	DEL	A	-	-	rs113571716		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27782771delA								USP12 (36742 upstream) : RPL21 (42921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	28372786	28372787	+	IGR	INS	-	T	T	rs143490307	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28372786_28372787insT								GSX1 (4697 upstream) : PDX1 (121381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30472055	30472056	+	IGR	DEL	GG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30472055_30472056delGG								UBL3 (47235 upstream) : KATNAL1 (304712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31652509	31652516	+	IGR	DEL	AAGGAAGA	-	-	rs148041842	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652509_31652516delAAGGAAGA								C13orf26 (103358 upstream) : HSPH1 (58249 downstream)																																			---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33315189	33315190	+	Intron	INS	-	T	T	rs2320470		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315189_33315190insT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36083511	36083512	+	Intron	DEL	AG	-	-	rs112003801		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36083511_36083512delAG	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc010teg.1_Intron	NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36638234	36638234	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36638234delT	uc001uvf.2	-							NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	39666797	39666797	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39666797delT								NHLRC3 (42555 upstream) : LHFP (250233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39860961	39860962	+	IGR	INS	-	A	A	rs148616790	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39860961_39860962insA								NHLRC3 (236719 upstream) : LHFP (56068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	44920752	44920754	+	IGR	DEL	GTT	-	-	rs66612442		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44920752_44920754delGTT								LOC121838 (316154 upstream) : SERP2 (27224 downstream)																																			---	---	---	---
SIAH3	283514	broad.mit.edu	37	13	46411695	46411698	+	Intron	DEL	GGAA	-	-	rs5803313	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46411695_46411698delGGAA	uc001vap.2	-							NM_198849	NP_942146			seven in absentia homolog 3						multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2																		---	---	---	---
CAB39L	81617	broad.mit.edu	37	13	50002764	50002764	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50002764delG	uc001vcx.2	-						CAB39L_uc010adf.2_Intron	NM_001079670	NP_001073138			calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)														---	---	---	---
PHF11	51131	broad.mit.edu	37	13	50084149	50084150	+	Intron	DEL	GT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50084149_50084150delGT	uc001vdb.2	+						PHF11_uc010tgl.1_Intron|PHF11_uc001vdc.2_Intron|PHF11_uc001vdd.2_Intron	NM_001040443	NP_001035533			PHD finger protein 11 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)														---	---	---	---
DLEU7	220107	broad.mit.edu	37	13	51340601	51340609	+	Intron	DEL	TCTTCCTTC	-	-	rs71678751		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51340601_51340609delTCTTCCTTC	uc001vex.2	-							NM_198989	NP_945340			deleted in lymphocytic leukemia, 7												0		Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	54794365	54794365	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54794365delG								None (None upstream) : MIR1297 (91742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59704481	59704481	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59704481delT								None (None upstream) : DIAPH3 (535244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63625086	63625094	+	IGR	DEL	TAGTGGAAT	-	-	rs66588106		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63625086_63625094delTAGTGGAAT								None (None upstream) : OR7E156P (686474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65741071	65741071	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65741071delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70791013	70791013	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70791013delT								ATXN8OS (77128 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73848825	73848828	+	IGR	DEL	AAGA	-	-	rs7318845		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73848825_73848828delAAGA								KLF5 (197150 upstream) : KLF12 (411322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75670737	75670737	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75670737delA								KLF12 (962343 upstream) : LOC647288 (141153 downstream)																																			---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76388860	76388860	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76388860delT	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Intron	NM_015842	NP_056667			LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	77374781	77374782	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77374781_77374782insT								LMO7 (940777 upstream) : KCTD12 (79522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78052278	78052279	+	IGR	INS	-	AC	AC	rs139819731	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78052278_78052279insAC								MYCBP2 (151101 upstream) : SCEL (57530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78364084	78364084	+	IGR	DEL	A	-	-	rs5804933		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78364084delA								SLAIN1 (25707 upstream) : EDNRB (105532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87932739	87932740	+	IGR	DEL	AG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87932739_87932740delAG								None (None upstream) : SLITRK5 (392130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89675353	89675353	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89675353delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90320017	90320017	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90320017delT								None (None upstream) : MIR622 (563419 downstream)																																			---	---	---	---
FARP1	10160	broad.mit.edu	37	13	99024719	99024720	+	Intron	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99024719_99024720delTC	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757			FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	100041107	100041107	+	IGR	DEL	G	-	-	rs35870266		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100041107delG								UBAC2 (2356 upstream) : TM9SF2 (112621 downstream)																																			---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101952718	101952719	+	Intron	INS	-	TTCC	TTCC	rs560750	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101952718_101952719insTTCC	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Intron|NALCN_uc001vpa.2_Intron	NM_052867	NP_443099			voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
ITGBL1	9358	broad.mit.edu	37	13	102343892	102343892	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102343892delT	uc001vpb.2	+						ITGBL1_uc010agb.2_Intron|ITGBL1_uc001vpc.3_Intron	NM_004791	NP_004782			integrin, beta-like 1 (with EGF-like repeat						cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102450084	102450085	+	Intron	INS	-	AT	AT	rs150559894	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102450084_102450085insAT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106			fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
TNFSF13B	10673	broad.mit.edu	37	13	108955485	108955486	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108955485_108955486insT	uc001vqr.2	+						TNFSF13B_uc010agj.2_Intron|TNFSF13B_uc001vqs.1_Intron	NM_006573	NP_006564			tumor necrosis factor superfamily, member 13b						cell proliferation|immune response|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity|tumor necrosis factor receptor binding				0	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)															---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109610735	109610735	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109610735delA	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc001vqu.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109660662	109660663	+	Intron	DEL	TA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109660662_109660663delTA	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc001vqu.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	110744651	110744651	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110744651delC								IRS2 (305737 upstream) : COL4A1 (56660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112850719	112850726	+	IGR	DEL	GGTTCCCT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850719_112850726delGGTTCCCT								SOX1 (124699 upstream) : C13orf28 (179943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	114026191	114026191	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114026191delC								GRTP1 (7728 upstream) : ADPRHL1 (50069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19010301	19010302	+	IGR	INS	-	C	C	rs146464832		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19010301_19010302insC								None (None upstream) : OR11H12 (367292 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19098325	19098325	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19098325delA								None (None upstream) : OR11H12 (279269 downstream)																																			---	---	---	---
POTEG	404785	broad.mit.edu	37	14	19551479	19551479	+	5'Flank	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19551479delT	uc001vuz.1	+						POTEG_uc001vva.1_5'Flank|POTEG_uc010ahc.1_5'Flank	NM_001005356	NP_001005356			POTE ankyrin domain family, member G											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	19590184	19590185	+	IGR	INS	-	AA	AA	rs4315277	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19590184_19590185insAA								POTEG (5242 upstream) : P704P (393769 downstream)																																			---	---	---	---
FLJ10357	55701	broad.mit.edu	37	14	21554542	21554542	+	Intron	DEL	T	-	-	rs140996694		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21554542delT	uc001vzp.2	+						FLJ10357_uc001vzo.1_3'UTR|FLJ10357_uc010aij.2_Intron|FLJ10357_uc010tln.1_Intron	NM_018071	NP_060541			hypothetical protein LOC55701						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	23586078	23586079	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23586078_23586079insT								C14orf119 (16414 upstream) : CEBPE (436 downstream)																																			---	---	---	---
IL25	64806	broad.mit.edu	37	14	23842810	23842811	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23842810_23842811insT	uc001wjr.2	+						IL25_uc001wjq.2_Intron	NM_022789	NP_073626			interleukin 25 isoform 1 precursor						inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding			ovary(1)	1	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	30932686	30932687	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30932686_30932687insA								PRKD1 (535787 upstream) : G2E3 (95642 downstream)																																			---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32249444	32249445	+	Intron	INS	-	T	T	rs71430994		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32249444_32249445insT	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428			nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	32475396	32475398	+	IGR	DEL	TCC	-	-	rs5807642		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32475396_32475398delTCC								NUBPL (144979 upstream) : C14orf128 (69228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	32652964	32652965	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32652964_32652965insT								ARHGAP5 (24032 upstream) : AKAP6 (145514 downstream)																																			---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32821278	32821279	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32821278_32821279delTG	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32992679	32992679	+	Intron	DEL	T	-	-	rs74452541		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32992679delT	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33192762	33192765	+	Intron	DEL	TTTA	-	-	rs2383374		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33192762_33192765delTTTA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	33313474	33313475	+	IGR	INS	-	CCTC	CCTC	rs141072406	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33313474_33313475insCCTC								AKAP6 (11207 upstream) : NPAS3 (94984 downstream)																																			---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	34010302	34010303	+	Intron	INS	-	GT	GT	rs140503260	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34010302_34010303insGT	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34972262	34972265	+	IGR	DEL	GTGT	-	-	rs67270619		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34972262_34972265delGTGT								C14orf147 (40794 upstream) : EAPP (12870 downstream)																																			---	---	---	---
BAZ1A	11177	broad.mit.edu	37	14	35268824	35268824	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35268824delT	uc001wsk.2	-						BAZ1A_uc001wsl.2_Intron	NM_013448	NP_038476			bromodomain adjacent to zinc finger domain, 1A						chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	37094792	37094792	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37094792delA								NKX2-8 (43006 upstream) : PAX9 (31990 downstream)																																			---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37229537	37229548	+	Intron	DEL	GAAGGAAGGAAG	-	-	rs10525656		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37229537_37229548delGAAGGAAGGAAG	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37282571	37282572	+	Intron	INS	-	T	T	rs141945314		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37282571_37282572insT	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
MIPOL1	145282	broad.mit.edu	37	14	37671590	37671591	+	Intron	DEL	AC	-	-	rs112529473		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37671590_37671591delAC	uc001wuc.2	+						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Intron|MIPOL1_uc001wud.2_Intron|MIPOL1_uc010ams.2_Intron|MIPOL1_uc001wue.2_Intron|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059			mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	42454163	42454164	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42454163_42454164delTG								LRFN5 (80413 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	51700259	51700259	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51700259delA								TRIM9 (137837 upstream) : TMX1 (6627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	52571034	52571039	+	IGR	DEL	GTGTGC	-	-	rs35395186		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52571034_52571039delGTGTGC								NID2 (35088 upstream) : PTGDR (163392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	52860550	52860550	+	IGR	DEL	C	-	-	rs11311847		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52860550delC								PTGER2 (65230 upstream) : TXNDC16 (36759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54204302	54204305	+	IGR	DEL	GAAA	-	-	rs71829926		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54204302_54204305delGAAA								DDHD1 (584256 upstream) : BMP4 (212152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57347904	57347906	+	Intron	DEL	AGA	-	-	rs34729917		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57347904_57347906delAGA	uc001xcr.1	+											Homo sapiens cDNA clone IMAGE:5492202, partial cds.																														---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58729284	58729284	+	Intron	DEL	T	-	-	rs35550068		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58729284delT	uc010tro.1	-						PSMA3_uc001xdj.1_Intron|PSMA3_uc001xdk.1_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	60416290	60416290	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60416290delG	uc001xep.1	+											Homo sapiens cDNA FLJ46156 fis, clone TESTI4001569.																														---	---	---	---
PRKCH	5583	broad.mit.edu	37	14	61754432	61754432	+	Intron	DEL	A	-	-	rs75623044		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61754432delA	uc010tsa.1	+							NM_006255	NP_006246			protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	62372494	62372494	+	IGR	DEL	G	-	-	rs67392436		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62372494delG								SNAPC1 (109349 upstream) : SYT16 (81309 downstream)																																			---	---	---	---
PPP2R5E	5529	broad.mit.edu	37	14	63863083	63863083	+	Intron	DEL	G	-	-	rs147486951	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63863083delG	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron	NM_006246	NP_006237			epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)														---	---	---	---
DNAL1	83544	broad.mit.edu	37	14	74135990	74135991	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74135990_74135991insT	uc001xoq.3	+						DNAL1_uc010aru.2_Intron|DNAL1_uc010arv.2_Intron	NM_031427	NP_113615			axonemal dynein light chain 1												0				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74864603	74864603	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74864603delA								C14orf115 (37893 upstream) : TMEM90A (7993 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79431211	79431211	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79431211delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	85078057	85078057	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85078057delG								None (None upstream) : FLRT2 (918431 downstream)																																			---	---	---	---
PTPN21	11099	broad.mit.edu	37	14	88958931	88958931	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88958931delC	uc001xwv.3	-						PTPN21_uc010twc.1_Intron	NM_007039	NP_008970			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4																OREG0022858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89730402	89730403	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89730402_89730403insA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
TTC7B	145567	broad.mit.edu	37	14	91108277	91108278	+	Intron	DEL	GC	-	-	rs67276326	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91108277_91108278delGC	uc001xyp.2	-						TTC7B_uc001xyo.2_Intron|TTC7B_uc010ats.2_Intron|uc001xyq.2_5'Flank	NM_001010854	NP_001010854			tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)																---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92308321	92308321	+	Intron	DEL	T	-	-	rs141430957		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92308321delT	uc001xzv.3	-							NM_001128596	NP_001122068			tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
RIN3	79890	broad.mit.edu	37	14	92984995	92984995	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92984995delA	uc001yap.2	+						RIN3_uc010auk.2_Intron	NM_024832	NP_079108			Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)																---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93514178	93514178	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93514178delG	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031			inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94043569	94043570	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94043569_94043570insA	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
TCL1A	8115	broad.mit.edu	37	14	96177805	96177805	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96177805delA	uc001yfc.3	-						TCL1A_uc001yfb.3_Intron	NM_001098725	NP_001092195			T-cell leukemia/lymphoma 1A						multicellular organismal development	endoplasmic reticulum|microsome				lung(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)				T	TRA@	T-CLL								---	---	---	---
Unknown	0	broad.mit.edu	37	14	96597232	96597233	+	IGR	INS	-	TAA	TAA	rs147847551	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96597232_96597233insTAA								C14orf132 (37099 upstream) : BDKRB2 (73902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97132520	97132520	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97132520delT								PAPOLA (99074 upstream) : VRK1 (131164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98184207	98184207	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98184207delT								VRK1 (836257 upstream) : C14orf64 (207740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98311208	98311211	+	IGR	DEL	GAAG	-	-	rs111619571	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98311208_98311211delGAAG								VRK1 (963258 upstream) : C14orf64 (80736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	101067735	101067736	+	IGR	INS	-	T	T	rs144531738	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101067735_101067736insT								BEGAIN (31604 upstream) : C14orf70 (55869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	101756629	101756630	+	IGR	DEL	AC	-	-	rs74081307		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101756629_101756630delAC								MIR656 (223491 upstream) : DIO3OS (261930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	103561831	103561845	+	IGR	DEL	GAGGGGCTGAGGTCA	-	-	rs56081944		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103561831_103561845delGAGGGGCTGAGGTCA								CDC42BPB (38089 upstream) : C14orf73 (4636 downstream)																																			---	---	---	---
MARK3	4140	broad.mit.edu	37	14	103905329	103905330	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103905329_103905330insA	uc001ymz.3	+						MARK3_uc001ymx.3_Intron|MARK3_uc001ymw.3_Intron|MARK3_uc001yna.3_Intron|MARK3_uc001ymy.3_Intron|MARK3_uc010awp.2_Intron	NM_001128918	NP_001122390			MAP/microtubule affinity-regulating kinase 3								ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	105006800	105006804	+	IGR	DEL	TCTTC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105006800_105006804delTCTTC								KIF26A (359566 upstream) : C14orf180 (39252 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106097365	106097385	+	Intron	DEL	CAGGAAGTGTCCAGCGTGGAC	-	-	rs71960640	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106097365_106097385delCAGGAAGTGTCCAGCGTGGAC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yry.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106806233	106806233	+	Intron	DEL	A	-	-	rs2015906		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106806233delA	uc010tyt.1	-						uc001ysw.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107183217	107183217	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107183217delC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107191514	107191515	+	Intron	INS	-	T	T	rs139140849	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107191514_107191515insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20035477	20035479	+	IGR	DEL	AAC	-	-	rs138212091		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20035477_20035479delAAC								None (None upstream) : GOLGA6L6 (701615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20038342	20038342	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20038342delA								None (None upstream) : GOLGA6L6 (698752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20567734	20567735	+	IGR	INS	-	A	A	rs148716792	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20567734_20567735insA								None (None upstream) : GOLGA6L6 (169359 downstream)																																			---	---	---	---
BCL8	606	broad.mit.edu	37	15	20877051	20877053	+	Intron	DEL	GAT	-	-	rs149283251		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20877051_20877053delGAT	uc010tze.1	-						BCL8_uc010tzd.1_5'Flank	NR_027992				RecName: Full=Putative protein BCL8;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	29917075	29917076	+	IGR	INS	-	TGTG	TGTG	rs143636832	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29917075_29917076insTGTG								FAM189A1 (54148 upstream) : TJP1 (75283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36749321	36749324	+	IGR	DEL	ACAT	-	-	rs66473257		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36749321_36749324delACAT								ATPBD4 (910917 upstream) : C15orf41 (122488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36785145	36785145	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36785145delA								ATPBD4 (946741 upstream) : C15orf41 (86667 downstream)																																			---	---	---	---
DNAJC17	55192	broad.mit.edu	37	15	41081649	41081649	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41081649delC	uc001zms.1	-						DNAJC17_uc010bbz.1_Intron|DNAJC17_uc010bca.1_Intron|DNAJC17_uc010bcb.1_Intron	NM_018163	NP_060633			DnaJ (Hsp40) homolog, subfamily C, member 17						protein folding		heat shock protein binding|nucleotide binding|RNA binding|unfolded protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	43600183	43600183	+	IGR	DEL	T	-	-	rs138646106		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43600183delT								TGM7 (5730 upstream) : LCMT2 (19793 downstream)																																			---	---	---	---
PPIP5K1	9677	broad.mit.edu	37	15	43838212	43838212	+	Intron	DEL	A	-	-	rs12910639	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43838212delA	uc001zrw.2	-						PPIP5K1_uc001zrx.1_Intron|PPIP5K1_uc001zru.2_Intron|PPIP5K1_uc001zry.3_Intron|PPIP5K1_uc001zrv.2_Intron	NM_001130858	NP_001124330			histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0																		---	---	---	---
GATM	2628	broad.mit.edu	37	15	45672448	45672449	+	5'Flank	DEL	AA	-	-	rs35353298		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45672448_45672449delAA	uc001zvb.2	-						GATM_uc001zvc.2_5'Flank|GATM_uc010uev.1_5'Flank|uc001zvd.2_Intron					RecName: Full=Glycine amidinotransferase, mitochondrial;          EC=2.1.4.1; AltName: Full=L-arginine:glycine amidinotransferase; AltName: Full=Transamidinase; AltName: Full=AT; Flags: Precursor;						creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)													---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48058484	48058484	+	Intron	DEL	G	-	-	rs528882	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058484delG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871			semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	49374693	49374693	+	IGR	DEL	A	-	-	rs72169125		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49374693delA								SECISBP2L (36063 upstream) : COPS2 (42780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	53556087	53556088	+	IGR	DEL	TT	-	-	rs71732791		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53556087_53556088delTT								ONECUT1 (473878 upstream) : WDR72 (249850 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54566257	54566258	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54566257_54566258insT	uc002ack.2	+						UNC13C_uc002acl.2_Intron	NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
ZNF280D	54816	broad.mit.edu	37	15	57049915	57049916	+	Intron	INS	-	GAAT	GAAT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57049915_57049916insGAAT	uc002adw.1	-							NM_001002843	NP_001002843			suppressor of hairy wing homolog 4 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)														---	---	---	---
TCF12	6938	broad.mit.edu	37	15	57460693	57460694	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57460693_57460694insT	uc002aec.2	+						TCF12_uc010ugm.1_Intron|TCF12_uc010ugn.1_Intron|TCF12_uc002aea.2_Intron|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Intron|TCF12_uc002aed.2_Intron	NM_207038	NP_996921			transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)				T	TEC	extraskeletal myxoid chondrosarcoma								---	---	---	---
RORA	6095	broad.mit.edu	37	15	61460415	61460416	+	Intron	DEL	GC	-	-	rs11637398	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61460415_61460416delGC	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	62490736	62490736	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62490736delG								C2CD4B (33254 upstream) : MGC15885 (438635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62668485	62668485	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62668485delA								C2CD4B (211003 upstream) : MGC15885 (260886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63763049	63763052	+	IGR	DEL	AGCC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63763049_63763052delAGCC								CA12 (88974 upstream) : USP3 (33758 downstream)																																			---	---	---	---
ZNF609	23060	broad.mit.edu	37	15	64955464	64955464	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64955464delA	uc002ann.2	+							NM_015042	NP_055857			zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
DPP8	54878	broad.mit.edu	37	15	65752812	65752813	+	Intron	DEL	AC	-	-	rs139355535		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65752812_65752813delAC	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron|DPP8_uc010bhi.2_Intron|DPP8_uc010bhk.1_Intron	NM_130434	NP_569118			dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1																		---	---	---	---
MEGF11	84465	broad.mit.edu	37	15	66512865	66512866	+	Intron	DEL	TT	-	-	rs146331148		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66512865_66512866delTT	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821			multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1																		---	---	---	---
TIPIN	54962	broad.mit.edu	37	15	66642628	66642628	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66642628delA	uc002apr.2	-						TIPIN_uc010ujn.1_Intron|TIPIN_uc010ujo.1_Intron|SCARNA14_uc010bhp.1_5'Flank	NM_017858	NP_060328			TIMELESS interacting protein						cell division|DNA replication checkpoint|intra-S DNA damage checkpoint|mitosis|positive regulation of cell proliferation|regulation of DNA replication involved in S phase|replication fork protection	cytoplasm|nuclear chromatin	protein binding			ovary(1)	1																		---	---	---	---
TIPIN	54962	broad.mit.edu	37	15	66651513	66651514	+	5'Flank	DEL	AC	-	-	rs34819845		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66651513_66651514delAC	uc002apr.2	-						TIPIN_uc010ujo.1_5'Flank	NM_017858	NP_060328			TIMELESS interacting protein						cell division|DNA replication checkpoint|intra-S DNA damage checkpoint|mitosis|positive regulation of cell proliferation|regulation of DNA replication involved in S phase|replication fork protection	cytoplasm|nuclear chromatin	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	67259603	67259603	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67259603delC								SMAD6 (185268 upstream) : SMAD3 (98592 downstream)																																			---	---	---	---
ANP32A	8125	broad.mit.edu	37	15	69092028	69092028	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69092028delA	uc002arl.2	-							NM_006305	NP_006296			acidic (leucine-rich) nuclear phosphoprotein 32						intracellular signal transduction|mRNA metabolic process|nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	70699346	70699347	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70699346_70699347insA								TLE3 (309090 upstream) : UACA (247548 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71757131	71757131	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71757131delC	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
MPI	4351	broad.mit.edu	37	15	75186964	75186965	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75186964_75186965insA	uc002azc.1	+						MPI_uc010ulv.1_Intron|MPI_uc010ulw.1_Intron|MPI_uc002azd.1_Intron|MPI_uc010ulx.1_Intron|MPI_uc002aze.1_Intron	NM_002435	NP_002426			mannose-6- phosphate isomerase						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
SIN3A	25942	broad.mit.edu	37	15	75702784	75702784	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75702784delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292			transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5																		---	---	---	---
ACSBG1	23205	broad.mit.edu	37	15	78492000	78492001	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78492000_78492001insT	uc002bdh.2	-						ACSBG1_uc010umw.1_Intron|ACSBG1_uc010umx.1_Intron|ACSBG1_uc010umy.1_Intron	NM_015162	NP_055977			lipidosin						long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
MORF4L1	10933	broad.mit.edu	37	15	79177552	79177552	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79177552delT	uc002bel.2	+						MORF4L1_uc010bli.1_Intron|MORF4L1_uc010blj.1_Intron|MORF4L1_uc002bem.2_Intron|MORF4L1_uc010une.1_Intron	NM_206839	NP_996670			MORF-related gene 15 isoform 2						double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79278694	79278694	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79278694delT	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	79456010	79456013	+	IGR	DEL	TTCT	-	-	rs10592830		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79456010_79456013delTTCT								RASGRF1 (72795 upstream) : MIR184 (46117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	79477728	79477731	+	IGR	DEL	CTTG	-	-	rs146430112		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79477728_79477731delCTTG								RASGRF1 (94513 upstream) : MIR184 (24399 downstream)																																			---	---	---	---
ALPK3	57538	broad.mit.edu	37	15	85416064	85416065	+	3'UTR	INS	-	TT	TT	rs150575068	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85416064_85416065insTT	uc002ble.2	+	14					ALPK3_uc010upc.1_3'UTR	NM_020778	NP_065829			alpha-kinase 3						heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	86468208	86468208	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86468208delC								KLHL25 (130019 upstream) : AGBL1 (217034 downstream)																																			---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87147066	87147068	+	Intron	DEL	TTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87147066_87147068delTTG	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87410557	87410557	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87410557delC	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88757923	88757923	+	Intron	DEL	C	-	-	rs59382574		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88757923delC	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010bnh.1_Intron|NTRK3_uc002bmg.2_Intron	NM_001012338	NP_001012338			neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90485213	90485213	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90485213delC								AP3S2 (28991 upstream) : ZNF710 (59539 downstream)																																			---	---	---	---
PRC1	9055	broad.mit.edu	37	15	91523763	91523764	+	Intron	INS	-	G	G	rs28584391		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91523763_91523764insG	uc002bqm.2	-						PRC1_uc002bqn.2_Intron|PRC1_uc002bqo.2_Intron|PRC1_uc010uqs.1_Intron	NM_003981	NP_003972			protein regulator of cytokinesis 1 isoform 1						cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)																	---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92400260	92400261	+	Intron	DEL	GT	-	-	rs71465714		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92400260_92400261delGT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93531313	93531313	+	Intron	DEL	T	-	-	rs71467747		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93531313delT	uc002bsp.2	+						CHD2_uc002bso.1_Intron	NM_001271	NP_001262			chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93534378	93534379	+	Intron	DEL	AC	-	-	rs35199180		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93534378_93534379delAC	uc002bsp.2	+						CHD2_uc002bso.1_Intron	NM_001271	NP_001262			chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	95553936	95553936	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95553936delA								MCTP2 (526756 upstream) : LOC145820 (422386 downstream)																																			---	---	---	---
NR2F2	7026	broad.mit.edu	37	15	96882026	96882028	+	3'UTR	DEL	TAT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96882026_96882028delTAT	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285			nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	96920150	96920173	+	IGR	DEL	TCTTTCTTTCTTTCTTTCTTTCTT	-	-	rs72101969		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96920150_96920173delTCTTTCTTTCTTTCTTTCTTTCTT								NR2F2 (36660 upstream) : SPATA8 (406506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98158585	98158585	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98158585delC								SPATA8 (829741 upstream) : LOC91948 (127261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98724192	98724192	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98724192delC								ARRDC4 (207125 upstream) : FAM169B (256199 downstream)																																			---	---	---	---
TTC23	64927	broad.mit.edu	37	15	99729788	99729789	+	Intron	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99729788_99729789delCA	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056			tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	101364255	101364255	+	IGR	DEL	G	-	-	rs78922159		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101364255delG								ASB7 (172353 upstream) : ALDH1A3 (55754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	102152000	102152001	+	IGR	INS	-	T	T	rs141773235	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102152000_102152001insT								PCSK6 (121813 upstream) : TM2D3 (21179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	102521236	102521237	+	5'Flank	INS	-	G	G	rs143531199		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102521236_102521237insG	uc010utv.1	-						uc002cds.2_5'Flank|uc010utw.1_5'Flank					SubName: Full=DEAD/H box polypeptide 11 like 9;																														---	---	---	---
ADCY9	115	broad.mit.edu	37	16	4161411	4161411	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4161411delT	uc002cvx.2	-							NM_001116	NP_001107			adenylate cyclase 9						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17469339	17469340	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17469339_17469340delAC	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17914562	17914562	+	IGR	DEL	T	-	-	rs146239345		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17914562delT								XYLT1 (349824 upstream) : NOMO2 (596621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18020933	18020933	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18020933delG								XYLT1 (456195 upstream) : NOMO2 (490250 downstream)																																			---	---	---	---
SMG1	23049	broad.mit.edu	37	16	18917509	18917509	+	Intron	DEL	A	-	-	rs112861120		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18917509delA	uc002dfm.2	-							NM_015092	NP_055907			PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	18945323	18945324	+	IGR	INS	-	TTTC	TTTC	rs140620652	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18945323_18945324insTTTC								SMG1 (7597 upstream) : TMC7 (49932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18960566	18960567	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18960566_18960567insA								SMG1 (22840 upstream) : TMC7 (34689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20090984	20090984	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20090984delG								GPR139 (5884 upstream) : GP2 (230828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20729245	20729250	+	IGR	DEL	AGGAGA	-	-	rs111861355		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20729245_20729250delAGGAGA								ACSM1 (20179 upstream) : THUMPD1 (15741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	21590723	21590723	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21590723delA	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21779288	21779289	+	Intron	DEL	AG	-	-	rs56940271		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21779288_21779289delAG	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
RRN3P1	730092	broad.mit.edu	37	16	21828346	21828346	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21828346delT	uc010vbl.1	-						uc002diq.3_Intron|RRN3P1_uc002djl.2_Intron	NR_003370				SubName: Full=Putative uncharacterized protein ENSP00000219758;												0																		---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22158090	22158090	+	Intron	DEL	A	-	-	rs77298018		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22158090delA	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc002dkg.3_Intron|VWA3A_uc010bxe.1_Intron	NM_173615	NP_775886			von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22674647	22674648	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22674647_22674648insT								LOC653786 (86461 upstream) : HS3ST2 (151212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22685469	22685474	+	IGR	DEL	TCTTTC	-	-	rs149140605	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22685469_22685474delTCTTTC								LOC653786 (97283 upstream) : HS3ST2 (140386 downstream)																																			---	---	---	---
GGA2	23062	broad.mit.edu	37	16	23498305	23498306	+	Intron	INS	-	TTT	TTT	rs116219854		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23498305_23498306insTTT	uc002dlq.2	-						GGA2_uc010bxo.1_Intron	NM_015044	NP_055859			ADP-ribosylation factor binding protein 2						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|clathrin-coated vesicle|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.0386)														---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	23945343	23945350	+	Intron	DEL	CATCCATC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23945343_23945350delCATCCATC	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	25300771	25300774	+	IGR	DEL	TTCT	-	-	rs8044599		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25300771_25300774delTTCT								ZKSCAN2 (31916 upstream) : HS3ST4 (402573 downstream)																																			---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25869220	25869221	+	Intron	INS	-	CTTC	CTTC	rs72453395		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25869220_25869221insCTTC	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	26035549	26035550	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26035549_26035550insA	uc002dof.2	+						hsa-mir-548w|MI0014222_5'Flank	NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	26825006	26825006	+	IGR	DEL	A	-	-	rs62031287		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26825006delA								HS3ST4 (675998 upstream) : C16orf82 (253213 downstream)																																			---	---	---	---
RABEP2	79874	broad.mit.edu	37	16	28934748	28934749	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28934748_28934749insA	uc002drq.2	-						uc010vct.1_Intron|RABEP2_uc010vdf.1_Intron|RABEP2_uc010byn.2_Intron|RABEP2_uc002drr.2_Intron	NM_024816	NP_079092			rabaptin, RAB GTPase binding effector protein 2						endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29866795	29866796	+	Intron	INS	-	T	T	rs142368387	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29866795_29866796insT	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31656282	31656282	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31656282delG								CSDAP1 (75437 upstream) : KIAA0664P3 (55652 downstream)																																			---	---	---	---
ZNF720	124411	broad.mit.edu	37	16	31760332	31760332	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31760332delA	uc002ecn.3	+						ZNF720_uc010vfs.1_Intron|ZNF720_uc002eco.2_Intron|ZNF720_uc002ecp.1_Intron|ZNF720_uc002ecq.2_Intron	NM_001130913	NP_001124385			zinc finger protein 720						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32265175	32265176	+	RNA	DEL	TT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32265175_32265176delTT	uc002ecy.2	+	2		c.427_428delTT			uc010cav.1_Intron					Homo sapiens mRNA for TP53TG3b, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	32545108	32545109	+	IGR	INS	-	C	C	rs150722905	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32545108_32545109insC								HERC2P4 (381234 upstream) : TP53TG3B (139732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32547649	32547655	+	IGR	DEL	ACTGTCC	-	-	rs140282941		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32547649_32547655delACTGTCC								HERC2P4 (383775 upstream) : TP53TG3B (137186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32817388	32817389	+	IGR	INS	-	TT	TT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817388_32817389insTT								TP53TG3B (128510 upstream) : SLC6A10P (71408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32830554	32830555	+	IGR	INS	-	A	A	rs147475511		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32830554_32830555insA								TP53TG3B (141676 upstream) : SLC6A10P (58242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33313228	33313228	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33313228delT	uc002edq.2	-											Homo sapiens similar to protein phosphatase 2A 48 kDa regulatory subunit isoform 1; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit; PP2A, subunit B, PR48 isoform; PP2A B subunit PR48; NY-REN-8 antigen, mRNA (cDNA clone IMAGE:5272051).																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	33471951	33471952	+	IGR	INS	-	A	A	rs150527934	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33471951_33471952insA								SLC6A10P (575488 upstream) : MIR1826 (493556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33532135	33532135	+	IGR	DEL	T	-	-	rs112724141		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33532135delT								SLC6A10P (635672 upstream) : MIR1826 (433373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33535747	33535748	+	IGR	DEL	AC	-	-	rs142655542		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33535747_33535748delAC								SLC6A10P (639284 upstream) : MIR1826 (429760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33866052	33866052	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33866052delC								SLC6A10P (969589 upstream) : MIR1826 (99456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33934069	33934070	+	IGR	INS	-	GAT	GAT	rs143490527		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33934069_33934070insGAT								None (None upstream) : MIR1826 (31438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33955493	33955494	+	IGR	DEL	CC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33955493_33955494delCC								None (None upstream) : MIR1826 (10014 downstream)																																			---	---	---	---
ANKRD26P1	124149	broad.mit.edu	37	16	46533195	46533196	+	Intron	INS	-	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46533195_46533196insG	uc002eeb.3	-						ANKRD26P1_uc010cbd.2_Intron	NR_026556				Homo sapiens cDNA FLJ43980 fis, clone TESTI4018806.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	46881193	46881193	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46881193delA								C16orf87 (16119 upstream) : GPT2 (37115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	48742710	48742710	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48742710delT								N4BP1 (98590 upstream) : CBLN1 (569501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49511442	49511445	+	IGR	DEL	AAGA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49511442_49511445delAAGA								C16orf78 (78125 upstream) : ZNF423 (13077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50448315	50448315	+	IGR	DEL	T	-	-	rs145851523	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50448315delT								BRD7 (45486 upstream) : NKD1 (133926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52901285	52901300	+	IGR	DEL	ATAGATAGATAGATAG	-	-	rs67114351	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52901285_52901300delATAGATAGATAGATAG								TOX3 (319571 upstream) : CHD9 (187645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54550677	54550678	+	IGR	INS	-	A	A	rs144317929	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54550677_54550678insA								IRX3 (230299 upstream) : IRX5 (414433 downstream)																																			---	---	---	---
NUP93	9688	broad.mit.edu	37	16	56763592	56763592	+	5'Flank	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56763592delC	uc002eka.2	+							NM_014669	NP_055484			nucleoporin 93kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
CIAPIN1	57019	broad.mit.edu	37	16	57464912	57464912	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57464912delT	uc002ell.1	-						CIAPIN1_uc002elk.1_Intron|CIAPIN1_uc002elm.1_Intron|CIAPIN1_uc002eln.1_Intron|CIAPIN1_uc010cda.1_Intron|CIAPIN1_uc002elo.1_Intron	NM_020313	NP_064709			cytokine induced apoptosis inhibitor 1						anti-apoptosis|apoptosis	cytoplasm|nucleolus					0																		---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57926561	57926561	+	Intron	DEL	A	-	-	rs35804354		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57926561delA	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288			cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	60279536	60279537	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60279536_60279537insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62169901	62169901	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62169901delA								CDH8 (99865 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62208927	62208928	+	IGR	INS	-	T	T	rs34094227		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62208927_62208928insT								CDH8 (138891 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63627340	63627345	+	IGR	DEL	ACACAT	-	-	rs28753980	byFrequency	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63627340_63627345delACACAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64007152	64007153	+	IGR	INS	-	GTGT	GTGT	rs142510219	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64007152_64007153insGTGT								None (None upstream) : CDH11 (973532 downstream)																																			---	---	---	---
CCDC79	283847	broad.mit.edu	37	16	66796592	66796592	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66796592delT	uc010viv.1	-						CCDC79_uc002eqc.1_Intron	NM_001136505	NP_001129977			coiled-coil domain containing 79						regulation of transcription, DNA-dependent		DNA binding				0																		---	---	---	---
HSD11B2	3291	broad.mit.edu	37	16	67467627	67467632	+	Intron	DEL	ACACAT	-	-	rs58877700		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67467627_67467632delACACAT	uc002etd.2	+							NM_000196	NP_000187			hydroxysteroid (11-beta) dehydrogenase 2						glucocorticoid biosynthetic process	endoplasmic reticulum|microsome					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)	NADH(DB00157)													---	---	---	---
CYB5B	80777	broad.mit.edu	37	16	69455585	69455585	+	5'Flank	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69455585delG	uc002exg.1	+						CYB5B_uc002exf.2_5'Flank|CYB5B_uc010cfl.1_5'Flank	NM_030579	NP_085056			cytochrome b5 outer mitochondrial membrane						electron transport chain|transport	integral to membrane|mitochondrial outer membrane	heme binding				0		Ovarian(137;0.101)																---	---	---	---
PHLPP2	23035	broad.mit.edu	37	16	71689993	71689993	+	Intron	DEL	C	-	-	rs76176186		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71689993delC	uc002fax.2	-						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Intron	NM_015020	NP_055835			PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	73699567	73699567	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73699567delA								HTA (571897 upstream) : PSMD7 (631114 downstream)																																			---	---	---	---
VAT1L	57687	broad.mit.edu	37	16	77892215	77892215	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77892215delA	uc002ffg.1	+							NM_020927	NP_065978			vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
C16orf46	123775	broad.mit.edu	37	16	81087883	81087883	+	Intron	DEL	C	-	-	rs62054595		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81087883delC	uc010chf.2	-							NM_001100873	NP_001094343			chromosome 16 open reading frame 46 isoform 1												0																		---	---	---	---
BANP	54971	broad.mit.edu	37	16	87982740	87982740	+	5'Flank	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87982740delG	uc010vow.1	+						BANP_uc002fkp.2_5'Flank|BANP_uc002fkq.2_5'Flank|BANP_uc002fks.3_5'Flank|BANP_uc002fko.1_5'Flank|BANP_uc010vov.1_5'Flank	NM_017869	NP_060339			BTG3 associated nuclear protein isoform a						cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0				BRCA - Breast invasive adenocarcinoma(80;0.00551)														---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89493930	89493931	+	Intron	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89493930_89493931insC	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	89669583	89669584	+	IGR	INS	-	TGCATGTGTGTGCA	TGCATGTGTGTGCA	rs149366615	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89669583_89669584insTGCATGTGTGTGCA								CPNE7 (5930 upstream) : DPEP1 (10132 downstream)																																			---	---	---	---
NXN	64359	broad.mit.edu	37	17	744683	744684	+	Intron	INS	-	C	C	rs146246056		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:744683_744684insC	uc002fsa.2	-						NXN_uc002fsb.1_Intron|NXN_uc002frz.2_Intron|NXN_uc010vqe.1_Intron	NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
ABR	29	broad.mit.edu	37	17	981345	981346	+	Intron	DEL	GT	-	-	rs72337293		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:981345_981346delGT	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
TUSC5	286753	broad.mit.edu	37	17	1182046	1182047	+	5'Flank	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1182046_1182047delCA	uc002fsi.1	+							NM_172367	NP_758955			LOST1						response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
MYO1C	4641	broad.mit.edu	37	17	1386094	1386095	+	Intron	INS	-	CACTGA	CACTGA	rs8065536	by1000genomes;by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1386094_1386095insCACTGA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248			myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
MIR1253	100302208	broad.mit.edu	37	17	2651727	2651730	+	5'Flank	DEL	TGTG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2651727_2651730delTGTG	hsa-mir-1253|MI0006387	-																							0																		---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2719530	2719531	+	Intron	INS	-	TT	TT	rs8075081	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2719530_2719531insTT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900			RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
TRPV3	162514	broad.mit.edu	37	17	3433670	3433671	+	Intron	INS	-	GCACAAAGCTT	GCACAAAGCTT	rs141342749	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3433670_3433671insGCACAAAGCTT	uc002fvt.1	-						TRPV3_uc002fvs.1_Intron|TRPV3_uc010vrh.1_Intron|TRPV3_uc010vri.1_Intron|TRPV3_uc010vrj.1_Intron|TRPV3_uc010vrk.1_Intron|TRPV3_uc010vrl.1_Intron|TRPV3_uc010vrm.1_Intron|TRPV3_uc002fvr.2_Intron|TRPV3_uc002fvu.2_Intron|TRPV3_uc010vrn.1_5'Flank	NM_145068	NP_659505			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)													---	---	---	---
C17orf85	55421	broad.mit.edu	37	17	3730242	3730243	+	Intron	INS	-	GCA	GCA	rs149113880	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3730242_3730243insGCA	uc010ckl.1	-						C17orf85_uc002fwr.2_Intron|C17orf85_uc002fwq.2_Intron	NM_001114118	NP_001107590			ELG protein isoform a								nucleotide binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)														---	---	---	---
ATP2A3	489	broad.mit.edu	37	17	3829585	3829585	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3829585delT	uc002fxb.1	-						ATP2A3_uc010ckn.1_Intron|ATP2A3_uc002fwx.1_Intron|ATP2A3_uc002fwy.1_Intron|ATP2A3_uc002fwz.1_Intron|ATP2A3_uc002fxa.1_Intron|ATP2A3_uc002fxc.1_Intron|ATP2A3_uc002fxd.1_Intron	NM_174955	NP_777615			ATPase, Ca++ transporting, ubiquitous isoform b						ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)														---	---	---	---
AIPL1	23746	broad.mit.edu	37	17	6333121	6333128	+	Intron	DEL	TAGGTAGG	-	-	rs71892523		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6333121_6333128delTAGGTAGG	uc002gcp.2	-						AIPL1_uc002gcq.2_Intron|AIPL1_uc002gcr.2_Intron|AIPL1_uc010clk.2_Intron|AIPL1_uc010cll.2_Intron|AIPL1_uc002gcs.2_Intron	NM_014336	NP_055151			aryl hydrocarbon receptor interacting						protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)														---	---	---	---
XAF1	54739	broad.mit.edu	37	17	6678743	6678743	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6678743delA	uc002gdn.2	+	7					FBXO39_uc010vtg.1_5'Flank|XAF1_uc002gdo.2_3'UTR|XAF1_uc002gdp.2_3'UTR|XAF1_uc002gdq.2_3'UTR|XAF1_uc002gdr.2_3'UTR	NM_017523	NP_059993			XIAP associated factor 1 isoform 1						apoptosis|type I interferon-mediated signaling pathway	mitochondrion|nucleus	zinc ion binding				0																		---	---	---	---
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451454	7451455	+	5'Flank	INS	-	TCCTTCCTTCCT	TCCTTCCTTCCT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451454_7451455insTCCTTCCTTCCT	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086			TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)																---	---	---	---
MPDU1	9526	broad.mit.edu	37	17	7489757	7489758	+	Intron	INS	-	A	A	rs112019115		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7489757_7489758insA	uc002ghw.2	+						MPDU1_uc010vub.1_Intron|MPDU1_uc002ghx.2_Intron|MPDU1_uc010vuc.1_Intron	NM_004870	NP_004861			mannose-P-dolichol utilization defect 1						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7570757	7570758	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7570757_7570758insA	uc002gih.2	-						TP53_uc002gig.1_Intron	NM_001126114	NP_001119586			tumor protein p53 isoform b						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(2)|p.?(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
GAS7	8522	broad.mit.edu	37	17	10081647	10081648	+	Intron	INS	-	T	T	rs144671365	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10081647_10081648insT	uc002gmg.1	-							NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10535440	10535448	+	Intron	DEL	TTTGTTTTG	-	-	rs10595582		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535440_10535448delTTTGTTTTG	uc002gmq.1	-							NM_002470	NP_002461			myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	13203326	13203326	+	IGR	DEL	A	-	-	rs8071952		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13203326delA								ELAC2 (281967 upstream) : HS3ST3A1 (195680 downstream)																																			---	---	---	---
MYO15A	51168	broad.mit.edu	37	17	18021382	18021383	+	Intron	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18021382_18021383delAC	uc010vxh.1	+							NM_016239	NP_057323			myosin XV						sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)																	---	---	---	---
TOP3A	7156	broad.mit.edu	37	17	18204145	18204145	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18204145delA	uc002gsx.1	-						TOP3A_uc010vxr.1_5'Flank|TOP3A_uc002gsw.1_Intron|TOP3A_uc010vxs.1_Intron|TOP3A_uc010cqa.1_Intron	NM_004618	NP_004609			topoisomerase (DNA) III alpha						DNA topological change|meiosis	chromosome|PML body	ATP binding|DNA topoisomerase type I activity|protein binding|zinc ion binding			skin(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	18293315	18293316	+	IGR	INS	-	TC	TC	rs140161091		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18293315_18293316insTC								EVPLL (357 upstream) : LOC339240 (29966 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21315339	21315342	+	Intron	DEL	CTCA	-	-	rs149843585		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21315339_21315342delCTCA	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21360908	21360909	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21360908_21360909insC								KCNJ12 (37729 upstream) : C17orf51 (70663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21507633	21507634	+	IGR	INS	-	AT	AT	rs144493186	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21507633_21507634insAT								C17orf51 (29902 upstream) : FAM27L (317736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561290	21561290	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561290delA								C17orf51 (83559 upstream) : FAM27L (264080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25276709	25276710	+	IGR	INS	-	TTT	TTT	rs149125339	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25276709_25276710insTTT								None (None upstream) : WSB1 (344396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25302994	25302995	+	IGR	INS	-	TC	TC	rs142013260		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25302994_25302995insTC								None (None upstream) : WSB1 (318111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25703462	25703463	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25703462_25703463insA								WSB1 (62817 upstream) : KSR1 (95573 downstream)																																			---	---	---	---
SSH2	85464	broad.mit.edu	37	17	27967617	27967618	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27967617_27967618insA	uc002heo.1	-						SSH2_uc010wbh.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	29414189	29414189	+	IGR	DEL	A	-	-	rs74831060		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29414189delA								RNF135 (87264 upstream) : NF1 (7806 downstream)																																			---	---	---	---
NF1	4763	broad.mit.edu	37	17	29650417	29650418	+	Intron	DEL	AA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29650417_29650418delAA	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2A_uc002hgl.2_5'Flank|EVI2A_uc002hgm.2_5'Flank	NM_001042492	NP_001035957			neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)				D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	31003833	31003833	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31003833delT	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	32823927	32823928	+	IGR	DEL	AT	-	-	rs59819560		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32823927_32823928delAT								CCL1 (133675 upstream) : C17orf102 (77214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	36385527	36385527	+	Intron	DEL	T	-	-	rs66721345		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36385527delT	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	39063535	39063538	+	IGR	DEL	TTCC	-	-	rs71764584		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39063535_39063538delTTCC								KRT20 (22056 upstream) : KRT23 (15414 downstream)																																			---	---	---	---
KLHL11	55175	broad.mit.edu	37	17	40018344	40018345	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40018344_40018345insT	uc002hyf.1	-							NM_018143	NP_060613			kelch-like 11 precursor							extracellular region					0		Breast(137;0.00156)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	40184897	40184898	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40184897_40184898insT								NKIRAS2 (7243 upstream) : DHX58 (68524 downstream)																																			---	---	---	---
RAB5C	5878	broad.mit.edu	37	17	40303639	40303640	+	Intron	INS	-	T	T	rs139958553	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40303639_40303640insT	uc002hyz.2	-						RAB5C_uc002hza.2_Intron|RAB5C_uc010cxx.2_Intron|RAB5C_uc010cxy.2_Intron	NM_201434	NP_958842			RAB5C, member RAS oncogene family isoform a						protein transport|small GTPase mediated signal transduction	early endosome membrane|melanosome|plasma membrane	GTP binding|GTPase activity|protein binding			large_intestine(1)|skin(1)	2		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	41677784	41677785	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41677784_41677785delCA								ETV4 (54022 upstream) : MEOX1 (39982 downstream)																																			---	---	---	---
PYY	5697	broad.mit.edu	37	17	42075100	42075100	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42075100delC	uc002ieq.2	-							NM_004160	NP_004151			peptide YY precursor						cell proliferation|cell-cell signaling|cellular component movement|cytoskeleton organization|digestion|G-protein coupled receptor protein signaling pathway	soluble fraction					0		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)														---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46345637	46345637	+	Intron	DEL	C	-	-	rs67283473		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46345637delC	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
HOXB3	3213	broad.mit.edu	37	17	46646013	46646014	+	Intron	DEL	GG	-	-	rs55686813	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46646013_46646014delGG	uc010dbf.2	-						HOXB3_uc010wlm.1_Intron|HOXB3_uc010dbg.2_Intron|HOXB3_uc002ino.2_Intron|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Intron	NM_002146	NP_002137			homeobox B3						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	47197827	47197828	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47197827_47197828delTG								IGF2BP1 (64322 upstream) : B4GALNT2 (11994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47197845	47197846	+	IGR	DEL	TC	-	-	rs71144571		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47197845_47197846delTC								IGF2BP1 (64340 upstream) : B4GALNT2 (11976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	48019867	48019867	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48019867delA								TAC4 (94488 upstream) : DLX4 (26695 downstream)																																			---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48602072	48602073	+	Intron	INS	-	GT	GT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48602072_48602073insGT	uc010wmr.1	+						MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509			Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
CA10	56934	broad.mit.edu	37	17	49712045	49712046	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49712045_49712046insA	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563			carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	52913256	52913256	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52913256delT								None (None upstream) : TOM1L1 (64796 downstream)																																			---	---	---	---
MMD	23531	broad.mit.edu	37	17	53494340	53494340	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53494340delT	uc002iui.2	-							NM_012329	NP_036461			monocyte to macrophage						cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0																		---	---	---	---
RNF126P1	376412	broad.mit.edu	37	17	55120340	55120341	+	5'Flank	INS	-	TTCC	TTCC	rs142789967	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55120340_55120341insTTCC	uc002iuw.2	+							NR_002818				Homo sapiens ring finger protein 126 pseudogene 1, mRNA (cDNA clone IMAGE:5166840), with apparent retained intron.												0																		---	---	---	---
CUEDC1	404093	broad.mit.edu	37	17	55970986	55970986	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55970986delC	uc002ivd.1	-						CUEDC1_uc002ive.1_Intron	NM_017949	NP_060419			CUE domain-containing 1											skin(2)	2																		---	---	---	---
EPX	8288	broad.mit.edu	37	17	56273299	56273300	+	Intron	INS	-	TCCT	TCCT	rs145140867	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56273299_56273300insTCCT	uc002ivq.2	+							NM_000502	NP_000493			eosinophil peroxidase preproprotein						hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2																		---	---	---	---
APPBP2	10513	broad.mit.edu	37	17	58540310	58540310	+	Intron	DEL	A	-	-	rs72375824		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58540310delA	uc002iys.1	-						APPBP2_uc010ddl.1_Intron	NM_006380	NP_006371			amyloid beta precursor protein-binding protein						intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)															---	---	---	---
APPBP2	10513	broad.mit.edu	37	17	58576693	58576694	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58576693_58576694insA	uc002iys.1	-						APPBP2_uc010ddl.1_Intron	NM_006380	NP_006371			amyloid beta precursor protein-binding protein						intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)															---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59480289	59480306	+	Intron	DEL	GATAGAGAGAGAGAGAGA	-	-	rs72277883		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480289_59480306delGATAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
SMURF2	64750	broad.mit.edu	37	17	62613041	62613042	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62613041_62613042insA	uc002jep.1	-						SMURF2_uc002jeq.1_Intron|SMURF2_uc002jer.1_Intron	NM_022739	NP_073576			SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)															---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64384414	64384415	+	Intron	INS	-	T	T	rs79649828		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64384414_64384415insT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66261231	66261232	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66261231_66261232insT	uc002jhc.2	+							NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66897127	66897127	+	Intron	DEL	A	-	-	rs79585518		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66897127delA	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron|ABCA8_uc010wqr.1_Intron|ABCA8_uc002jhr.2_Intron	NM_007168	NP_009099			ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	68234509	68234509	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68234509delA								KCNJ2 (58328 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	72597903	72597903	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72597903delC								C17orf77 (7555 upstream) : CD300E (10809 downstream)																																			---	---	---	---
NUP85	79902	broad.mit.edu	37	17	73211307	73211307	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73211307delT	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron	NM_024844	NP_079120			nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)															---	---	---	---
MYO15B	80022	broad.mit.edu	37	17	73603072	73603072	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73603072delG	uc002jon.1	+						MYO15B_uc002jom.1_Intron|MYO15B_uc002joo.1_Intron|MYO15B_uc010dgh.2_RNA|MYO15B_uc010wse.1_Intron|MYO15B_uc010dgi.1_Intron					RecName: Full=Putative myosin-XVB; AltName: Full=Unconventional myosin-15B; AltName: Full=Myosin XVBP;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	73764572	73764573	+	IGR	INS	-	A	A	rs146059150		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73764572_73764573insA								GALK1 (3292 upstream) : H3F3B (7944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74111610	74111610	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74111610delA								EXOC7 (11742 upstream) : FOXJ1 (20807 downstream)																																			---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75481141	75481141	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75481141delG	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	75573980	75573985	+	IGR	DEL	ATGTGT	-	-	rs71363681		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75573980_75573985delATGTGT								SEPT9 (77304 upstream) : FLJ45079 (301124 downstream)																																			---	---	---	---
EIF4A3	9775	broad.mit.edu	37	17	78120046	78120047	+	Intron	INS	-	T	T	rs141573878	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78120046_78120047insT	uc010wuc.1	-						EIF4A3_uc002jxs.2_Intron	NM_014740	NP_055555			eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)															---	---	---	---
FSCN2	25794	broad.mit.edu	37	17	79498342	79498344	+	Intron	DEL	TGA	-	-	rs142557936	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79498342_79498344delTGA	uc010wup.1	+						FSCN2_uc010wuo.1_Intron	NM_012418	NP_036550			fascin 2 isoform 1						actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)															---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80544327	80544327	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544327delG	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	1015484	1015485	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1015484_1015485delTC								ADCYAP1 (103313 upstream) : C18orf2 (238905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1891932	1891932	+	IGR	DEL	A	-	-	rs33967154		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1891932delA								C18orf2 (484751 upstream) : METTL4 (645593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3489062	3489063	+	IGR	INS	-	CTTCCTTCCTTCCTTC	CTTCCTTCCTTCCTTC	rs142673313	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3489062_3489063insCTTCCTTCCTTCCTTC								TGIF1 (30658 upstream) : DLGAP1 (9774 downstream)																																			---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4216292	4216292	+	Intron	DEL	C	-	-	rs11334039		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4216292delC	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7856741	7856742	+	Intron	INS	-	A	A	rs5822986		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7856741_7856742insA	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	8551872	8551872	+	IGR	DEL	A	-	-	rs4598980		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8551872delA								PTPRM (145014 upstream) : RAB12 (57563 downstream)																																			---	---	---	---
SPIRE1	56907	broad.mit.edu	37	18	12510547	12510547	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12510547delT	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098			spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0																		---	---	---	---
RNMT	8731	broad.mit.edu	37	18	13745764	13745765	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13745764_13745765insA	uc002ksk.1	+						RNMT_uc002ksl.1_Intron|RNMT_uc002ksm.1_Intron|RNMT_uc010dlk.2_Intron|RNMT_uc010xae.1_Intron	NM_003799	NP_003790			RNA (guanine-7-) methyltransferase						mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	mRNA (guanine-N7-)-methyltransferase activity|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	15204886	15204886	+	IGR	DEL	C	-	-	rs111501791		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15204886delC								ANKRD30B (352149 upstream) : LOC644669 (108669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	18765937	18765938	+	IGR	INS	-	T	T	rs111685239		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18765937_18765938insT								ROCK1 (74125 upstream) : GREB1L (56265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20424675	20424678	+	IGR	DEL	TATC	-	-	rs10577566		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20424675_20424678delTATC								CTAGE1 (426797 upstream) : RBBP8 (88617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20672214	20672214	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20672214delG								RBBP8 (65769 upstream) : CABLES1 (42314 downstream)																																			---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24222891	24222892	+	5'Flank	INS	-	G	G	rs144748017	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24222891_24222892insG	uc010xbk.1	-							NM_198991	NP_945342			potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
CHST9	83539	broad.mit.edu	37	18	24492337	24492346	+	3'UTR	DEL	ATACACACAC	-	-	rs72231202		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24492337_24492346delATACACACAC	uc002kwd.2	-	5					C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_3'UTR|CHST9_uc002kwe.2_3'UTR	NM_031422	NP_113610			GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	28318928	28318928	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28318928delA								MIR302F (440002 upstream) : DSC3 (251125 downstream)																																			---	---	---	---
PSTPIP2	9050	broad.mit.edu	37	18	43579160	43579160	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43579160delG	uc002lbp.3	-						PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748			proline-serine-threonine phosphatase interacting							membrane				ovary(1)	1																		---	---	---	---
IER3IP1	51124	broad.mit.edu	37	18	44682386	44682386	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44682386delA	uc002lcu.2	-	3						NM_016097	NP_057181			immediate early response 3 interacting protein							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	51523655	51523656	+	IGR	INS	-	AG	AG	rs150380853	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51523655_51523656insAG								DCC (465873 upstream) : MBD2 (156919 downstream)																																			---	---	---	---
NEDD4L	23327	broad.mit.edu	37	18	55815067	55815067	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55815067delT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lhc.2_5'Flank|NEDD4L_uc002lhd.2_5'Flank|NEDD4L_uc002lhb.2_5'Flank|NEDD4L_uc002lhe.2_5'Flank|NEDD4L_uc002lha.1_Intron	NM_001144967	NP_001138439			neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	56473482	56473482	+	IGR	DEL	G	-	-	rs6567012	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56473482delG								MALT1 (56112 upstream) : ZNF532 (56579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	57790181	57790182	+	IGR	DEL	TG	-	-	rs71336386		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57790181_57790182delTG								PMAIP1 (218643 upstream) : MC4R (248382 downstream)																																			---	---	---	---
KIAA1468	57614	broad.mit.edu	37	18	59912374	59912374	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59912374delA	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905			hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	62733839	62733839	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62733839delA								C18orf20 (917579 upstream) : CDH7 (683649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66964902	66964903	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66964902_66964903insA								CCDC102B (242476 upstream) : DOK6 (103388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	74905950	74905951	+	IGR	INS	-	T	T	rs56155505		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74905950_74905951insT								MBP (61176 upstream) : GALR1 (56057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76001882	76001882	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76001882delG								None (None upstream) : SALL3 (738393 downstream)																																			---	---	---	---
MED16	10025	broad.mit.edu	37	19	878914	878925	+	Intron	DEL	CCAGCCCCGGCC	-	-	rs141014120	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:878914_878925delCCAGCCCCGGCC	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Intron|MED16_uc010xfx.1_Intron|MED16_uc010xfy.1_Intron	NM_005481	NP_005472			mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	2861339	2861339	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2861339delA								ZNF555 (7133 upstream) : ZNF556 (5994 downstream)																																			---	---	---	---
C19orf77	284422	broad.mit.edu	37	19	3477061	3477062	+	Intron	INS	-	G	G	rs151002011	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3477061_3477062insG	uc010xhk.1	-							NM_001136503	NP_001129975			hypothetical protein LOC284422 precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	3990839	3990842	+	IGR	DEL	TCCT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3990839_3990842delTCCT								EEF2 (5378 upstream) : PIAS4 (16907 downstream)																																			---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	4982304	4982304	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4982304delA	uc002mbq.3	+						KDM4B_uc010xil.1_Intron	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	5401811	5401814	+	IGR	DEL	GGAA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5401811_5401814delGGAA								PTPRS (60997 upstream) : ZNRF4 (53612 downstream)																																			---	---	---	---
DENND1C	79958	broad.mit.edu	37	19	6484247	6484247	+	5'Flank	DEL	G	-	-	rs112591192		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6484247delG	uc002mfe.2	-						DENND1C_uc010xje.1_5'Flank	NM_024898	NP_079174			DENN/MADD domain containing 1C							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1																		---	---	---	---
EVI5L	115704	broad.mit.edu	37	19	7922668	7922669	+	Intron	INS	-	C	C	rs149098725	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7922668_7922669insC	uc002min.2	+						EVI5L_uc010xjz.1_Intron|EVI5L_uc002mio.1_3'UTR	NM_145245	NP_660288			ecotropic viral integration site 5-like isoform							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9131013	9131014	+	IGR	DEL	GA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9131013_9131014delGA								MUC16 (38995 upstream) : OR1M1 (72907 downstream)																																			---	---	---	---
ZNF433	163059	broad.mit.edu	37	19	12143905	12143906	+	Intron	DEL	TT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12143905_12143906delTT	uc002msy.1	-						ZNF433_uc002msz.1_Intron	NM_001080411	NP_001073880			zinc finger protein 433						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
C19orf57	79173	broad.mit.edu	37	19	13994685	13994686	+	Intron	INS	-	GGTGGTG	GGTGGTG	rs138705661	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13994685_13994686insGGTGGTG	uc002mxl.1	-						C19orf57_uc002mxk.1_Intron|C19orf57_uc002mxm.1_Intron	NM_024323	NP_077299			hypothetical protein LOC79173						multicellular organismal development		protein binding			ovary(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(19;2e-21)															---	---	---	---
CYP4F22	126410	broad.mit.edu	37	19	15658800	15658807	+	Intron	DEL	GAGAGAGG	-	-	rs145247351	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15658800_15658807delGAGAGAGG	uc002nbh.3	+							NM_173483	NP_775754			cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2																		---	---	---	---
GLT25D1	79709	broad.mit.edu	37	19	17668418	17668418	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17668418delT	uc002nhc.1	+							NM_024656	NP_078932			glycosyltransferase 25 domain containing 1						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17733460	17733461	+	Intron	INS	-	CAC	CAC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17733460_17733461insCAC	uc002nhd.2	-							NM_001080421	NP_001073890			unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	18056760	18056760	+	IGR	DEL	C	-	-	rs35535810		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18056760delC								CCDC124 (1967 upstream) : KCNN1 (5351 downstream)																																			---	---	---	---
KCNN1	3780	broad.mit.edu	37	19	18076829	18076844	+	Intron	DEL	CCTGCCTTCCTTCCTT	-	-	rs72017725		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18076829_18076844delCCTGCCTTCCTTCCTT	uc002nht.2	+						KCNN1_uc010xqa.1_Intron	NM_002248	NP_002239			potassium intermediate/small conductance						synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0																		---	---	---	---
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775			arrestin domain containing 2 isoform 2											pancreas(1)	1																		---	---	---	---
CRTC1	23373	broad.mit.edu	37	19	18795694	18795695	+	Intron	INS	-	CTTCC	CTTCC	rs147478490	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18795694_18795695insCTTCC	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron	NM_015321	NP_056136			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20796753	20796755	+	IGR	DEL	GAA	-	-	rs144426189		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20796753_20796755delGAA								ZNF737 (48127 upstream) : ZNF626 (5990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22081984	22081985	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22081984_22081985insA								ZNF43 (47154 upstream) : ZNF208 (33775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22454960	22454961	+	IGR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22454960_22454961delTC								ZNF676 (75207 upstream) : ZNF98 (118938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23412593	23412611	+	Intron	DEL	CTTGAAGAGGTGTTTGTTT	-	-	rs141363213		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23412593_23412611delCTTGAAGAGGTGTTTGTTT	uc010xri.1	-											SubName: Full=cDNA FLJ56866, moderately similar to Zinc finger protein 43;																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	27750333	27750333	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27750333delG								None (None upstream) : LOC148189 (531069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27865507	27865507	+	IGR	DEL	C	-	-	rs71224979		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27865507delC								None (None upstream) : LOC148189 (415895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28745381	28745382	+	IGR	INS	-	CACA	CACA	rs143962607	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28745381_28745382insCACA								LOC148189 (460533 upstream) : LOC148145 (710658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29367619	29367620	+	IGR	INS	-	A	A	rs11424461		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29367619_29367620insA								None (None upstream) : LOC148145 (88420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29506653	29506653	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29506653delT								LOC148145 (46598 upstream) : UQCRFS1 (191514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29506945	29506946	+	IGR	INS	-	TCTCCCTCTCTC	TCTCCCTCTCTC	rs147640190	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29506945_29506946insTCTCCCTCTCTC								LOC148145 (46890 upstream) : UQCRFS1 (191221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29743476	29743476	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29743476delA								UQCRFS1 (39340 upstream) : VSTM2B (274015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29768153	29768153	+	IGR	DEL	C	-	-	rs74181471		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29768153delC								UQCRFS1 (64017 upstream) : VSTM2B (249338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29914316	29914317	+	Intron	INS	-	TG	TG	rs144712349	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29914316_29914317insTG	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	30133970	30133970	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30133970delT								POP4 (25808 upstream) : PLEKHF1 (22357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30401907	30401922	+	IGR	DEL	TCTTTCTTTCTTTCTT	-	-	rs56128977	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30401907_30401922delTCTTTCTTTCTTTCTT								CCNE1 (86689 upstream) : C19orf2 (12629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30607204	30607209	+	IGR	DEL	ACATAT	-	-	rs143140090		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30607204_30607209delACATAT								C19orf2 (100593 upstream) : ZNF536 (256119 downstream)																																			---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30875092	30875093	+	Intron	INS	-	TCCTTCCT	TCCTTCCT	rs139525043	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30875092_30875093insTCCTTCCT	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532			zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	31125974	31125975	+	IGR	INS	-	GT	GT	rs55756033		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31125974_31125975insGT								ZNF536 (77009 upstream) : DKFZp566F0947 (514808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31205185	31205188	+	IGR	DEL	TGTG	-	-	rs68191425		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31205185_31205188delTGTG								ZNF536 (156220 upstream) : DKFZp566F0947 (435595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31573690	31573691	+	IGR	INS	-	TG	TG	rs10639070		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31573690_31573691insTG								ZNF536 (524725 upstream) : DKFZp566F0947 (67092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31666347	31666347	+	IGR	DEL	T	-	-	rs68106723		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31666347delT								DKFZp566F0947 (25038 upstream) : TSHZ3 (99506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31681550	31681550	+	IGR	DEL	A	-	-	rs66960597		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31681550delA								DKFZp566F0947 (40241 upstream) : TSHZ3 (84303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31706990	31706991	+	IGR	INS	-	TGTA	TGTA	rs147661730	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31706990_31706991insTGTA								DKFZp566F0947 (65681 upstream) : TSHZ3 (58862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31870752	31870753	+	IGR	INS	-	TC	TC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31870752_31870753insTC								TSHZ3 (30562 upstream) : ZNF507 (965761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32037570	32037571	+	IGR	INS	-	T	T	rs113712617		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32037570_32037571insT								TSHZ3 (197380 upstream) : ZNF507 (798943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32043171	32043174	+	IGR	DEL	TGAC	-	-	rs146439928		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32043171_32043174delTGAC								TSHZ3 (202981 upstream) : ZNF507 (793340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32157606	32157606	+	IGR	DEL	T	-	-	rs72035590		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32157606delT								TSHZ3 (317416 upstream) : ZNF507 (678908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32180916	32180917	+	IGR	DEL	CT	-	-	rs67462310		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32180916_32180917delCT								TSHZ3 (340726 upstream) : ZNF507 (655597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33023521	33023530	+	IGR	DEL	TGTCTCTCTG	-	-	rs71922504		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33023521_33023530delTGTCTCTCTG								DPY19L3 (48285 upstream) : PDCD5 (48574 downstream)																																			---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33523767	33523767	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33523767delC	uc002nuf.2	-						RHPN2_uc010xro.1_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
HPN	3249	broad.mit.edu	37	19	35540766	35540766	+	Intron	DEL	T	-	-	rs67924531		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35540766delT	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron	NM_002151	NP_002142			hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)													---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38958666	38958669	+	Intron	DEL	CATC	-	-	rs67434030		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38958666_38958669delCATC	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
MAP4K1	11184	broad.mit.edu	37	19	39103971	39103972	+	Intron	INS	-	A	A	rs74176452		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39103971_39103972insA	uc002oix.1	-						MAP4K1_uc002oiy.1_Intron|MAP4K1_uc010xug.1_Intron	NM_007181	NP_009112			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	39240949	39240950	+	IGR	INS	-	C	C	rs141726695	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39240949_39240950insC								CAPN12 (5835 upstream) : LGALS7 (20658 downstream)																																			---	---	---	---
PAPL	390928	broad.mit.edu	37	19	39593021	39593022	+	Intron	INS	-	T	T	rs36113504		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39593021_39593022insT	uc002oki.2	+						PAPL_uc010egl.2_Intron	NM_001004318	NP_001004318			iron/zinc purple acid phosphatase-like protein							extracellular region	acid phosphatase activity|metal ion binding				0																		---	---	---	---
PAPL	390928	broad.mit.edu	37	19	39601842	39601842	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39601842delA	uc002oki.2	+	13					PAPL_uc010egl.2_3'UTR	NM_001004318	NP_001004318			iron/zinc purple acid phosphatase-like protein							extracellular region	acid phosphatase activity|metal ion binding				0																		---	---	---	---
SAMD4B	55095	broad.mit.edu	37	19	39857294	39857294	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39857294delG	uc002olb.2	+						SAMD4B_uc002ola.2_Intron	NM_018028	NP_060498			sterile alpha motif domain containing 4B								protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)															---	---	---	---
FBL	2091	broad.mit.edu	37	19	40332239	40332239	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40332239delC	uc002omn.2	-						FBL_uc002omm.1_5'Flank|FBL_uc002omo.2_Intron|FBL_uc010egr.2_Intron	NM_001436	NP_001427			fibrillarin						rRNA processing|tRNA processing	box C/D snoRNP complex|Cajal body	methyltransferase activity|protein binding|RNA binding			ovary(1)	1	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	41331423	41331426	+	IGR	DEL	TGTA	-	-	rs10534714		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41331423_41331426delTGTA								EGLN2 (17087 upstream) : CYP2A6 (18018 downstream)																																			---	---	---	---
CYP2A7	1549	broad.mit.edu	37	19	41482436	41482436	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41482436delA	uc002opo.2	-							NM_000764	NP_000755			cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)															---	---	---	---
QPCTL	54814	broad.mit.edu	37	19	46202290	46202290	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46202290delT	uc010xxr.1	+						QPCTL_uc010ekn.2_Intron	NM_017659	NP_060129			glutaminyl-peptide cyclotransferase-like isoform						peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	Golgi membrane|integral to membrane	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|protein binding|zinc ion binding			skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47383687	47383688	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47383687_47383688insA								AP2S1 (29484 upstream) : GRLF1 (38245 downstream)																																			---	---	---	---
PLEKHA4	57664	broad.mit.edu	37	19	49371510	49371511	+	5'UTR	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49371510_49371511delTC	uc002pkx.2	-	1					PLEKHA4_uc010eml.2_5'UTR	NM_020904	NP_065955			pleckstrin homology domain containing family A							cytoplasm|membrane	1-phosphatidylinositol binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)														---	---	---	---
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314			tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)														---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50919399	50919399	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50919399delC	uc002psb.3	+						POLD1_uc002psc.3_Intron|POLD1_uc010enx.2_Intron|POLD1_uc010eny.2_Intron|SPIB_uc002psd.2_5'Flank|SPIB_uc002pse.2_5'Flank|SPIB_uc010ycc.1_5'Flank	NM_002691	NP_002682			DNA-directed DNA polymerase delta 1						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
Unknown	0	broad.mit.edu	37	19	52337944	52337944	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52337944delT								FPR3 (8610 upstream) : ZNF577 (21112 downstream)																																			---	---	---	---
ZNF83	55769	broad.mit.edu	37	19	53130612	53130613	+	Intron	INS	-	A	A	rs35408180		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53130612_53130613insA	uc002pzv.3	-						ZNF83_uc010eps.2_Intron|ZNF83_uc010ept.2_Intron|ZNF83_uc010epu.2_Intron|ZNF83_uc010epv.2_Intron|ZNF83_uc010epw.2_Intron|ZNF83_uc010epx.2_Intron|ZNF83_uc010epy.2_Intron|ZNF83_uc010epz.2_Intron|ZNF83_uc010eqb.1_Intron	NM_018300	NP_060770			zinc finger protein 83 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	53610800	53610801	+	IGR	INS	-	AGGGT	AGGGT	rs140092597	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53610800_53610801insAGGGT								ZNF160 (4113 upstream) : ZNF415 (332 downstream)																																			---	---	---	---
TARM1	441864	broad.mit.edu	37	19	54583284	54583285	+	Intron	INS	-	GGAA	GGAA			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54583284_54583285insGGAA	uc010yei.1	-							NM_001135686	NP_001129158			OSCAR-like transcript-2							integral to membrane					0																		---	---	---	---
TMC4	147798	broad.mit.edu	37	19	54671790	54671790	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54671790delA	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775			transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)																	---	---	---	---
LENG8	114823	broad.mit.edu	37	19	54964561	54964561	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54964561delT	uc002qfv.1	+						LENG8_uc002qfw.2_Intron					RecName: Full=Leukocyte receptor cluster member 8;								protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)														---	---	---	---
EPS8L1	54869	broad.mit.edu	37	19	55587649	55587649	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55587649delG	uc002qis.3	+						EPS8L1_uc010ess.1_Intron|EPS8L1_uc010est.1_Intron|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_5'Flank	NM_133180	NP_573441			epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56039253	56039254	+	IGR	DEL	CA	-	-	rs145100664		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56039253_56039254delCA								SSC5D (8788 upstream) : SBK2 (1847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	56059737	56059738	+	IGR	DEL	TG	-	-	rs146039797		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56059737_56059738delTG								SBK2 (12076 upstream) : ZNF579 (29154 downstream)																																			---	---	---	---
ZNF135	7694	broad.mit.edu	37	19	58576729	58576729	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58576729delT	uc010yhq.1	+						ZNF135_uc002qre.2_Intron|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Intron|ZNF135_uc002qrg.2_Intron|ZNF135_uc010yhr.1_Intron	NM_003436	NP_003427			zinc finger protein 135 isoform 2						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)														---	---	---	---
FKBP1A	2280	broad.mit.edu	37	20	1332846	1332847	+	Intron	INS	-	TTCCTTCCTTCCTTCCTTCCTTTCC	TTCCTTCCTTCCTTCCTTCCTTTCC	rs149418603	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332846_1332847insTTCCTTCCTTCCTTCCTTCCTTTCC	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron					Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)													---	---	---	---
TGM6	343641	broad.mit.edu	37	20	2410112	2410113	+	Intron	INS	-	A	A	rs142259305		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2410112_2410113insA	uc002wfy.1	+						TGM6_uc010gal.1_Intron	NM_198994	NP_945345			transglutaminase 6						cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)													---	---	---	---
RNF24	11237	broad.mit.edu	37	20	3994911	3994911	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3994911delA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150			ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0																		---	---	---	---
ADRA1D	146	broad.mit.edu	37	20	4222607	4222607	+	Intron	DEL	G	-	-	rs11087625		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4222607delG	uc002wkr.2	-							NM_000678	NP_000669			alpha-1D-adrenergic receptor						cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)													---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4991953	4991954	+	5'Flank	INS	-	A	A	rs144432174	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4991953_4991954insA	uc002wlh.1	-						SLC23A2_uc002wli.2_5'Flank	NM_203327	NP_976072			solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5468036	5468037	+	IGR	INS	-	TT	TT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5468036_5468037insTT								PROKR2 (170658 upstream) : LOC149837 (11181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	5608126	5608127	+	IGR	INS	-	T	T	rs75304230		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5608126_5608127insT								GPCPD1 (16454 upstream) : C20orf196 (122916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6980720	6980721	+	IGR	INS	-	GT	GT	rs146899673	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6980720_6980721insGT								BMP2 (219810 upstream) : HAO1 (882910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7738564	7738564	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7738564delA								BMP2 (977654 upstream) : HAO1 (125067 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8774274	8774274	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8774274delA	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	10984421	10984421	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10984421delA								JAG1 (329727 upstream) : BTBD3 (887056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	13148828	13148829	+	IGR	DEL	TT	-	-	rs111351596		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13148828_13148829delTT								SPTLC3 (1417 upstream) : ISM1 (53589 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14545994	14545995	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14545994_14545995insA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15667586	15667586	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15667586delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
CSRP2BP	57325	broad.mit.edu	37	20	18136821	18136821	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18136821delT	uc002wqj.2	+						CSRP2BP_uc002wqk.2_Intron|CSRP2BP_uc010zru.1_Intron	NM_020536	NP_065397			CSRP2 binding protein						histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	19791690	19791690	+	5'Flank	DEL	A	-	-	rs113439666		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19791690delA	uc002wrn.1	-											DQ573663																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	19994209	19994210	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19994209_19994210insA								RIN2 (11109 upstream) : NAA20 (3727 downstream)																																			---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20148205	20148205	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20148205delA	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc010zsf.1_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20317995	20318002	+	Intron	DEL	TGGGTGGA	-	-	rs111753471		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20317995_20318002delTGGGTGGA	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
RALGAPA2	57186	broad.mit.edu	37	20	20431597	20431597	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20431597delA	uc002wrz.2	-						RALGAPA2_uc010gcx.2_Intron|RALGAPA2_uc010zsg.1_Intron	NM_020343	NP_065076			akt substrate AS250						activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	21414625	21414625	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21414625delA								NKX2-4 (36578 upstream) : NKX2-2 (77039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23136436	23136436	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23136436delG								CD93 (69459 upstream) : NXT1 (194937 downstream)																																			---	---	---	---
CST7	8530	broad.mit.edu	37	20	24935690	24935691	+	Intron	DEL	AC	-	-	rs141064952	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24935690_24935691delAC	uc002wtx.1	+							NM_003650	NP_003641			cystatin F						immune response	cytoplasm|extracellular region	cysteine-type endopeptidase inhibitor activity			ovary(1)	1																		---	---	---	---
NINL	22981	broad.mit.edu	37	20	25437184	25437184	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25437184delA	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc002wuw.1_Intron	NM_025176	NP_079452			ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25858995	25858996	+	IGR	INS	-	CTC	CTC			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25858995_25858996insCTC								FAM182B (10209 upstream) : LOC100134868 (131439 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29616935	29616936	+	Intron	INS	-	T	T	rs141973478	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29616935_29616936insT	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29634402	29634402	+	Intron	DEL	T	-	-	rs67656346		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29634402delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29648467	29648467	+	Intron	DEL	A	-	-	rs72020022		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29648467delA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	29828630	29828634	+	IGR	DEL	GAATG	-	-	rs140218877		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29828630_29828634delGAATG								FRG1B (174722 upstream) : DEFB115 (16833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31134057	31134057	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31134057delT								C20orf112 (9857 upstream) : C20orf203 (86605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31135299	31135299	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31135299delC								C20orf112 (11099 upstream) : C20orf203 (85363 downstream)																																			---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35735334	35735335	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35735334_35735335insT	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36270688	36270689	+	IGR	INS	-	TCCA	TCCA	rs142535458	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36270688_36270689insTCCA								BLCAP (114385 upstream) : CTNNBL1 (51745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	43090929	43090930	+	Intron	INS	-	A	A	rs147265115	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43090929_43090930insA	uc002xmb.3	-											RecName: Full=Uncharacterized protein C20orf62;																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	44161752	44161753	+	IGR	INS	-	AA	AA			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44161752_44161753insAA								SPINT3 (17488 upstream) : WFDC6 (1083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	44624529	44624532	+	IGR	DEL	CTTT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44624529_44624532delCTTT								ZNF335 (23696 upstream) : MMP9 (13015 downstream)																																			---	---	---	---
CDH22	64405	broad.mit.edu	37	20	44889103	44889103	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44889103delG	uc010ghk.1	-							NM_021248	NP_067071			cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45228952	45228953	+	Intron	INS	-	GGAAGGAA	GGAAGGAA	rs144741251	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228952_45228953insGGAAGGAA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45265453	45265454	+	Intron	INS	-	T	T	rs146301926	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45265453_45265454insT	uc002xsf.1	-						SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron|SLC13A3_uc002xsi.3_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48705323	48705323	+	Intron	DEL	A	-	-	rs146291633		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48705323delA	uc002xvf.2	-						UBE2V1_uc002xvb.2_Intron|UBE2V1_uc002xva.2_Intron|UBE2V1_uc002xvc.2_Intron|UBE2V1_uc002xvd.2_Intron|UBE2V1_uc002xve.2_Intron	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
TMEM189	387521	broad.mit.edu	37	20	48740836	48740836	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48740836delA	uc002xvg.2	-	6					TMEM189-UBE2V1_uc002xvf.2_Intron|TMEM189_uc010zyq.1_RNA|TMEM189_uc010gif.2_3'UTR|TMEM189_uc010zyp.1_3'UTR	NM_199129	NP_954580			transmembrane protein 189 isoform 1							endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(9;3.02e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48791968	48791969	+	IGR	DEL	AT	-	-	rs56972102		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48791968_48791969delAT								TMEM189-UBE2V1 (21633 upstream) : CEBPB (15407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49068651	49068651	+	IGR	DEL	A	-	-	rs71190560		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068651delA								CEBPB (259439 upstream) : PTPN1 (58240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49582901	49582901	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49582901delT								MOCS3 (5081 upstream) : KCNG1 (37293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49690086	49690086	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49690086delA								KCNG1 (50411 upstream) : NFATC2 (317680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51190117	51190117	+	IGR	DEL	C	-	-	rs112101559		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51190117delC								ZFP64 (381593 upstream) : TSHZ2 (398760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52138508	52138509	+	IGR	INS	-	AA	AA	rs74179203		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52138508_52138509insAA								TSHZ2 (34543 upstream) : ZNF217 (45103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52455174	52455175	+	IGR	INS	-	AC	AC	rs141559658	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52455174_52455175insAC								ZNF217 (244373 upstream) : SUMO1P1 (35867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52710278	52710279	+	IGR	INS	-	C	C	rs58416962	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52710278_52710279insC								BCAS1 (22974 upstream) : CYP24A1 (59709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52896773	52896774	+	IGR	INS	-	A	A	rs113862537		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52896773_52896774insA								PFDN4 (60282 upstream) : DOK5 (195483 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53176659	53176660	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53176659_53176660delTG	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	54282123	54282124	+	IGR	DEL	AG	-	-	rs72488725		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54282123_54282124delAG								None (None upstream) : CBLN4 (290373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54415479	54415480	+	IGR	DEL	AC	-	-	rs73628118		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54415479_54415480delAC								None (None upstream) : CBLN4 (157017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55509352	55509352	+	IGR	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55509352delC								TFAP2C (295016 upstream) : BMP7 (234457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55665861	55665862	+	IGR	DEL	CG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55665861_55665862delCG								TFAP2C (451525 upstream) : BMP7 (77947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55844794	55844797	+	Intron	DEL	GAAT	-	-	rs145698955		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55844794_55844797delGAAT	uc010gir.1	+											Homo sapiens cDNA clone IMAGE:5275266.																														---	---	---	---
PPP4R1L	55370	broad.mit.edu	37	20	56809359	56809359	+	Intron	DEL	A	-	-	rs79383333		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56809359delA	uc002xyw.2	-						PPP4R1L_uc010gjn.1_Intron					Homo sapiens PRO1085 mRNA, complete cds.												0																OREG0026074	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
APCDD1L	164284	broad.mit.edu	37	20	57087946	57087947	+	Intron	INS	-	C	C	rs142947239	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57087946_57087947insC	uc002xze.1	-						uc002xzg.1_5'Flank|APCDD1L_uc010zzp.1_Intron|uc002xzf.1_5'Flank	NM_153360	NP_699191			adenomatosis polyposis coli down-regulated							integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57092112	57092112	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57092112delA	uc002xzg.1	+						APCDD1L_uc002xze.1_5'Flank|APCDD1L_uc010zzp.1_5'Flank|uc002xzf.1_Intron					Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	57159887	57159888	+	Intron	INS	-	CTTC	CTTC	rs142796198	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57159887_57159888insCTTC	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	57972186	57972187	+	IGR	DEL	CA	-	-	rs147374051		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57972186_57972187delCA								EDN3 (71140 upstream) : PHACTR3 (180377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	58776017	58776017	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58776017delA	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59116903	59116906	+	Intron	DEL	TGTA	-	-	rs72123231		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59116903_59116906delTGTA	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59477028	59477029	+	IGR	DEL	CT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59477028_59477029delCT								MIR646 (593403 upstream) : CDH4 (350530 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59942302	59942303	+	Intron	DEL	GA	-	-	rs34134614		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59942302_59942303delGA	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60381631	60381632	+	Intron	INS	-	CA	CA	rs141897200	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60381631_60381632insCA	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
OSBPL2	9885	broad.mit.edu	37	20	60820156	60820157	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60820156_60820157insT	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081			oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)															---	---	---	---
OSBPL2	9885	broad.mit.edu	37	20	60835908	60835908	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60835908delT	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081			oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)															---	---	---	---
CABLES2	81928	broad.mit.edu	37	20	60973071	60973073	+	Intron	DEL	GGT	-	-	rs113048661		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973071_60973073delGGT	uc002ycv.2	-							NM_031215	NP_112492			Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)															---	---	---	---
SLCO4A1	28231	broad.mit.edu	37	20	61293564	61293564	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61293564delA	uc002ydb.1	+						SLCO4A1_uc002ydc.1_Intron	NM_016354	NP_057438			solute carrier organic anion transporter family						sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(1)	1	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61399622	61399625	+	IGR	DEL	CCAT	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61399622_61399625delCCAT								NTSR1 (5500 upstream) : C20orf20 (28180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	62019528	62019529	+	IGR	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62019528_62019529delCA								CHRNA4 (10039 upstream) : KCNQ2 (18013 downstream)																																			---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62618832	62618832	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62618832delA	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601			PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9829245	9829246	+	IGR	INS	-	TA	TA	rs3074471		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9829245_9829246insTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10371638	10371639	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10371638_10371639insT								None (None upstream) : TPTE (535104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10457789	10457791	+	Intron	DEL	TTC	-	-	rs3831350		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10457789_10457791delTTC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10463798	10463798	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10463798delG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10515775	10515776	+	Intron	INS	-	AT	AT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10515775_10515776insAT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10560974	10560975	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10560974_10560975insT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10564407	10564408	+	Intron	INS	-	T	T	rs79905988	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10564407_10564408insT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10572021	10572022	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10572021_10572022insA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10572493	10572493	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10572493delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10588349	10588349	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10588349delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10602653	10602654	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10602653_10602654insA								None (None upstream) : TPTE (304089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10617042	10617042	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10617042delT								None (None upstream) : TPTE (289701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10618773	10618773	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10618773delT								None (None upstream) : TPTE (287970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10632205	10632206	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10632205_10632206insA								None (None upstream) : TPTE (274537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10642339	10642340	+	IGR	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10642339_10642340insA								None (None upstream) : TPTE (264403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10645821	10645822	+	IGR	DEL	AC	-	-	rs76858500		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10645821_10645822delAC								None (None upstream) : TPTE (260921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10763047	10763047	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10763047delT								None (None upstream) : TPTE (143696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10784970	10784974	+	IGR	DEL	AATGG	-	-	rs111997296		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10784970_10784974delAATGG								None (None upstream) : TPTE (121769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10819192	10819201	+	IGR	DEL	AATGGAATGG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10819192_10819201delAATGGAATGG								None (None upstream) : TPTE (87542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10846713	10846713	+	IGR	DEL	A	-	-	rs112940503		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10846713delA								None (None upstream) : TPTE (60030 downstream)																																			---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10960734	10960734	+	Intron	DEL	T	-	-	rs149240605		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10960734delT	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10990694	10990694	+	Intron	DEL	C	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10990694delC	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11024346	11024347	+	Intron	INS	-	A	A	rs146206335	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11024346_11024347insA	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	14846879	14846879	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14846879delA								C21orf99 (356310 upstream) : POTED (135619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	16456784	16456785	+	IGR	DEL	GG	-	-	rs77348278		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16456784_16456785delGG								NRIP1 (19658 upstream) : USP25 (645711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	16815033	16815033	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16815033delA								NRIP1 (377907 upstream) : USP25 (287463 downstream)																																			---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17469918	17469919	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17469918_17469919delTG	uc002ykb.2	+						C21orf34_uc010glc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20085499	20085500	+	Intron	DEL	TC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20085499_20085500delTC	uc010glf.1	-						uc002ykx.2_Intron					Homo sapiens, clone IMAGE:5392784, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	24227367	24227367	+	IGR	DEL	A	-	-	rs77863831		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24227367delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24650309	24650309	+	IGR	DEL	T	-	-	rs11366946		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24650309delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25535112	25535112	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25535112delT								None (None upstream) : None (None downstream)																																			---	---	---	---
CYYR1	116159	broad.mit.edu	37	21	27935077	27935080	+	Intron	DEL	ACAG	-	-	rs34042597		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27935077_27935080delACAG	uc002ymd.2	-						CYYR1_uc011ack.1_Intron|CYYR1_uc002yme.2_Intron	NM_052954	NP_443186			cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	28932042	28932043	+	IGR	INS	-	A	A	rs143907330	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28932042_28932043insA								ADAMTS5 (592603 upstream) : NCRNA00113 (162655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29128368	29128368	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29128368delT								NCRNA00113 (4816 upstream) : C21orf94 (257314 downstream)																																			---	---	---	---
CCT8	10694	broad.mit.edu	37	21	30438529	30438530	+	Intron	INS	-	TAT	TAT			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30438529_30438530insTAT	uc002ynb.2	-						CCT8_uc011acp.1_Intron|CCT8_uc002yna.2_Intron|CCT8_uc002ync.2_Intron|CCT8_uc010glm.2_Intron|CCT8_uc011acq.1_Intron	NM_006585	NP_006576			chaperonin containing TCP1, subunit 8 (theta)						'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding				0																		---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	30978986	30978990	+	Intron	DEL	AAAAC	-	-	rs113562741		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30978986_30978990delAAAAC	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron|uc002ynp.1_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
KRTAP13-2	337959	broad.mit.edu	37	21	31746755	31746756	+	5'Flank	DEL	CT	-	-	rs73201822	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31746755_31746756delCT	uc002ynz.3	-							NM_181621	NP_853652			keratin associated protein 13-2							intermediate filament					0																		---	---	---	---
MRAP	56246	broad.mit.edu	37	21	33673876	33673876	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33673876delT	uc002ypj.2	+						MRAP_uc002ypk.2_Intron|MRAP_uc011ado.1_Intron|MRAP_uc002ypl.2_Intron	NM_178817	NP_848932			melanocortin 2 receptor accessory protein						positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding				0																		---	---	---	---
URB1	9875	broad.mit.edu	37	21	33707628	33707628	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33707628delA	uc002ypn.2	-							NM_014825	NP_055640			URB1 ribosome biogenesis 1 homolog							nucleolus	protein binding				0																		---	---	---	---
C21orf63	59271	broad.mit.edu	37	21	33865019	33865020	+	Intron	INS	-	TT	TT	rs112341937		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33865019_33865020insTT	uc002ypr.1	+						C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron|C21orf63_uc002ypu.1_Intron|C21orf63_uc011adq.1_5'Flank	NM_058187	NP_478067			hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3																		---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34133212	34133213	+	Intron	DEL	GC	-	-	rs8133271		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133212_34133213delGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
SLC5A3	6526	broad.mit.edu	37	21	35458817	35458818	+	Intron	DEL	TG	-	-	rs140560551		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35458817_35458818delTG	uc002yto.2	+						MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864			solute carrier family 5 (inositol transporters),							integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2																		---	---	---	---
KCNE2	9992	broad.mit.edu	37	21	35735642	35735651	+	5'Flank	DEL	TTCTTCTTCC	-	-	rs77254249	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35735642_35735651delTTCTTCTTCC	uc002ytt.1	+							NM_172201	NP_751951			potassium voltage-gated channel, Isk-related						blood circulation|muscle contraction|regulation of heart contraction	lysosome|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	35786523	35786524	+	IGR	DEL	CA	-	-	rs111903972	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35786523_35786524delCA								FAM165B (11449 upstream) : KCNE1 (32465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	35999787	35999787	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35999787delT								RCAN1 (12405 upstream) : CLIC6 (41901 downstream)																																			---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36365943	36365944	+	Intron	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36365943_36365944delCA	uc010gmu.2	-						RUNX1_uc002yut.1_Intron|RUNX1_uc010gmv.2_Intron|RUNX1_uc002yuj.3_Intron|RUNX1_uc002yuk.3_Intron|RUNX1_uc002yum.1_Intron|RUNX1_uc010gmw.1_Intron	NM_001754	NP_001745			runt-related transcription factor 1 isoform						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36588309	36588310	+	Intron	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36588309_36588310insC	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
RUNX1	861	broad.mit.edu	37	21	37200381	37200382	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37200381_37200382insT	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37629963	37629964	+	Intron	INS	-	GTAG	GTAG	rs144536686	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37629963_37629964insGTAG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron|DOPEY2_uc002yvh.2_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
HLCS	3141	broad.mit.edu	37	21	38349169	38349169	+	Intron	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38349169delG	uc002yvs.2	-							NM_000411	NP_000402			holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	39360234	39360234	+	IGR	DEL	T	-	-	rs111276317		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39360234delT								KCNJ6 (71538 upstream) : DSCR4 (66080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	41188351	41188352	+	IGR	INS	-	GAGAG	GAGAG	rs143121776	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41188351_41188352insGAGAG								IGSF5 (14330 upstream) : PCP4 (50995 downstream)																																			---	---	---	---
C21orf121	150142	broad.mit.edu	37	21	43443260	43443260	+	3'UTR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43443260delA	uc011aeu.1	+	1						NR_027273				Homo sapiens cDNA FLJ30605 fis, clone CTONG2000303.												0																		---	---	---	---
SLC37A1	54020	broad.mit.edu	37	21	43940071	43940074	+	Intron	DEL	TGTT	-	-	rs11277768		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43940071_43940074delTGTT	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837			solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	45266646	45266646	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45266646delT								LOC284837 (34198 upstream) : AGPAT3 (18470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	45865887	45865887	+	IGR	DEL	A	-	-	rs11331681		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45865887delA								TRPM2 (2923 upstream) : LRRC3 (9506 downstream)																																			---	---	---	---
C21orf29	54084	broad.mit.edu	37	21	46108213	46108214	+	Intron	INS	-	ACT	ACT	rs147296839	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46108213_46108214insACT	uc002zfe.1	-						C21orf29_uc010gpv.1_Intron	NM_144991	NP_659428			chromosome 21 open reading frame 29 precursor						cell adhesion	extracellular region	structural molecule activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	46815681	46815682	+	IGR	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46815681_46815682delTG								LOC642852 (98413 upstream) : COL18A1 (9415 downstream)																																			---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46892724	46892725	+	Intron	INS	-	T	T	rs145756727	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46892724_46892725insT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46899207	46899208	+	Intron	DEL	AT	-	-	rs67843080		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46899207_46899208delAT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46904533	46904534	+	Intron	INS	-	ACAT	ACAT	rs145656079	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46904533_46904534insACAT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46904578	46904581	+	Intron	DEL	ACAC	-	-	rs5844239		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46904578_46904581delACAC	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	46983986	46983987	+	IGR	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46983986_46983987insT								SLC19A1 (19661 upstream) : PCBP3 (79696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	47486332	47486333	+	IGR	INS	-	GCA	GCA	rs140477542	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47486332_47486333insGCA								COL6A1 (61369 upstream) : COL6A2 (31700 downstream)																																			---	---	---	---
DIP2A	23181	broad.mit.edu	37	21	47880613	47880613	+	Intron	DEL	T	-	-	rs112784209		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47880613delT	uc002zjo.2	+						DIP2A_uc011afy.1_Intron|DIP2A_uc011afz.1_Intron|uc002zjk.2_5'Flank|DIP2A_uc002zjl.2_Intron|DIP2A_uc002zjm.2_Intron|DIP2A_uc010gql.2_Intron|DIP2A_uc002zjn.2_Intron	NM_015151	NP_055966			disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---
CECR2	27443	broad.mit.edu	37	22	17898546	17898557	+	Intron	DEL	GAGGAAGAGGAG	-	-	rs55821121		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17898546_17898557delGAGGAAGAGGAG	uc010gqv.1	+							NM_031413	NP_113601			cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	19618951	19618951	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19618951delT								LOC150185 (64589 upstream) : SEPT5 (83036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	28144125	28144126	+	IGR	DEL	AC	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28144125_28144126delAC								None (None upstream) : MN1 (140 downstream)																																			---	---	---	---
PITPNB	23760	broad.mit.edu	37	22	28302790	28302791	+	Intron	DEL	CA	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28302790_28302791delCA	uc003adk.2	-						PITPNB_uc011akh.1_Intron|PITPNB_uc003adl.2_Intron	NM_012399	NP_036531			phosphatidylinositol transfer protein, beta						lipid metabolic process|transport	Golgi apparatus	lipid binding			skin(1)	1																		---	---	---	---
KREMEN1	83999	broad.mit.edu	37	22	29513138	29513139	+	Intron	DEL	TG	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29513138_29513139delTG	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434			kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5																		---	---	---	---
KREMEN1	83999	broad.mit.edu	37	22	29533136	29533136	+	Intron	DEL	T	-	-	rs113129675		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29533136delT	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434			kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5																		---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30359833	30359833	+	Intron	DEL	A	-	-	rs76147281		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30359833delA	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576			myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)															---	---	---	---
BPIL2	254240	broad.mit.edu	37	22	32860634	32860637	+	5'Flank	DEL	ACAC	-	-	rs35194852		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32860634_32860637delACAC	uc011amb.1	-						BPIL2_uc003amo.3_5'Flank					SubName: Full=cDNA FLJ61439, highly similar to Bactericidal/permeability-increasingprotein-like 2;							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2																OREG0003514	type=REGULATORY REGION|Gene=BC062656|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
LARGE	9215	broad.mit.edu	37	22	34205868	34205869	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34205868_34205869insA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	35205127	35205128	+	IGR	INS	-	T	T	rs148456180	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35205127_35205128insT								LARGE (886543 upstream) : ISX (257001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	37714553	37714553	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37714553delG								CYTH4 (3165 upstream) : ELFN2 (49426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	39677295	39677296	+	IGR	INS	-	A	A	rs111516717		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39677295_39677296insA								PDGFB (36338 upstream) : RPL3 (31592 downstream)																																			---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40689118	40689118	+	Intron	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40689118delA	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973			trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
POLDIP3	84271	broad.mit.edu	37	22	42994097	42994097	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42994097delT	uc003bcu.2	-						POLDIP3_uc011app.1_Intron|POLDIP3_uc003bcv.2_Intron|POLDIP3_uc011apq.1_Intron|POLDIP3_uc010gza.2_Intron|POLDIP3_uc011apr.1_Intron|POLDIP3_uc010gzb.1_Intron	NM_032311	NP_115687			DNA polymerase delta interacting protein 3						positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
CYB5R3	1727	broad.mit.edu	37	22	43044859	43044860	+	Intron	DEL	CC	-	-	rs71793094		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43044859_43044860delCC	uc003bcz.2	-						CYB5R3_uc003bcy.2_5'Flank|CYB5R3_uc003bcx.2_5'Flank	NM_000398	NP_000389			cytochrome b5 reductase 3 isoform m						blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity			skin(1)	1					NADH(DB00157)													---	---	---	---
TTLL1	25809	broad.mit.edu	37	22	43482135	43482136	+	Intron	INS	-	A	A	rs145790230	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43482135_43482136insA	uc003bdi.2	-						TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395			tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)														---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	43985692	43985693	+	Intron	INS	-	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43985692_43985693insA	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzj.1_Intron	NM_022785	NP_073622			CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
ATXN10	25814	broad.mit.edu	37	22	46152027	46152028	+	Intron	INS	-	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46152027_46152028insT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368			ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)														---	---	---	---
PPARA	5465	broad.mit.edu	37	22	46622056	46622057	+	Intron	DEL	AT	-	-	rs34108706		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46622056_46622057delAT	uc003bgw.1	+						PPARA_uc003bgx.1_Intron|PPARA_uc010hab.1_Intron|PPARA_uc003bhb.1_Intron|PPARA_uc010hac.1_Intron	NM_005036	NP_005027			peroxisome proliferative activated receptor,						fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)													---	---	---	---
CERK	64781	broad.mit.edu	37	22	47133197	47133198	+	Intron	INS	-	AC	AC	rs148155813	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47133197_47133198insAC	uc003bia.2	-							NM_022766	NP_073603			ceramide kinase						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48693723	48693724	+	IGR	INS	-	T	T	rs146835778	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48693723_48693724insT								None (None upstream) : FAM19A5 (191564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	685723	685724	+	IGR	INS	-	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:685723_685724insC								SHOX (65578 upstream) : CRLF2 (629163 downstream)																																			---	---	---	---
GYG2	8908	broad.mit.edu	37	X	2774786	2774793	+	Intron	DEL	TATCTATG	-	-	rs80318590		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774786_2774793delTATCTATG	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909			glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
PDK3	5165	broad.mit.edu	37	X	24517162	24517162	+	Intron	DEL	T	-	-	rs113531183		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24517162delT	uc004dbg.2	+						PDK3_uc004dbh.2_Intron	NM_005391	NP_005382			pyruvate dehydrogenase kinase 3 isoform 2						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|protein binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6																		---	---	---	---
DMD	1756	broad.mit.edu	37	X	32900174	32900174	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32900174delT	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
CLCN5	1184	broad.mit.edu	37	X	49791133	49791133	+	Intron	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49791133delT	uc004dor.1	+						CLCN5_uc004doq.1_Intron	NM_001127899	NP_001121371			chloride channel 5 isoform a						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	61773240	61773240	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61773240delG								None (None upstream) : SPIN4 (793868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	64548402	64548402	+	IGR	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64548402delT								ZC4H2 (293809 upstream) : ZC3H12B (160304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	75317336	75317337	+	IGR	DEL	TA	-	-	rs2158452	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75317336_75317337delTA								MAGEE2 (312265 upstream) : CXorf26 (75434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	85025108	85025108	+	IGR	DEL	G	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85025108delG								POF1B (390360 upstream) : MIR1321 (65677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	109071286	109071291	+	IGR	DEL	TTGTTG	-	-	rs5903340		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109071286_109071291delTTGTTG								ACSL4 (94665 upstream) : TMEM164 (174572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	121424389	121424389	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:121424389delA								None (None upstream) : GRIA3 (893707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	148335157	148335157	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148335157delA								AFF2 (252965 upstream) : IDS (225140 downstream)																																			---	---	---	---
TMLHE	55217	broad.mit.edu	37	X	154844697	154844697	+	5'Flank	DEL	T	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154844697delT	uc004fnn.2	-						TMLHE_uc004fno.2_5'Flank|TMLHE_uc004fnp.3_5'Flank	NM_018196	NP_060666			trimethyllysine hydroxylase, epsilon						carnitine biosynthetic process	mitochondrial matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|trimethyllysine dioxygenase activity			ovary(1)	1	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9937799	9937799	+	IGR	DEL	A	-	-			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9937799delA								TTTY22 (286945 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9987492	9987493	+	IGR	DEL	CA	-	-	rs111703981		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9987492_9987493delCA								TTTY22 (336638 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13843008	13843012	+	IGR	DEL	AGTCA	-	-	rs76111096		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13843008_13843012delAGTCA								None (None upstream) : TTTY15 (931286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59032071	59032071	+	IGR	DEL	T	-	-	rs113525697		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59032071delT								None (None upstream) : None (None downstream)																																			---	---	---	---
SLC2A5	6518	broad.mit.edu	37	1	9117577	9117577	+	Missense_Mutation	SNP	C	T	T	rs13306771		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9117577C>T	uc001apo.2	-	3	515	c.223G>A	c.(223-225)GTG>ATG	p.V75M	SLC2A5_uc010nzz.1_Intron|SLC2A5_uc010oaa.1_Missense_Mutation_p.V31M|SLC2A5_uc010oab.1_Missense_Mutation_p.V75M|SLC2A5_uc010oac.1_Missense_Mutation_p.V75M|SLC2A5_uc001app.3_Missense_Mutation_p.V75M	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated	75	Helical; Name=2; (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17263238	17263238	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17263238G>C	uc001azt.2	+	9	1132	c.1063G>C	c.(1063-1065)GCA>CCA	p.A355P	CROCC_uc009voy.1_Missense_Mutation_p.A58P|CROCC_uc009voz.1_Missense_Mutation_p.A118P	NM_014675	NP_055490	Q5TZA2	CROCC_HUMAN	ciliary rootlet coiled-coil	355	Potential.				cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
KIAA0467	23334	broad.mit.edu	37	1	43916105	43916105	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43916105C>T	uc001cjk.1	+	57	8018	c.7556C>T	c.(7555-7557)TCT>TTT	p.S2519F	KIAA0467_uc001cjl.1_Missense_Mutation_p.S507F	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	3418						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
FOXE3	2301	broad.mit.edu	37	1	47882477	47882477	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47882477C>T	uc001crk.2	+	1	734	c.490C>T	c.(490-492)CGC>TGC	p.R164C		NM_012186	NP_036318	Q13461	FOXE3_HUMAN	forkhead box E3	164					cell migration|embryonic organ morphogenesis|enteric nervous system development|hair follicle morphogenesis|hard palate development|lens morphogenesis in camera-type eye|pattern specification process|positive regulation of epithelial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|soft palate development|thyroid gland development|thyroid hormone generation	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0				READ - Rectum adenocarcinoma(2;0.0908)														---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50610618	50610618	+	Intron	SNP	T	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50610618T>C	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
RBMXL1	494115	broad.mit.edu	37	1	89448906	89448906	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89448906G>A	uc009wcx.2	-	3	1320	c.604C>T	c.(604-606)CGT>TGT	p.R202C	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Missense_Mutation_p.R202C	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	202							nucleotide binding|RNA binding				0																		---	---	---	---
ATXN7L2	127002	broad.mit.edu	37	1	110030289	110030289	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110030289C>A	uc001dxr.2	+	5	578	c.563C>A	c.(562-564)CCT>CAT	p.P188H	ATXN7L2_uc001dxs.2_5'Flank	NM_153340	NP_699171	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	188										ovary(2)	2		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)														---	---	---	---
CDC42SE1	56882	broad.mit.edu	37	1	151027565	151027565	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151027565C>A	uc001ewo.2	-	4	662	c.92G>T	c.(91-93)GGG>GTG	p.G31V	CDC42SE1_uc001ewp.2_Missense_Mutation_p.G31V	NM_001038707	NP_001033796	Q9NRR8	C42S1_HUMAN	CDC42 small effector 1	31	CRIB.				phagocytosis|regulation of cell shape|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase inhibitor activity				0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152085380	152085380	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152085380C>T	uc001ezp.2	-	2	313	c.313G>A	c.(313-315)GGA>AGA	p.G105R	TCHH_uc009wne.1_Missense_Mutation_p.G105R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	105					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152280937	152280937	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152280937G>T	uc001ezu.1	-	3	6461	c.6425C>A	c.(6424-6426)CCG>CAG	p.P2142Q		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2142	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
MTX1	4580	broad.mit.edu	37	1	155181981	155181981	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155181981C>T	uc001fjb.2	+	4	848	c.742C>T	c.(742-744)CTC>TTC	p.L248F	RAG1AP1_uc010pey.1_Intron|MTX1_uc001fjc.2_Intron	NM_002455	NP_002446	Q13505	MTX1_HUMAN	metaxin 1 isoform 1	248					protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	protein binding			skin(1)	1	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
IFI16	3428	broad.mit.edu	37	1	158986334	158986334	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158986334A>T	uc001ftf.1	+	5	1000	c.393A>T	c.(391-393)AAA>AAT	p.K131N	IFI16_uc001ftg.2_Missense_Mutation_p.K131N|IFI16_uc010pis.1_Intron	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	131	Lys-rich.|Nuclear localization signal (Potential).				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)																	---	---	---	---
NCSTN	23385	broad.mit.edu	37	1	160321502	160321502	+	Silent	SNP	C	A	A	rs11547485		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160321502C>A	uc001fvx.2	+	7	874	c.750C>A	c.(748-750)CCC>CCA	p.P250P	NCSTN_uc001fvy.2_Silent_p.P230P|NCSTN_uc010pjf.1_Intron|NCSTN_uc001fvz.2_Silent_p.P30P|NCSTN_uc010pjg.1_5'UTR	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	250	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
LMX1A	4009	broad.mit.edu	37	1	165173286	165173286	+	Intron	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165173286G>C	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron|LMX1A_uc001gcw.1_Intron|LMX1A_uc001gcx.1_Intron	NM_177398	NP_796372			LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)																	---	---	---	---
PRRX1	5396	broad.mit.edu	37	1	170695508	170695508	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170695508G>A	uc001ghf.2	+	3	612	c.565G>A	c.(565-567)GAT>AAT	p.D189N	PRRX1_uc001ghe.2_Missense_Mutation_p.D189N	NM_022716	NP_073207	P54821	PRRX1_HUMAN	paired mesoderm homeobox 1 isoform pmx-1b	189						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185964194	185964194	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185964194A>C	uc001grq.1	+	24	3982	c.3753A>C	c.(3751-3753)GAA>GAC	p.E1251D		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1251	Ig-like C2-type 9.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
FLVCR1	28982	broad.mit.edu	37	1	213032517	213032517	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213032517C>A	uc001hjt.2	+	1	921	c.723C>A	c.(721-723)GCC>GCA	p.A241A	LQK1_uc001hjr.3_5'Flank|LQK1_uc001hjs.3_5'Flank	NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular	241	Helical; (Potential).		A -> T (in PCARP).		cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)														---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216138733	216138733	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216138733C>A	uc001hku.1	-	37	7433	c.7046G>T	c.(7045-7047)TGG>TTG	p.W2349L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2349	Extracellular (Potential).|Fibronectin type-III 10.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
DNMT3A	1788	broad.mit.edu	37	2	25467508	25467508	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25467508T>A	uc002rgc.2	-	14	1825	c.1568A>T	c.(1567-1569)GAG>GTG	p.E523V	DNMT3A_uc002rgd.2_Missense_Mutation_p.E523V|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.E334V	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	523	Interaction with the PRC2/EED-EZH2 complex (By similarity).|GATA-type; atypical.|ADD.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding	p.E523*(1)		haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							Mis|F|N|S		AML								---	---	---	---
ACTR2	10097	broad.mit.edu	37	2	65467087	65467087	+	Silent	SNP	T	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65467087T>C	uc002sdq.2	+	2	365	c.150T>C	c.(148-150)ATT>ATC	p.I50I	ACTR2_uc010yqf.1_5'UTR|ACTR2_uc002sdp.2_Silent_p.I50I|ACTR2_uc010yqg.1_5'UTR	NM_005722	NP_005713	P61160	ARP2_HUMAN	actin-related protein 2 isoform b	50					cellular component movement	Arp2/3 protein complex|cell projection|cytoplasm	actin binding|ATP binding				0																		---	---	---	---
REEP1	65055	broad.mit.edu	37	2	86479152	86479152	+	Nonsense_Mutation	SNP	G	C	C	rs138656911		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86479152G>C	uc002srh.3	-	5	489	c.345C>G	c.(343-345)TAC>TAG	p.Y115*	REEP1_uc010ytg.1_Nonsense_Mutation_p.Y94*|REEP1_uc010yth.1_Nonsense_Mutation_p.Y88*|REEP1_uc010yti.1_Intron	NM_022912	NP_075063	Q9H902	REEP1_HUMAN	receptor accessory protein 1 isoform 2	115					cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0																		---	---	---	---
CCDC138	165055	broad.mit.edu	37	2	109408220	109408220	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109408220C>A	uc002ten.1	+	4	416	c.356C>A	c.(355-357)TCG>TAG	p.S119*	CCDC138_uc002teo.1_Nonsense_Mutation_p.S119*|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	119											0																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179456492	179456492	+	Silent	SNP	T	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179456492T>C	uc010zfg.1	-	252	52574	c.52350A>G	c.(52348-52350)GAA>GAG	p.E17450E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.E11145E|TTN_uc010zfi.1_Silent_p.E11078E|TTN_uc010zfj.1_Silent_p.E10953E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18377							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
HJURP	55355	broad.mit.edu	37	2	234749470	234749470	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234749470G>A	uc002vvg.2	-	8	2022	c.1956C>T	c.(1954-1956)GGC>GGT	p.G652G	HJURP_uc010znd.1_Silent_p.G591G|HJURP_uc010zne.1_Silent_p.G560G	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	652					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)														---	---	---	---
COL6A3	1293	broad.mit.edu	37	2	238277470	238277470	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238277470G>A	uc002vwl.2	-	10	4921	c.4636C>T	c.(4636-4638)CTG>TTG	p.L1546L	COL6A3_uc002vwo.2_Silent_p.L1340L|COL6A3_uc010znj.1_Silent_p.L939L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1546	VWFA 8.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---
EDEM1	9695	broad.mit.edu	37	3	5252830	5252830	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5252830G>T	uc003bqi.2	+	10	1741	c.1609G>T	c.(1609-1611)GTC>TTC	p.V537F	EDEM1_uc003bqh.2_Missense_Mutation_p.V537F	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	537	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)														---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38627472	38627472	+	Missense_Mutation	SNP	C	A	A	rs45475899	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38627472C>A	uc003cio.2	-	16	2691	c.2497G>T	c.(2497-2499)GGG>TGG	p.G833W	SCN5A_uc003cin.2_Missense_Mutation_p.G833W|SCN5A_uc003cil.3_Missense_Mutation_p.G833W|SCN5A_uc010hhi.2_Missense_Mutation_p.G833W|SCN5A_uc010hhk.2_Missense_Mutation_p.G833W|SCN5A_uc011ayr.1_Missense_Mutation_p.G833W|SCN5A_uc010hhj.1_Missense_Mutation_p.G444W	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	833					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48621033	48621033	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48621033C>A	uc003ctz.2	-	40	4358	c.4357G>T	c.(4357-4359)GGA>TGA	p.G1453*		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1453	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
STAB1	23166	broad.mit.edu	37	3	52542330	52542330	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52542330G>A	uc003dej.2	+	21	2264	c.2190G>A	c.(2188-2190)ACG>ACA	p.T730T	STAB1_uc003dei.1_Silent_p.T730T	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	730	EGF-like 5.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)														---	---	---	---
APPL1	26060	broad.mit.edu	37	3	57276167	57276167	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57276167A>G	uc003dio.2	+	6	559	c.412A>G	c.(412-414)AAT>GAT	p.N138D	APPL1_uc010hnb.2_Missense_Mutation_p.N138D|APPL1_uc011bey.1_Missense_Mutation_p.N121D	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH	138	Required for RAB5A binding.				apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62501832	62501832	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62501832G>T	uc003dll.2	-	16	2843	c.2483C>A	c.(2482-2484)CCA>CAA	p.P828Q	CADPS_uc003dlk.1_Missense_Mutation_p.P332Q|CADPS_uc003dlm.2_Missense_Mutation_p.P828Q|CADPS_uc003dln.2_Missense_Mutation_p.P811Q	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	828	Interaction with DRD2.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77542416	77542416	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77542416G>T	uc003dpy.3	+	5	1332	c.689G>T	c.(688-690)AGG>ATG	p.R230M	ROBO2_uc003dpz.2_Missense_Mutation_p.R230M|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R230M	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	230	Ig-like C2-type 3.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
OR5AC2	81050	broad.mit.edu	37	3	97806545	97806545	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806545C>T	uc011bgs.1	+	1	529	c.529C>T	c.(529-531)CAT>TAT	p.H177Y		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
MCM2	4171	broad.mit.edu	37	3	127325043	127325043	+	Silent	SNP	G	T	T	rs146895950		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127325043G>T	uc003ejp.2	+	5	813	c.756G>T	c.(754-756)CCG>CCT	p.P252P	MCM2_uc011bkm.1_Silent_p.P122P|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Silent_p.P136P	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	252	Interaction with MYST2 (By similarity).				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4																		---	---	---	---
MASP1	5648	broad.mit.edu	37	3	186954126	186954126	+	Intron	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186954126G>A	uc003frh.1	-						MASP1_uc003fri.2_Silent_p.V511V|MASP1_uc003frj.2_Silent_p.V480V	NM_001879	NP_001870			mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)														---	---	---	---
SST	6750	broad.mit.edu	37	3	187386909	187386909	+	Silent	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187386909G>T	uc003frn.2	-	2	417	c.295C>A	c.(295-297)CGA>AGA	p.R99R		NM_001048	NP_001039	P61278	SMS_HUMAN	somatostatin preproprotein	99					digestion|G-protein coupled receptor protein signaling pathway|induction of apoptosis by hormones|negative regulation of cell proliferation|response to nutrient|synaptic transmission	extracellular space	hormone activity			pancreas(1)	1	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Bromocriptine(DB01200)|Cysteamine(DB00847)													---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66213904	66213904	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66213904G>C	uc003hcy.2	-	15	2719	c.2526C>G	c.(2524-2526)ATC>ATG	p.I842M	EPHA5_uc003hcx.2_Missense_Mutation_p.I774M|EPHA5_uc003hcz.2_Missense_Mutation_p.I820M|EPHA5_uc011cah.1_Missense_Mutation_p.I843M|EPHA5_uc011cai.1_Missense_Mutation_p.I821M|EPHA5_uc003hda.2_Missense_Mutation_p.I843M	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	842	Cytoplasmic (Potential).|Protein kinase.				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
ENAM	10117	broad.mit.edu	37	4	71508801	71508801	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71508801C>A	uc011caw.1	+	9	1939	c.1658C>A	c.(1657-1659)CCT>CAT	p.P553H		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	553					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)															---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372269	126372269	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372269A>C	uc003ifj.3	+	9	10098	c.10098A>C	c.(10096-10098)GAA>GAC	p.E3366D	FAT4_uc011cgp.1_Missense_Mutation_p.E1664D|FAT4_uc003ifi.1_Missense_Mutation_p.E844D	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3366	Cadherin 32.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
GUCY1B3	2983	broad.mit.edu	37	4	156710933	156710933	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156710933G>A	uc003ipc.2	+	5	532	c.365G>A	c.(364-366)TGC>TAC	p.C122Y	GUCY1B3_uc011cio.1_Missense_Mutation_p.C144Y|GUCY1B3_uc011cip.1_Missense_Mutation_p.C102Y|GUCY1B3_uc003ipd.2_Missense_Mutation_p.C50Y|GUCY1B3_uc010iqf.2_Missense_Mutation_p.C122Y|GUCY1B3_uc010iqg.2_Missense_Mutation_p.C50Y|GUCY1B3_uc011ciq.1_Missense_Mutation_p.C50Y	NM_000857	NP_000848	Q02153	GCYB1_HUMAN	guanylate cyclase 1, soluble, beta 3	122					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)														---	---	---	---
FBXO8	26269	broad.mit.edu	37	4	175180888	175180888	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175180888C>T	uc003itp.2	-	3	1268	c.418G>A	c.(418-420)GAT>AAT	p.D140N	FBXO8_uc003itq.2_Missense_Mutation_p.D99N	NM_012180	NP_036312	Q9NRD0	FBX8_HUMAN	F-box only protein 8	140					regulation of ARF protein signal transduction|ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ARF guanyl-nucleotide exchange factor activity			breast(2)	2		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)														---	---	---	---
IRX2	153572	broad.mit.edu	37	5	2749779	2749779	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2749779G>A	uc003jda.2	-	2	614	c.372C>T	c.(370-372)GAC>GAT	p.D124D	C5orf38_uc003jdc.2_5'Flank|C5orf38_uc011cmg.1_5'Flank|C5orf38_uc011cmh.1_5'Flank|C5orf38_uc011cmi.1_5'Flank|C5orf38_uc011cmj.1_5'Flank|IRX2_uc003jdb.2_Silent_p.D124D	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	124	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)														---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7816990	7816990	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7816990G>A	uc003jdz.1	+	23	2962	c.2895G>A	c.(2893-2895)CGG>CGA	p.R965R	ADCY2_uc011cmo.1_Silent_p.R785R|ADCY2_uc010itm.1_Silent_p.R161R	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	965	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																OREG0016499	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PRDM9	56979	broad.mit.edu	37	5	23522938	23522938	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522938T>A	uc003jgo.2	+	8	1008	c.826T>A	c.(826-828)TAT>AAT	p.Y276N		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	276	SET.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33576653	33576653	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576653C>A	uc003jia.1	-	19	3641	c.3478G>T	c.(3478-3480)GGG>TGG	p.G1160W	ADAMTS12_uc010iuq.1_Missense_Mutation_p.G1075W	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1160	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
RXFP3	51289	broad.mit.edu	37	5	33937325	33937325	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937325G>A	uc003jic.1	+	1	837	c.480G>A	c.(478-480)ATG>ATA	p.M160I		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	160	Helical; Name=3; (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
HCN1	348980	broad.mit.edu	37	5	45262695	45262695	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262695C>T	uc003jok.2	-	8	2026	c.2001G>A	c.(1999-2001)GTG>GTA	p.V667V		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	667	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---
F2R	2149	broad.mit.edu	37	5	76028235	76028235	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76028235A>C	uc003ken.3	+	2	450	c.185A>C	c.(184-186)AAT>ACT	p.N62T		NM_001992	NP_001983	P25116	PAR1_HUMAN	coagulation factor II receptor precursor	62	Extracellular (Potential).				activation of caspase activity|anatomical structure morphogenesis|connective tissue replacement involved in inflammatory response wound healing|negative regulation of cell proliferation|platelet activation|positive regulation of blood coagulation|positive regulation of cell migration|positive regulation of collagen biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JAK-STAT cascade|positive regulation of MAPKKK cascade|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of transcription, DNA-dependent|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	caveola|extracellular region|Golgi apparatus|integral to plasma membrane|platelet dense tubular network	receptor binding|thrombin receptor activity			ovary(3)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)													---	---	---	---
CMYA5	202333	broad.mit.edu	37	5	79032618	79032618	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79032618G>A	uc003kgc.2	+	2	8102	c.8030G>A	c.(8029-8031)AGA>AAA	p.R2677K		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2677						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---
ELL2	22936	broad.mit.edu	37	5	95242391	95242391	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95242391G>A	uc003klr.3	-	5	927	c.577C>T	c.(577-579)CGA>TGA	p.R193*		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	193					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)														---	---	---	---
FNIP1	96459	broad.mit.edu	37	5	131008175	131008175	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131008175G>A	uc003kvs.1	-	14	2104	c.1962C>T	c.(1960-1962)GAC>GAT	p.D654D	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Silent_p.D626D|FNIP1_uc010jdm.1_Silent_p.D609D	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	654					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)														---	---	---	---
SLC23A1	9963	broad.mit.edu	37	5	138715427	138715427	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138715427G>A	uc003leh.2	-	8	962	c.865C>T	c.(865-867)CGA>TGA	p.R289*	SLC23A1_uc003leg.2_Nonsense_Mutation_p.R293*	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	289					brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)													---	---	---	---
PCDHA2	56146	broad.mit.edu	37	5	140176010	140176010	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140176010C>T	uc003lhd.2	+	1	1567	c.1461C>T	c.(1459-1461)AAC>AAT	p.N487N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.N487N|PCDHA2_uc011czy.1_Silent_p.N487N	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	487	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA8	56140	broad.mit.edu	37	5	140221483	140221483	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221483G>C	uc003lhs.2	+	1	577	c.577G>C	c.(577-579)GAG>CAG	p.E193Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.E193Q	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	193	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA8	56140	broad.mit.edu	37	5	140221536	140221536	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221536A>T	uc003lhs.2	+	1	630	c.630A>T	c.(628-630)TTA>TTT	p.L210F	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.L210F	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	210	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	145972544	145972544	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145972544C>A	uc003loe.2	-	8	1567	c.1042G>T	c.(1042-1044)GGG>TGG	p.G348W	PPP2R2B_uc010jgm.2_Missense_Mutation_p.G337W|PPP2R2B_uc003log.3_Missense_Mutation_p.G348W|PPP2R2B_uc003lof.3_Missense_Mutation_p.G348W|PPP2R2B_uc003loi.3_Missense_Mutation_p.G351W|PPP2R2B_uc003loh.3_Missense_Mutation_p.G348W|PPP2R2B_uc003loj.3_Missense_Mutation_p.G328W|PPP2R2B_uc003lok.3_Missense_Mutation_p.G337W|PPP2R2B_uc011dbu.1_Missense_Mutation_p.G354W|PPP2R2B_uc011dbv.1_Missense_Mutation_p.G406W	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	348	WD 6.				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PCYOX1L	78991	broad.mit.edu	37	5	148742349	148742349	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148742349G>A	uc003lqk.2	+	2	300	c.238G>A	c.(238-240)GGG>AGG	p.G80R	PCYOX1L_uc003lql.2_Missense_Mutation_p.G63R|PCYOX1L_uc010jgz.2_Missense_Mutation_p.G63R|PCYOX1L_uc003lqm.2_5'UTR|PCYOX1L_uc003lqn.2_5'UTR	NM_024028	NP_076933	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like precursor	80					prenylcysteine catabolic process	extracellular region	oxidoreductase activity, acting on a sulfur group of donors, oxygen as acceptor			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
GPLD1	2822	broad.mit.edu	37	6	24433622	24433622	+	Intron	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24433622A>T	uc003ned.1	-							NM_001503	NP_001494			glycosylphosphatidylinositol specific							extracellular region	glycosylphosphatidylinositol phospholipase D activity			ovary(2)|kidney(1)	3																		---	---	---	---
HIST1H1B	3009	broad.mit.edu	37	6	27835189	27835189	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27835189C>A	uc003njx.2	-	1	171	c.119G>T	c.(118-120)GGG>GTG	p.G40V		NM_005322	NP_005313	P16401	H15_HUMAN	histone cluster 1, H1b	40	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(2)|lung(1)	3																		---	---	---	---
MSH5	4439	broad.mit.edu	37	6	31729521	31729521	+	Intron	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31729521C>A	uc003nwv.1	+						MSH5_uc003nwt.1_Intron|MSH5_uc003nwu.1_Intron|MSH5_uc003nww.1_Intron|MSH5_uc003nwx.1_Intron|MSH5_uc011dof.1_Intron|MSH5_uc003nwy.1_Intron|MSH5_uc003nwz.3_Intron|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898			mutS homolog 5 isoform c						chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3													Direct_reversal_of_damage|MMR					---	---	---	---
CUL9	23113	broad.mit.edu	37	6	43164586	43164586	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43164586G>T	uc003ouk.2	+	11	2864	c.2789G>T	c.(2788-2790)AGC>ATC	p.S930I	CUL9_uc003oul.2_Missense_Mutation_p.S930I|CUL9_uc010jyk.2_Missense_Mutation_p.S82I	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	930					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66205120	66205120	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66205120C>T	uc011dxu.1	-	4	722	c.184G>A	c.(184-186)GTA>ATA	p.V62I	EYS_uc003peq.2_Missense_Mutation_p.V62I|EYS_uc003per.1_Missense_Mutation_p.V62I|EYS_uc010kaj.1_RNA	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	62					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
C6orf58	352999	broad.mit.edu	37	6	127898516	127898516	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127898516G>A	uc003qbh.2	+	1	198	c.186G>A	c.(184-186)GGG>GGA	p.G62G		NM_001010905	NP_001010905	Q6P5S2	CF058_HUMAN	hypothetical protein LOC352999 precursor	62						extracellular region					0				GBM - Glioblastoma multiforme(226;0.0405)|all cancers(137;0.156)														---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42007479	42007479	+	Missense_Mutation	SNP	G	T	T	rs116840750		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42007479G>T	uc011kbh.1	-	14	2237	c.2146C>A	c.(2146-2148)CAA>AAA	p.Q716K	GLI3_uc011kbg.1_Missense_Mutation_p.Q657K	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	716					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82581840	82581840	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82581840G>T	uc003uhx.2	-	5	8718	c.8429C>A	c.(8428-8430)ACA>AAA	p.T2810K	PCLO_uc003uhv.2_Missense_Mutation_p.T2810K|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2741					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
SEMA3A	10371	broad.mit.edu	37	7	83689885	83689885	+	Intron	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83689885A>T	uc003uhz.2	-							NM_006080	NP_006071			semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4																		---	---	---	---
ST7	7982	broad.mit.edu	37	7	116862067	116862067	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116862067C>A	uc003vin.2	+	15	1803	c.1589C>A	c.(1588-1590)GCC>GAC	p.A530D	ST7_uc011knl.1_Missense_Mutation_p.A507D|ST7_uc003vio.2_Missense_Mutation_p.A507D|ST7_uc003viq.2_Missense_Mutation_p.A484D|ST7_uc011knm.1_Missense_Mutation_p.A487D|ST7_uc003vir.2_Missense_Mutation_p.A450D|ST7_uc011knn.1_Intron	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b	530	Helical; (Potential).					integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
OR6B1	135946	broad.mit.edu	37	7	143701816	143701816	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701816C>T	uc003wdt.1	+	1	727	c.727C>T	c.(727-729)CTT>TTT	p.L243F		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)																	---	---	---	---
GIMAP8	155038	broad.mit.edu	37	7	150171411	150171411	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150171411C>T	uc003whj.2	+	4	1324	c.994C>T	c.(994-996)CCA>TCA	p.P332S		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	332						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)														---	---	---	---
GIMAP1	170575	broad.mit.edu	37	7	150417566	150417566	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150417566C>T	uc003whq.2	+	3	561	c.474C>T	c.(472-474)GCC>GCT	p.A158A	GIMAP1_uc003whp.2_Silent_p.A166A	NM_130759	NP_570115	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	158	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
ARHGEF10	9639	broad.mit.edu	37	8	1842700	1842700	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1842700G>A	uc003wpr.2	+	13	1580	c.1402G>A	c.(1402-1404)GAC>AAC	p.D468N	ARHGEF10_uc003wpq.1_Missense_Mutation_p.D493N|ARHGEF10_uc003wps.2_Missense_Mutation_p.D430N|ARHGEF10_uc003wpt.2_Missense_Mutation_p.D344N|ARHGEF10_uc003wpv.2_Missense_Mutation_p.D201N|ARHGEF10_uc010lre.2_Missense_Mutation_p.D148N	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	493	DH.				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)														---	---	---	---
ANK1	286	broad.mit.edu	37	8	41577373	41577373	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41577373C>A	uc003xok.2	-	10	997	c.913G>T	c.(913-915)GGC>TGC	p.G305C	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Missense_Mutation_p.G305C|ANK1_uc003xoj.2_Missense_Mutation_p.G305C|ANK1_uc003xol.2_Missense_Mutation_p.G305C|ANK1_uc003xom.2_Missense_Mutation_p.G338C	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	305	ANK 9.|89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)															---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	59059489	59059489	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059489G>A	uc003xtj.1	+	5	1580	c.700G>A	c.(700-702)GCC>ACC	p.A234T		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	234						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61764746	61764746	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61764746G>A	uc003xue.2	+	29	6311	c.5834G>A	c.(5833-5835)CGA>CAA	p.R1945Q		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1945	Poly-Arg.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68995493	68995493	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68995493G>T	uc003xxv.1	+	18	1924	c.1897G>T	c.(1897-1899)GGG>TGG	p.G633W	PREX2_uc003xxu.1_Missense_Mutation_p.G633W|PREX2_uc011lez.1_Missense_Mutation_p.G568W	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	633	PDZ 1.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87491233	87491233	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87491233A>T	uc003ydu.2	-	7	808	c.648T>A	c.(646-648)TAT>TAA	p.Y216*	FAM82B_uc011lfz.1_Nonsense_Mutation_p.Y186*|FAM82B_uc011lga.1_Nonsense_Mutation_p.Y186*	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	216						microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
RNF19A	25897	broad.mit.edu	37	8	101281002	101281002	+	Intron	SNP	A	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101281002A>G	uc003yjj.1	-						RNF19A_uc003yjk.1_Intron	NM_015435	NP_056250			ring finger protein 19						microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)															---	---	---	---
C9orf131	138724	broad.mit.edu	37	9	35045147	35045147	+	Missense_Mutation	SNP	C	A	A	rs149037917		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35045147C>A	uc003zvw.2	+	2	2550	c.2521C>A	c.(2521-2523)CAC>AAC	p.H841N	C9orf131_uc003zvu.2_Missense_Mutation_p.H793N|C9orf131_uc003zvv.2_Missense_Mutation_p.H768N|C9orf131_uc003zvx.2_Missense_Mutation_p.H806N	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	841											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)															---	---	---	---
SHC3	53358	broad.mit.edu	37	9	91680437	91680437	+	Intron	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91680437C>A	uc004aqg.2	-							NM_016848	NP_058544			src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114911611	114911611	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114911611C>A	uc004bfu.2	-	3	327	c.286G>T	c.(286-288)GGG>TGG	p.G96W	SUSD1_uc010mui.2_Missense_Mutation_p.G96W|SUSD1_uc010muj.2_Missense_Mutation_p.G96W	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor	96	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).					integral to membrane	calcium ion binding				0																		---	---	---	---
TRIM32	22954	broad.mit.edu	37	9	119461520	119461520	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119461520G>A	uc004bjx.2	+	2	1657	c.1499G>A	c.(1498-1500)CGA>CAA	p.R500Q	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Missense_Mutation_p.R500Q	NM_001099679	NP_001093149	Q13049	TRI32_HUMAN	tripartite motif-containing 32	500					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(2)|kidney(1)	3														Bardet-Biedl_syndrome				---	---	---	---
ASS1	445	broad.mit.edu	37	9	133346258	133346258	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133346258C>A	uc004bzm.2	+	8	889	c.533C>A	c.(532-534)CCG>CAG	p.P178Q	ASS1_uc004bzn.2_Missense_Mutation_p.P178Q|ASS1_uc010mza.2_Missense_Mutation_p.P254Q|ASS1_uc004bzo.2_Missense_Mutation_p.P159Q|ASS1_uc010mzb.2_Missense_Mutation_p.P216Q|ASS1_uc004bzp.2_Missense_Mutation_p.P178Q|ASS1_uc010mzc.2_Missense_Mutation_p.P178Q	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	178					arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)													---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37441047	37441047	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37441047G>C	uc001iza.1	+	12	1636	c.1537G>C	c.(1537-1539)GAG>CAG	p.E513Q		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	569						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---
ANUBL1	93550	broad.mit.edu	37	10	46122367	46122367	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46122367G>C	uc001jcp.3	-	7	1146	c.904C>G	c.(904-906)CAA>GAA	p.Q302E	ANUBL1_uc001jcl.3_5'UTR|ANUBL1_uc001jcm.3_Missense_Mutation_p.Q302E|ANUBL1_uc009xmu.2_Missense_Mutation_p.Q228E|ANUBL1_uc001jcn.3_Missense_Mutation_p.Q228E|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog	302							zinc ion binding				0																		---	---	---	---
C10orf71	118461	broad.mit.edu	37	10	50531548	50531548	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50531548C>T	uc010qgp.1	+	3	1297	c.958C>T	c.(958-960)CGC>TGC	p.R320C		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	320											0																		---	---	---	---
COL13A1	1305	broad.mit.edu	37	10	71647246	71647246	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71647246C>T	uc001jpr.1	+	6	1057	c.521C>T	c.(520-522)CCG>CTG	p.P174L	COL13A1_uc001jqj.1_Missense_Mutation_p.P174L|COL13A1_uc001jps.1_Missense_Mutation_p.P145L|COL13A1_uc001jpt.1_Missense_Mutation_p.P174L|COL13A1_uc001jpu.1_Missense_Mutation_p.P174L|COL13A1_uc001jpv.1_Missense_Mutation_p.P174L|COL13A1_uc001jpx.1_Missense_Mutation_p.P174L|COL13A1_uc001jpw.1_Missense_Mutation_p.P162L|COL13A1_uc001jpy.1_Missense_Mutation_p.P153L|COL13A1_uc001jpz.1_Missense_Mutation_p.P136L|COL13A1_uc001jqa.1_Missense_Mutation_p.P136L|COL13A1_uc001jqc.1_Missense_Mutation_p.P174L|COL13A1_uc001jqb.1_Missense_Mutation_p.P145L|COL13A1_uc001jql.2_Missense_Mutation_p.P174L|COL13A1_uc001jqd.1_Missense_Mutation_p.P162L|COL13A1_uc001jqe.1_Missense_Mutation_p.P157L|COL13A1_uc001jqf.1_Missense_Mutation_p.P174L|COL13A1_uc001jqg.1_Missense_Mutation_p.P174L|COL13A1_uc001jqh.1_Missense_Mutation_p.P174L|COL13A1_uc001jqi.1_Missense_Mutation_p.P174L|COL13A1_uc010qjf.1_5'UTR|COL13A1_uc001jqk.1_Missense_Mutation_p.P34L	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1	174	Extracellular (Potential).|Triple-helical region 1 (COL1).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
SLC29A3	55315	broad.mit.edu	37	10	73115914	73115914	+	Silent	SNP	C	T	T	rs113542201	byFrequency;by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73115914C>T	uc001jrr.3	+	5	744	c.687C>T	c.(685-687)AGC>AGT	p.S229S	SLC29A3_uc001jrs.3_Silent_p.S229S|SLC29A3_uc010qjq.1_Silent_p.S83S|SLC29A3_uc001jrt.3_Silent_p.S23S|SLC29A3_uc001jru.3_Silent_p.S41S	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (nucleoside	229	Extracellular (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity				0																		---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78649330	78649330	+	Intron	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78649330G>T	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron|uc001jxp.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
COX15	1355	broad.mit.edu	37	10	101478208	101478208	+	Silent	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101478208G>T	uc001kqb.3	-	7	1499	c.882C>A	c.(880-882)CCC>CCA	p.P294P	COX15_uc001kqc.3_Silent_p.P294P|COX15_uc010qpj.1_Silent_p.P115P	NM_078470	NP_510870	Q7KZN9	COX15_HUMAN	COX15 homolog isoform 1	294					heme a biosynthetic process|respiratory chain complex IV assembly|respiratory gaseous exchange	integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)														---	---	---	---
CWF19L1	55280	broad.mit.edu	37	10	102003464	102003464	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102003464G>A	uc001kqq.1	-	10	1122	c.1035C>T	c.(1033-1035)ATC>ATT	p.I345I	CWF19L1_uc001kqs.1_Silent_p.I97I|CWF19L1_uc001kqr.1_Silent_p.I345I|CWF19L1_uc001kqt.1_Silent_p.I49I|CWF19L1_uc010qpn.1_Silent_p.I208I	NM_018294	NP_060764	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control	345							catalytic activity				0		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)														---	---	---	---
C10orf118	55088	broad.mit.edu	37	10	115910910	115910910	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115910910C>T	uc001lbb.1	-	4	1481	c.829G>A	c.(829-831)GTT>ATT	p.V277I	C10orf118_uc001lbc.1_Missense_Mutation_p.V277I|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2	277	Potential.									ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)														---	---	---	---
APBB1	322	broad.mit.edu	37	11	6422608	6422608	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6422608C>T	uc001mdb.1	-	10	1655	c.1555G>A	c.(1555-1557)GAC>AAC	p.D519N	APBB1_uc001mcz.1_Missense_Mutation_p.D138N|APBB1_uc001mdd.3_Missense_Mutation_p.D297N|APBB1_uc001mda.2_Missense_Mutation_p.D44N|APBB1_uc001mdc.1_Missense_Mutation_p.D517N|APBB1_uc010rab.1_Missense_Mutation_p.D44N|APBB1_uc010rac.1_RNA|APBB1_uc010rad.1_Missense_Mutation_p.D236N	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	519					apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)														---	---	---	---
PAX6	5080	broad.mit.edu	37	11	31815020	31815020	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31815020G>A	uc001mtd.3	-	10	1888	c.998C>T	c.(997-999)CCC>CTC	p.P333L	PAX6_uc001mte.3_Missense_Mutation_p.P333L|PAX6_uc001mtg.3_Missense_Mutation_p.P347L|PAX6_uc001mtf.3_Missense_Mutation_p.P333L|PAX6_uc001mth.3_Missense_Mutation_p.P333L|PAX6_uc009yjr.2_Missense_Mutation_p.P333L	NM_001127612	NP_001121084	P26367	PAX6_HUMAN	paired box gene 6 isoform a	333	Pro/Ser/Thr-rich.				blood vessel development|central nervous system development|cornea development in camera-type eye|glucose homeostasis|iris morphogenesis|negative regulation of neurogenesis|neuron fate commitment|pancreatic A cell development|positive regulation of transcription, DNA-dependent|response to wounding|visual perception	cytoplasm|nuclear chromatin	R-SMAD binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|ubiquitin-protein ligase activity			lung(4)|ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	9	Lung SC(675;0.225)													Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				---	---	---	---
TRAF6	7189	broad.mit.edu	37	11	36511865	36511865	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36511865C>T	uc001mwr.1	-	8	1432	c.1092G>A	c.(1090-1092)TTG>TTA	p.L364L	uc001mwq.1_5'Flank|TRAF6_uc001mws.1_Silent_p.L364L	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	364	MATH.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40137320	40137320	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137320G>A	uc001mxa.1	-	2	2487	c.523C>T	c.(523-525)CGC>TGC	p.R175C	LRRC4C_uc001mxc.1_Missense_Mutation_p.R171C|LRRC4C_uc001mxd.1_Missense_Mutation_p.R171C|LRRC4C_uc001mxb.1_Missense_Mutation_p.R171C	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	175	LRR 5.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
TRIM48	79097	broad.mit.edu	37	11	55032378	55032378	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032378A>G	uc010rid.1	+	2	133	c.47A>G	c.(46-48)AAC>AGC	p.N16S		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	Error:Variant_position_missing_in_Q8IWZ4_after_alignment						intracellular	zinc ion binding				0																		---	---	---	---
OR5T3	390154	broad.mit.edu	37	11	56019843	56019843	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56019843C>A	uc010rjd.1	+	1	168	c.168C>A	c.(166-168)TTC>TTA	p.F56L		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	56	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)																	---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61094371	61094371	+	Intron	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61094371G>T	uc001nrc.3	-						DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Intron|DDB1_uc010rlg.1_Intron|DDB1_uc001nrd.2_Intron|DDB1_uc009ynl.1_Intron	NM_001923	NP_001914			damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
CORO1B	57175	broad.mit.edu	37	11	67209299	67209299	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67209299G>T	uc001olj.1	-	3	395	c.359C>A	c.(358-360)CCG>CAG	p.P120Q	CORO1B_uc009yrs.1_RNA|CORO1B_uc001olk.1_Missense_Mutation_p.P120Q|CORO1B_uc009yrt.1_RNA|CORO1B_uc009yru.1_RNA|CORO1B_uc001oll.1_Missense_Mutation_p.P120Q|CORO1B_uc010rps.1_Missense_Mutation_p.P120Q|CORO1B_uc009yrv.1_Missense_Mutation_p.P120Q	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B	120	WD 1.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)															---	---	---	---
PANX1	24145	broad.mit.edu	37	11	93862538	93862538	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93862538C>A	uc001per.2	+	1	445	c.60C>A	c.(58-60)CCC>CCA	p.P20P	uc001pen.1_RNA|PANX1_uc001peq.2_Silent_p.P20P	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1	20	Cytoplasmic (Potential).				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
MAML2	84441	broad.mit.edu	37	11	95724765	95724765	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95724765C>A	uc001pfw.1	-	3	3547	c.2262G>T	c.(2260-2262)ATG>ATT	p.M754I		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	754					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)						T	MECT1|CRTC3	salivary gland mucoepidermoid								---	---	---	---
HTR3A	3359	broad.mit.edu	37	11	113853937	113853937	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113853937G>A	uc010rxb.1	+	5	721	c.488G>A	c.(487-489)TGT>TAT	p.C163Y	HTR3A_uc010rxa.1_Missense_Mutation_p.C163Y|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Missense_Mutation_p.C142Y	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	157	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)													---	---	---	---
RNF214	257160	broad.mit.edu	37	11	117150932	117150932	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117150932G>C	uc001pqt.2	+	8	1147	c.1102G>C	c.(1102-1104)GAA>CAA	p.E368Q	RNF214_uc001pqu.2_Missense_Mutation_p.E368Q|RNF214_uc010rxf.1_Missense_Mutation_p.E213Q	NM_207343	NP_997226	Q8ND24	RN214_HUMAN	ring finger protein 214	368	Potential.						zinc ion binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)														---	---	---	---
MPZL2	10205	broad.mit.edu	37	11	118130885	118130885	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118130885C>A	uc001psn.2	-	4	609	c.468G>T	c.(466-468)CTG>CTT	p.L156L	MPZL2_uc001pso.2_Silent_p.L156L|MPZL2_uc001psp.1_Silent_p.L156L	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor	156	Helical; (Potential).				anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)														---	---	---	---
OR10G8	219869	broad.mit.edu	37	11	123901048	123901048	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123901048G>C	uc001pzp.1	+	1	719	c.719G>C	c.(718-720)TGT>TCT	p.C240S		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)														---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125281641	125281641	+	Splice_Site	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125281641G>T	uc001qbu.2	+	10	1131	c.817_splice	c.e10-1	p.V273_splice	PKNOX2_uc010saz.1_Splice_Site_p.V244_splice|PKNOX2_uc010sba.1_Splice_Site_p.V244_splice|PKNOX2_uc010sbb.1_Splice_Site_p.V209_splice|PKNOX2_uc001qbv.2_Missense_Mutation_p.K37N	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
GALNT8	26290	broad.mit.edu	37	12	4853758	4853758	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4853758G>A	uc001qne.1	+	4	844	c.752G>A	c.(751-753)CGG>CAG	p.R251Q		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	251	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding	p.R251Q(1)		ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
PLEKHA5	54477	broad.mit.edu	37	12	19498773	19498773	+	Intron	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19498773C>T	uc001reb.2	+						PLEKHA5_uc010sie.1_Intron|PLEKHA5_uc001rea.2_Intron|PLEKHA5_uc009zin.2_Intron|PLEKHA5_uc010sif.1_Intron|PLEKHA5_uc010sig.1_Intron|PLEKHA5_uc010sih.1_Intron|PLEKHA5_uc001rec.1_Intron|PLEKHA5_uc009zio.2_Intron	NM_019012	NP_061885			pleckstrin homology domain containing, family A								1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)																	---	---	---	---
AQP5	362	broad.mit.edu	37	12	50357409	50357409	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50357409C>T	uc001rvo.2	+	2	1020	c.498C>T	c.(496-498)GGC>GGT	p.G166G		NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5	166	Helical; (Potential).				carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0																		---	---	---	---
TPH2	121278	broad.mit.edu	37	12	72366364	72366364	+	Missense_Mutation	SNP	G	T	T	rs139896303		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72366364G>T	uc009zrw.1	+	6	815	c.674G>T	c.(673-675)CGG>CTG	p.R225L	TPH2_uc001swy.2_Missense_Mutation_p.R135L	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	225					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)													---	---	---	---
POLR3B	55703	broad.mit.edu	37	12	106804634	106804634	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106804634A>T	uc001tlp.2	+	12	1219	c.997A>T	c.(997-999)ATC>TTC	p.I333F	POLR3B_uc001tlq.2_Missense_Mutation_p.I275F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	333					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PLA2G1B	5319	broad.mit.edu	37	12	120762766	120762766	+	Nonsense_Mutation	SNP	G	T	T	rs146439623		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120762766G>T	uc001tyd.2	-	3	329	c.293C>A	c.(292-294)TCG>TAG	p.S98*	PLA2G1B_uc009zwx.2_Intron	NM_000928	NP_000919	P04054	PA21B_HUMAN	phospholipase A2 group IB precursor	98					actin filament organization|activation of MAPK activity|activation of phospholipase A2 activity|arachidonic acid secretion|cellular response to insulin stimulus|glucose transport|interleukin-8 production|leukotriene biosynthetic process|multicellular organismal lipid catabolic process|neutrophil chemotaxis|neutrophil mediated immunity|phosphatidylcholine metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of DNA replication|positive regulation of immune response|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein secretion|positive regulation of transcription from RNA polymerase II promoter	extracellular space	bile acid binding|calcium ion binding|calcium-dependent phospholipase A2 activity|cell surface binding|receptor binding			skin(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)															OREG0022189	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
UBC	7316	broad.mit.edu	37	12	125398297	125398297	+	Silent	SNP	A	T	T	rs146545363		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125398297A>T	uc001ugs.3	-	2	469	c.21T>A	c.(19-21)ACT>ACA	p.T7T	UBC_uc001ugr.2_5'Flank|UBC_uc001ugu.1_Silent_p.T7T|UBC_uc001ugt.2_Silent_p.T7T|UBC_uc001ugv.2_Silent_p.T7T|UBC_uc001ugw.2_5'UTR|UBC_uc009zyf.1_RNA	NM_021009	NP_066289	P0CG48	UBC_HUMAN	ubiquitin C	7	Ubiquitin-like 1.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|viral reproduction	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane	protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)														---	---	---	---
FRY	10129	broad.mit.edu	37	13	32802634	32802634	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32802634C>A	uc001utx.2	+	40	5744	c.5248C>A	c.(5248-5250)CCT>ACT	p.P1750T	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	1750					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
SOX21	11166	broad.mit.edu	37	13	95364245	95364245	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95364245C>A	uc001vma.2	-	1	145	c.59G>T	c.(58-60)CGG>CTG	p.R20L	uc001vmb.1_5'Flank	NM_007084	NP_009015	Q9Y651	SOX21_HUMAN	SRY-box 21	20	HMG box.				regulation of transcription from RNA polymerase II promoter|stem cell differentiation	nucleus	DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity				0	all_neural(89;0.0646)|Medulloblastoma(90;0.163)																	---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108518274	108518274	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518274G>T	uc001vql.2	-	1	1187	c.671C>A	c.(670-672)TCG>TAG	p.S224*		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	224						integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	22919110	22919110	+	Intron	SNP	A	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22919110A>G	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdw.2_Intron|uc001wdx.3_5'UTR					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22985292	22985292	+	Intron	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22985292C>T	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_RNA|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_Intron|uc001wfi.2_Intron|uc001wfj.1_RNA|uc001wfk.2_Intron|uc001wfl.2_RNA|uc010ajy.1_Intron|uc001wfn.2_Translation_Start_Site|uc001wfo.2_5'Flank|uc001wfp.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
HECTD1	25831	broad.mit.edu	37	14	31578734	31578734	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31578734G>A	uc001wrc.1	-	36	6838	c.6349C>T	c.(6349-6351)CGA>TGA	p.R2117*	HECTD1_uc001wra.1_Nonsense_Mutation_p.R243*|HECTD1_uc001wrb.1_Nonsense_Mutation_p.R243*	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	2117					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)														---	---	---	---
HEATR5A	25938	broad.mit.edu	37	14	31778285	31778285	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31778285C>A	uc001wrf.3	-	23	3743	c.3666G>T	c.(3664-3666)ACG>ACT	p.T1222T	HEATR5A_uc010ami.2_Silent_p.T1120T	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1509							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)														---	---	---	---
CTAGE5	4253	broad.mit.edu	37	14	39787141	39787141	+	Intron	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39787141C>T	uc001wvg.3	+						CTAGE5_uc010tqe.1_Intron|CTAGE5_uc001wuz.3_Intron|CTAGE5_uc001wuy.3_Intron|CTAGE5_uc001wvb.3_Intron|CTAGE5_uc001wvc.3_Intron|CTAGE5_uc001wva.3_Intron|CTAGE5_uc001wvh.3_Intron|CTAGE5_uc001wvf.3_Intron|CTAGE5_uc001wvi.3_Intron|CTAGE5_uc010amz.2_Intron|CTAGE5_uc001wvj.3_Intron	NM_005930	NP_005921			CTAGE family, member 5 isoform 1								enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)														---	---	---	---
DAAM1	23002	broad.mit.edu	37	14	59787287	59787287	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59787287G>T	uc001xdz.1	+	5	550	c.425G>T	c.(424-426)AGG>ATG	p.R142M	DAAM1_uc001xea.1_Missense_Mutation_p.R142M|DAAM1_uc001xeb.1_Missense_Mutation_p.R142M	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	142	GBD/FH3.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)														---	---	---	---
FUT8	2530	broad.mit.edu	37	14	66209050	66209050	+	Silent	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66209050G>A	uc001xin.2	+	11	2847	c.1650G>A	c.(1648-1650)ACG>ACA	p.T550T	FUT8_uc001xio.2_Silent_p.T550T|FUT8_uc010tsp.1_Silent_p.T387T|FUT8_uc001xir.3_RNA|FUT8_uc001xip.2_Silent_p.T550T|FUT8_uc001xiq.2_Silent_p.T421T|FUT8_uc001xis.2_Silent_p.T144T	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a	550	SH3.|Lumenal (Potential).				in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)														---	---	---	---
SLC12A6	9990	broad.mit.edu	37	15	34529608	34529608	+	Intron	SNP	C	T	T	rs11854257	by1000genomes	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34529608C>T	uc001zhw.2	-						SLC12A6_uc001zhv.2_Intron|SLC12A6_uc001zhx.2_Intron|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_Intron|SLC12A6_uc001zia.2_Intron|SLC12A6_uc001zib.2_Intron|SLC12A6_uc001zic.2_Intron|SLC12A6_uc010bau.2_Intron|SLC12A6_uc001zid.2_Intron|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Intron	NM_133647	NP_598408			solute carrier family 12, member 6 isoform a						angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)													---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48063496	48063496	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48063496G>T	uc010bek.2	+	19	3096	c.2736G>T	c.(2734-2736)ATG>ATT	p.M912I	SEMA6D_uc001zvw.2_Missense_Mutation_p.M850I|SEMA6D_uc001zvy.2_Missense_Mutation_p.M912I|SEMA6D_uc001zvz.2_Missense_Mutation_p.M856I|SEMA6D_uc001zwa.2_3'UTR|SEMA6D_uc001zwb.2_Missense_Mutation_p.M850I|SEMA6D_uc001zwc.2_Missense_Mutation_p.M837I	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	912	Cytoplasmic (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
WDR72	256764	broad.mit.edu	37	15	53957790	53957790	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53957790C>A	uc002acj.2	-	14	1983	c.1941G>T	c.(1939-1941)CTG>CTT	p.L647L	WDR72_uc010bfi.1_Silent_p.L647L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	647										lung(1)|skin(1)	2				all cancers(107;0.0511)														---	---	---	---
HEXA	3073	broad.mit.edu	37	15	72643464	72643464	+	Intron	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72643464G>T	uc002aun.3	-						uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Intron|HEXA_uc002auo.3_Intron|HEXA_uc010bix.2_Intron|HEXA_uc010biy.2_Intron|HEXA_uc010uko.1_Intron|HEXA_uc010biz.1_Intron	NM_000520	NP_000511			hexosaminidase A preproprotein						cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
ERCC4	2072	broad.mit.edu	37	16	14014039	14014039	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14014039C>A	uc002dce.2	+	1	26	c.17C>A	c.(16-18)CCG>CAG	p.P6Q	ERCC4_uc010bva.2_Missense_Mutation_p.P6Q	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	6					double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10								Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				---	---	---	---
PRSS53	339105	broad.mit.edu	37	16	31105608	31105608	+	Intron	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31105608C>A	uc002ear.2	-						VKORC1_uc002eas.2_Intron|VKORC1_uc002eat.2_Intron|VKORC1_uc002eau.2_Intron	NM_001039503	NP_001034592			polyserase 3 precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0																		---	---	---	---
KCNG4	93107	broad.mit.edu	37	16	84270619	84270619	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84270619T>G	uc010voc.1	-	2	594	c.473A>C	c.(472-474)GAG>GCG	p.E158A	KCNG4_uc002fhu.1_Missense_Mutation_p.E158A	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	158						voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3																		---	---	---	---
ZC3H18	124245	broad.mit.edu	37	16	88689636	88689636	+	Silent	SNP	G	A	A	rs147792336		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88689636G>A	uc002fky.2	+	10	1877	c.1677G>A	c.(1675-1677)TCG>TCA	p.S559S	ZC3H18_uc010voz.1_Silent_p.S583S|ZC3H18_uc010chw.2_RNA	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	559	Ser-rich.					nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)														---	---	---	---
RNF167	26001	broad.mit.edu	37	17	4845658	4845658	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4845658C>A	uc002fzq.2	+	5	604	c.188C>A	c.(187-189)CCA>CAA	p.P63Q	SLC25A11_uc002fzo.1_5'Flank|SLC25A11_uc002fzp.1_5'Flank|RNF167_uc002fzr.2_Missense_Mutation_p.P63Q|RNF167_uc002fzs.2_Missense_Mutation_p.P63Q|RNF167_uc002fzt.2_Missense_Mutation_p.P63Q|RNF167_uc002fzu.2_Missense_Mutation_p.P63Q|RNF167_uc002fzv.2_Missense_Mutation_p.P28Q|RNF167_uc002fzw.1_Missense_Mutation_p.P28Q|RNF167_uc002fzx.2_Missense_Mutation_p.P28Q|RNF167_uc002fzy.2_5'Flank	NM_015528	NP_056343	Q9H6Y7	RN167_HUMAN	ring finger protein 167 precursor	63	PA.				negative regulation of cell cycle|protein polyubiquitination	cytoplasm|endomembrane system|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
RNF167	26001	broad.mit.edu	37	17	4845904	4845904	+	Silent	SNP	C	T	T	rs149050030	byFrequency	TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4845904C>T	uc002fzq.2	+	6	740	c.324C>T	c.(322-324)GCC>GCT	p.A108A	SLC25A11_uc002fzo.1_5'Flank|SLC25A11_uc002fzp.1_5'Flank|RNF167_uc002fzr.2_Silent_p.A108A|RNF167_uc002fzs.2_Silent_p.A108A|RNF167_uc002fzt.2_Silent_p.A108A|RNF167_uc002fzu.2_Silent_p.A108A|RNF167_uc002fzv.2_Silent_p.A73A|RNF167_uc002fzw.1_Silent_p.A73A|RNF167_uc002fzx.2_Silent_p.A73A|RNF167_uc002fzy.2_5'Flank	NM_015528	NP_056343	Q9H6Y7	RN167_HUMAN	ring finger protein 167 precursor	108	PA.				negative regulation of cell cycle|protein polyubiquitination	cytoplasm|endomembrane system|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578532	7578532	+	Missense_Mutation	SNP	A	T	T	rs28934873		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578532A>T	uc002gim.2	-	5	592	c.398T>A	c.(397-399)ATG>AAG	p.M133K	TP53_uc002gig.1_Missense_Mutation_p.M133K|TP53_uc002gih.2_Missense_Mutation_p.M133K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M1K|TP53_uc010cng.1_Missense_Mutation_p.M1K|TP53_uc002gii.1_Missense_Mutation_p.M1K|TP53_uc010cnh.1_Missense_Mutation_p.M133K|TP53_uc010cni.1_Missense_Mutation_p.M133K|TP53_uc002gij.2_Missense_Mutation_p.M133K|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M40K|TP53_uc002gio.2_Missense_Mutation_p.M1K|TP53_uc010vug.1_Missense_Mutation_p.M94K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	133	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		KM -> NL (in a sporadic cancer; somatic mutation).|M -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.M133K(12)|p.0?(7)|p.M133R(5)|p.M133fs*37(3)|p.M133I(3)|p.M133L(2)|p.N131fs*27(2)|p.M133T(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.Y126fs*11(1)|p.M133V(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.M133fs*16(1)|p.M133fs*13(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KDM6B	23135	broad.mit.edu	37	17	7754539	7754539	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7754539C>T	uc002giw.1	+	14	4250	c.3874C>T	c.(3874-3876)CTG>TTG	p.L1292L	KDM6B_uc002gix.2_Silent_p.L594L	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1292					inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
MYH1	4619	broad.mit.edu	37	17	10398535	10398535	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10398535C>G	uc002gmo.2	-	36	5363	c.5269G>C	c.(5269-5271)GAG>CAG	p.E1757Q	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1757	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---
SUZ12	23512	broad.mit.edu	37	17	30303615	30303615	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30303615C>A	uc002hgs.2	+	8	1121	c.899C>A	c.(898-900)ACA>AAA	p.T300K	SUZ12_uc002hgt.2_Missense_Mutation_p.T277K	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	300					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)						T	JAZF1	endometrial stromal tumours								---	---	---	---
C17orf66	256957	broad.mit.edu	37	17	34185332	34185332	+	Intron	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34185332G>T	uc002hke.1	-						C17orf66_uc010wck.1_Intron|C17orf66_uc010wcl.1_Intron|C17orf66_uc010wcm.1_Intron	NM_152781	NP_689994			hypothetical protein LOC256957								binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)														---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	40001805	40001805	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40001805C>T	uc010cxr.2	+	3	1254	c.1112C>T	c.(1111-1113)CCG>CTG	p.P371L	KLHL10_uc010wfv.1_Missense_Mutation_p.P365L|KLHL10_uc010wfw.1_Missense_Mutation_p.P283L	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN	kelch-like 10	371	Kelch 2.					cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)																---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21662912	21662912	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21662912C>A	uc002kuw.2	+	6	1303	c.851C>A	c.(850-852)CCG>CAG	p.P284Q	TTC39C_uc002kuu.2_Missense_Mutation_p.P223Q	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1	284							binding			ovary(1)	1																		---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25565038	25565038	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25565038A>T	uc002kwg.2	-	13	2594	c.2135T>A	c.(2134-2136)GTG>GAG	p.V712E	CDH2_uc010xbn.1_Missense_Mutation_p.V681E	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	712	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
ZNF555	148254	broad.mit.edu	37	19	2852753	2852753	+	Silent	SNP	T	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2852753T>C	uc002lwo.2	+	4	779	c.690T>C	c.(688-690)TGT>TGC	p.C230C	ZNF555_uc002lwn.3_Silent_p.C229C	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	230	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ABHD8	79575	broad.mit.edu	37	19	17411792	17411792	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17411792C>T	uc002ngb.3	-	2	874	c.634G>A	c.(634-636)GGC>AGC	p.G212S		NM_024527	NP_078803	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	212							hydrolase activity				0																		---	---	---	---
UPF1	5976	broad.mit.edu	37	19	18966845	18966845	+	Silent	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18966845C>T	uc002nkg.2	+	12	1964	c.1689C>T	c.(1687-1689)ATC>ATT	p.I563I	UPF1_uc002nkf.2_Silent_p.I552I	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	563					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30935325	30935325	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935325C>T	uc002nsu.1	+	2	994	c.856C>T	c.(856-858)CGC>TGC	p.R286C	ZNF536_uc010edd.1_Missense_Mutation_p.R286C	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	286	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	31039632	31039632	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039632G>T	uc002nsu.1	+	4	3244	c.3106G>T	c.(3106-3108)GGG>TGG	p.G1036W	ZNF536_uc010edd.1_Missense_Mutation_p.G1036W	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1036					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	31039975	31039975	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039975C>A	uc002nsu.1	+	4	3587	c.3449C>A	c.(3448-3450)CCC>CAC	p.P1150H	ZNF536_uc010edd.1_Missense_Mutation_p.P1150H	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1150					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31768550	31768550	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31768550G>A	uc002nsy.3	-	2	2214	c.2149C>T	c.(2149-2151)CCT>TCT	p.P717S		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	717					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
MLL4	9757	broad.mit.edu	37	19	36212032	36212032	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36212032C>T	uc010eei.2	+	3	1783	c.1783C>T	c.(1783-1785)CCA>TCA	p.P595S		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	595	Pro-rich.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
ZNF585B	92285	broad.mit.edu	37	19	37677377	37677377	+	Silent	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37677377G>T	uc002ofq.2	-	5	1316	c.1062C>A	c.(1060-1062)TCC>TCA	p.S354S	uc002ofp.1_5'Flank|ZNF585B_uc002ofr.1_Silent_p.S168S	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B	354	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
PAPL	390928	broad.mit.edu	37	19	39590936	39590936	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39590936C>T	uc002oki.2	+	5	849	c.575C>T	c.(574-576)CCC>CTC	p.P192L	PAPL_uc010egl.2_Intron	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein	192						extracellular region	acid phosphatase activity|metal ion binding				0																		---	---	---	---
CCDC114	93233	broad.mit.edu	37	19	48806125	48806125	+	Intron	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48806125G>A	uc002pir.2	-						CCDC114_uc002piq.2_Intron|CCDC114_uc002pio.2_Intron|CCDC114_uc002pis.1_Intron|CCDC114_uc002pit.1_Intron	NM_144577	NP_653178			coiled-coil domain containing 114 isoform 2											ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)														---	---	---	---
ZNF616	90317	broad.mit.edu	37	19	52619231	52619231	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52619231G>A	uc002pym.2	-	4	1469	c.1186C>T	c.(1186-1188)CTT>TTT	p.L396F	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	396	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)														---	---	---	---
ZNF606	80095	broad.mit.edu	37	19	58491122	58491122	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58491122C>G	uc002qqw.2	-	7	1544	c.926G>C	c.(925-927)GGA>GCA	p.G309A	ZNF606_uc010yhp.1_Missense_Mutation_p.G219A	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	309	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)														---	---	---	---
HAO1	54363	broad.mit.edu	37	20	7915207	7915207	+	Silent	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7915207G>C	uc002wmw.1	-	2	237	c.213C>G	c.(211-213)GTC>GTG	p.V71V	HAO1_uc010gbu.2_Silent_p.V71V	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	71	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3																		---	---	---	---
CTCFL	140690	broad.mit.edu	37	20	56083663	56083663	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56083663C>A	uc010gix.1	-	8	2335	c.1673G>T	c.(1672-1674)TGG>TTG	p.W558L	CTCFL_uc010giw.1_Missense_Mutation_p.W558L|CTCFL_uc002xym.2_Missense_Mutation_p.W558L|CTCFL_uc010giz.1_Missense_Mutation_p.W146L|CTCFL_uc010giy.1_Missense_Mutation_p.W228L|CTCFL_uc010gja.1_Missense_Mutation_p.W508L|CTCFL_uc010gjb.1_Missense_Mutation_p.W558L|CTCFL_uc010gjc.1_Missense_Mutation_p.W558L|CTCFL_uc010gjd.1_Missense_Mutation_p.W558L|CTCFL_uc010gje.2_Missense_Mutation_p.W558L|CTCFL_uc010gjf.2_Missense_Mutation_p.W353L|CTCFL_uc010gjg.2_Missense_Mutation_p.W290L|CTCFL_uc010gjh.1_Missense_Mutation_p.W414L|CTCFL_uc010gji.1_Missense_Mutation_p.W353L|CTCFL_uc010gjj.1_Missense_Mutation_p.W558L|CTCFL_uc010giu.2_RNA|CTCFL_uc010giv.2_RNA	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein	558	C2H2-type 11; atypical.				cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)															---	---	---	---
PCK1	5105	broad.mit.edu	37	20	56138197	56138197	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56138197G>A	uc002xyn.3	+	5	887	c.724G>A	c.(724-726)GGG>AGG	p.G242R	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	242					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60485604	60485604	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60485604G>A	uc002ybn.1	+	9	1329	c.1315G>A	c.(1315-1317)GGG>AGG	p.G439R	CDH4_uc002ybp.1_Missense_Mutation_p.G365R	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	439	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10944732	10944732	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10944732T>G	uc002yip.1	-	11	870	c.502A>C	c.(502-504)ATT>CTT	p.I168L	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.I150L|TPTE_uc002yir.1_Missense_Mutation_p.I130L|TPTE_uc010gkv.1_Missense_Mutation_p.I30L	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	168	Helical; (Potential).				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
MRPL39	54148	broad.mit.edu	37	21	26965248	26965248	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26965248C>T	uc002ylo.2	-	8	811	c.797G>A	c.(796-798)GGC>GAC	p.G266D	MRPL39_uc002yln.2_Missense_Mutation_p.G266D	NM_017446	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39 isoform a	266						mitochondrial ribosome	nucleotide binding				0																		---	---	---	---
PFKL	5211	broad.mit.edu	37	21	45742889	45742889	+	Missense_Mutation	SNP	G	A	A	rs148438309		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45742889G>A	uc002zel.2	+	15	1513	c.1454G>A	c.(1453-1455)CGC>CAC	p.R485H	PFKL_uc002zek.2_Missense_Mutation_p.R532H|PFKL_uc002zem.2_Missense_Mutation_p.R72H|PFKL_uc002zen.2_Missense_Mutation_p.R72H	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	485					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)														---	---	---	---
UBE2G2	7327	broad.mit.edu	37	21	46193521	46193521	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46193521C>A	uc002zfy.2	-	5	401	c.326G>T	c.(325-327)CGG>CTG	p.R109L	UBE2G2_uc002zfx.2_Missense_Mutation_p.R81L	NM_003343	NP_003334	P60604	UB2G2_HUMAN	ubiquitin-conjugating enzyme E2G 2 isoform 1	109					protein K48-linked ubiquitination	cytosol	ATP binding|protein binding|ubiquitin-protein ligase activity			breast(3)|central_nervous_system(1)	4				Colorectal(79;0.0638)														---	---	---	---
ASMT	438	broad.mit.edu	37	X	1748781	1748781	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1748781G>A	uc004cqd.2	+	6	656	c.511G>A	c.(511-513)GTG>ATG	p.V171M	ASMT_uc010ncy.2_Missense_Mutation_p.V171M|ASMT_uc004cqe.2_Missense_Mutation_p.V171M	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase	171					melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
GPR173	54328	broad.mit.edu	37	X	53106179	53106179	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53106179G>A	uc004dru.2	+	2	634	c.376G>A	c.(376-378)GCC>ACC	p.A126T		NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	126	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---
FAM120C	54954	broad.mit.edu	37	X	54143040	54143040	+	Silent	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54143040C>A	uc004dsz.3	-	10	2333	c.2250G>T	c.(2248-2250)ACG>ACT	p.T750T	FAM120C_uc011moh.1_Silent_p.T750T	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954	750										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69510574	69510574	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69510574G>C	uc004dyg.2	+	3	281	c.154G>C	c.(154-156)GAT>CAT	p.D52H	KIF4A_uc010nkw.2_Missense_Mutation_p.D52H|PDZD11_uc004dyd.1_5'Flank|PDZD11_uc004dye.1_5'Flank|KIF4A_uc004dyf.1_Missense_Mutation_p.D52H	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	52	Kinesin-motor.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100364480	100364480	+	Missense_Mutation	SNP	G	A	A	rs150287797		TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100364480G>A	uc004egx.2	+	4	653	c.383G>A	c.(382-384)CGG>CAG	p.R128Q	CENPI_uc011mrg.1_Missense_Mutation_p.R128Q|CENPI_uc004egy.2_Missense_Mutation_p.R128Q	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	128					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
GLRA4	441509	broad.mit.edu	37	X	102968453	102968453	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102968453G>A	uc011mse.1	-	8	1499	c.1078C>T	c.(1078-1080)CGC>TGC	p.R360C	TMEM31_uc004elh.2_Intron	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	360	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0																		---	---	---	---
TMEM31	203562	broad.mit.edu	37	X	102968651	102968651	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102968651A>G	uc004elh.2	+	3	423	c.232A>G	c.(232-234)ACT>GCT	p.T78A	GLRA4_uc011mse.1_Intron	NM_182541	NP_872347	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	78						integral to membrane					0																		---	---	---	---
NRK	203447	broad.mit.edu	37	X	105150480	105150480	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105150480A>T	uc004emd.2	+	11	1222	c.919A>T	c.(919-921)ATG>TTG	p.M307L	NRK_uc010npc.1_5'UTR	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	307	Protein kinase.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14															HNSCC(51;0.14)			---	---	---	---
MIR1298	100302153	broad.mit.edu	37	X	113949753	113949753	+	RNA	SNP	C	A	A			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113949753C>A	hsa-mir-1298|MI0003938	+			c.104C>A			HTR2C_uc004epu.1_Intron|HTR2C_uc010nqc.1_Intron|HTR2C_uc004epv.1_Intron																	0																		---	---	---	---
SLC25A5	292	broad.mit.edu	37	X	118604017	118604017	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4195-01	TCGA-BR-4195-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118604017G>T	uc004erh.3	+	2	621	c.505G>T	c.(505-507)GGG>TGG	p.G169W	LOC100303728_uc004ere.1_5'Flank|LOC100303728_uc004erg.1_5'Flank	NM_001152	NP_001143	P05141	ADT2_HUMAN	adenine nucleotide translocator 2	169	Solcar 2.				chromosome segregation|energy reserve metabolic process|interspecies interaction between organisms|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane|mitochondrial nucleoid|MMXD complex	adenine transmembrane transporter activity|protein binding			ovary(1)	1					Clodronate(DB00720)													---	---	---	---
