Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	244159	244159	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244159delG								OR4F5 (174151 upstream) : LOC100132287 (77878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2765300	2765301	+	IGR	INS	-	A	A	rs140035156	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2765300_2765301insA								MMEL1 (200819 upstream) : ACTRT2 (172745 downstream)																																			---	---	---	---
MEGF6	1953	broad.mit.edu	37	1	3418614	3418615	+	Intron	DEL	CG	-	-	rs58330456		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3418614_3418615delCG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400			EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	5728863	5728864	+	5'Flank	INS	-	A	A	rs36026711		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5728863_5728864insA	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																														---	---	---	---
NPHP4	261734	broad.mit.edu	37	1	6049148	6049148	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6049148delG	uc001alq.1	-						NPHP4_uc001als.1_Intron|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917			nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7189980	7189985	+	Intron	DEL	TGTGTG	-	-	rs71582087		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7189980_7189985delTGTGTG	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7410783	7410784	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7410783_7410784delGT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	14257942	14257943	+	IGR	INS	-	GT	GT	rs139587494	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14257942_14257943insGT								PRDM2 (106370 upstream) : KAZ (667270 downstream)																																			---	---	---	---
TMEM51	55092	broad.mit.edu	37	1	15491286	15491287	+	Intron	INS	-	T	T	rs142461643		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15491286_15491287insT	uc001avw.3	+						TMEM51_uc010obk.1_Intron|TMEM51_uc001avz.2_Intron|TMEM51_uc001avy.2_Intron|TMEM51_uc001avx.2_Intron	NM_001136216	NP_001129688			transmembrane protein 51							integral to membrane					0		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)														---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15641271	15641272	+	Intron	DEL	GG	-	-	rs138900179		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15641271_15641272delGG	uc001awb.2	+						FHAD1_uc001awa.1_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16917461	16917462	+	Intron	DEL	CT	-	-	rs35460036		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16917461_16917462delCT	uc009vos.1	-						NBPF1_uc010oce.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16955663	16955664	+	5'Flank	INS	-	A	A	rs150193674		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16955663_16955664insA	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16967676	16967676	+	Intron	DEL	T	-	-	rs74438643		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16967676delT	uc001azg.1	-						CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17233181	17233182	+	Intron	INS	-	G	G	rs148950928		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17233181_17233182insG	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17241580	17241580	+	Intron	DEL	A	-	-	rs68125552		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17241580delA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17271566	17271566	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17271566delA	uc001azt.2	+						CROCC_uc009voz.1_Intron|CROCC_uc001azu.2_5'UTR	NM_014675	NP_055490			ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	18903282	18903293	+	IGR	DEL	CTTCAGCCCTCC	-	-	rs142880868		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18903282_18903293delCTTCAGCCCTCC								KLHDC7A (90743 upstream) : PAX7 (54207 downstream)																																			---	---	---	---
NBL1	4681	broad.mit.edu	37	1	19974357	19974360	+	Intron	DEL	GTGC	-	-	rs143469817		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19974357_19974360delGTGC	uc001bck.1	+						NBL1_uc009vpl.1_Intron|NBL1_uc001bcj.1_Intron|NBL1_uc009vpm.1_Intron	NM_005380	NP_005371			neuroblastoma, suppression of tumorigenicity 1 2							extracellular region				ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20506229	20506230	+	IGR	DEL	GT	-	-	rs34844244		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20506229_20506230delGT								PLA2G2C (4542 upstream) : UBXN10 (6348 downstream)																																			---	---	---	---
KIF17	57576	broad.mit.edu	37	1	21042734	21042735	+	Intron	INS	-	AA	AA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21042734_21042735insAA	uc001bdr.3	-						KIF17_uc001bds.3_Intron	NM_020816	NP_065867			kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)														---	---	---	---
USP48	84196	broad.mit.edu	37	1	22084678	22084679	+	Intron	INS	-	AC	AC	rs149088635	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22084678_22084679insAC	uc001bfb.2	-						USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfe.1_Intron|USP48_uc001bff.2_Intron	NM_032236	NP_115612			ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	22424834	22424834	+	IGR	DEL	A	-	-	rs34637390		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22424834delA								CDC42 (5399 upstream) : WNT4 (18966 downstream)																																			---	---	---	---
TCEA3	6920	broad.mit.edu	37	1	23719103	23719104	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23719103_23719104delAC	uc001bgx.1	-						TCEA3_uc009vqm.1_Intron	NM_003196	NP_003187			transcription elongation factor A (SII), 3						regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation, DNA-dependent	nucleus	DNA binding|translation elongation factor activity|zinc ion binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)														---	---	---	---
E2F2	1870	broad.mit.edu	37	1	23853344	23853345	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23853344_23853345delCA	uc001bhe.1	-						uc001bhf.1_5'Flank	NM_004091	NP_004082			E2F transcription factor 2						G1 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(2)|skin(2)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.52e-24)|Colorectal(126;6.25e-08)|COAD - Colon adenocarcinoma(152;3.42e-06)|GBM - Glioblastoma multiforme(114;8.98e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|KIRC - Kidney renal clear cell carcinoma(1967;0.00366)|STAD - Stomach adenocarcinoma(196;0.0132)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.0888)|LUSC - Lung squamous cell carcinoma(448;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	25435296	25435300	+	IGR	DEL	AGGGA	-	-	rs112876793		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25435296_25435300delAGGGA								RUNX3 (143684 upstream) : SYF2 (113467 downstream)																																			---	---	---	---
CD164L2	388611	broad.mit.edu	37	1	27710404	27710405	+	5'Flank	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27710404_27710405insG	uc001boc.2	-							NM_207397	NP_997280			CD164 sialomucin-like 2							integral to membrane					0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	29196745	29196745	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29196745delT								OPRD1 (6537 upstream) : EPB41 (16883 downstream)																																			---	---	---	---
ZCCHC17	51538	broad.mit.edu	37	1	31775149	31775150	+	Intron	INS	-	CTA	CTA	rs141212607	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31775149_31775150insCTA	uc001bsp.1	+						ZCCHC17_uc001bsq.1_Intron|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Intron|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589			zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)														---	---	---	---
ZCCHC17	51538	broad.mit.edu	37	1	31807150	31807151	+	Intron	INS	-	TC	TC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31807150_31807151insTC	uc001bsp.1	+						ZCCHC17_uc001bsq.1_Intron|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Intron|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589			zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	33461679	33461680	+	Intron	INS	-	T	T	rs150930543	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33461679_33461680insT	uc001bwn.2	+											Homo sapiens cDNA clone IMAGE:4825059, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	33716453	33716454	+	IGR	INS	-	GAA	GAA	rs146604881	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33716453_33716454insGAA								TRIM62 (68782 upstream) : ZNF362 (5720 downstream)																																			---	---	---	---
OSCP1	127700	broad.mit.edu	37	1	36884363	36884364	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36884363_36884364insA	uc001cap.2	-						OSCP1_uc001caq.2_Intron	NM_145047	NP_659484			oxidored-nitro domain-containing protein isoform						transport	basal plasma membrane				ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
TRIT1	54802	broad.mit.edu	37	1	40338485	40338488	+	Intron	DEL	AGGG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40338485_40338488delAGGG	uc010oiz.1	-						TRIT1_uc001ceq.2_Intron|TRIT1_uc001cek.2_Intron|TRIT1_uc009vvx.2_Intron|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Intron|TRIT1_uc001cen.2_Intron|TRIT1_uc001ceo.2_Intron|TRIT1_uc001cep.2_Intron	NM_017646	NP_060116			tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40811062	40811062	+	IGR	DEL	A	-	-	rs74345912		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40811062delA								COL9A2 (28002 upstream) : SMAP2 (28666 downstream)																																			---	---	---	---
KCNQ4	9132	broad.mit.edu	37	1	41279113	41279113	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41279113delG	uc001cgh.1	+						KCNQ4_uc001cgi.1_Intron	NM_004700	NP_004691			potassium voltage-gated channel KQT-like protein						sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	41417235	41417235	+	IGR	DEL	A	-	-	rs67523911		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41417235delA								CITED4 (89217 upstream) : CTPS (27772 downstream)																																			---	---	---	---
GUCA2A	2980	broad.mit.edu	37	1	42632473	42632474	+	5'Flank	INS	-	GT	GT	rs140638678	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42632473_42632474insGT	uc001chd.1	-							NM_033553	NP_291031			guanylate cyclase activator 2A precursor						signal transduction	extracellular region	guanylate cyclase activator activity|hormone activity			pancreas(1)	1	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
KLF17	128209	broad.mit.edu	37	1	44513675	44513678	+	5'Flank	DEL	TGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44513675_44513678delTGTG	uc009vxf.1	+							NM_173484	NP_775755			zinc finger protein 393						regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)															OREG0013436	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PIK3R3	8503	broad.mit.edu	37	1	46625411	46625412	+	Intron	DEL	AC	-	-	rs147533362		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46625411_46625412delAC	uc010olw.1	-							NM_003629	NP_003620			phosphoinositide-3-kinase, regulatory subunit 3						insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	50200969	50200970	+	Intron	DEL	GT	-	-	rs144160941		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50200969_50200970delGT	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52784043	52784052	+	Intron	DEL	TGTGTGTGTG	-	-	rs61782537		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52784043_52784052delTGTGTGTGTG	uc001cto.2	+						ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	53034261	53034262	+	IGR	INS	-	T	T	rs111437410		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53034261_53034262insT								ZCCHC11 (15131 upstream) : GPX7 (33781 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	53060627	53060628	+	IGR	INS	-	G	G	rs145059523	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53060627_53060628insG								ZCCHC11 (41497 upstream) : GPX7 (7415 downstream)																																			---	---	---	---
LRP8	7804	broad.mit.edu	37	1	53783913	53783913	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53783913delT	uc001cvi.1	-						LRP8_uc001cvh.1_Intron|LRP8_uc001cvk.1_Intron|LRP8_uc001cvj.1_Intron|LRP8_uc001cvl.1_Intron	NM_004631	NP_004622			low density lipoprotein receptor-related protein						cytokine-mediated signaling pathway|endocytosis|lipid metabolic process|platelet activation|proteolysis	caveola	calcium ion binding|very-low-density lipoprotein particle receptor activity				0																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58122024	58122025	+	Intron	INS	-	TG	TG	rs148466319	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58122024_58122025insTG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62399613	62399613	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62399613delT	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62551901	62551904	+	Intron	DEL	TGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62551901_62551904delTGTG	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	62692916	62692918	+	IGR	DEL	TTG	-	-	rs112197980		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62692916_62692918delTTG								L1TD1 (14918 upstream) : KANK4 (8920 downstream)																																			---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	62922123	62922123	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62922123delA	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron	NM_033407	NP_212132			dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	69174747	69174750	+	IGR	DEL	CTCT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69174747_69174750delCTCT								DEPDC1 (211948 upstream) : LRRC7 (858118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	71105216	71105217	+	IGR	INS	-	AA	AA	rs138315131		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71105216_71105217insAA								CTH (199964 upstream) : PTGER3 (212819 downstream)																																			---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72022336	72022337	+	Intron	DEL	AT	-	-	rs1400841		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72022336_72022337delAT	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
ST6GALNAC5	81849	broad.mit.edu	37	1	77373405	77373405	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77373405delT	uc001dhi.2	+						ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_Intron	NM_030965	NP_112227			sialyltransferase 7E						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	84132065	84132065	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84132065delG	uc001diz.3	-											Homo sapiens cDNA clone IMAGE:4815396.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	87297001	87297001	+	IGR	DEL	T	-	-	rs7539403	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87297001delT								SH3GLB1 (83135 upstream) : SEP15 (31129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	90731935	90731936	+	IGR	INS	-	GT	GT	rs147460854	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90731935_90731936insGT								ZNF326 (237841 upstream) : BARHL2 (445644 downstream)																																			---	---	---	---
EPHX4	253152	broad.mit.edu	37	1	92521545	92521546	+	Intron	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92521545_92521546delAG	uc001don.2	+							NM_173567	NP_775838			abhydrolase domain containing 7							integral to membrane	hydrolase activity			central_nervous_system(1)	1																		---	---	---	---
BCAR3	8412	broad.mit.edu	37	1	94219429	94219430	+	Intron	DEL	AC	-	-	rs10584274	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94219429_94219430delAC	uc001dqb.2	-						uc001dqd.1_RNA	NM_003567	NP_003558			breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)														---	---	---	---
BCAR3	8412	broad.mit.edu	37	1	94232737	94232744	+	Intron	DEL	GAACAAGG	-	-	rs141964799		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94232737_94232744delGAACAAGG	uc001dqb.2	-						uc001dqd.1_Intron	NM_003567	NP_003558			breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	94443840	94443841	+	IGR	INS	-	GAGA	GAGA	rs146234308	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94443840_94443841insGAGA								GCLM (68828 upstream) : ABCA4 (14555 downstream)																																			---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94588081	94588082	+	5'Flank	INS	-	TGA	TGA	rs144949414	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94588081_94588082insTGA	uc001dqh.2	-						ABCA4_uc010otn.1_5'Flank	NM_000350	NP_000341			ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95802623	95802624	+	IGR	INS	-	T	T	rs67198504		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95802623_95802624insT								RWDD3 (89850 upstream) : None (None downstream)																																			---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98117132	98117138	+	Intron	DEL	CTTTCAT	-	-	rs113664016		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98117132_98117138delCTTTCAT	uc001drv.2	-							NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	98587967	98587967	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98587967delA								MIR137 (76240 upstream) : SNX7 (539269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	101086578	101086579	+	IGR	DEL	TA	-	-	rs147487409		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101086578_101086579delTA								GPR88 (78996 upstream) : VCAM1 (98718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102095867	102095867	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102095867delA								S1PR1 (388791 upstream) : OLFM3 (172260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104048324	104048325	+	IGR	INS	-	T	T	rs147163736	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104048324_104048325insT								COL11A1 (474272 upstream) : RNPC3 (20253 downstream)																																			---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108306945	108306946	+	Intron	INS	-	T	T	rs150696033	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108306945_108306946insT	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104			vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
SLC16A4	9122	broad.mit.edu	37	1	110908758	110908759	+	Intron	DEL	TT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110908758_110908759delTT	uc001dzo.1	-						SLC16A4_uc009wfs.1_Intron|SLC16A4_uc001dzp.1_Intron|SLC16A4_uc010ovy.1_Intron|SLC16A4_uc001dzq.1_Intron|SLC16A4_uc010ovz.1_Intron	NM_004696	NP_004687			solute carrier family 16, member 4							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			ovary(3)	3		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)													---	---	---	---
RAP1A	5906	broad.mit.edu	37	1	112252111	112252112	+	Intron	INS	-	G	G	rs144285094	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112252111_112252112insG	uc001ebi.2	+						RAP1A_uc001ebk.2_Intron|RAP1A_uc001ebl.2_Intron|RAP1A_uc001ebm.2_Intron	NM_002884	NP_002875			RAP1A, member of RAS oncogene family precursor						activation of MAPKK activity|blood coagulation|energy reserve metabolic process|nerve growth factor receptor signaling pathway|regulation of insulin secretion	cytosol|plasma membrane	GTP binding|GTPase activity				0		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	116725085	116725086	+	IGR	INS	-	C	C	rs138197254	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116725085_116725086insC								C1orf161 (47224 upstream) : ATP1A1 (189918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	117392537	117392537	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117392537delA								CD2 (80687 upstream) : PTGFRN (60152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119843112	119843113	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119843112_119843113insA								WARS2 (159817 upstream) : HAO2 (68289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	121110266	121110266	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121110266delA	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142544716	142544717	+	IGR	INS	-	TAAG	TAAG	rs9629108	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142544716_142544717insTAAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142564649	142564649	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142564649delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142572757	142572758	+	IGR	INS	-	C	C	rs140633082	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142572757_142572758insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142686987	142686989	+	Intron	DEL	CTT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142686987_142686989delCTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143176598	143176598	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143176598delG	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143283271	143283271	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143283271delG								None (None upstream) : LOC100286793 (364368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143422088	143422088	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143422088delC								None (None upstream) : LOC100286793 (225551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	144066327	144066327	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144066327delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144597983	144597991	+	Intron	DEL	CAGATAGAC	-	-	rs111294330		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144597983_144597991delCAGATAGAC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc009wif.1_Intron|uc001ele.2_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024589	145024590	+	Intron	DEL	AT	-	-	rs72375630		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024589_145024590delAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145051480	145051481	+	Intron	INS	-	A	A	rs3099168	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145051480_145051481insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145080627	145080628	+	Intron	INS	-	A	A	rs143218507		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145080627_145080628insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145085808	145085809	+	Intron	INS	-	T	T	rs146743627		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145085808_145085809insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145189953	145189953	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145189953delC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145267379	145267379	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145267379delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145299617	145299619	+	Intron	DEL	CAT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145299617_145299619delCAT	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792			hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145705569	145705569	+	Intron	DEL	A	-	-	rs67233205		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145705569delA	uc001emp.3	+						CD160_uc001eol.1_Intron|CD160_uc001eom.1_Intron|CD160_uc010oyz.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	147816516	147816517	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147816516_147816517insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|uc001eqk.1_RNA	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	149022599	149022600	+	IGR	DEL	AA	-	-	rs145093724		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149022599_149022600delAA								LOC645166 (69545 upstream) : LOC388692 (256876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149029055	149029055	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149029055delG								LOC645166 (76001 upstream) : LOC388692 (250421 downstream)																																			---	---	---	---
LOC388692	388692	broad.mit.edu	37	1	149287048	149287049	+	RNA	INS	-	A	A	rs143412331	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149287048_149287049insA	uc010pbf.1	+	1		c.7573_7574insA			LOC388692_uc001esg.3_5'Flank	NR_027002				Homo sapiens cDNA FLJ13580 fis, clone PLACE1008851.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	152619521	152619522	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152619521_152619522delAC								LCE3A (23942 upstream) : LCE2D (16350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	154265891	154265892	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154265891_154265892delAC								HAX1 (17542 upstream) : AQP10 (27700 downstream)																																			---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155352522	155352522	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155352522delT	uc009wqq.2	-						RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Intron	NM_018489	NP_060959			absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155516122	155516122	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155516122delA	uc009wqq.2	-						ASH1L_uc001fkt.2_Intron|ASH1L_uc009wqr.1_Intron	NM_018489	NP_060959			absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	161622141	161622142	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161622141_161622142insT								FCGR3B (20983 upstream) : FCGR2B (10798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	161716320	161716321	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716320_161716321insTTCCTTCCTTCC								FCRLB (18388 upstream) : DUSP12 (3260 downstream)																																			---	---	---	---
ATF6	22926	broad.mit.edu	37	1	161885414	161885415	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161885414_161885415insT	uc001gbr.2	+							NM_007348	NP_031374			activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	164203983	164203984	+	IGR	INS	-	AG	AG	rs35026099		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164203983_164203984insAG								NUF2 (878430 upstream) : PBX1 (324818 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164839428	164839429	+	Intron	INS	-	CTTT	CTTT	rs77254277	byFrequency;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164839428_164839429insCTTT	uc010pkw.1	+							NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	166519446	166519446	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166519446delT								FAM78B (383240 upstream) : FMO9P (53707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166804814	166804815	+	IGR	INS	-	CTT	CTT	rs143374707	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166804814_166804815insCTT								FMO9P (210343 upstream) : POGK (3909 downstream)																																			---	---	---	---
CD247	919	broad.mit.edu	37	1	167400621	167400622	+	3'UTR	DEL	GC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167400621_167400622delGC	uc001gei.3	-	8					CD247_uc001gej.3_3'UTR	NM_198053	NP_932170			T-cell receptor zeta chain isoform 1 precursor						interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	167583435	167583436	+	IGR	INS	-	T	T	rs140805531	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167583435_167583436insT								CREG1 (60379 upstream) : RCSD1 (16038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168137881	168137882	+	IGR	INS	-	TC	TC	rs71888387		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168137881_168137882insTC								GPR161 (31060 upstream) : TIPRL (10289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168785645	168785646	+	IGR	INS	-	A	A	rs151320489		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168785645_168785646insA								MGC4473 (23525 upstream) : ATP1B1 (290301 downstream)																																			---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172257187	172257187	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172257187delA	uc001gie.2	+						DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	172785891	172785892	+	IGR	INS	-	TTTG	TTTG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172785891_172785892insTTTG								FASLG (149881 upstream) : TNFSF18 (224468 downstream)																																			---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174164792	174164792	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174164792delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174909097	174909097	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174909097delA	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkf.2_Intron|RABGAP1L_uc001gkg.2_Intron|RABGAP1L_uc001gkh.3_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	175742192	175742197	+	IGR	DEL	GGAGAA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175742192_175742197delGGAGAA								TNR (29440 upstream) : RFWD2 (171770 downstream)																																			---	---	---	---
LHX4	89884	broad.mit.edu	37	1	180211398	180211399	+	Intron	INS	-	TG	TG	rs145401539	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180211398_180211399insTG	uc001goe.1	+							NM_033343	NP_203129			LIM homeobox protein 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181227194	181227195	+	IGR	INS	-	G	G	rs146889252	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181227194_181227195insG								IER5 (167217 upstream) : CACNA1E (225521 downstream)																																			---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183098698	183098698	+	Intron	DEL	T	-	-	rs35704532		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183098698delT	uc001gpy.3	+							NM_002293	NP_002284			laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	184962896	184962897	+	IGR	INS	-	T	T	rs79190637		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184962896_184962897insT								FAM129A (19214 upstream) : RNF2 (51654 downstream)																																			---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185756274	185756279	+	Intron	DEL	TGTGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185756274_185756279delTGTGTG	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	188871836	188871836	+	IGR	DEL	A	-	-	rs35340114		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188871836delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189895414	189895415	+	IGR	INS	-	A	A	rs77871894		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189895414_189895415insA								None (None upstream) : FAM5C (171382 downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190257015	190257019	+	Intron	DEL	ATTTT	-	-	rs145307642		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190257015_190257019delATTTT	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
PLEKHA6	22874	broad.mit.edu	37	1	204318668	204318669	+	Intron	INS	-	A	A	rs11446926		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204318668_204318669insA	uc001hau.2	-							NM_014935	NP_055750			phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)															---	---	---	---
NUCKS1	64710	broad.mit.edu	37	1	205696614	205696616	+	Intron	DEL	TTG	-	-	rs1775154	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205696614_205696616delTTG	uc001hdb.2	-							NM_022731	NP_073568			nuclear casein kinase and cyclin-dependent							nucleus					0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	206805115	206805115	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206805115delT								LGTN (19211 upstream) : DYRK3 (3766 downstream)																																			---	---	---	---
DYRK3	8444	broad.mit.edu	37	1	206830275	206830275	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206830275delT	uc001hek.2	+											Homo sapiens regulatory erythroid kinase long form (RED) mRNA, alternatively spliced product, complete cds.						erythrocyte differentiation	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|central_nervous_system(1)	3	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
FAIM3	9214	broad.mit.edu	37	1	207097499	207097503	+	5'Flank	DEL	GTGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207097499_207097503delGTGTG	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440			Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)																	---	---	---	---
LPGAT1	9926	broad.mit.edu	37	1	211933880	211933884	+	Intron	DEL	ATAAG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211933880_211933884delATAAG	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688			lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212351829	212351836	+	IGR	DEL	GCTTGCTG	-	-	rs67283884		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212351829_212351836delGCTTGCTG								DTL (73643 upstream) : PPP2R5A (107043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213601652	213601652	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213601652delT								RPS6KC1 (154845 upstream) : PROX1 (559634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	214008053	214008054	+	Intron	DEL	AC	-	-	rs35448391		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214008053_214008054delAC	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																														---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216152061	216152062	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216152061_216152062insT	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	217105875	217105876	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217105875_217105876delGT	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	219152252	219152253	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219152252_219152253insT								TGFB2 (534293 upstream) : LYPLAL1 (194939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219161909	219161909	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219161909delT								TGFB2 (543950 upstream) : LYPLAL1 (185283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226531787	226531788	+	IGR	INS	-	TCC	TCC	rs146034428	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226531787_226531788insTCC								LIN9 (34217 upstream) : PARP1 (16605 downstream)																																			---	---	---	---
ITPKB	3707	broad.mit.edu	37	1	226912757	226912759	+	Intron	DEL	ACA	-	-	rs145631642		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226912757_226912759delACA	uc010pvo.1	-						ITPKB_uc001hqh.2_Intron	NM_002221	NP_002212			1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	227621536	227621537	+	IGR	INS	-	GAGAGAG	GAGAGAG	rs142913097	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227621536_227621537insGAGAGAG								CDC42BPA (115710 upstream) : ZNF678 (129707 downstream)																																			---	---	---	---
TRIM11	81559	broad.mit.edu	37	1	228585688	228585688	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228585688delG	uc001hss.2	-						TRIM11_uc010pvx.1_Intron|TRIM11_uc001hst.1_Intron	NM_145214	NP_660215			tripartite motif-containing 11						response to virus	cytoplasm|nucleus	protein binding|zinc ion binding			lung(3)|ovary(1)	4		Prostate(94;0.0724)																---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230258362	230258363	+	Intron	DEL	TG	-	-	rs5781568		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230258362_230258363delTG	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
CAPN9	10753	broad.mit.edu	37	1	230920352	230920353	+	Intron	DEL	GT	-	-	rs72513662		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230920352_230920353delGT	uc001htz.1	+						CAPN9_uc009xfg.1_Intron|CAPN9_uc001hua.1_Intron	NM_006615	NP_006606			calpain 9 isoform 1						digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	230966234	230966234	+	IGR	DEL	T	-	-	rs66904933		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230966234delT								CAPN9 (28485 upstream) : C1orf198 (6632 downstream)																																			---	---	---	---
DISC1	27185	broad.mit.edu	37	1	232001840	232001841	+	Intron	DEL	GT	-	-	rs73094825	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232001840_232001841delGT	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234208661	234208661	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234208661delA	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234232020	234232021	+	Intron	INS	-	CTCT	CTCT	rs143247236	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234232020_234232021insCTCT	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234432200	234432201	+	Intron	INS	-	G	G	rs143538933	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234432200_234432201insG	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234684338	234684339	+	IGR	INS	-	TAAG	TAAG	rs149206922	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234684338_234684339insTAAG								TARBP1 (69489 upstream) : IRF2BP2 (55678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234918511	234918512	+	IGR	INS	-	GT	GT	rs146753231		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234918511_234918512insGT								IRF2BP2 (173240 upstream) : TOMM20 (354148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236094590	236094590	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236094590delT								LYST (47650 upstream) : NID1 (44551 downstream)																																			---	---	---	---
CHRM3	1131	broad.mit.edu	37	1	239994295	239994295	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239994295delT	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731			cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)													---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242463754	242463769	+	Intron	DEL	AAGAAAGAAAGAAAGA	-	-	rs112718417		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242463754_242463769delAAGAAAGAAAGAAAGA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
C1orf100	200159	broad.mit.edu	37	1	244542155	244542157	+	Intron	DEL	GGA	-	-	rs67899905		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244542155_244542157delGGA	uc001iah.2	+						C1orf100_uc001iai.2_Intron	NM_001012970	NP_001012988			hypothetical protein LOC200159												0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245343594	245343595	+	Intron	INS	-	AG	AG	rs139668358	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245343594_245343595insAG	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
OR2T11	127077	broad.mit.edu	37	1	248793411	248793413	+	5'Flank	DEL	ATT	-	-	rs144768531		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248793411_248793413delATT	uc001ier.1	-							NM_001001964	NP_001001964			olfactory receptor, family 2, subfamily T,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	1601571	1601572	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1601571_1601572delAC								TPO (55073 upstream) : PXDN (34088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3105004	3105004	+	Intron	DEL	A	-	-	rs146368980		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3105004delA	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3115425	3115426	+	Intron	INS	-	C	C	rs113009079		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3115425_3115426insC	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
RNASEH1	246243	broad.mit.edu	37	2	3608120	3608131	+	5'Flank	DEL	TTCCTTCCTTCT	-	-	rs70938948	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3608120_3608131delTTCCTTCCTTCT	uc002qxs.2	-						RNASEH1_uc002qxt.2_5'Flank|uc002qxu.2_Intron|uc002qxv.2_Intron					SubName: Full=cDNA FLJ39594 fis, clone SKNSH2001875, highly similar to Ribonuclease H1 (EC 3.1.26.4);						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4390195	4390196	+	IGR	DEL	TG	-	-	rs5828916		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4390195_4390196delTG								ALLC (639937 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6324684	6324687	+	IGR	DEL	AGGA	-	-	rs76871621		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6324684_6324687delAGGA								LOC400940 (196320 upstream) : CMPK2 (655816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8730658	8730658	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8730658delG								LOC339788 (613681 upstream) : ID2 (88682 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8749401	8749405	+	IGR	DEL	CTACT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8749401_8749405delCTACT								LOC339788 (632424 upstream) : ID2 (69935 downstream)																																			---	---	---	---
HPCAL1	3241	broad.mit.edu	37	2	10497962	10497963	+	Intron	INS	-	A	A	rs112651247		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10497962_10497963insA	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron	NM_002149	NP_002140			hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	10981604	10981605	+	IGR	DEL	AG	-	-	rs67248825		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10981604_10981605delAG								PDIA6 (3501 upstream) : KCNF1 (70458 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13910217	13910217	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13910217delT								None (None upstream) : FAM84A (862639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16021698	16021698	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16021698delG								DDX1 (250474 upstream) : MYCNOS (58322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	17475512	17475512	+	IGR	DEL	A	-	-	rs112402810		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17475512delA								FAM49A (628416 upstream) : RAD51AP2 (216474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20311012	20311012	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20311012delA								LAPTM4A (59223 upstream) : SDC1 (89546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21087324	21087326	+	IGR	DEL	CTC	-	-	rs77243577		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21087324_21087326delCTC								C2orf43 (64497 upstream) : APOB (136976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21482693	21482693	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21482693delT								APOB (215748 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22503424	22503425	+	IGR	INS	-	A	A	rs11282395		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22503424_22503425insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23182068	23182070	+	IGR	DEL	CTT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23182068_23182070delCTT								None (None upstream) : KLHL29 (573385 downstream)																																			---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24984631	24984634	+	Intron	DEL	CTTG	-	-	rs56244032		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24984631_24984634delCTTG	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron|NCOA1_uc010eyf.2_Intron	NM_003743	NP_003734			nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	2	25448513	25448514	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25448513_25448514insA								POMC (56954 upstream) : DNMT3A (7332 downstream)																																			---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25827268	25827269	+	Intron	INS	-	TC	TC	rs143604875	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25827268_25827269insTC	uc002rgh.2	-						DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ASXL2	55252	broad.mit.edu	37	2	26102497	26102497	+	5'Flank	DEL	A	-	-	rs72055641		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26102497delA	uc002rgs.2	-							NM_018263	NP_060733			additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
RAB10	10890	broad.mit.edu	37	2	26323844	26323844	+	Intron	DEL	A	-	-	rs68033386		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26323844delA	uc002rgv.2	+							NM_016131	NP_057215			ras-related GTP-binding protein RAB10						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28310524	28310524	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28310524delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	30272325	30272326	+	IGR	INS	-	C	C	rs150043912	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30272325_30272326insC								ALK (127893 upstream) : YPEL5 (97424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34770264	34770264	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34770264delG								MYADML (816980 upstream) : None (None downstream)																																			---	---	---	---
QPCT	25797	broad.mit.edu	37	2	37580809	37580810	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37580809_37580810insA	uc002rqg.2	+						QPCT_uc002rqh.2_Intron	NM_012413	NP_036545			glutaminyl-peptide cyclotransferase precursor						peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase|proteolysis	extracellular region	acyltransferase activity|glutaminyl-peptide cyclotransferase activity|peptidase activity|zinc ion binding			central_nervous_system(1)	1		Ovarian(717;0.051)|all_hematologic(82;0.21)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	37994529	37994530	+	IGR	DEL	CT	-	-	rs142632267		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37994529_37994530delCT								CDC42EP3 (95203 upstream) : FAM82A1 (157932 downstream)																																			---	---	---	---
GALM	130589	broad.mit.edu	37	2	38952689	38952690	+	Intron	INS	-	AT	AT	rs142684432	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38952689_38952690insAT	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
GALM	130589	broad.mit.edu	37	2	38960363	38960364	+	Intron	DEL	AA	-	-	rs10555489		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38960363_38960364delAA	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
ARHGEF33	100271715	broad.mit.edu	37	2	39162786	39162786	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39162786delT	uc010ynq.1	+							NM_001145451	NP_001138923			DH and coiled-coil domain-containing protein												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	39397589	39397591	+	IGR	DEL	TTG	-	-	rs115092256	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39397589_39397591delTTG								SOS1 (46103 upstream) : CDKL4 (8099 downstream)																																			---	---	---	---
MTA3	57504	broad.mit.edu	37	2	42924523	42924524	+	Intron	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42924523_42924524delAG	uc002rso.1	+						MTA3_uc002rsp.1_Intron|MTA3_uc002rsq.2_Intron|MTA3_uc002rsr.2_Intron	NM_020744	NP_065795			metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2																		---	---	---	---
TTC7A	57217	broad.mit.edu	37	2	47299955	47299956	+	Intron	INS	-	C	C	rs143536722	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47299955_47299956insC	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|C2orf61_uc010fbd.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191			tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	49495254	49495254	+	IGR	DEL	A	-	-	rs11310396		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49495254delA								FSHR (113624 upstream) : NRXN1 (650390 downstream)																																			---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51090693	51090694	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51090693_51090694delCA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	54914585	54914585	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54914585delA								SPTBN1 (16003 upstream) : EML6 (37564 downstream)																																			---	---	---	---
SMEK2	57223	broad.mit.edu	37	2	55806644	55806645	+	Intron	INS	-	C	C	rs139950586	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55806644_55806645insC	uc002rzc.2	-						SMEK2_uc002rzb.2_Intron|SMEK2_uc002rzd.2_Intron|SMEK2_uc002rza.2_Intron	NM_001122964	NP_001116436			SMEK homolog 2, suppressor of mek1 isoform 1							microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
EFEMP1	2202	broad.mit.edu	37	2	56114576	56114576	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56114576delG	uc002rzh.2	-						EFEMP1_uc002rzi.2_Intron|EFEMP1_uc002rzj.2_Intron|EFEMP1_uc010ypc.1_Intron	NM_004105	NP_004096			EGF-containing fibulin-like extracellular matrix						negative regulation of chondrocyte differentiation|peptidyl-tyrosine phosphorylation|regulation of transcription, DNA-dependent|visual perception	extracellular space|proteinaceous extracellular matrix	calcium ion binding|epidermal growth factor receptor activity|epidermal growth factor receptor binding|growth factor activity			ovary(4)|pancreas(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	59202007	59202007	+	Intron	DEL	T	-	-	rs147956754		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59202007delT	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
PAPOLG	64895	broad.mit.edu	37	2	61023857	61023857	+	Intron	DEL	T	-	-	rs71400300		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61023857delT	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron|PAPOLG_uc010fch.2_Intron	NM_022894	NP_075045			poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	61399297	61399298	+	IGR	INS	-	A	A	rs138456703	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61399297_61399298insA								C2orf74 (7333 upstream) : AHSA2 (5255 downstream)																																			---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	63035441	63035441	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63035441delT	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc010fcq.1_Intron|EHBP1_uc002sbx.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067			EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)											Hereditary_Prostate_Cancer				---	---	---	---
ETAA1	54465	broad.mit.edu	37	2	67625181	67625181	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67625181delT	uc002sdz.1	+							NM_019002	NP_061875			ETAA16 protein							cytoplasm|nucleus				ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	67698665	67698666	+	IGR	INS	-	G	G	rs150454445	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67698665_67698666insG								ETAA1 (61132 upstream) : C1D (570667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	68144509	68144510	+	IGR	DEL	AC	-	-	rs59271338		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68144509_68144510delAC								ETAA1 (506976 upstream) : C1D (124823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	69482166	69482166	+	IGR	DEL	T	-	-	rs111422416		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69482166delT								ANTXR1 (5709 upstream) : GFPT1 (64739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	73362426	73362427	+	IGR	INS	-	AAGG	AAGG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73362426_73362427insAAGG								RAB11FIP5 (22280 upstream) : NOTO (66959 downstream)																																			---	---	---	---
ALMS1	7840	broad.mit.edu	37	2	73672912	73672913	+	Intron	INS	-	T	T	rs149416639	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73672912_73672913insT	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjg.2_5'Flank|ALMS1_uc002sjh.1_5'Flank	NM_015120	NP_055935			Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9																		---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77369557	77369558	+	Intron	DEL	AC	-	-	rs71381264		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77369557_77369558delAC	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217			leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	77772328	77772328	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77772328delT								LRRTM4 (22826 upstream) : SNAR-H (409705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82726158	82726158	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82726158delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	85116934	85116934	+	IGR	DEL	A	-	-	rs35890132		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85116934delA								C2orf89 (8682 upstream) : TMSB10 (15829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	88733981	88733981	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88733981delT								THNSL2 (247836 upstream) : FOXI3 (13745 downstream)																																			---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89076553	89076554	+	Intron	INS	-	TT	TT	rs139718494	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89076553_89076554insTT	uc002stf.2	+						FLJ40330_uc010fhf.2_Intron|FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90451181	90451184	+	Intron	DEL	AAAG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90451181_90451184delAAAG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91662469	91662469	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91662469delA								None (None upstream) : LOC654342 (142723 downstream)																																			---	---	---	---
LOC285033	285033	broad.mit.edu	37	2	96897407	96897407	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96897407delG	uc002svo.2	+						LOC285033_uc002svn.2_Intron					Homo sapiens cDNA FLJ32857 fis, clone TESTI2003541.												0																		---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97594712	97594712	+	Intron	DEL	C	-	-	rs72308456		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97594712delC	uc002sxl.3	-						FAM178B_uc002sxk.3_Intron	NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102161569	102161570	+	IGR	INS	-	T	T	rs111436544		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102161569_102161570insT								RFX8 (70404 upstream) : MAP4K4 (152918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103506501	103506502	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103506501_103506502delTG								TMEM182 (72365 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106601441	106601442	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106601441_106601442delTC								NCK2 (90715 upstream) : C2orf40 (80671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107206942	107206942	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107206942delT								RGPD3 (122141 upstream) : ST6GAL2 (211116 downstream)																																			---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	109820279	109820280	+	Intron	INS	-	G	G	rs146911861	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109820279_109820280insG	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
ZC3H8	84524	broad.mit.edu	37	2	112998586	112998587	+	Intron	INS	-	TG	TG	rs143710961	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112998586_112998587insTG	uc002thp.2	-							NM_032494	NP_115883			zinc finger CCCH-type containing 8						apoptosis|negative regulation of T cell differentiation in thymus|negative regulation of transcription, DNA-dependent|positive regulation of thymocyte apoptosis|response to antibiotic|T cell homeostasis	nucleus	RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
IL1F8	27177	broad.mit.edu	37	2	113787808	113787808	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113787808delA	uc002tiq.1	-						IL1F8_uc002tir.1_Intron	NM_014438	NP_055253			interleukin 1 family, member 8 isoform 1						immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114427698	114427698	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114427698delT								RABL2A (26724 upstream) : SLC35F5 (44233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119865144	119865145	+	IGR	INS	-	TGTG	TGTG	rs72438757		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119865144_119865145insTGTG								MARCO (112908 upstream) : C1QL2 (48674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	123299450	123299450	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123299450delT								TSN (774024 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126698884	126698885	+	IGR	DEL	TT	-	-	rs77479733		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126698884_126698885delTT								None (None upstream) : GYPC (714799 downstream)																																			---	---	---	---
SAP130	79595	broad.mit.edu	37	2	128705555	128705555	+	Intron	DEL	G	-	-	rs75571876		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128705555delG	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron	NM_024545	NP_078821			Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	132403233	132403236	+	IGR	DEL	ACAG	-	-	rs148619714		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132403233_132403236delACAG								CCDC74A (111996 upstream) : C2orf27A (76828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132454462	132454463	+	RNA	INS	-	A	A	rs113051586		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132454462_132454463insA	uc002tte.2	+	4		c.1586_1587insA								Homo sapiens mRNA; cDNA DKFZp686A02119 (from clone DKFZp686A02119).																														---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132981315	132981315	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981315delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133001716	133001717	+	Intron	DEL	TT	-	-	rs79369156		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133001716_133001717delTT	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133023955	133023956	+	IGR	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133023955_133023956delGA								NCRNA00164 (8413 upstream) : GPR39 (150191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133116248	133116249	+	IGR	INS	-	T	T	rs147563539	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133116248_133116249insT								NCRNA00164 (100706 upstream) : GPR39 (57898 downstream)																																			---	---	---	---
ACMSD	130013	broad.mit.edu	37	2	135620627	135620628	+	Intron	INS	-	G	G	rs148492517	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135620627_135620628insG	uc002ttz.2	+						ACMSD_uc002tua.2_Intron	NM_138326	NP_612199			aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	138620590	138620590	+	IGR	DEL	T	-	-	rs34023189		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138620590delT								THSD7B (185303 upstream) : HNMT (101000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	139949186	139949187	+	IGR	INS	-	T	T	rs150006786	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139949186_139949187insT								NXPH2 (411375 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140247618	140247618	+	IGR	DEL	T	-	-	rs11365268		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140247618delT								NXPH2 (709807 upstream) : LRP1B (741378 downstream)																																			---	---	---	---
CACNB4	785	broad.mit.edu	37	2	152806003	152806004	+	Intron	INS	-	T	T	rs35773740		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152806003_152806004insT	uc002tya.2	-						CACNB4_uc002txy.2_Intron|CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron|CACNB4_uc002tyb.2_Intron	NM_000726	NP_000717			calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	159595722	159595723	+	IGR	INS	-	T	T	rs111597958		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159595722_159595723insT								PKP4 (57784 upstream) : DAPL1 (56106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164033019	164033020	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164033019_164033020insA								KCNH7 (337779 upstream) : FIGN (431098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164304607	164304607	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164304607delT								KCNH7 (609367 upstream) : FIGN (159511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	169307590	169307590	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169307590delT								STK39 (203485 upstream) : LASS6 (5245 downstream)																																			---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170867428	170867429	+	Intron	INS	-	T	T	rs150334606	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170867428_170867429insT	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron|UBR3_uc010zdj.1_Intron	NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171654306	171654306	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171654306delA	uc002ugg.2	+											RecName: Full=Uncharacterized protein LOC285141;																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	173387645	173387645	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173387645delC								ITGA6 (16464 upstream) : PDK1 (32456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	173536191	173536192	+	IGR	INS	-	T	T	rs147055366	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173536191_173536192insT								PDK1 (46368 upstream) : LOC91149 (51728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	180262768	180262785	+	IGR	DEL	TACGTATATACACACATA	-	-	rs74176594	by1000genomes;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180262768_180262785delTACGTATATACACACATA								SESTD1 (133418 upstream) : ZNF385B (43935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	181960921	181960921	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181960921delA								UBE2E3 (32771 upstream) : ITGA4 (360698 downstream)																																			---	---	---	---
PDE1A	5136	broad.mit.edu	37	2	183376902	183376903	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183376902_183376903insT	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683			phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	184639411	184639418	+	IGR	DEL	ACACACAC	-	-	rs35360131	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184639411_184639418delACACACAC								NUP35 (613004 upstream) : ZNF804A (823675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	191685177	191685178	+	IGR	INS	-	C	C	rs146627344		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191685177_191685178insC								NAB1 (127686 upstream) : GLS (60369 downstream)																																			---	---	---	---
STAT4	6775	broad.mit.edu	37	2	191966735	191966736	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191966735_191966736insT	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc002uso.2_Intron|STAT4_uc002usp.3_Intron	NM_003151	NP_003142			signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	195195730	195195737	+	IGR	DEL	TGTGTGTG	-	-	rs10582458		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195195730_195195737delTGTGTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198744989	198744990	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198744989_198744990insT	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133			RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	201959765	201959765	+	IGR	DEL	A	-	-	rs141042407	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201959765delA								NDUFB3 (9294 upstream) : CFLAR (21051 downstream)																																			---	---	---	---
INO80D	54891	broad.mit.edu	37	2	206933418	206933419	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206933418_206933419insT	uc002vaz.3	-							NM_017759	NP_060229			INO80 complex subunit D						DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1																		---	---	---	---
ATG9A	79065	broad.mit.edu	37	2	220092238	220092238	+	Intron	DEL	A	-	-	rs34195462		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220092238delA	uc002vke.1	-						ATG9A_uc002vkd.1_5'Flank|ATG9A_uc002vkf.1_Intron|ANKZF1_uc010zkv.1_5'Flank|ANKZF1_uc010zkw.1_5'Flank|ANKZF1_uc002vkg.2_5'Flank|ANKZF1_uc002vkh.2_5'Flank|ANKZF1_uc002vki.2_5'Flank	NM_001077198	NP_001070666			APG9 autophagy 9-like 1						autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
TUBA4B	80086	broad.mit.edu	37	2	220119769	220119770	+	Intron	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220119769_220119770delTC	uc002vkv.1	+						TUBA4A_uc002vkt.1_5'Flank|TUBA4A_uc010zkz.1_5'Flank|TUBA4B_uc002vku.2_Intron	NR_003063				RecName: Full=Putative tubulin-like protein alpha-4B; AltName: Full=Alpha-tubulin 4B;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	220211025	220211026	+	IGR	DEL	TC	-	-	rs67942202		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220211025_220211026delTC								RESP18 (13126 upstream) : DNPEP (22047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220717554	220717554	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220717554delC								SLC4A3 (210853 upstream) : None (None downstream)																																			---	---	---	---
AP1S3	130340	broad.mit.edu	37	2	224653853	224653854	+	Intron	INS	-	A	A	rs148951417	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224653853_224653854insA	uc010fwx.1	-						AP1S3_uc002vnn.2_Intron|AP1S3_uc010fww.2_Intron|AP1S3_uc002vno.2_Intron	NM_001039569	NP_001034658			adaptor-related protein complex 1, sigma 3						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane coat	protein transporter activity				0		Renal(207;0.0112)|Lung NSC(271;0.0186)|all_lung(227;0.0272)		Epithelial(121;7.6e-10)|all cancers(144;3.62e-07)|Lung(261;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.00902)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225555620	225555621	+	IGR	DEL	TG	-	-	rs35812459		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225555620_225555621delTG								CUL3 (105510 upstream) : DOCK10 (74186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228670597	228670605	+	IGR	DEL	CGCGGGGAA	-	-	rs66843448		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228670597_228670605delCGCGGGGAA								SLC19A3 (87852 upstream) : CCL20 (7953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	233920774	233920777	+	IGR	DEL	GATA	-	-	rs72099512		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233920774_233920777delGATA								NEU2 (21008 upstream) : INPP5D (4259 downstream)																																			---	---	---	---
SAG	6295	broad.mit.edu	37	2	234253803	234253803	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234253803delA	uc002vuh.2	+						SAG_uc010zmq.1_Intron	NM_000541	NP_000532			S-arrestin						rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity			ovary(1)	1		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)														---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240217903	240217904	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240217903_240217904delCA	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	241519593	241519593	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241519593delT								RNPEPL1 (1452 upstream) : CAPN10 (6552 downstream)																																			---	---	---	---
D2HGDH	728294	broad.mit.edu	37	2	242680356	242680356	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242680356delA	uc002wce.1	+						D2HGDH_uc010zpc.1_Intron|D2HGDH_uc010fzq.1_Intron|D2HGDH_uc002wcg.1_Intron	NM_152783	NP_689996			D-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	1796071	1796072	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1796071_1796072delTC								CNTN6 (350794 upstream) : CNTN4 (344478 downstream)																																			---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2686900	2686900	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2686900delA	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	3011763	3011775	+	Intron	DEL	TTGTTGTTGTTGT	-	-	rs111284363		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3011763_3011775delTTGTTGTTGTTGT	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron|CNTN4_uc003bpe.2_Intron|CNTN4_uc003bpf.2_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	5932384	5932384	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5932384delT								EDEM1 (670735 upstream) : GRM7 (970418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	8496782	8496783	+	Intron	INS	-	TA	TA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8496782_8496783insTA	uc003bqp.2	-											Homo sapiens cDNA FLJ42094 fis, clone TESOP2002489.																														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9166085	9166086	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9166085_9166086delTG	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
Unknown	0	broad.mit.edu	37	3	9333287	9333290	+	IGR	DEL	CACA	-	-	rs34633160		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9333287_9333290delCACA								SRGAP3 (41976 upstream) : LOC440944 (58084 downstream)																																			---	---	---	---
TADA3	10474	broad.mit.edu	37	3	9827626	9827627	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9827626_9827627insT	uc003bsx.1	-						TADA3_uc010hcn.1_Intron|TADA3_uc003bsy.2_Intron|TADA3_uc003bsw.1_Intron	NM_006354	NP_006345			transcriptional adaptor 3 isoform a						estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10543058	10543058	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10543058delT	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdp.2_Intron	NM_001001331	NP_001001331			plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	12902646	12902646	+	5'Flank	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12902646delG	uc003bxp.1	-						uc003bxq.1_5'Flank					DQ583118																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	13926117	13926124	+	IGR	DEL	GTGTGTGT	-	-	rs1873003		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13926117_13926124delGTGTGTGT								WNT7A (4499 upstream) : TPRXL (52683 downstream)																																			---	---	---	---
EAF1	85403	broad.mit.edu	37	3	15482997	15482997	+	3'UTR	DEL	T	-	-	rs34923485		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15482997delT	uc003bzu.2	+	6					EAF1_uc011avq.1_3'UTR	NM_033083	NP_149074			ELL associated factor 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cajal body|nuclear speck	protein binding			central_nervous_system(1)	1																		---	---	---	---
ANKRD28	23243	broad.mit.edu	37	3	15735113	15735115	+	Intron	DEL	TGC	-	-	rs66813774		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15735113_15735115delTGC	uc003caj.1	-						ANKRD28_uc003cai.1_Intron|ANKRD28_uc011avz.1_Intron|ANKRD28_uc003cak.1_Intron|ANKRD28_uc011awa.1_Intron|ANKRD28_uc003cal.1_Intron|ANKRD28_uc003cam.2_Intron	NM_015199	NP_056014			ankyrin repeat domain 28							nucleoplasm	protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	21062872	21062872	+	IGR	DEL	T	-	-	rs34171068		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21062872delT								SGOL1 (835189 upstream) : VENTXP7 (384346 downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21882071	21882071	+	Intron	DEL	A	-	-	rs75160659		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21882071delA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22253695	22253696	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22253695_22253696delGT	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	24747270	24747271	+	IGR	DEL	AT	-	-	rs138959307		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24747270_24747271delAT								THRB (210817 upstream) : RARB (468552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30249906	30249906	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30249906delA								RBMS3 (203287 upstream) : TGFBR2 (398088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	31233662	31233663	+	IGR	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31233662_31233663insG								GADL1 (297509 upstream) : STT3B (340828 downstream)																																			---	---	---	---
TRIM71	131405	broad.mit.edu	37	3	32907655	32907656	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32907655_32907656insT	uc003cff.2	+							NM_001039111	NP_001034200			tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
MLH1	4292	broad.mit.edu	37	3	37083138	37083138	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37083138delA	uc003cgl.2	+						MLH1_uc011aye.1_Intron|MLH1_uc011ayb.1_Intron|MLH1_uc010hge.2_Intron|MLH1_uc003cgn.3_Intron|MLH1_uc011ayc.1_Intron|MLH1_uc011ayd.1_Intron|MLH1_uc003cgo.2_Intron|MLH1_uc010hgk.2_Intron|MLH1_uc010hgn.2_Intron|MLH1_uc010hgm.2_Intron|MLH1_uc010hgo.2_Intron|MLH1_uc010hgp.2_5'Flank|MLH1_uc010hgq.2_5'Flank	NM_000249	NP_000240			MutL protein homolog 1						mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77							1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41877268	41877268	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41877268delC	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	47583457	47583458	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47583457_47583458insA								C3orf75 (28258 upstream) : CSPG5 (20271 downstream)																																			---	---	---	---
FBXW12	285231	broad.mit.edu	37	3	48422513	48422514	+	Intron	DEL	TT	-	-	rs72381403		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48422513_48422514delTT	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985			F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
SHISA5	51246	broad.mit.edu	37	3	48524059	48524059	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48524059delT	uc003ctp.1	-						SHISA5_uc003cto.1_Intron|SHISA5_uc003ctq.1_Intron|SHISA5_uc003ctr.1_Intron|SHISA5_uc003cts.1_Intron	NM_016479	NP_057563			scotin precursor						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding				0																		---	---	---	---
SHISA5	51246	broad.mit.edu	37	3	48531049	48531049	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48531049delA	uc003ctp.1	-						SHISA5_uc003cto.1_Intron|SHISA5_uc003ctq.1_Intron|SHISA5_uc003ctr.1_Intron|SHISA5_uc003cts.1_Intron	NM_016479	NP_057563			scotin precursor						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	49921256	49921257	+	IGR	DEL	CT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49921256_49921257delCT								CAMKV (13887 upstream) : MST1R (3181 downstream)																																			---	---	---	---
IQCF1	132141	broad.mit.edu	37	3	51853018	51853018	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51853018delG	uc003dbq.3	-											Homo sapiens cDNA FLJ27508 fis, clone TST08061.											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54723749	54723750	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54723749_54723750delAC	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	65245560	65245567	+	IGR	DEL	GTGTGTGT	-	-	rs72015624		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65245560_65245567delGTGTGTGT								ADAMTS9 (572195 upstream) : MAGI1 (94340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	66854870	66854870	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66854870delT								LRIG1 (304025 upstream) : KBTBD8 (193857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	67801779	67801779	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67801779delA	uc003dnc.2	+											Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	70742118	70742118	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70742118delC								MITF (724632 upstream) : FOXP1 (262619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73702985	73702986	+	IGR	INS	-	A	A	rs150308313	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73702985_73702986insA								PDZRN3 (28913 upstream) : CNTN3 (608736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	84555918	84555919	+	IGR	INS	-	TG	TG	rs149132842	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84555918_84555919insTG								None (None upstream) : CADM2 (452214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90453693	90453693	+	IGR	DEL	A	-	-	rs150170861	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90453693delA								EPHA3 (922411 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90497892	90497895	+	IGR	DEL	TCTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90497892_90497895delTCTG								EPHA3 (966610 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96280838	96280839	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96280838_96280839delTG								None (None upstream) : EPHA6 (252586 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97211208	97211208	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97211208delA	uc010how.1	+						EPHA6_uc011bgo.1_Intron|EPHA6_uc011bgp.1_Intron|EPHA6_uc003drs.3_Intron|EPHA6_uc003drr.3_Intron|EPHA6_uc003drt.2_Intron|EPHA6_uc010hox.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	97696372	97696372	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97696372delG								MINA (5077 upstream) : GABRR3 (9156 downstream)																																			---	---	---	---
DCBLD2	131566	broad.mit.edu	37	3	98557961	98557962	+	Intron	INS	-	TT	TT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98557961_98557962insTT	uc003dtd.2	-						DCBLD2_uc003dte.2_Intron	NM_080927	NP_563615			discoidin, CUB and LCCL domain containing 2						cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	99112197	99112208	+	IGR	DEL	ATTGACACTGGT	-	-	rs111857546		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99112197_99112208delATTGACACTGGT								DCBLD2 (491664 upstream) : COL8A1 (245246 downstream)																																			---	---	---	---
FILIP1L	11259	broad.mit.edu	37	3	99646217	99646217	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99646217delT	uc003dtm.2	-						C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913			filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	101364588	101364589	+	IGR	INS	-	A	A	rs144650547	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101364588_101364589insA								PCNP (51309 upstream) : ZBTB11 (3696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	101595951	101595951	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101595951delT								NFKBIZ (16086 upstream) : LOC152225 (63752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	106328172	106328172	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106328172delA								CBLB (739906 upstream) : LOC100302640 (227488 downstream)																																			---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106821226	106821227	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106821226_106821227delAC	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
FLJ25363	401082	broad.mit.edu	37	3	109193966	109193966	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109193966delT	uc003dxr.1	+							NM_001145553	NP_001139025			hypothetical protein LOC401082												0																		---	---	---	---
GRAMD1C	54762	broad.mit.edu	37	3	113556571	113556574	+	5'Flank	DEL	AAAC	-	-	rs72299949		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113556571_113556574delAAAC	uc003eaq.3	+						GRAMD1C_uc011bil.1_Intron|GRAMD1C_uc011bim.1_5'Flank	NM_017577	NP_060047			GRAM domain containing 1C							integral to membrane				ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	116866854	116866856	+	IGR	DEL	TTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116866854_116866856delTTG								LOC285194 (430969 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118342729	118342729	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118342729delG	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	118998072	118998073	+	IGR	INS	-	T	T	rs148599108	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118998072_118998073insT								B4GALT4 (38320 upstream) : ARHGAP31 (15147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	119839981	119839982	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119839981_119839982delTG	uc003edp.2	+											Homo sapiens cDNA clone IMAGE:4827879.																														---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119896647	119896648	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119896647_119896648insA	uc011bjf.1	-						GPR156_uc011bjg.1_Intron	NM_153002	NP_694547			G protein-coupled receptor 156							integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	121143384	121143385	+	3'UTR	INS	-	T	T	rs148250054	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121143384_121143385insT	uc003eec.3	+	28					STXBP5L_uc011bji.1_3'UTR	NM_014980	NP_055795			syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)														---	---	---	---
CASR	846	broad.mit.edu	37	3	121912037	121912037	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121912037delT	uc003eev.3	+						CASR_uc003eew.3_Intron	NM_000388	NP_000379			calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)													---	---	---	---
SEMA5B	54437	broad.mit.edu	37	3	122736456	122736456	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122736456delT	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872			semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)														---	---	---	---
SEC22A	26984	broad.mit.edu	37	3	122954289	122954290	+	Intron	DEL	AT	-	-	rs139254339		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122954289_122954290delAT	uc003ege.2	+						SEC22A_uc003egf.2_Intron	NM_012430	NP_036562			SEC22 vesicle trafficking protein homolog A						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)														---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124484907	124484907	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124484907delA	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
SNX4	8723	broad.mit.edu	37	3	125197262	125197263	+	Intron	INS	-	T	T	rs143779467		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125197262_125197263insT	uc003eib.2	-						SNX4_uc011bkf.1_Intron	NM_003794	NP_003785			sorting nexin 4						cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
UROC1	131669	broad.mit.edu	37	3	126221599	126221602	+	Intron	DEL	TGTG	-	-	rs149775959		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126221599_126221602delTGTG	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240			urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	127210115	127210116	+	Intron	DEL	GC	-	-	rs66566224		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127210115_127210116delGC	uc003ejk.2	-											Homo sapiens cDNA FLJ25806 fis, clone TST07194.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	133411477	133411477	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133411477delC								TOPBP1 (30740 upstream) : TF (7734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	140308786	140308786	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140308786delC								CLSTN2 (21869 upstream) : TRIM42 (88095 downstream)																																			---	---	---	---
PCOLCE2	26577	broad.mit.edu	37	3	142569654	142569655	+	Intron	INS	-	CT	CT	rs139522427	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142569654_142569655insCT	uc003evd.2	-							NM_013363	NP_037495			procollagen C-endopeptidase enhancer 2							extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144523598	144523598	+	IGR	DEL	T	-	-	rs111327431		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144523598delT								C3orf58 (812389 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144556703	144556704	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144556703_144556704insT								C3orf58 (845494 upstream) : None (None downstream)																																			---	---	---	---
CPB1	1360	broad.mit.edu	37	3	148575476	148575477	+	Intron	INS	-	AA	AA	rs139871842		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148575476_148575477insAA	uc003ewl.2	+							NM_001871	NP_001862			pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)															---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150904440	150904440	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150904440delC	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728			mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	151246987	151246987	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151246987delC								IGSF10 (70490 upstream) : AADACL2 (204717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153525207	153525208	+	IGR	DEL	AC	-	-	rs66535966		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153525207_153525208delAC								C3orf79 (304724 upstream) : SGEF (313941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	159830862	159830862	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159830862delA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	160461360	160461360	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160461360delG								ARL14 (65127 upstream) : PPM1L (12636 downstream)																																			---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160653907	160653907	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160653907delT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161232159	161232159	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161232159delA								OTOL1 (10431 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164519030	164519031	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164519030_164519031insT								MIR720 (459792 upstream) : SI (177656 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166581486	166581487	+	IGR	INS	-	AAT	AAT	rs144769299	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166581486_166581487insAAT								None (None upstream) : ZBBX (376594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168052324	168052324	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168052324delG								GOLIM4 (238907 upstream) : MIR551B (217318 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169002360	169002361	+	Intron	DEL	CA	-	-	rs59802264	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169002360_169002361delCA	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175220715	175220715	+	Intron	DEL	T	-	-	rs10570754		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175220715delT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	177242041	177242042	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177242041_177242042insT								TBL1XR1 (326993 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181236552	181236552	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181236552delT								DNAJC19 (529022 upstream) : SOX2OT (44957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181475346	181475346	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181475346delC								SOX2OT (16343 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	182308609	182308610	+	IGR	INS	-	T	T	rs141337178	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182308609_182308610insT								SOX2OT (849606 upstream) : ATP11B (202681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	183325134	183325135	+	IGR	INS	-	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183325134_183325135insC								KLHL6 (51635 upstream) : KLHL24 (28276 downstream)																																			---	---	---	---
DGKG	1608	broad.mit.edu	37	3	186045179	186045180	+	Intron	INS	-	T	T	rs36076414		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186045179_186045180insT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	193492702	193492702	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193492702delG								OPA1 (77103 upstream) : LOC100128023 (218182 downstream)																																			---	---	---	---
TCTEX1D2	255758	broad.mit.edu	37	3	196041339	196041340	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196041339_196041340insA	uc003fwi.2	-							NM_152773	NP_689986			Tctex1 domain containing 2								protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	16767	16768	+	IGR	INS	-	T	T	rs141189818		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16767_16768insT								None (None upstream) : ZNF595 (36459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	47505	47507	+	IGR	DEL	AAG	-	-	rs61313838		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47505_47507delAAG								None (None upstream) : ZNF595 (5720 downstream)																																			---	---	---	---
ZNF141	7700	broad.mit.edu	37	4	362948	362949	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:362948_362949delAC	uc003gaa.2	+						ZNF141_uc003gab.2_Intron	NM_003441	NP_003432			zinc finger protein 141						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF721	170960	broad.mit.edu	37	4	476833	476834	+	Intron	DEL	TG	-	-	rs34874772		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:476833_476834delTG	uc003gag.2	-						ZNF721_uc010ibe.2_Intron	NM_133474	NP_597731			zinc finger protein 721							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
GAK	2580	broad.mit.edu	37	4	881707	881708	+	Intron	INS	-	CA	CA	rs149242240	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:881707_881708insCA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246			cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	2438367	2438369	+	Intron	DEL	TCA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2438367_2438369delTCA	uc003gfa.1	+											Homo sapiens cDNA FLJ44040 fis, clone TESTI4028983.																														---	---	---	---
LRPAP1	4043	broad.mit.edu	37	4	3528841	3528843	+	Intron	DEL	CCC	-	-	rs10532132		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3528841_3528843delCCC	uc003ghi.2	-							NM_002337	NP_002328			low density lipoprotein receptor-related protein						negative regulation of protein binding|negative regulation of very-low-density lipoprotein particle clearance|protein folding|vesicle-mediated transport	cell surface|integral to membrane|plasma membrane	asialoglycoprotein receptor activity|heparin binding|low-density lipoprotein particle receptor binding|receptor antagonist activity|unfolded protein binding|very-low-density lipoprotein particle receptor binding			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3585125	3585127	+	Intron	DEL	CTC	-	-	rs144308608		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3585125_3585127delCTC	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3587241	3587241	+	Intron	DEL	T	-	-	rs11286905		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3587241delT	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3601658	3601659	+	IGR	DEL	TC	-	-	rs10607272		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3601658_3601659delTC								LRPAP1 (67434 upstream) : ADRA2C (166416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3910700	3910700	+	IGR	DEL	A	-	-	rs112018013		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3910700delA								ADRA2C (140449 upstream) : LOC348926 (32970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	4075661	4075664	+	Intron	DEL	GAGA	-	-	rs71241259		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4075661_4075664delGAGA	uc003gho.2	+											Homo sapiens cDNA clone IMAGE:5275587.																														---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7447733	7447734	+	Intron	INS	-	T	T	rs138077637	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7447733_7447734insT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8736208	8736208	+	IGR	DEL	G	-	-	rs140987801	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8736208delG								CPZ (114722 upstream) : HMX1 (132565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	8759876	8759883	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8759876_8759883delACACACAC								CPZ (138390 upstream) : HMX1 (108890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	10700855	10700856	+	IGR	DEL	TA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10700855_10700856delTA								CLNK (14469 upstream) : MIR572 (669595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13965271	13965271	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13965271delT								BOD1L (335943 upstream) : None (None downstream)																																			---	---	---	---
CPEB2	132864	broad.mit.edu	37	4	15021233	15021233	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15021233delA	uc003gni.1	+						CPEB2_uc003gnj.1_Intron|CPEB2_uc003gnk.1_Intron|CPEB2_uc003gnl.1_Intron|CPEB2_uc003gnm.1_Intron|CPEB2_uc003gnn.1_Intron	NM_182485	NP_872291			cytoplasmic polyadenylation element binding						regulation of translation	cytoplasm	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	16439934	16439934	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16439934delT								FLJ39653 (180124 upstream) : LDB2 (63233 downstream)																																			---	---	---	---
GPR125	166647	broad.mit.edu	37	4	22470392	22470392	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22470392delA	uc003gqm.1	-						GPR125_uc003gqo.2_Intron	NM_145290	NP_660333			G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	24628933	24628934	+	IGR	INS	-	A	A	rs34640928		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24628933_24628934insA								DHX15 (42749 upstream) : SOD3 (168151 downstream)																																			---	---	---	---
PI4K2B	55300	broad.mit.edu	37	4	25209510	25209511	+	Intron	INS	-	AC	AC	rs147462949	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25209510_25209511insAC	uc011bxs.1	+							NM_018323	NP_060793			phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)																---	---	---	---
TBC1D19	55296	broad.mit.edu	37	4	26733444	26733445	+	Intron	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26733444_26733445delAA	uc003gsf.3	+						TBC1D19_uc010iew.2_Intron|TBC1D19_uc011bxu.1_Intron	NM_018317	NP_060787			TBC1 domain family, member 19							intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)														OREG0031815	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)	---	---	---	---
Unknown	0	broad.mit.edu	37	4	29466648	29466648	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29466648delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29729481	29729481	+	IGR	DEL	A	-	-	rs34277856		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29729481delA								None (None upstream) : PCDH7 (992556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29965528	29965528	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29965528delA								None (None upstream) : PCDH7 (756509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31162619	31162620	+	IGR	DEL	GT	-	-	rs77365856		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31162619_31162620delGT								PCDH7 (14198 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31633972	31633973	+	IGR	INS	-	AAAG	AAAG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31633972_31633973insAAAG								PCDH7 (485551 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32696009	32696010	+	IGR	INS	-	GT	GT	rs138711764	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32696009_32696010insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33086584	33086584	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33086584delA								None (None upstream) : None (None downstream)																																			---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	38066553	38066554	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38066553_38066554insT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
FAM114A1	92689	broad.mit.edu	37	4	38880181	38880182	+	Intron	INS	-	TGTGT	TGTGT	rs142950595	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38880181_38880182insTGTGT	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron	NM_138389	NP_612398			hypothetical protein LOC92689							cytoplasm				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	40330938	40330940	+	IGR	DEL	AGG	-	-	rs72145179		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40330938_40330940delAGG								RHOH (84657 upstream) : CHRNA9 (6529 downstream)																																			---	---	---	---
APBB2	323	broad.mit.edu	37	4	41002879	41002879	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41002879delA	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	43777356	43777356	+	IGR	DEL	T	-	-	rs35541492		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43777356delT								GRXCR1 (744683 upstream) : KCTD8 (398566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45611310	45611313	+	IGR	DEL	ACAG	-	-	rs149887931		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45611310_45611313delACAG								GNPDA2 (882698 upstream) : GABRG1 (426476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	46676291	46676292	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46676291_46676292delTG								GABRA2 (283870 upstream) : COX7B2 (60557 downstream)																																			---	---	---	---
GABRA4	2557	broad.mit.edu	37	4	46966655	46966656	+	Intron	INS	-	T	T	rs150393866	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46966655_46966656insT	uc003gxg.2	-							NM_000809	NP_000800			gamma-aminobutyric acid A receptor, alpha 4						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	49159737	49159737	+	IGR	DEL	T	-	-	rs113227791		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49159737delT								CWH43 (95644 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49217943	49217944	+	IGR	INS	-	A	A	rs145580170		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49217943_49217944insA								CWH43 (153850 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49220041	49220041	+	IGR	DEL	A	-	-	rs35986529		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49220041delA								CWH43 (155948 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49638716	49638716	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49638716delC								CWH43 (574623 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53242283	53242283	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53242283delA								SPATA18 (278826 upstream) : USP46 (214846 downstream)																																			---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57082736	57082737	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57082736_57082737delGT	uc003hbk.2	+							NM_020722	NP_065773			hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	61201115	61201117	+	IGR	DEL	ATT	-	-	rs79410900		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61201115_61201117delATT								None (None upstream) : LPHN3 (865857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65971402	65971402	+	IGR	DEL	A	-	-	rs75544200		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65971402delA								TECRL (696224 upstream) : EPHA5 (213880 downstream)																																			---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66394180	66394181	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66394180_66394181insA	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	76490971	76490971	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76490971delA								C4orf26 (1044 upstream) : CDKL2 (10734 downstream)																																			---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77455693	77455694	+	Intron	INS	-	AT	AT	rs140019866	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77455693_77455694insAT	uc011cbx.1	+							NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	80189193	80189194	+	Intron	INS	-	TAA	TAA	rs148336321	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80189193_80189194insTAA	uc003hlr.1	+						uc003hls.2_Intron					Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	81147568	81147568	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81147568delT								PRDM8 (22088 upstream) : FGF5 (40174 downstream)																																			---	---	---	---
SCD5	79966	broad.mit.edu	37	4	83697009	83697010	+	Intron	INS	-	A	A	rs112456183		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83697009_83697010insA	uc003hna.2	-						SCD5_uc003hnb.3_Intron|SCD5_uc003hnc.2_Intron	NM_001037582	NP_001032671			stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	86071391	86071392	+	IGR	DEL	CA	-	-	rs10537041	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86071391_86071392delCA								C4orf12 (143223 upstream) : ARHGAP24 (324892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86120275	86120275	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86120275delA								C4orf12 (192107 upstream) : ARHGAP24 (276009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	89459697	89459698	+	IGR	DEL	TT	-	-	rs34873660		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89459697_89459698delTT								PIGY (14742 upstream) : HERC3 (53949 downstream)																																			---	---	---	---
BMPR1B	658	broad.mit.edu	37	4	95791533	95791534	+	Intron	DEL	AA	-	-	rs35248282		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95791533_95791534delAA	uc003htm.3	+							NM_001203	NP_001194			bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)														---	---	---	---
UNC5C	8633	broad.mit.edu	37	4	96134074	96134076	+	Intron	DEL	TCC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96134074_96134076delTCC	uc003htp.1	-						UNC5C_uc010ilc.1_Intron	NM_003728	NP_003719			unc5C precursor						apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	97030131	97030132	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97030131_97030132insA								PDHA2 (267507 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100022332	100022332	+	Intron	DEL	A	-	-	rs11315926		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100022332delA	uc003hum.1	+						uc003hul.1_Intron					Homo sapiens full length insert cDNA clone ZD94A03.																														---	---	---	---
SLC39A8	64116	broad.mit.edu	37	4	103224740	103224740	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103224740delA	uc003hwb.1	-						SLC39A8_uc011ceo.1_Intron|SLC39A8_uc003hwa.1_Intron|SLC39A8_uc003hwc.2_Intron	NM_022154	NP_071437			solute carrier family 39 (zinc transporter),							integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	107285041	107285042	+	IGR	DEL	GG	-	-	rs34967487		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107285041_107285042delGG								AIMP1 (14662 upstream) : DKK2 (557918 downstream)																																			---	---	---	---
ENPEP	2028	broad.mit.edu	37	4	111471179	111471179	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111471179delA	uc003iab.3	+							NM_001977	NP_001968			glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)													---	---	---	---
C4orf21	55345	broad.mit.edu	37	4	113557280	113557280	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113557280delC	uc003iau.2	-						C4orf21_uc003iaw.2_Intron|LARP7_uc003iay.2_5'Flank|LARP7_uc003iaz.2_5'Flank|LARP7_uc003iba.2_5'Flank|LARP7_uc003ibb.2_5'Flank	NM_018392	NP_060862			prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)														---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115960317	115960317	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115960317delG	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091			heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)														---	---	---	---
SYNPO2	171024	broad.mit.edu	37	4	119834719	119834720	+	Intron	DEL	TG	-	-	rs142118657		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119834719_119834720delTG	uc003icm.3	+						SYNPO2_uc010ina.2_Intron|SYNPO2_uc010inb.2_Intron|SYNPO2_uc011cgh.1_Intron	NM_001128933	NP_001122405			synaptopodin 2 isoform b							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	124939702	124939702	+	IGR	DEL	T	-	-	rs112094577		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124939702delT								LOC285419 (88184 upstream) : ANKRD50 (645766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	129480275	129480276	+	IGR	INS	-	A	A	rs67689053		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129480275_129480276insA								PGRMC2 (271327 upstream) : PHF17 (250503 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136107512	136107513	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136107512_136107513insT								PABPC4L (984609 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136675773	136675773	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136675773delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137688937	137688937	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137688937delA								None (None upstream) : PCDH18 (751139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138878714	138878714	+	IGR	DEL	A	-	-	rs34915390		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138878714delA								PCDH18 (425066 upstream) : SLC7A11 (206534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139493618	139493619	+	IGR	INS	-	ACAA	ACAA	rs75719317		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139493618_139493619insACAA								SLC7A11 (330115 upstream) : CCRN4L (443324 downstream)																																			---	---	---	---
TBC1D9	23158	broad.mit.edu	37	4	141545161	141545162	+	Intron	INS	-	AA	AA	rs151003995	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141545161_141545162insAA	uc010ioj.2	-							NM_015130	NP_055945			TBC1 domain family, member 9 (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)																---	---	---	---
TBC1D9	23158	broad.mit.edu	37	4	141599172	141599173	+	Intron	INS	-	A	A	rs146991211	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141599172_141599173insA	uc010ioj.2	-							NM_015130	NP_055945			TBC1 domain family, member 9 (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	146269471	146269471	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146269471delT								OTUD4 (168639 upstream) : SMAD1 (133480 downstream)																																			---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147288159	147288160	+	Intron	INS	-	T	T	rs145957887	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147288159_147288160insT	uc010ioz.2	-						SLC10A7_uc003ikr.2_Intron|SLC10A7_uc010ipa.2_Intron|SLC10A7_uc003iks.2_Intron	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
MND1	84057	broad.mit.edu	37	4	154334840	154334840	+	Intron	DEL	A	-	-	rs71598282		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154334840delA	uc003ink.1	+							NM_032117	NP_115493			GAJ protein						DNA recombination|meiosis	nucleus	DNA binding				0	all_hematologic(180;0.093)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	154938702	154938702	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154938702delT								SFRP2 (228474 upstream) : DCHS2 (216825 downstream)																																			---	---	---	---
GUCY1B3	2983	broad.mit.edu	37	4	156716930	156716930	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156716930delT	uc003ipc.2	+						GUCY1B3_uc011cio.1_Intron|GUCY1B3_uc011cip.1_Intron|GUCY1B3_uc003ipd.2_Intron|GUCY1B3_uc010iqf.2_Intron|GUCY1B3_uc010iqg.2_Intron|GUCY1B3_uc011ciq.1_Intron	NM_000857	NP_000848			guanylate cyclase 1, soluble, beta 3						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	156799859	156799859	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156799859delA								ACCN5 (12434 upstream) : TDO2 (24988 downstream)																																			---	---	---	---
PDGFC	56034	broad.mit.edu	37	4	157735280	157735280	+	Intron	DEL	A	-	-	rs66807203		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157735280delA	uc003iph.1	-						PDGFC_uc003ipi.1_Intron|PDGFC_uc011cis.1_Intron|PDGFC_uc011cir.1_Intron	NM_016205	NP_057289			platelet-derived growth factor C precursor						central nervous system development|platelet-derived growth factor receptor signaling pathway|positive regulation of cell division|positive regulation of DNA replication|positive regulation of fibroblast proliferation|vascular endothelial growth factor receptor signaling pathway	endoplasmic reticulum lumen|extracellular space|Golgi membrane|nucleus	cell surface binding|growth factor activity|platelet-derived growth factor receptor binding|protein homodimerization activity			ovary(1)|lung(1)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	158563698	158563699	+	IGR	DEL	TG	-	-	rs34627989		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158563698_158563699delTG								LOC340017 (66403 upstream) : FAM198B (482034 downstream)																																			---	---	---	---
RXFP1	59350	broad.mit.edu	37	4	159546540	159546542	+	Intron	DEL	CTT	-	-	rs67132533		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159546540_159546542delCTT	uc003ipz.2	+						RXFP1_uc010iqj.1_Intron|RXFP1_uc011cja.1_Intron|RXFP1_uc010iqo.2_Intron|RXFP1_uc011cjb.1_Intron|RXFP1_uc010iqk.2_Intron|RXFP1_uc011cjc.1_Intron|RXFP1_uc011cjd.1_Intron|RXFP1_uc010iql.2_Intron|RXFP1_uc011cje.1_Intron|RXFP1_uc010iqm.2_Intron|RXFP1_uc011cjf.1_Intron|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647			relaxin/insulin-like family peptide receptor 1							integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	162012654	162012654	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162012654delT								None (None upstream) : FSTL5 (292397 downstream)																																			---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	162734182	162734183	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162734182_162734183insT	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501			follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
FSTL5	56884	broad.mit.edu	37	4	163088144	163088145	+	5'Flank	DEL	TG	-	-	rs35431272		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163088144_163088145delTG	uc003iqh.2	-						FSTL5_uc003iqi.2_5'Flank|FSTL5_uc010iqv.2_5'Flank	NM_020116	NP_064501			follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	165858362	165858363	+	IGR	INS	-	TTG	TTG	rs144106467	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165858362_165858363insTTG								MARCH1 (553160 upstream) : TRIM61 (17237 downstream)																																			---	---	---	---
DDX60L	91351	broad.mit.edu	37	4	169337603	169337604	+	Intron	INS	-	TA	TA	rs142137108	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169337603_169337604insTA	uc003irq.3	-						DDX60L_uc003irr.1_Intron|DDX60L_uc003irs.1_Intron	NM_001012967	NP_001012985			DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)														---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173526997	173526998	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173526997_173526998insA	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	177439666	177439667	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177439666_177439667insT								SPCS3 (186272 upstream) : VEGFC (165024 downstream)																																			---	---	---	---
VEGFC	7424	broad.mit.edu	37	4	177631147	177631149	+	Intron	DEL	AGA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177631147_177631149delAGA	uc003ius.1	-							NM_005429	NP_005420			vascular endothelial growth factor C						angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	179231526	179231527	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179231526_179231527insT								LOC285501 (319623 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	179417636	179417637	+	IGR	INS	-	A	A	rs148745539	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179417636_179417637insA								LOC285501 (505733 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	179927022	179927023	+	IGR	DEL	AC	-	-	rs71959722		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179927022_179927023delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	185263596	185263596	+	Intron	DEL	A	-	-	rs113783093		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185263596delA	uc003iwd.1	-											Homo sapiens cDNA FLJ39791 fis, clone SPLEN2003219.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	186886495	186886495	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186886495delG								SORBS2 (8625 upstream) : TLR3 (103814 downstream)																																			---	---	---	---
MTNR1A	4543	broad.mit.edu	37	4	187461961	187461962	+	Intron	INS	-	GAAG	GAAG	rs34538990		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187461961_187461962insGAAG	uc003izd.1	-							NM_005958	NP_005949			melatonin receptor 1A						circadian rhythm|G-protein signaling, coupled to cyclic nucleotide second messenger|mating behavior	integral to plasma membrane	melatonin receptor activity			ovary(1)|skin(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Melatonin(DB01065)|Ramelteon(DB00980)													---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187526464	187526464	+	Intron	DEL	G	-	-	rs112768259		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187526464delG	uc003izf.2	-							NM_005245	NP_005236			FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188960884	188960885	+	IGR	INS	-	T	T	rs139578156		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188960884_188960885insT								ZFP42 (34685 upstream) : TRIML2 (51542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190488619	190488619	+	IGR	DEL	T	-	-	rs71756780		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190488619delT								None (None upstream) : FRG1 (373355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190514054	190514055	+	IGR	DEL	GT	-	-	rs79143395		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190514054_190514055delGT								None (None upstream) : FRG1 (347919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190582423	190582424	+	IGR	INS	-	A	A	rs143592182		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190582423_190582424insA								None (None upstream) : FRG1 (279550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190588715	190588716	+	IGR	DEL	AG	-	-	rs67332528		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588715_190588716delAG								None (None upstream) : FRG1 (273258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190629252	190629262	+	IGR	DEL	ACCTAAAAGTA	-	-	rs6148862		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190629252_190629262delACCTAAAAGTA								None (None upstream) : FRG1 (232712 downstream)																																			---	---	---	---
AHRR	57491	broad.mit.edu	37	5	427082	427083	+	Intron	INS	-	ATGG	ATGG	rs144989841	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:427082_427083insATGG	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_Intron|AHRR_uc003jax.2_Intron|AHRR_uc003jay.2_Intron	NM_020731	NP_065782			arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	1154469	1154470	+	IGR	INS	-	AC	AC	rs149383112	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1154469_1154470insAC								SLC12A7 (42297 upstream) : SLC6A19 (47240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1961198	1961199	+	IGR	DEL	AT	-	-	rs144650950		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1961198_1961199delAT								IRX4 (78318 upstream) : IRX2 (785082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2077344	2077345	+	IGR	DEL	AA	-	-	rs142072744		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2077344_2077345delAA								IRX4 (194464 upstream) : IRX2 (668936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2131846	2131847	+	IGR	INS	-	TTT	TTT	rs137976607	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2131846_2131847insTTT								IRX4 (248966 upstream) : IRX2 (614434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5595549	5595550	+	IGR	DEL	AA	-	-	rs10604333		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5595549_5595550delAA								KIAA0947 (105212 upstream) : FLJ33360 (715004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6830890	6830891	+	5'Flank	INS	-	ACAT	ACAT	rs145128296	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6830890_6830891insACAT	hsa-mir-4278|MI0015888	-																																									---	---	---	---
Unknown	0	broad.mit.edu	37	5	7163883	7163884	+	IGR	DEL	CT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7163883_7163884delCT								PAPD7 (406722 upstream) : ADCY2 (232459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8026450	8026451	+	IGR	INS	-	A	A	rs148658309	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8026450_8026451insA								MTRR (125217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10766246	10766249	+	IGR	DEL	TATG	-	-	rs34164020		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10766246_10766249delTATG								DAP (4859 upstream) : CTNND2 (205703 downstream)																																			---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13705943	13705952	+	Intron	DEL	CTTCACAAGA	-	-	rs113132739		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13705943_13705952delCTTCACAAGA	uc003jfd.2	-						DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360			dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13774030	13774030	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13774030delA	uc003jfd.2	-							NM_001369	NP_001360			dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	5	13977606	13977607	+	IGR	INS	-	CA	CA	rs140900191	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13977606_13977607insCA								DNAH5 (33017 upstream) : TRIO (166222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	16371637	16371637	+	IGR	DEL	T	-	-	rs11294843		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16371637delT								MARCH11 (191740 upstream) : ZNF622 (79992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17035685	17035686	+	IGR	INS	-	TTCT	TTCT	rs146467907	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17035685_17035686insTTCT								MYO10 (99300 upstream) : LOC285696 (94451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17496472	17496472	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17496472delA								BASP1 (219537 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18355931	18355931	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18355931delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	21220607	21220607	+	IGR	DEL	T	-	-	rs35022194		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21220607delT								None (None upstream) : GUSBP1 (121335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26781917	26781918	+	IGR	INS	-	T	T	rs151073946	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26781917_26781918insT								None (None upstream) : CDH9 (98791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27159652	27159653	+	IGR	DEL	AG	-	-	rs35238235		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27159652_27159653delAG								CDH9 (120963 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28269976	28269976	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28269976delC								None (None upstream) : None (None downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31908813	31908823	+	Intron	DEL	AGCCCCTTGCA	-	-	rs139814389		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31908813_31908823delAGCCCCTTGCA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	34241848	34241848	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34241848delT								C1QTNF3 (198531 upstream) : RAI14 (414585 downstream)																																			---	---	---	---
EGFLAM	133584	broad.mit.edu	37	5	38391487	38391488	+	Intron	DEL	TG	-	-	rs34060472		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38391487_38391488delTG	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616			EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	39451542	39451543	+	IGR	DEL	CA	-	-	rs72330020		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39451542_39451543delCA								DAB2 (26207 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	39947723	39947724	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39947723_39947724delAC								DAB2 (522388 upstream) : PTGER4 (732308 downstream)																																			---	---	---	---
OXCT1	5019	broad.mit.edu	37	5	41836048	41836048	+	Intron	DEL	A	-	-	rs35908088		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41836048delA	uc003jmn.2	-							NM_000436	NP_000427			3-oxoacid CoA transferase 1 precursor						cellular lipid metabolic process|ketone body catabolic process	mitochondrial matrix	3-oxoacid CoA-transferase activity|protein homodimerization activity			ovary(2)|large_intestine(1)	3					Succinic acid(DB00139)													---	---	---	---
GHR	2690	broad.mit.edu	37	5	42515113	42515114	+	Intron	INS	-	GGTA	GGTA	rs138738767	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42515113_42515114insGGTA	uc003jmt.2	+							NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
HMGCS1	3157	broad.mit.edu	37	5	43315062	43315063	+	5'Flank	DEL	AC	-	-	rs141417511		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43315062_43315063delAC	uc003jnr.3	-						HMGCS1_uc003jnq.3_5'Flank	NM_001098272	NP_001091742			hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	49624293	49624293	+	IGR	DEL	A	-	-	rs11346399		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49624293delA								None (None upstream) : EMB (67740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	53791735	53791735	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53791735delT								HSPB3 (39528 upstream) : SNX18 (21854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	54258645	54258646	+	IGR	DEL	TA	-	-	rs35693314		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54258645_54258646delTA								SNX18 (416230 upstream) : ESM1 (15050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55794508	55794509	+	IGR	DEL	GG	-	-	rs3074482		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55794508_55794509delGG								ANKRD55 (265322 upstream) : MAP3K1 (316391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	57122465	57122466	+	IGR	INS	-	TTT	TTT	rs143004685	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57122465_57122466insTTT								ACTBL2 (343829 upstream) : PLK2 (627346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	58245332	58245333	+	IGR	INS	-	G	G	rs147273092	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58245332_58245333insG								RAB3C (97927 upstream) : PDE4D (19533 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58954212	58954212	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58954212delT	uc003jsa.2	-						PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58998984	58998984	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58998984delA	uc003jsa.2	-						PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
NDUFAF2	91942	broad.mit.edu	37	5	60330898	60330898	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60330898delT	uc003jsp.3	+						NDUFAF2_uc003jso.3_Intron	NM_174889	NP_777549			NADH dehydrogenase (ubiquinone) 1 alpha							membrane|mitochondrion	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	61364947	61364952	+	IGR	DEL	TGTGTG	-	-	rs72107782		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61364947_61364952delTGTGTG								FLJ37543 (362585 upstream) : KIF2A (237037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	65190465	65190465	+	IGR	DEL	C	-	-	rs112910653		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65190465delC								NLN (71078 upstream) : ERBB2IP (31919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71106786	71106787	+	IGR	INS	-	T	T	rs148754981	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71106786_71106787insT								CARTPT (89914 upstream) : MAP1B (296331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71945994	71945997	+	IGR	DEL	TATT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71945994_71945997delTATT								ZNF366 (142745 upstream) : TNPO1 (166421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74436114	74436114	+	IGR	DEL	G	-	-	rs71961024		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74436114delG								GCNT4 (109390 upstream) : ANKRD31 (6948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	75216320	75216320	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75216320delC								POC5 (203007 upstream) : SV2C (162985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	77643717	77643717	+	IGR	DEL	T	-	-	rs5868916		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77643717delT								AP3B1 (53189 upstream) : SCAMP1 (12622 downstream)																																			---	---	---	---
ARSB	411	broad.mit.edu	37	5	78134679	78134679	+	Intron	DEL	C	-	-	rs71613988		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78134679delC	uc003kfq.2	-						ARSB_uc003kfr.3_Intron	NM_000046	NP_000037			arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	81765357	81765357	+	IGR	DEL	T	-	-	rs35664079		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81765357delT								ATP6AP1L (151211 upstream) : TMEM167A (583310 downstream)																																			---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83570612	83570613	+	Intron	INS	-	AC	AC	rs146634556	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83570612_83570613insAC	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	89741257	89741258	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89741257_89741258insT								CETN3 (35654 upstream) : MBLAC2 (12764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91765427	91765427	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91765427delT								None (None upstream) : FLJ42709 (979638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91904946	91904947	+	IGR	INS	-	A	A	rs138018534		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91904946_91904947insA								None (None upstream) : FLJ42709 (840118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	94691990	94691991	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94691990_94691991insT								MCTP1 (71711 upstream) : FAM81B (35057 downstream)																																			---	---	---	---
LIX1	167410	broad.mit.edu	37	5	96438434	96438434	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96438434delT	uc003kmy.3	-							NM_153234	NP_694966			limb expression 1											ovary(1)	1		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	97906631	97906632	+	IGR	INS	-	GAA	GAA	rs140022148	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97906631_97906632insGAA								None (None upstream) : RGMB (198367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	98478173	98478175	+	IGR	DEL	AAG	-	-	rs143564121		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98478173_98478175delAAG								CHD1 (215935 upstream) : None (None downstream)																																			---	---	---	---
FER	2241	broad.mit.edu	37	5	108383526	108383527	+	Intron	INS	-	AAG	AAG	rs144890182	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108383526_108383527insAAG	uc003kop.1	+						FER_uc011cvg.1_Intron	NM_005246	NP_005237			fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	111881491	111881491	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111881491delT								FLJ11235 (124818 upstream) : APC (161727 downstream)																																			---	---	---	---
APC	324	broad.mit.edu	37	5	112040544	112040544	+	5'Flank	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112040544delT	uc010jby.2	+						APC_uc011cvt.1_5'Flank	NM_001127511	NP_001120983			adenomatous polyposis coli						canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	114766731	114766731	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114766731delG								CCDC112 (134273 upstream) : FEM1C (89877 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	115008755	115008756	+	IGR	INS	-	GTGT	GTGT	rs142214775	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115008755_115008756insGTGT								TMED7-TICAM2 (46885 upstream) : CDO1 (131676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116094237	116094252	+	IGR	DEL	ATTCACACAGGTAGAG	-	-	rs6149196		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116094237_116094252delATTCACACAGGTAGAG								SEMA6A (183686 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	117711081	117711081	+	IGR	DEL	A	-	-	rs140652365		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117711081delA								None (None upstream) : DTWD2 (461490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	120965014	120965014	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120965014delA								PRR16 (942052 upstream) : FTMT (222636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	122346904	122346905	+	IGR	INS	-	A	A	rs145977285	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122346904_122346905insA								SNX24 (2003 upstream) : PPIC (12175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123299648	123299649	+	IGR	DEL	TA	-	-	rs139751717	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123299648_123299649delTA								CSNK1G3 (347186 upstream) : ZNF608 (672961 downstream)																																			---	---	---	---
MARCH3	115123	broad.mit.edu	37	5	126284439	126284439	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126284439delG	uc003kuf.2	-						MARCH3_uc011cxc.1_Intron	NM_178450	NP_848545			membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	131609680	131609680	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131609680delT	uc003kwm.3	-											Homo sapiens cDNA clone IMAGE:5207811.																														---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132929917	132929918	+	Intron	DEL	TG	-	-	rs55954526		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132929917_132929918delTG	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	135099478	135099479	+	IGR	INS	-	CA	CA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135099478_135099479insCA								LOC340074 (109854 upstream) : LOC153328 (70886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	136935010	136935011	+	IGR	INS	-	A	A	rs145492467	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136935010_136935011insA								SPOCK1 (99992 upstream) : KLHL3 (18179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	137944318	137944319	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137944318_137944319insT								HSPA9 (33203 upstream) : CTNNA1 (144788 downstream)																																			---	---	---	---
SIL1	64374	broad.mit.edu	37	5	138444596	138444596	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138444596delA	uc003ldm.2	-						SIL1_uc003ldn.2_Intron|SIL1_uc003ldo.2_Intron|SIL1_uc003ldp.2_Intron	NM_022464	NP_071909			SIL1 protein precursor						intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)											Marinesco-Sj_gren_syndrome				---	---	---	---
JAKMIP2	9832	broad.mit.edu	37	5	147108666	147108666	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147108666delG	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron	NM_014790	NP_055605			janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
ARHGEF37	389337	broad.mit.edu	37	5	149010744	149010744	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149010744delT	uc003lra.1	+							NM_001001669	NP_001001669			hypothetical protein LOC389337						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
PDE6A	5145	broad.mit.edu	37	5	149244976	149244976	+	Intron	DEL	A	-	-	rs34772790		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149244976delA	uc003lrg.3	-							NM_000440	NP_000431			phosphodiesterase 6A						cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
ADAM19	8728	broad.mit.edu	37	5	156845946	156845947	+	Intron	INS	-	CTCTCC	CTCTCC	rs139701401	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156845946_156845947insCTCTCC	uc003lww.1	-											SubName: Full=cDNA FLJ34145 fis, clone FCBBF3011867, highly similar to ADAM 19 (EC 3.4.24.-);						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
CLINT1	9685	broad.mit.edu	37	5	157236506	157236506	+	Intron	DEL	A	-	-	rs72318416		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157236506delA	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481			epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
TTC1	7265	broad.mit.edu	37	5	159448304	159448304	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159448304delT	uc003lxu.2	+							NM_003314	NP_003305			tetratricopeptide repeat domain 1						protein folding		unfolded protein binding			skin(1)	1	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	159881844	159881845	+	IGR	INS	-	A	A	rs143705318	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159881844_159881845insA								PTTG1 (26099 upstream) : MIR146A (30514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	159887308	159887309	+	IGR	DEL	AC	-	-	rs10582764		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159887308_159887309delAC								PTTG1 (31563 upstream) : MIR146A (25050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	162241997	162241998	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162241997_162241998delTC								GABRG2 (659453 upstream) : CCNG1 (622579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164657699	164657699	+	IGR	DEL	A	-	-	rs74723685		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164657699delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165692317	165692317	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165692317delT								None (None upstream) : None (None downstream)																																			---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169225328	169225330	+	Intron	DEL	ACA	-	-	rs138493543		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169225328_169225330delACA	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	170965746	170965747	+	IGR	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170965746_170965747delGT								FGF18 (81584 upstream) : FBXW11 (322809 downstream)																																			---	---	---	---
SH3PXD2B	285590	broad.mit.edu	37	5	171849003	171849004	+	Intron	INS	-	T	T	rs113159124		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171849003_171849004insT	uc003mbr.2	-						SH3PXD2B_uc003mbs.1_Intron	NM_001017995	NP_001017995			SH3 and PX domains 2B						adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
NEURL1B	54492	broad.mit.edu	37	5	172101143	172101143	+	Intron	DEL	A	-	-	rs112362262		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172101143delA	uc003mbt.2	+							NM_001142651	NP_001136123			neuralized homolog 1B								ligase activity|zinc ion binding				0																		---	---	---	---
ERGIC1	57222	broad.mit.edu	37	5	172359817	172359818	+	Intron	INS	-	A	A	rs139038154	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172359817_172359818insA	uc003mbw.3	+						ERGIC1_uc003mby.3_Intron|ERGIC1_uc011dfa.1_Intron|ERGIC1_uc003mca.3_5'Flank	NM_001031711	NP_001026881			endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)													OREG0017050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	5	173600625	173600628	+	IGR	DEL	ACAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173600625_173600628delACAC								HMP19 (64444 upstream) : MSX2 (550947 downstream)																																			---	---	---	---
CPLX2	10814	broad.mit.edu	37	5	175296246	175296246	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175296246delT	uc003mde.1	+						CPLX2_uc003mdf.1_5'Flank	NM_006650	NP_006641			complexin 2						mast cell degranulation|positive regulation of synaptic plasticity|vesicle docking involved in exocytosis	cytosol				ovary(1)	1	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
CDHR2	54825	broad.mit.edu	37	5	176019518	176019519	+	Intron	INS	-	GTG	GTG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176019518_176019519insGTG	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145			protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2																		---	---	---	---
UNC5A	90249	broad.mit.edu	37	5	176284537	176284538	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176284537_176284538delCA	uc003mey.2	+						UNC5A_uc003mex.1_Intron	NM_133369	NP_588610			netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
MXD3	83463	broad.mit.edu	37	5	176740566	176740566	+	5'Flank	DEL	C	-	-	rs139253546		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176740566delC	uc003mgb.2	-						MXD3_uc010jkk.2_5'Flank|MXD3_uc003mga.3_5'Flank|MXD3_uc003mgc.2_5'Flank	NM_031300	NP_112590			MAX dimerization protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	177279828	177279828	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177279828delA								FAM153A (69429 upstream) : LOC728554 (22434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	177316690	177316690	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177316690delT								LOC728554 (5423 upstream) : PROP1 (102546 downstream)																																			---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177836490	177836491	+	Intron	INS	-	GT	GT	rs143061971	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177836490_177836491insGT	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	178012438	178012439	+	Intron	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178012438_178012439insG	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
ADAMTS2	9509	broad.mit.edu	37	5	178683531	178683534	+	Intron	DEL	GAGA	-	-	rs67300413		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178683531_178683534delGAGA	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)														---	---	---	---
RASGEF1C	255426	broad.mit.edu	37	5	179622320	179622320	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179622320delC	uc003mlr.2	-							NM_175062	NP_778232			RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	367660	367661	+	IGR	DEL	AC	-	-	rs146534455		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:367660_367661delAC								DUSP22 (16307 upstream) : IRF4 (24091 downstream)																																			---	---	---	---
RIPK1	8737	broad.mit.edu	37	6	3110841	3110842	+	Intron	INS	-	T	T	rs34063767		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3110841_3110842insT	uc010jni.2	+						RIPK1_uc003muv.3_Intron|RIPK1_uc003muw.3_Intron|RIPK1_uc011dhs.1_Intron|RIPK1_uc003mux.2_Intron	NM_003804	NP_003795			receptor (TNFRSF)-interacting serine-threonine						activation of caspase activity|activation of JUN kinase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of necroptosis by extracellular signals|innate immune response|MyD88-independent toll-like receptor signaling pathway|positive regulation of anti-apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|protein autophosphorylation|regulation of ATP:ADP antiporter activity|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|death-inducing signaling complex|endosome membrane|mitochondrion|receptor complex	ATP binding|death domain binding|death receptor binding|protein serine/threonine kinase activity			large_intestine(3)|lung(1)|skin(1)	5	Ovarian(93;0.0386)	all_hematologic(90;0.0895)																---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3380193	3380194	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3380193_3380194delGT	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297			solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	3606705	3606706	+	IGR	INS	-	ACACACACAT	ACACACACAT	rs72508000		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3606705_3606706insACACACACAT								SLC22A23 (149912 upstream) : C6orf145 (116130 downstream)																																			---	---	---	---
NRN1	51299	broad.mit.edu	37	6	6008478	6008478	+	5'Flank	DEL	G	-	-	rs112235434		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6008478delG	uc003mwu.2	-							NM_016588	NP_057672			neuritin precursor							anchored to membrane|plasma membrane					0	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)														---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7207062	7207062	+	Intron	DEL	T	-	-	rs34228389		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7207062delT	uc003mxc.2	+						RREB1_uc010jnw.2_Intron|RREB1_uc003mxb.2_Intron|RREB1_uc010jnx.2_Intron|RREB1_uc003mxd.2_Intron	NM_001003698	NP_001003698			ras responsive element binding protein 1 isoform						multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	7435634	7435634	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7435634delT								RIOK1 (17366 upstream) : DSP (106236 downstream)																																			---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11342642	11342643	+	Intron	INS	-	A	A	rs147414502	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11342642_11342643insA	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	12521229	12521229	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12521229delT								EDN1 (223803 upstream) : PHACTR1 (195659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18366238	18366238	+	5'Flank	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18366238delT	uc011djh.1	+											DQ597117																														---	---	---	---
E2F3	1871	broad.mit.edu	37	6	20466917	20466917	+	Intron	DEL	T	-	-	rs35856468		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20466917delT	uc003nda.2	+						E2F3_uc003ncz.2_Intron	NM_001949	NP_001940			E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	21398951	21398951	+	IGR	DEL	G	-	-	rs36116767		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21398951delG								CDKAL1 (166319 upstream) : SOX4 (195021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23081041	23081041	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23081041delA								HDGFL1 (510292 upstream) : None (None downstream)																																			---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24947303	24947305	+	Intron	DEL	TTC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24947303_24947305delTTC	uc011dju.1	-							NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25731757	25731757	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25731757delT								HIST1H2BA (4185 upstream) : SLC17A4 (23170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26820615	26820615	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26820615delA								ZNF322A (160652 upstream) : GUSBL1 (18651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27674105	27674105	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27674105delT	uc003njk.2	+											Homo sapiens cDNA clone IMAGE:5262055.																														---	---	---	---
LTB	4050	broad.mit.edu	37	6	31551503	31551503	+	5'Flank	DEL	T	-	-	rs112437083		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31551503delT	uc003nuk.2	-						LTB_uc003nul.2_5'Flank|LST1_uc003num.2_5'Flank|LST1_uc003nun.2_5'Flank|LST1_uc003nuo.2_5'Flank|LST1_uc003nup.2_5'Flank|LST1_uc010jss.1_5'Flank	NM_002341	NP_002332			lymphotoxin-beta isoform a						cell-cell signaling|immune response|positive regulation of interleukin-12 biosynthetic process|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding				0					Infliximab(DB00065)|Simvastatin(DB00641)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	32450817	32450817	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32450817delA								HLA-DRA (37996 upstream) : HLA-DRB1 (34346 downstream)																																			---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32548143	32548144	+	Intron	DEL	TC	-	-	rs71540437		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32548143_32548144delTC	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron|HLA-DRB1_uc011dqc.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
HLA-DQA1	3117	broad.mit.edu	37	6	32605387	32605388	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32605387_32605388insT	uc003obr.2	+						HLA-DQA1_uc003obs.2_Intron|HLA-DQA1_uc003obt.1_Intron	NM_002122	NP_002113			major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33099641	33099642	+	IGR	DEL	CA	-	-	rs3130238		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33099641_33099642delCA								HLA-DPB1 (2751 upstream) : COL11A2 (30827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33298195	33298195	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33298195delT								DAXX (7402 upstream) : LYPLA2P1 (34320 downstream)																																			---	---	---	---
PACSIN1	29993	broad.mit.edu	37	6	34437302	34437302	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34437302delA	uc003ojo.2	+							NM_020804	NP_065855			protein kinase C and casein kinase substrate in						endocytosis		protein kinase activity				0																		---	---	---	---
FKBP5	2289	broad.mit.edu	37	6	35560641	35560641	+	Intron	DEL	C	-	-	rs35236464		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35560641delC	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_Intron	NM_001145776	NP_001139248			FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	36095068	36095070	+	IGR	DEL	TTA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36095068_36095070delTTA								MAPK14 (16056 upstream) : MAPK13 (3192 downstream)																																			---	---	---	---
C6orf222	389384	broad.mit.edu	37	6	36306170	36306171	+	5'Flank	INS	-	AAAG	AAAG	rs149650645	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36306170_36306171insAAAG	uc003oly.2	-							NM_001010903	NP_001010903			hypothetical protein LOC389384											skin(2)|ovary(1)|breast(1)	4																		---	---	---	---
STK38	11329	broad.mit.edu	37	6	36461975	36461975	+	3'UTR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36461975delT	uc003omg.2	-	13					STK38_uc003omh.2_3'UTR|STK38_uc003omi.2_3'UTR	NM_007271	NP_009202			serine/threonine kinase 38						intracellular protein kinase cascade|negative regulation of MAP kinase activity	cytoplasm|MLL5-L complex	ATP binding|magnesium ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	41371944	41371944	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41371944delT								NCR2 (53319 upstream) : FOXP4 (142220 downstream)																																			---	---	---	---
RSPH9	221421	broad.mit.edu	37	6	43614706	43614706	+	Intron	DEL	A	-	-	rs112627830		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43614706delA	uc003ovw.1	+						RSPH9_uc003ovx.1_Intron	NM_152732	NP_689945			radial spoke head 9 homolog						cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton				upper_aerodigestive_tract(1)|skin(1)	2														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	6	43734426	43734427	+	IGR	INS	-	GA	GA	rs147696863	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43734426_43734427insGA								MRPS18A (78898 upstream) : VEGFA (3526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43926380	43926383	+	IGR	DEL	GAGA	-	-	rs142828202	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43926380_43926383delGAGA								LOC100132354 (20437 upstream) : C6orf223 (41956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43950093	43950094	+	IGR	INS	-	T	T	rs147012637	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43950093_43950094insT								LOC100132354 (44150 upstream) : C6orf223 (18245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	44012242	44012243	+	Intron	INS	-	AT	AT	rs113326564		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44012242_44012243insAT	uc003owm.1	-											Homo sapiens cDNA: FLJ21083 fis, clone CAS03150.																														---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45444083	45444084	+	Intron	INS	-	A	A	rs138174805	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45444083_45444084insA	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron|RUNX2_uc003oxt.2_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51923567	51923570	+	Intron	DEL	CTCT	-	-	rs144129939	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51923567_51923570delCTCT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
LRRC1	55227	broad.mit.edu	37	6	53768363	53768375	+	Intron	DEL	CTTTTCCTTTTCG	-	-	rs56737135		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53768363_53768375delCTTTTCCTTTTCG	uc003pcd.1	+							NM_018214	NP_060684			leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---
FAM83B	222584	broad.mit.edu	37	6	54756140	54756141	+	Intron	INS	-	T	T	rs139358205	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54756140_54756141insT	uc003pck.2	+							NM_001010872	NP_001010872			hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)																	---	---	---	---
BEND6	221336	broad.mit.edu	37	6	56830783	56830783	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56830783delA	uc010kab.2	+						BEND6_uc003pdg.2_Intron	NM_152731	NP_689944			BEN domain containing 6												0																		---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57225332	57225334	+	Intron	DEL	TAA	-	-	rs139089707		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57225332_57225334delTAA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57261078	57261079	+	Intron	INS	-	CTGT	CTGT	rs147489906	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57261078_57261079insCTGT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57315620	57315621	+	Intron	INS	-	TACTT	TACTT	rs148186678	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57315620_57315621insTACTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57323955	57323956	+	Intron	INS	-	T	T	rs150464138		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57323955_57323956insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57368655	57368657	+	Intron	DEL	AAA	-	-	rs77419103		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57368655_57368657delAAA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57444073	57444073	+	Intron	DEL	A	-	-	rs33922243		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57444073delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57487931	57487931	+	Intron	DEL	T	-	-	rs74294531		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57487931delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57558058	57558058	+	IGR	DEL	T	-	-	rs74318708		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57558058delT								PRIM2 (44683 upstream) : GUSBL2 (688101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57564465	57564466	+	IGR	INS	-	AT	AT	rs139957360		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564465_57564466insAT								PRIM2 (51090 upstream) : GUSBL2 (681693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57565371	57565372	+	IGR	INS	-	CTA	CTA	rs149489760		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57565371_57565372insCTA								PRIM2 (51996 upstream) : GUSBL2 (680787 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	66153027	66153028	+	Intron	INS	-	AC	AC	rs142063050	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66153027_66153028insAC	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66167031	66167032	+	Intron	INS	-	TTG	TTG	rs148009394	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66167031_66167032insTTG	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	67725292	67725295	+	IGR	DEL	TCTC	-	-	rs138977746		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67725292_67725295delTCTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	70519795	70519796	+	IGR	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70519795_70519796delGA								LMBRD1 (12907 upstream) : COL19A1 (56652 downstream)																																			---	---	---	---
COL19A1	1310	broad.mit.edu	37	6	70648714	70648714	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70648714delA	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849			alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4																		---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	70987047	70987047	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70987047delA	uc003pfg.3	-						COL9A1_uc003pfe.3_Intron|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842			alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	79996470	79996470	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79996470delA								HMGN3 (52015 upstream) : LCA5 (198239 downstream)																																			---	---	---	---
BCKDHB	594	broad.mit.edu	37	6	80995238	80995239	+	Intron	DEL	TT	-	-	rs72564121		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80995238_80995239delTT	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047			branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)														---	---	---	---
BCKDHB	594	broad.mit.edu	37	6	81053717	81053719	+	Intron	DEL	TTG	-	-	rs142572622		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81053717_81053719delTTG	uc003pjd.2	+						BCKDHB_uc003pje.2_3'UTR	NM_000056	NP_000047			branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	81585234	81585234	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81585234delT								BCKDHB (529247 upstream) : FAM46A (870214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81971410	81971412	+	IGR	DEL	AGG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81971410_81971412delAGG								BCKDHB (915423 upstream) : FAM46A (484036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89109559	89109560	+	IGR	DEL	CT	-	-	rs71789321		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89109559_89109560delCT								CNR1 (233792 upstream) : RNGTT (210429 downstream)																																			---	---	---	---
BACH2	60468	broad.mit.edu	37	6	90862413	90862413	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90862413delT	uc011eab.1	-						BACH2_uc003pnw.2_Intron|BACH2_uc010kch.2_Intron	NM_021813	NP_068585			BTB and CNC homology 1, basic leucine zipper							nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92277554	92277555	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92277554_92277555delTC								MAP3K7 (980647 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93769924	93769931	+	IGR	DEL	CTTTGATC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93769924_93769931delCTTTGATC								None (None upstream) : EPHA7 (179811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96177510	96177511	+	IGR	INS	-	TAAAA	TAAAA	rs139673778	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96177510_96177511insTAAAA								MANEA (120184 upstream) : FUT9 (286334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96187159	96187159	+	IGR	DEL	A	-	-	rs142367215		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96187159delA								MANEA (129833 upstream) : FUT9 (276686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	101835480	101835481	+	IGR	INS	-	A	A	rs140922700	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101835480_101835481insA								ASCC3 (506256 upstream) : GRIK2 (11424 downstream)																																			---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102086433	102086433	+	Intron	DEL	A	-	-	rs10716146		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102086433delA	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102369971	102369972	+	Intron	INS	-	TCCAT	TCCAT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102369971_102369972insTCCAT	uc003pqp.3	+						GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	106372531	106372532	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106372531_106372532insT								PREP (521562 upstream) : PRDM1 (161663 downstream)																																			---	---	---	---
CDK19	23097	broad.mit.edu	37	6	111046758	111046759	+	Intron	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111046758_111046759delAG	uc003puh.1	-						CDK19_uc003pui.1_Intron	NM_015076	NP_055891			cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	115325859	115325859	+	IGR	DEL	T	-	-	rs5879290		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115325859delT								HS3ST5 (662319 upstream) : FRK (936834 downstream)																																			---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124752340	124752340	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124752340delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128396521	128396522	+	Intron	DEL	CT	-	-	rs147992361		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128396521_128396522delCT	uc003qbk.2	-						PTPRK_uc003qbj.2_Intron|PTPRK_uc010kfc.2_Intron|PTPRK_uc011ebu.1_Intron|PTPRK_uc003qbl.1_Intron|PTPRK_uc011ebv.1_Intron	NM_002844	NP_002835			protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
SGK1	6446	broad.mit.edu	37	6	134526567	134526567	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134526567delA	uc003qeo.3	-							NM_001143676	NP_001137148			serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)														---	---	---	---
NHEG1	100294720	broad.mit.edu	37	6	137307915	137307915	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137307915delG	uc003qhg.3	-						NHEG1_uc003qhh.3_Intron	NR_027994				Homo sapiens cDNA clone IMAGE:4897409.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	137428490	137428491	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137428490_137428491delTC								IL20RA (62192 upstream) : IL22RA2 (36467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	141837554	141837555	+	IGR	INS	-	C	C	rs142145216	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141837554_141837555insC								None (None upstream) : NMBR (559191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142561564	142561565	+	IGR	INS	-	AT	AT	rs139422299	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142561564_142561565insAT								VTA1 (19481 upstream) : GPR126 (61491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145439183	145439183	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145439183delC								UTRN (265015 upstream) : EPM2A (507263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	146775433	146775433	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146775433delT								GRM1 (16702 upstream) : RAB32 (89395 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149274908	149274908	+	Intron	DEL	A	-	-	rs147617058		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149274908delA	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	150847932	150847932	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150847932delC								IYD (122168 upstream) : PLEKHG1 (73067 downstream)																																			---	---	---	---
PLEKHG1	57480	broad.mit.edu	37	6	150947966	150947967	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150947966_150947967delGT	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron	NM_001029884	NP_001025055			pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)														---	---	---	---
PLEKHG1	57480	broad.mit.edu	37	6	151087448	151087450	+	Intron	DEL	AGC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151087448_151087450delAGC	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron|PLEKHG1_uc011eem.1_Intron|PLEKHG1_uc003qnz.2_Intron	NM_001029884	NP_001025055			pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152713397	152713398	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152713397_152713398insA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153133030	153133031	+	IGR	INS	-	TTCT	TTCT	rs144267325	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153133030_153133031insTTCT								VIP (52132 upstream) : FBXO5 (158629 downstream)																																			---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154643508	154643509	+	Intron	DEL	AC	-	-	rs72008332		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154643508_154643509delAC	uc003qpx.2	-						IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155226438	155226439	+	Intron	INS	-	TTG	TTG	rs140700279	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155226438_155226439insTTG	uc003qqb.2	+						uc003qqc.1_Intron	NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
RSPH3	83861	broad.mit.edu	37	6	159406097	159406097	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159406097delA	uc003qrx.2	-						RSPH3_uc010kju.2_Intron|RSPH3_uc003qry.1_Intron	NM_031924	NP_114130			radial spoke 3 homolog											ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)														---	---	---	---
QKI	9444	broad.mit.edu	37	6	163840336	163840337	+	Intron	INS	-	T	T	rs67965569		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163840336_163840337insT	uc003qui.2	+						QKI_uc003que.2_Intron|QKI_uc003quf.2_Intron|QKI_uc003qug.2_Intron|QKI_uc003quh.2_Intron|QKI_uc003quj.2_Intron	NM_006775	NP_006766			quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	165268367	165268367	+	IGR	DEL	A	-	-	rs71659934		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165268367delA								None (None upstream) : C6orf118 (424788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166162952	166162954	+	IGR	DEL	CAA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166162952_166162954delCAA								PDE10A (87368 upstream) : C6orf176 (174582 downstream)																																			---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166995598	166995598	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166995598delG	uc003qvb.1	-						RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168058879	168058879	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168058879delT								TCP10 (260881 upstream) : C6orf123 (126342 downstream)																																			---	---	---	---
FAM20C	56975	broad.mit.edu	37	7	291486	291486	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:291486delA	uc003sip.2	+						FAM20C_uc011jvn.1_Intron	NM_020223	NP_064608			family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)														---	---	---	---
C7orf50	84310	broad.mit.edu	37	7	1103736	1103739	+	Intron	DEL	ACAT	-	-	rs139206181		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1103736_1103739delACAT	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726			hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1662307	1662307	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1662307delG								TFAMP1 (5980 upstream) : ELFN1 (86491 downstream)																																			---	---	---	---
USP42	84132	broad.mit.edu	37	7	6151235	6151235	+	Intron	DEL	T	-	-	rs67530758		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6151235delT	uc011jwo.1	+						USP42_uc011jwn.1_Intron|USP42_uc010kth.1_Intron|USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Intron	NM_032172	NP_115548			ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)														---	---	---	---
TMEM106B	54664	broad.mit.edu	37	7	12258399	12258400	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12258399_12258400delAC	uc011jxk.1	+						TMEM106B_uc003ssh.2_Intron	NM_018374	NP_060844			transmembrane protein 106B							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)														---	---	---	---
VWDE	221806	broad.mit.edu	37	7	12390302	12390303	+	Intron	INS	-	TC	TC	rs145525252	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12390302_12390303insTC	uc003ssj.2	-						VWDE_uc011jxl.1_Intron|VWDE_uc011jxm.1_Intron	NM_001135924	NP_001129396			von Willebrand factor D and EGF domains							extracellular region					0																		---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14278218	14278219	+	Intron	INS	-	TT	TT	rs146452523	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14278218_14278219insTT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
TMEM195	392636	broad.mit.edu	37	7	15414230	15414231	+	Intron	INS	-	AT	AT	rs143644925	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15414230_15414231insAT	uc003stb.1	-							NM_001004320	NP_001004320			transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	20624573	20624574	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20624573_20624574delAC								ITGB8 (169195 upstream) : ABCB5 (30671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	21069709	21069710	+	IGR	DEL	GT	-	-	rs146940737		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21069709_21069710delGT								RPL23P8 (202270 upstream) : SP4 (397979 downstream)																																			---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21713678	21713681	+	Intron	DEL	GTGA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21713678_21713681delGTGA	uc003svc.2	+							NM_003777	NP_003768			dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
DFNA5	1687	broad.mit.edu	37	7	24758439	24758440	+	Intron	DEL	TA	-	-	rs137893101		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24758439_24758440delTA	uc010kus.1	-						DFNA5_uc003swz.2_Intron|DFNA5_uc003sxa.1_Intron|DFNA5_uc010kut.1_Intron|DFNA5_uc003sxb.2_Intron	NM_001127453	NP_001120925			deafness, autosomal dominant 5 protein isoform						sensory perception of sound					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25962132	25962133	+	IGR	DEL	GG	-	-	rs137938234		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25962132_25962133delGG								NPVF (694027 upstream) : MIR148A (27406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26119170	26119170	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26119170delG								MIR148A (129564 upstream) : NFE2L3 (72677 downstream)																																			---	---	---	---
SNX10	29887	broad.mit.edu	37	7	26399288	26399289	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26399288_26399289insT	uc003sxx.2	+						SNX10_uc011jzg.1_Intron|SNX10_uc010kuu.2_Intron|SNX10_uc010kuv.2_5'Flank	NM_013322	NP_037454			sorting nexin 10						cell communication|endosome organization|protein transport	extrinsic to endosome membrane	1-phosphatidylinositol binding				0																		---	---	---	---
JAZF1	221895	broad.mit.edu	37	7	28034091	28034091	+	Intron	DEL	C	-	-	rs112453620		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28034091delC	uc003szn.2	-						JAZF1_uc003szm.2_5'Flank	NM_175061	NP_778231			JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131								T	SUZ12	endometrial stromal tumours								---	---	---	---
JAZF1	221895	broad.mit.edu	37	7	28170933	28170933	+	Intron	DEL	A	-	-	rs35200756		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28170933delA	uc003szn.2	-							NM_175061	NP_778231			JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131								T	SUZ12	endometrial stromal tumours								---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28637098	28637098	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28637098delT	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	31996931	31996931	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31996931delA	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	32498793	32498794	+	IGR	INS	-	T	T	rs142518928	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32498793_32498794insT								PDE1C (159852 upstream) : LSM5 (26151 downstream)																																			---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39103374	39103374	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39103374delA	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183			POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40736665	40736666	+	Intron	INS	-	CA	CA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40736665_40736666insCA	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41162906	41162906	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41162906delT								C7orf10 (262549 upstream) : INHBA (565697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	43850903	43850903	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43850903delT								BLVRA (3967 upstream) : MRPS24 (55254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44931595	44931595	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44931595delG								PURB (6635 upstream) : MYO1G (70665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45478358	45478359	+	IGR	INS	-	AGC	AGC	rs144841463	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45478358_45478359insAGC								RAMP3 (254511 upstream) : ADCY1 (135380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	50322030	50322030	+	IGR	DEL	T	-	-	rs72216901		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50322030delT								C7orf72 (122672 upstream) : IKZF1 (22348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53337811	53337811	+	IGR	DEL	G	-	-	rs146918334	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53337811delG								POM121L12 (233194 upstream) : HPVC1 (931106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56557408	56557409	+	IGR	INS	-	G	G	rs146847538	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56557408_56557409insG								PSPH (373318 upstream) : DKFZp434L192 (6507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57548720	57548722	+	IGR	DEL	ATC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57548720_57548722delATC								ZNF716 (15455 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57624568	57624569	+	IGR	INS	-	T	T	rs145893548		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57624568_57624569insT								ZNF716 (91303 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57989291	57989291	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57989291delA								ZNF716 (456026 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61066693	61066693	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61066693delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61526871	61526871	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61526871delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61761545	61761545	+	IGR	DEL	T	-	-	rs113286717		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61761545delT								None (None upstream) : LOC643955 (990127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61991142	61991143	+	IGR	INS	-	TGA	TGA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61991142_61991143insTGA								None (None upstream) : LOC643955 (760529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62964754	62964754	+	IGR	DEL	T	-	-	rs75520005		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62964754delT								LOC100287704 (152603 upstream) : ZNF727 (541067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63465800	63465804	+	IGR	DEL	TCTTT	-	-	rs71836131		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63465800_63465804delTCTTT								LOC100287704 (653649 upstream) : ZNF727 (40017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63555031	63555032	+	IGR	DEL	AC	-	-	rs112965813		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63555031_63555032delAC								ZNF727 (16106 upstream) : ZNF735 (112549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64234047	64234047	+	IGR	DEL	A	-	-	rs78782542		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64234047delA								ZNF107 (62648 upstream) : ZNF138 (20724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67830044	67830044	+	IGR	DEL	G	-	-	rs34892882		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67830044delG								None (None upstream) : None (None downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69822973	69822974	+	Intron	INS	-	T	T	rs145320631	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69822973_69822974insT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70141134	70141136	+	Intron	DEL	AAT	-	-	rs73180204	byFrequency;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70141134_70141136delAAT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71326164	71326165	+	Intron	DEL	GT	-	-	rs151168512		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71326164_71326165delGT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
TYW1B	441250	broad.mit.edu	37	7	72068715	72068716	+	Intron	INS	-	A	A	rs138443846	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72068715_72068716insA	uc011kej.1	-						TYW1B_uc011keh.1_Intron|TYW1B_uc011kei.1_Intron	NM_001145440	NP_001138912			tRNA-yW synthesizing protein 1 homolog B isoform						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78269941	78269942	+	Intron	DEL	AT	-	-	rs34309425		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78269941_78269942delAT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	81538567	81538567	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81538567delT								HGF (139115 upstream) : CACNA2D1 (40851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84169397	84169398	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84169397_84169398delAC	uc003uia.1	+											Homo sapiens mRNA; cDNA DKFZp686F03118 (from clone DKFZp686F03118).																														---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88853629	88853629	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88853629delT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	88983733	88983734	+	IGR	DEL	CA	-	-	rs111877237		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88983733_88983734delCA								ZNF804B (17389 upstream) : DPY19L2P4 (764980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91048572	91048595	+	IGR	DEL	AAACTTTTCGAAGTGCTAATGAAT	-	-	rs72159527		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91048572_91048595delAAACTTTTCGAAGTGCTAATGAAT								FZD1 (150441 upstream) : MTERF (382865 downstream)																																			---	---	---	---
GNGT1	2792	broad.mit.edu	37	7	93401314	93401315	+	Intron	INS	-	A	A	rs112796572		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93401314_93401315insA	uc003umx.1	+											Homo sapiens guanine nucleotide binding protein gamma 1 (GNG1) mRNA, complete cds.						G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
SHFM1	7979	broad.mit.edu	37	7	96333285	96333286	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96333285_96333286delAC	uc003uoi.2	-						SHFM1_uc010lfn.1_Intron	NM_006304	NP_006295			split hand/foot malformation type 1						proteolysis	proteasome complex	peptidase activity|protein binding				0	all_cancers(62;4.24e-09)|all_epithelial(64;5.59e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0353)|Lung NSC(181;0.0987)												Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
DLX5	1749	broad.mit.edu	37	7	96652650	96652651	+	Intron	DEL	GT	-	-	rs150476513		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96652650_96652651delGT	uc003uon.2	-						DLX5_uc011kim.1_Intron	NM_005221	NP_005212			distal-less homeobox 5						cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)																	---	---	---	---
RASA4	10156	broad.mit.edu	37	7	102232285	102232285	+	Intron	DEL	T	-	-	rs144691366		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102232285delT	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc011kla.1_Intron|RASA4_uc010lig.2_Intron|RASA4_uc003vaf.2_Intron|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_Intron|RASA4_uc011kld.1_Intron|uc003vag.1_5'Flank|RASA4_uc011kkz.1_Intron|RASA4_uc003vad.2_Intron|RASA4_uc011klc.1_Intron|uc010lii.1_5'Flank	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	103730429	103730429	+	IGR	DEL	A	-	-	rs35542904		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103730429delA								RELN (100466 upstream) : ORC5L (36361 downstream)																																			---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105297024	105297024	+	Intron	DEL	T	-	-	rs72031738		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105297024delT	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	106494378	106494378	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106494378delG								FLJ36031 (192787 upstream) : PIK3CG (11345 downstream)																																			---	---	---	---
NRCAM	4897	broad.mit.edu	37	7	107905785	107905785	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107905785delG	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209			neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5																		---	---	---	---
IFRD1	3475	broad.mit.edu	37	7	112113100	112113123	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTGTGTA	-	-	rs141635606	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112113100_112113123delTGTGTGTGTGTGTGTGTGTGTGTA	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron|IFRD1_uc003vgj.2_Intron|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Intron|IFRD1_uc003vgk.2_Intron	NM_001007245	NP_001007246			interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2																		---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	114330185	114330186	+	3'UTR	DEL	TT	-	-	rs143759073		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114330185_114330186delTT	uc003vhb.2	+	17					FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_3'UTR|FOXP2_uc003vha.2_3'UTR|FOXP2_uc011kmu.1_3'UTR|FOXP2_uc011kmv.1_3'UTR|FOXP2_uc010ljz.1_3'UTR	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	116580880	116580880	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116580880delA								CAPZA2 (21568 upstream) : ST7OT1 (11623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121422580	121422593	+	IGR	DEL	CCAAACCTACATTG	-	-	rs6150325		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121422580_121422593delCCAAACCTACATTG								FAM3C (386158 upstream) : PTPRZ1 (90566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124064643	124064644	+	IGR	INS	-	A	A	rs147053638	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124064643_124064644insA								TMEM229A (391120 upstream) : GPR37 (321472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125632502	125632503	+	IGR	INS	-	T	T	rs143620247	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125632502_125632503insT								None (None upstream) : GRM8 (446149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127987212	127987212	+	IGR	DEL	G	-	-	rs150678938		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127987212delG								RBM28 (3250 upstream) : PRRT4 (3168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	130010174	130010175	+	5'Flank	INS	-	T	T	rs111517155		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130010174_130010175insT	uc003vpv.1	-											Homo sapiens cDNA FLJ40591 fis, clone THYMU2010161.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	132817057	132817057	+	IGR	DEL	T	-	-	rs113980820		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132817057delT								CHCHD3 (50229 upstream) : EXOC4 (120766 downstream)																																			---	---	---	---
CNOT4	4850	broad.mit.edu	37	7	135197555	135197556	+	5'Flank	INS	-	CAAAA	CAAAA	rs141135433	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135197555_135197556insCAAAA	uc003vsv.1	-						CNOT4_uc003vss.2_5'Flank|CNOT4_uc011kpz.1_5'Flank|CNOT4_uc003vst.2_5'Flank|CNOT4_uc003vsu.1_5'Flank	NM_001008225	NP_001008226			CCR4-NOT transcription complex, subunit 4						nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139812859	139812859	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139812859delA	uc003vvm.2	-						JHDM1D_uc010lng.2_Intron	NM_030647	NP_085150			jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	142223659	142223659	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142223659delA	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	145793794	145793795	+	IGR	DEL	CA	-	-	rs113771331		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145793794_145793795delCA								None (None upstream) : CNTNAP2 (19658 downstream)																																			---	---	---	---
CUL1	8454	broad.mit.edu	37	7	148494795	148494795	+	Intron	DEL	T	-	-	rs72007939		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148494795delT	uc010lpg.2	+						CUL1_uc003wey.2_Intron|CUL1_uc003wez.2_Intron|CUL1_uc003wfa.2_Intron	NM_003592	NP_003583			cullin 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	149208090	149208090	+	IGR	DEL	A	-	-	rs111440742		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149208090delA								ZNF746 (13192 upstream) : ZNF767 (36155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	150341639	150341647	+	IGR	DEL	CTCCTCCTC	-	-	rs7791866		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150341639_150341647delCTCCTCCTC								GIMAP6 (11959 upstream) : GIMAP2 (41147 downstream)																																			---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152076861	152076862	+	Intron	INS	-	AAAGT	AAAGT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152076861_152076862insAAAGT	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152103887	152103890	+	Intron	DEL	AAAG	-	-	rs10533742		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152103887_152103890delAAAG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152106492	152106495	+	Intron	DEL	AAGA	-	-	rs76883025		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152106492_152106495delAAGA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153784450	153784450	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153784450delG	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158460964	158460965	+	Intron	INS	-	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158460964_158460965insC	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_5'Flank	NM_017760	NP_060230			leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	252688	252688	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:252688delA								ZNF596 (55356 upstream) : FBXO25 (104120 downstream)																																			---	---	---	---
ERICH1	157697	broad.mit.edu	37	8	676896	676897	+	Intron	INS	-	CAAG	CAAG	rs149696270	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:676896_676897insCAAG	uc003wph.2	-						ERICH1_uc011kwh.1_Intron|ERICH1_uc003wpe.1_Intron	NM_207332	NP_997215			glutamate-rich 1											large_intestine(2)	2		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2271344	2271345	+	IGR	INS	-	G	G	rs139341315		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2271344_2271345insG								MYOM2 (177965 upstream) : CSMD1 (521531 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4847891	4847892	+	Intron	INS	-	TT	TT	rs10625552		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4847891_4847892insTT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5876599	5876600	+	IGR	DEL	AA	-	-	rs34369173		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5876599_5876600delAA								None (None upstream) : MCPH1 (387521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9729215	9729215	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9729215delA								TNKS (89360 upstream) : LOC157627 (28359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11519012	11519019	+	IGR	DEL	CGTGTGTG	-	-	rs61609603		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11519012_11519019delCGTGTGTG								BLK (96905 upstream) : GATA4 (15449 downstream)																																			---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11685404	11685405	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11685404_11685405insA	uc003wui.2	+						FDFT1_uc003wuh.2_Intron|FDFT1_uc010lsa.1_Intron|FDFT1_uc011kxe.1_Intron|FDFT1_uc011kxf.1_Intron|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Intron|FDFT1_uc010lsb.2_Intron|FDFT1_uc011kxh.1_Intron|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Intron|FDFT1_uc003wuk.2_Intron|FDFT1_uc011kxk.1_Intron	NM_004462	NP_004453			squalene synthase						cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12379711	12379711	+	Intron	DEL	G	-	-	rs116324233	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12379711delG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12419282	12419283	+	Intron	DEL	AG	-	-	rs79450543		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12419282_12419283delAG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12460563	12460563	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12460563delC	uc003wvy.3	-						uc003wwc.3_Intron					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13140803	13140804	+	Intron	DEL	AC	-	-	rs58438325		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13140803_13140804delAC	uc003wwm.2	-						DLC1_uc003wwn.2_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15512933	15512933	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15512933delG	uc003wwt.2	+						TUSC3_uc003wwr.2_Intron|TUSC3_uc003wws.2_Intron|TUSC3_uc003wwu.2_Intron|TUSC3_uc003wwv.2_Intron|TUSC3_uc003www.2_Intron|TUSC3_uc003wwx.2_Intron|TUSC3_uc003wwy.2_Intron	NM_006765	NP_006756			tumor suppressor candidate 3 isoform a						cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16982638	16982639	+	IGR	INS	-	TATAGCCTGTAA	TATAGCCTGTAA	rs143443646	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16982638_16982639insTATAGCCTGTAA								EFHA2 (2490 upstream) : ZDHHC2 (31197 downstream)																																			---	---	---	---
SH2D4A	63898	broad.mit.edu	37	8	19236585	19236586	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19236585_19236586insA	uc003wzb.2	+						SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Intron	NM_022071	NP_071354			SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	20910210	20910213	+	IGR	DEL	TGTG	-	-	rs10539520		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20910210_20910213delTGTG								LZTS1 (797407 upstream) : GFRA2 (639317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	23342959	23342964	+	IGR	DEL	GTGTGT	-	-	rs13257250	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23342959_23342964delGTGTGT								ENTPD4 (27715 upstream) : SLC25A37 (43399 downstream)																																			---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	26061308	26061309	+	Intron	INS	-	AGA	AGA	rs143623104	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26061308_26061309insAGA	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27930696	27930696	+	Intron	DEL	T	-	-	rs149796845		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27930696delT	uc003xgm.3	-							NM_001010906	NP_001010906			speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)												OREG0018676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PNOC	5368	broad.mit.edu	37	8	28197119	28197120	+	3'UTR	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28197119_28197120delCA	uc010lva.2	+	3					PNOC_uc003xgp.2_Intron|PNOC_uc011lau.1_3'UTR	NM_006228	NP_006219			prepronociceptin precursor						neuropeptide signaling pathway|sensory perception|synaptic transmission	extracellular region	neuropeptide hormone activity|opioid peptide activity			central_nervous_system(1)	1		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)														---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	29007658	29007659	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29007658_29007659delAC	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron	NM_015254	NP_056069			kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	31491866	31491873	+	IGR	DEL	ACACACAC	-	-	rs71914544		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31491866_31491873delACACACAC								WRN (460590 upstream) : NRG1 (5395 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32397766	32397766	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32397766delA	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	37572947	37572950	+	5'Flank	DEL	AGAA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37572947_37572950delAGAA	uc003xka.1	+											Homo sapiens cDNA clone IMAGE:4827062.																														---	---	---	---
LETM2	137994	broad.mit.edu	37	8	38265165	38265166	+	Intron	INS	-	A	A	rs3215418		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38265165_38265166insA	uc003xlm.1	+						LETM2_uc003xll.1_Intron|LETM2_uc003xln.1_Intron|LETM2_uc003xlo.1_Intron	NM_144652	NP_653253			leucine zipper-EF-hand containing transmembrane							integral to membrane|mitochondrial inner membrane					0	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)															---	---	---	---
ADAM2	2515	broad.mit.edu	37	8	39611331	39611332	+	Intron	INS	-	AC	AC	rs147326576	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39611331_39611332insAC	uc003xnj.2	-						ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455			ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	42238323	42238326	+	IGR	DEL	AAGG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42238323_42238326delAAGG								DKK4 (3649 upstream) : VDAC3 (11020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47415816	47415816	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47415816delA								None (None upstream) : BEYLA (336692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	48144963	48144963	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48144963delA								BEYLA (377556 upstream) : KIAA0146 (28579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49494868	49494868	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49494868delC								UBE2V2 (520416 upstream) : EFCAB1 (128483 downstream)																																			---	---	---	---
ST18	9705	broad.mit.edu	37	8	53297346	53297347	+	Intron	INS	-	GT	GT	rs147007096	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53297346_53297347insGT	uc003xra.2	-						ST18_uc003xrb.2_Intron|ST18_uc010lyb.2_Intron	NM_014682	NP_055497			suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)																---	---	---	---
LYN	4067	broad.mit.edu	37	8	56852022	56852023	+	Intron	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56852022_56852023delAG	uc003xsk.3	+						LYN_uc003xsl.3_Intron	NM_002350	NP_002341			Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	57438918	57438919	+	Intron	INS	-	TAG	TAG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57438918_57438919insTAG	uc003xtb.1	+						uc003xtc.1_Intron					Homo sapiens cDNA FLJ34244 fis, clone FCBBF3028794.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	58157335	58157335	+	IGR	DEL	A	-	-	rs112011163		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58157335delA								IMPAD1 (250908 upstream) : C8orf71 (34767 downstream)																																			---	---	---	---
NSMAF	8439	broad.mit.edu	37	8	59507282	59507282	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59507282delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron	NM_003580	NP_003571			neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)																---	---	---	---
TOX	9760	broad.mit.edu	37	8	59793968	59793969	+	Intron	INS	-	G	G	rs142566353	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59793968_59793969insG	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	60532805	60532806	+	IGR	INS	-	T	T	rs138483235	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60532805_60532806insT								TOX (501038 upstream) : CA8 (568617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65124695	65124696	+	IGR	DEL	GA	-	-	rs151049593		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65124695_65124696delGA								YTHDF3 (999350 upstream) : MIR124-2 (167010 downstream)																																			---	---	---	---
CYP7B1	9420	broad.mit.edu	37	8	65586464	65586464	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65586464delA	uc003xvj.2	-							NM_004820	NP_004811			cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	66194390	66194391	+	IGR	DEL	AC	-	-	rs34058018		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66194390_66194391delAC								CYP7B1 (483042 upstream) : ARMC1 (320681 downstream)																																			---	---	---	---
ARMC1	55156	broad.mit.edu	37	8	66539812	66539822	+	Intron	DEL	AGTTTGAGAAA	-	-	rs35778954		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66539812_66539822delAGTTTGAGAAA	uc003xvl.2	-						ARMC1_uc011leo.1_Intron	NM_018120	NP_060590			armadillo repeat-containing protein						metal ion transport		metal ion binding			skin(1)	1			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)															---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68169783	68169784	+	Intron	INS	-	GTCTAAT	GTCTAAT	rs140469764	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68169783_68169784insGTCTAAT	uc003xxo.1	-						ARFGEF1_uc003xxl.1_Intron	NM_006421	NP_006412			brefeldin A-inhibited guanine						exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	73154152	73154152	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73154152delT	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	73271433	73271433	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73271433delT	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																														---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74628158	74628158	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74628158delT	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Intron|STAU2_uc003xzr.2_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	74852890	74852890	+	IGR	DEL	T	-	-	rs71561553		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74852890delT								UBE2W (61780 upstream) : TCEB1 (5744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75424381	75424381	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75424381delA								GDAP1 (145048 upstream) : MIR2052 (193547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78406404	78406407	+	IGR	DEL	TCCC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78406404_78406407delTCCC								PEX2 (493880 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83158590	83158591	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83158590_83158591delTG								SNX16 (404069 upstream) : None (None downstream)																																			---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87550195	87550196	+	Intron	DEL	TC	-	-	rs72165946		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87550195_87550196delTC	uc003ydv.2	+							NM_003909	NP_003900			copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92236963	92236963	+	Intron	DEL	G	-	-	rs79670058		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92236963delG	uc003yex.2	+						SLC26A7_uc003yey.2_Intron	NM_052832	NP_439897			solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	96482574	96482577	+	IGR	DEL	TTTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96482574_96482577delTTTG								C8orf37 (201137 upstream) : GDF6 (671983 downstream)																																			---	---	---	---
PGCP	10404	broad.mit.edu	37	8	97825127	97825127	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97825127delA	uc003yhw.2	+						PGCP_uc010mbe.2_Intron	NM_016134	NP_057218			plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	101501745	101501746	+	IGR	INS	-	A	A	rs150642325	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101501745_101501746insA								RNF19A (179418 upstream) : ANKRD46 (20241 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102962003	102962004	+	Intron	INS	-	A	A	rs11433689		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102962003_102962004insA	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	104346275	104346275	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104346275delT								FZD6 (1183 upstream) : CTHRC1 (37511 downstream)																																			---	---	---	---
RSPO2	340419	broad.mit.edu	37	8	108919203	108919204	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108919203_108919204delCA	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660			R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)															---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110500106	110500107	+	Intron	DEL	AG	-	-	rs113930065		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110500106_110500107delAG	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114999606	114999607	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114999606_114999607insA								CSMD3 (550364 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116101858	116101859	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116101858_116101859delTG								None (None upstream) : TRPS1 (318866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116267282	116267283	+	IGR	INS	-	GAGA	GAGA	rs139228085	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116267282_116267283insGAGA								None (None upstream) : TRPS1 (153442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118515606	118515611	+	IGR	DEL	AGGAGG	-	-	rs111979261		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118515606_118515611delAGGAGG								SLC30A8 (326654 upstream) : MED30 (17354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	119164672	119164672	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119164672delT								EXT1 (40614 upstream) : SAMD12 (37023 downstream)																																			---	---	---	---
DERL1	79139	broad.mit.edu	37	8	124034655	124034657	+	Intron	DEL	CTT	-	-	rs143530722		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124034655_124034657delCTT	uc003ypl.2	-						DERL1_uc003ypm.2_Intron|DERL1_uc011lif.1_Intron|DERL1_uc003ypn.2_Intron	NM_024295	NP_077271			Der1-like domain family, member 1 isoform a						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|intracellular transport of viral proteins in host cell|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	MHC class I protein binding|receptor activity				0	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)													OREG0018957	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
WDR67	93594	broad.mit.edu	37	8	124141115	124141116	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124141115_124141116insA	uc003ypp.1	+						WDR67_uc011lig.1_Intron|WDR67_uc011lih.1_Intron|WDR67_uc003ypq.1_Intron|WDR67_uc003yps.1_Intron|WDR67_uc003ypt.1_Intron|WDR67_uc003ypu.1_Intron	NM_145647	NP_663622			WD repeat domain 67 isoform 1							centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	125298712	125298713	+	IGR	DEL	TC	-	-	rs72248152		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125298712_125298713delTC								FER1L6 (166411 upstream) : TMEM65 (24448 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125586588	125586590	+	Intron	DEL	ATT	-	-	rs151207787		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125586588_125586590delATT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	125943268	125943269	+	IGR	DEL	TG	-	-	rs141482010		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125943268_125943269delTG								MTSS1 (202538 upstream) : LOC157381 (8615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128219600	128219601	+	IGR	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128219600_128219601delGA								FAM84B (649134 upstream) : LOC727677 (82461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128263780	128263782	+	IGR	DEL	TCA	-	-	rs71298198	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128263780_128263782delTCA								FAM84B (693314 upstream) : LOC727677 (38280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130675068	130675068	+	IGR	DEL	T	-	-	rs72326930		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130675068delT								None (None upstream) : GSDMC (85375 downstream)																																			---	---	---	---
ST3GAL1	6482	broad.mit.edu	37	8	134575095	134575096	+	Intron	INS	-	TC	TC	rs71299080		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134575095_134575096insTC	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479			ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134859377	134859377	+	IGR	DEL	A	-	-	rs139745339		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134859377delA								ST3GAL1 (275194 upstream) : ZFAT (630656 downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139878263	139878264	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139878263_139878264delTG	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143454462	143454465	+	Intron	DEL	TGTC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143454462_143454465delTGTC	uc003ywk.2	-						TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440			t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	144836222	144836223	+	IGR	DEL	CC	-	-	rs71935162		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144836222_144836223delCC								FAM83H (20308 upstream) : SCRIB (36867 downstream)																																			---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6742559	6742560	+	Intron	DEL	TT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6742559_6742560delTT	uc010mhu.2	+							NM_001146696	NP_001140168			jumonji domain containing 2C isoform 4						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	10943763	10943764	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10943763_10943764delAC								PTPRD (331040 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13915169	13915169	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13915169delT								MPDZ (635606 upstream) : NFIB (166679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13978290	13978290	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13978290delA								MPDZ (698727 upstream) : NFIB (103558 downstream)																																			---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14881400	14881400	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14881400delA	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
SH3GL2	6456	broad.mit.edu	37	9	17666543	17666544	+	Intron	INS	-	GTGTGT	GTGTGT	rs112240956		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17666543_17666544insGTGTGT	uc003zna.2	+							NM_003026	NP_003017			SH3-domain GRB2-like 2						axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	31135355	31135355	+	IGR	DEL	T	-	-	rs75485902		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31135355delT								None (None upstream) : None (None downstream)																																			---	---	---	---
AQP7	364	broad.mit.edu	37	9	33386780	33386781	+	Intron	INS	-	A	A	rs144468472	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386780_33386781insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161			aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	34537549	34537549	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34537549delT								ENHO (14512 upstream) : CNTFR (13882 downstream)																																			---	---	---	---
C9orf100	84904	broad.mit.edu	37	9	35669753	35669753	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35669753delG	uc003zxl.2	-											Homo sapiens cDNA FLJ10325 fis, clone NT2RM2000569.						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	38095090	38095091	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38095090_38095091delTG								SHB (25880 upstream) : ALDH1B1 (297611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66463156	66463156	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66463156delA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66465028	66465029	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66465028_66465029insA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66480406	66480407	+	IGR	DEL	TT	-	-	rs148610216		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66480406_66480407delTT								FAM74A4 (986020 upstream) : LOC442421 (16063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66711193	66711194	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66711193_66711194delAC								LOC442421 (208166 upstream) : AQP7P1 (543073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68375418	68375419	+	IGR	INS	-	AC	AC	rs138387266		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68375418_68375419insAC								FAM27B (581229 upstream) : MIR1299 (626820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68406963	68406964	+	IGR	INS	-	CT	CT	rs150304681	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68406963_68406964insCT								FAM27B (612774 upstream) : MIR1299 (595275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69056460	69056461	+	IGR	INS	-	A	A	rs145372655		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69056460_69056461insA								MIR1299 (54139 upstream) : PGM5P2 (23784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69957671	69957672	+	IGR	INS	-	A	A	rs112996117		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69957671_69957672insA								LOC100133920 (292722 upstream) : FOXD4L5 (218037 downstream)																																			---	---	---	---
APBA1	320	broad.mit.edu	37	9	72150511	72150511	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72150511delT	uc004ahh.2	-							NM_001163	NP_001154			amyloid beta A4 precursor protein-binding,						axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1																		---	---	---	---
GDA	9615	broad.mit.edu	37	9	74830253	74830253	+	Intron	DEL	T	-	-	rs35547082		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74830253delT	uc004aiq.2	+						GDA_uc011lse.1_Intron|GDA_uc011lsf.1_Intron|GDA_uc004air.2_Intron|GDA_uc010mow.1_Intron|GDA_uc004ais.2_Intron|GDA_uc004ait.1_Intron	NM_004293	NP_004284			guanine deaminase						nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)														---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75218303	75218306	+	Intron	DEL	ACAC	-	-	rs5898266		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75218303_75218306delACAC	uc004aiz.1	+						TMC1_uc010moz.1_Intron	NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
UBQLN1	29979	broad.mit.edu	37	9	86323252	86323252	+	5'Flank	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86323252delC	uc004amv.2	-						UBQLN1_uc004amw.2_5'Flank|uc004amx.2_5'UTR	NM_013438	NP_038466			ubiquilin 1 isoform 1						apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0																		---	---	---	---
GOLM1	51280	broad.mit.edu	37	9	88685485	88685486	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88685485_88685486insA	uc004aol.2	-						GOLM1_uc010mqd.1_Intron|GOLM1_uc004aom.2_Intron	NM_016548	NP_057632			golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0																		---	---	---	---
ZCCHC6	79670	broad.mit.edu	37	9	88947275	88947275	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88947275delA	uc004aoq.2	-						ZCCHC6_uc011ltf.1_Intron|ZCCHC6_uc004aor.2_Intron|ZCCHC6_uc004aos.2_Intron|ZCCHC6_uc004aot.2_Intron|ZCCHC6_uc004aou.2_Intron	NM_024617	NP_078893			zinc finger, CCHC domain containing 6						RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90305988	90305989	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90305988_90305989insT	uc004apc.2	+						DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929			death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	9	92150205	92150206	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92150205_92150206delTG								SEMA4D (37317 upstream) : GADD45G (69721 downstream)																																			---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94654815	94654815	+	Intron	DEL	T	-	-	rs145553027	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94654815delT	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551			receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
BICD2	23299	broad.mit.edu	37	9	95506234	95506234	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95506234delG	uc004aso.1	-						BICD2_uc004asp.1_Intron	NM_015250	NP_056065			bicaudal D homolog 2 isoform 2						microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	97359141	97359141	+	IGR	DEL	A	-	-	rs71909264		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97359141delA								FBP2 (3066 upstream) : FBP1 (6282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	98507307	98507308	+	IGR	INS	-	AG	AG	rs147256051	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98507307_98507308insAG								PTCH1 (228060 upstream) : C9orf130 (61064 downstream)																																			---	---	---	---
C9orf102	375748	broad.mit.edu	37	9	98678837	98678838	+	Intron	INS	-	A	A	rs144815828	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98678837_98678838insA	uc004avt.3	+						C9orf102_uc010mrx.1_Intron|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Intron	NM_001010895	NP_001010895			RAD26L hypothetical protein						DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
NCBP1	4686	broad.mit.edu	37	9	100414291	100414291	+	Intron	DEL	T	-	-	rs111943212		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100414291delT	uc004axq.2	+							NM_002486	NP_002477			nuclear cap binding protein subunit 1, 80kDa						gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA cleavage|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of mRNA 3'-end processing|positive regulation of viral transcription|regulation of translational initiation|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm|ribonucleoprotein complex	protein binding|RNA cap binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.158)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	108909549	108909549	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108909549delA	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	110873396	110873396	+	IGR	DEL	T	-	-	rs34621552		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110873396delT								KLF4 (621349 upstream) : ACTL7B (743475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111360080	111360087	+	IGR	DEL	TGGATGGA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111360080_111360087delTGGATGGA								None (None upstream) : ACTL7B (256784 downstream)																																			---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114458941	114458941	+	Intron	DEL	T	-	-	rs5899963		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114458941delT	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792			hypothetical protein LOC158401 isoform 1											ovary(2)	2																		---	---	---	---
UGCG	7357	broad.mit.edu	37	9	114675169	114675170	+	Intron	DEL	GT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114675169_114675170delGT	uc004bft.2	+							NM_003358	NP_003349			ceramide glucosyltransferase						epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	115908161	115908161	+	IGR	DEL	T	-	-	rs112104968		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115908161delT								C9orf109 (26037 upstream) : SLC31A2 (5077 downstream)																																			---	---	---	---
BSPRY	54836	broad.mit.edu	37	9	116121328	116121329	+	Intron	INS	-	A	A	rs149080292	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116121328_116121329insA	uc004bhg.3	+						BSPRY_uc010muw.2_Intron	NM_017688	NP_060158			B-box and SPRY domain containing						calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1																		---	---	---	---
ZNF618	114991	broad.mit.edu	37	9	116736720	116736720	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116736720delG	uc004bid.2	+						ZNF618_uc004bib.1_Intron|ZNF618_uc004bic.2_Intron|ZNF618_uc011lxi.1_Intron|ZNF618_uc011lxj.1_Intron	NM_133374	NP_588615			zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	118751601	118751601	+	IGR	DEL	T	-	-	rs72491617		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118751601delT								C9orf27 (64224 upstream) : PAPPA (164470 downstream)																																			---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119530525	119530526	+	Intron	INS	-	T	T	rs147179451	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119530525_119530526insT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	120698879	120698879	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120698879delT								TLR4 (219115 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121044959	121044960	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121044959_121044960delAC								TLR4 (565195 upstream) : DBC1 (883948 downstream)																																			---	---	---	---
CDK5RAP2	55755	broad.mit.edu	37	9	123322902	123322903	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123322902_123322903insT	uc004bkf.2	-						CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron	NM_018249	NP_060719			CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	125107102	125107125	+	IGR	DEL	TGTGTGTGTGTGTGTGTGTGTGTG	-	-	rs67075497		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125107102_125107125delTGTGTGTGTGTGTGTGTGTGTGTG								MRRF (21362 upstream) : PTGS1 (25684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	125425212	125425213	+	IGR	INS	-	TG	TG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125425212_125425213insTG								OR1L1 (287 upstream) : OR1L3 (12196 downstream)																																			---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126347360	126347360	+	Intron	DEL	A	-	-	rs2026746		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126347360delA	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
GAPVD1	26130	broad.mit.edu	37	9	128120255	128120255	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128120255delA	uc010mwx.2	+						GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc004bpt.2_Intron	NM_015635	NP_056450			GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
LMX1B	4010	broad.mit.edu	37	9	129428847	129428848	+	Intron	INS	-	TAAAA	TAAAA	rs139848947	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129428847_129428848insTAAAA	uc004bqj.2	+						LMX1B_uc004bqi.2_Intron|LMX1B_uc011maa.1_Intron	NM_002316	NP_002307			LIM homeobox transcription factor 1, beta						dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														Nail-Patella_Syndrome				---	---	---	---
FNBP1	23048	broad.mit.edu	37	9	132701675	132701675	+	Intron	DEL	T	-	-	rs6478929		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132701675delT	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848			formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)				T	MLL	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	9	133585611	133585611	+	IGR	DEL	A	-	-	rs34949987		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133585611delA								EXOSC2 (5159 upstream) : ABL1 (3657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	133840595	133840596	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133840595_133840596insA								FIBCD1 (26140 upstream) : LAMC3 (43908 downstream)																																			---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133931881	133931882	+	Intron	INS	-	A	A	rs144224681	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133931881_133931882insA	uc004caa.1	+							NM_006059	NP_006050			laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	134445900	134445901	+	IGR	INS	-	T	T	rs147340637	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134445900_134445901insT								UCK1 (39238 upstream) : RAPGEF1 (6257 downstream)																																			---	---	---	---
NTNG2	84628	broad.mit.edu	37	9	135082422	135082422	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135082422delG	uc004cbh.2	+							NM_032536	NP_115925			netrin G2 precursor						axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)														---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136799004	136799006	+	Intron	DEL	AAT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136799004_136799006delAAT	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137945586	137945586	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137945586delG								FCN1 (135777 upstream) : OLFM1 (21503 downstream)																																			---	---	---	---
ZMYND19	116225	broad.mit.edu	37	9	140487037	140487038	+	5'Flank	INS	-	A	A	rs74679041		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140487037_140487038insA	uc004cno.1	-							NM_138462	NP_612471			zinc finger, MYND domain containing 19							Golgi apparatus|plasma membrane	zinc ion binding			skin(1)	1	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)														---	---	---	---
MIR602	693187	broad.mit.edu	37	9	140730823	140730824	+	5'Flank	DEL	GT	-	-	rs111782067		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140730823_140730824delGT	hsa-mir-602|MI0003615	+																							0																		---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	661573	661574	+	Intron	DEL	CA	-	-	rs58771630		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:661573_661574delCA	uc001ifp.2	-							NM_014974	NP_055789			DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	1914290	1914290	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1914290delA								ADARB2 (134572 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3268940	3268941	+	IGR	INS	-	A	A	rs66633892		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3268940_3268941insA								PITRM1 (53937 upstream) : KLF6 (549248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4174682	4174683	+	IGR	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4174682_4174683delCA								KLF6 (347209 upstream) : LOC100216001 (446761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4764962	4764965	+	IGR	DEL	AATC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4764962_4764965delAATC								LOC100216001 (44700 upstream) : AKR1E2 (103437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6446764	6446765	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6446764_6446765delTC								PFKFB3 (169259 upstream) : PRKCQ (22340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	8388837	8388837	+	IGR	DEL	A	-	-	rs112682655		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8388837delA								GATA3 (271675 upstream) : None (None downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11301393	11301393	+	Intron	DEL	A	-	-	rs71914582		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11301393delA	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	13056613	13056614	+	Intron	INS	-	T	T	rs142528625	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13056613_13056614insT	uc009xjb.1	-						CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron|uc009xjd.1_Intron					Homo sapiens MSTP151 (MST151) mRNA, complete cds.							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
PHYH	5264	broad.mit.edu	37	10	13342978	13342981	+	5'Flank	DEL	AAAC	-	-	rs111759779		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13342978_13342981delAAAC	uc001imf.2	-						PHYH_uc001ime.2_5'Flank|PHYH_uc001img.2_Intron	NM_006214	NP_006205			phytanoyl-CoA 2-hydroxylase isoform a precursor						fatty acid alpha-oxidation|nervous system development	peroxisomal matrix	electron carrier activity|L-ascorbic acid binding|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|phytanoyl-CoA dioxygenase activity|protein binding				0		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	14826838	14826839	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14826838_14826839insT								FAM107B (9942 upstream) : CDNF (34412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	15041595	15041596	+	IGR	INS	-	A	A	rs142469319	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15041595_15041596insA								MEIG1 (26745 upstream) : ACBD7 (15475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	16051113	16051117	+	IGR	DEL	GGTCA	-	-	rs11278781		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16051113_16051117delGGTCA								FAM188A (148594 upstream) : PTER (427850 downstream)																																			---	---	---	---
VIM	7431	broad.mit.edu	37	10	17273338	17273338	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17273338delT	uc001iou.2	+						uc001iot.1_5'Flank|VIM_uc001iov.1_Intron|VIM_uc001iow.1_Intron|VIM_uc001iox.1_Intron|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_Intron|VIM_uc001ipb.1_Intron|VIM_uc009xjv.1_Intron|VIM_uc001ipc.1_Intron	NM_003380	NP_003371			vimentin						cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23071621	23071622	+	IGR	INS	-	AAC	AAC	rs140960229	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23071621_23071622insAAC								PIP4K2A (68118 upstream) : ARMC3 (145332 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24502503	24502504	+	Intron	INS	-	CTCT	CTCT	rs139108290	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24502503_24502504insCTCT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	25370181	25370181	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25370181delG								ENKUR (18973 upstream) : LOC100128811 (76820 downstream)																																	OREG0020078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MASTL	84930	broad.mit.edu	37	10	27472199	27472201	+	Intron	DEL	TTG	-	-	rs147321879		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27472199_27472201delTTG	uc001itm.2	+						MASTL_uc001itl.2_Intron|MASTL_uc009xkw.1_Intron|MASTL_uc009xkx.1_Intron	NM_032844	NP_116233			microtubule associated serine/threonine						cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27718541	27718541	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27718541delT								PTCHD3 (15244 upstream) : RAB18 (74708 downstream)																																			---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30604431	30604432	+	Intron	INS	-	A	A	rs147462371		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30604431_30604432insA	uc001iva.3	-						MTPAP_uc001ivb.3_Intron	NM_018109	NP_060579			PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30644529	30644530	+	Intron	INS	-	C	C	rs143860756	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30644529_30644530insC	uc001ivb.3	-							NM_018109	NP_060579			PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35646852	35646852	+	Intron	DEL	T	-	-	rs111580605	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35646852delT	uc001iyw.3	+						CCNY_uc001iyu.3_Intron|CCNY_uc001iyv.3_Intron|CCNY_uc001iyx.3_Intron|CCNY_uc009xmb.2_Intron|CCNY_uc010qet.1_Intron	NM_145012	NP_659449			cyclin Y isoform 1						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	37902697	37902704	+	IGR	DEL	GTGTGTGT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37902697_37902704delGTGTGTGT								ANKRD30A (381202 upstream) : ZNF248 (187743 downstream)																																			---	---	---	---
LOC399744	399744	broad.mit.edu	37	10	38725663	38725663	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38725663delT	uc009xme.2	+							NR_024497				Homo sapiens cDNA FLJ44672 fis, clone BRACE3006553.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	38804086	38804090	+	IGR	DEL	ACCCT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38804086_38804090delACCCT								LOC399744 (63006 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42617064	42617066	+	IGR	DEL	TTC	-	-	rs71529064		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42617064_42617066delTTC								None (None upstream) : LOC441666 (210249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42627717	42627717	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42627717delT								None (None upstream) : LOC441666 (199598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42676291	42676292	+	IGR	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42676291_42676292delAG								None (None upstream) : LOC441666 (151023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42816027	42816031	+	IGR	DEL	CCATT	-	-	rs149650414	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42816027_42816031delCCATT								None (None upstream) : LOC441666 (11284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44278943	44278943	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44278943delC								ZNF32 (134617 upstream) : HNRNPA3P1 (3917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44289092	44289093	+	IGR	DEL	CA	-	-	rs66694515		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44289092_44289093delCA								HNRNPA3P1 (3227 upstream) : CXCL12 (576514 downstream)																																			---	---	---	---
RASSF4	83937	broad.mit.edu	37	10	45460315	45460316	+	Intron	INS	-	A	A	rs144725300	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45460315_45460316insA	uc001jbo.2	+						RASSF4_uc001jbp.2_Intron|RASSF4_uc009xmn.2_Intron|RASSF4_uc001jbq.2_Intron	NM_032023	NP_114412			Ras association domain family 4						cell cycle|signal transduction		protein binding			large_intestine(1)	1																		---	---	---	---
GPRIN2	9721	broad.mit.edu	37	10	46994376	46994376	+	Intron	DEL	G	-	-	rs67082868		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46994376delG	uc001jec.2	+							NM_014696	NP_055511			G protein-regulated inducer of neurite outgrowth												0																		---	---	---	---
WDFY4	57705	broad.mit.edu	37	10	49910835	49910835	+	Intron	DEL	C	-	-	rs143042238		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49910835delC	uc001jha.3	+						WDFY4_uc001jgy.2_Intron	NM_020945	NP_065996			WDFY family member 4							integral to membrane	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	52488096	52488097	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52488096_52488097insA								SGMS1 (103173 upstream) : ASAH2B (11599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	61757845	61757845	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61757845delG								C10orf40 (37174 upstream) : ANK3 (30315 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	62118600	62118600	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62118600delT	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	62955874	62955874	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62955874delC								RHOBTB1 (194676 upstream) : TMEM26 (210527 downstream)																																			---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63698724	63698725	+	Intron	DEL	GT	-	-	rs111552458		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63698724_63698725delGT	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	64005582	64005583	+	Intron	INS	-	A	A	rs145698745	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64005582_64005583insA	uc001jlw.2	-						RTKN2_uc001jlx.2_Intron	NM_145307	NP_660350			rhotekin 2						signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	67153214	67153214	+	IGR	DEL	T	-	-	rs11327413		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67153214delT								ANXA2P3 (566580 upstream) : CTNNA3 (526511 downstream)																																			---	---	---	---
H2AFY2	55506	broad.mit.edu	37	10	71830719	71830720	+	Intron	DEL	GT	-	-	rs10561349		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71830719_71830720delGT	uc001jqm.2	+						H2AFY2_uc001jqn.2_Intron	NM_018649	NP_061119			H2A histone family, member Y2						chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	72351238	72351238	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72351238delG								KIAA1274 (23033 upstream) : PRF1 (5867 downstream)																																			---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	78217269	78217270	+	Intron	INS	-	T	T	rs138587159	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78217269_78217270insT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	78329519	78329520	+	IGR	INS	-	T	T	rs141702606	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78329519_78329520insT								C10orf11 (12395 upstream) : KCNMA1 (299839 downstream)																																			---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	80964728	80964731	+	Intron	DEL	GGAT	-	-	rs72460291		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80964728_80964731delGGAT	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071			retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)															---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84137213	84137214	+	Intron	INS	-	GTGCGC	GTGCGC	rs141762555	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84137213_84137214insGTGCGC	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87854405	87854406	+	Intron	INS	-	A	A	rs141157820	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87854405_87854406insA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
PTEN	5728	broad.mit.edu	37	10	89720799	89720802	+	Frame_Shift_Del	DEL	TACT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89720799_89720802delTACT	uc001kfb.2	+	9	1981_1984	c.950_953delTACT	c.(949-954)GTACTTfs	p.V317fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	317_318	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L318fs*2(17)|p.V317fs*3(16)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.V317fs*6(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.L318F(1)|p.T318fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		V317fs*3(SKUT1_SOFT_TISSUE)|V317fs*3(EVSAT_BREAST)|V317fs*3(IGROV1_OVARY)|V317fs*3(ISHIKAWAHERAKLIO02ER_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	90791899	90791900	+	IGR	DEL	GG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90791899_90791900delGG								FAS (16358 upstream) : CH25H (173796 downstream)																																			---	---	---	---
SLC16A12	387700	broad.mit.edu	37	10	91208054	91208055	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91208054_91208055delAC	uc001kgm.2	-							NM_213606	NP_998771			solute carrier family 16 (monocarboxylic acid							integral to membrane|plasma membrane	symporter activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	95020945	95020945	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95020945delC								CYP26A1 (183304 upstream) : MYOF (45242 downstream)																																			---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	96047224	96047225	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96047224_96047225insA	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron|PLCE1_uc001kjp.2_Intron|uc001kjo.1_5'Flank	NM_016341	NP_057425			phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	100045714	100045715	+	IGR	INS	-	TA	TA	rs149182081	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100045714_100045715insTA								LOXL4 (17707 upstream) : PYROXD2 (97608 downstream)																																			---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106880006	106880006	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106880006delG	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	110342848	110342848	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110342848delC								None (None upstream) : None (None downstream)																																			---	---	---	---
RBM20	282996	broad.mit.edu	37	10	112496136	112496137	+	Intron	DEL	TG	-	-	rs34071775		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112496136_112496137delTG	uc001kzf.2	+							NM_001134363	NP_001127835			RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0																		---	---	---	---
CASP7	840	broad.mit.edu	37	10	115443814	115443815	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115443814_115443815delAC	uc001lan.2	+						CASP7_uc001lam.2_Intron|CASP7_uc001lao.2_Intron|CASP7_uc001lap.2_Intron|CASP7_uc001laq.2_Intron|CASP7_uc010qsa.1_Intron	NM_033339	NP_203125			caspase 7 isoform alpha						activation of caspase activity by cytochrome c|cellular component disassembly involved in apoptosis|induction of apoptosis by intracellular signals|proteolysis	cytosol|endoplasmic reticulum membrane|mitochondrial membrane|nucleoplasm	cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)														---	---	---	---
TDRD1	56165	broad.mit.edu	37	10	115937527	115937527	+	5'Flank	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115937527delA	uc001lbg.1	+						TDRD1_uc001lbf.2_5'Flank|TDRD1_uc001lbh.1_5'Flank|TDRD1_uc001lbi.1_5'Flank	NM_198795	NP_942090			tudor domain containing 1						DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)														---	---	---	---
FGFR2	2263	broad.mit.edu	37	10	123344371	123344372	+	Intron	DEL	CC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123344371_123344372delCC	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfn.3_Intron|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Intron|FGFR2_uc010qtp.1_Intron|FGFR2_uc010qtq.1_Intron	NM_000141	NP_000132			fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127583238	127583239	+	Intron	INS	-	T	T	rs142355498		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127583238_127583239insT	uc001ljg.1	-						FANK1_uc010quk.1_5'Flank|FANK1_uc001ljh.3_5'Flank|FANK1_uc009yan.2_5'Flank	NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	130301344	130301345	+	IGR	DEL	AC	-	-	rs33915708		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130301344_130301345delAC								MKI67 (376876 upstream) : MGMT (964109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132021781	132021781	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132021781delT								GLRX3 (38997 upstream) : TCERG1L (868875 downstream)																																			---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	132974877	132974878	+	Intron	INS	-	CA	CA	rs143998824		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132974877_132974878insCA	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
PPP2R2D	55844	broad.mit.edu	37	10	133755363	133755363	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133755363delT	uc001lks.2	+						PPP2R2D_uc001lkr.2_Intron|PPP2R2D_uc001lkt.2_Intron|PPP2R2D_uc009yay.2_Intron	NM_018461	NP_060931			protein phosphatase 2, regulatory subunit B,						cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			skin(1)	1		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)														---	---	---	---
STK32C	282974	broad.mit.edu	37	10	134072550	134072550	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134072550delG	uc001lle.1	-						STK32C_uc001lld.1_Intron|STK32C_uc010quu.1_Intron|STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron	NM_173575	NP_775846			serine/threonine kinase 32C								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134195329	134195329	+	IGR	DEL	A	-	-	rs138472274		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134195329delA								LRRC27 (319 upstream) : PWWP2B (15373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134635117	134635119	+	Intron	DEL	TGA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134635117_134635119delTGA	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	189702	189702	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:189702delC								LOC100133161 (50550 upstream) : SCGB1C1 (3378 downstream)																																			---	---	---	---
HRAS	3265	broad.mit.edu	37	11	534410	534415	+	Intron	DEL	CCCAGC	-	-	rs61877782		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:534410_534415delCCCAGC	uc001lpv.2	-						HRAS_uc010qvw.1_Intron|HRAS_uc010qvx.1_Intron|HRAS_uc010qvy.1_Intron	NM_005343	NP_005334			v-Ha-ras Harvey rat sarcoma viral oncogene						activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding			urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			---	---	---	---
MOB2	81532	broad.mit.edu	37	11	1499151	1499152	+	Intron	DEL	CT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1499151_1499152delCT	uc010qwz.1	-						MOB2_uc001lto.1_Intron|MOB2_uc001ltp.1_Intron|MOB2_uc001ltq.1_Intron|MOB2_uc010qwy.1_Intron	NM_053005	NP_443731			HCCA2 protein							nucleus|perinuclear region of cytoplasm	metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	1695967	1695968	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1695967_1695968delAC								FAM99A (6882 upstream) : FAM99B (8532 downstream)																																			---	---	---	---
STIM1	6786	broad.mit.edu	37	11	3947489	3947489	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3947489delG	uc001lyv.2	+						STIM1_uc009yef.2_Intron	NM_003156	NP_003147			stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)														---	---	---	---
TRIM5	85363	broad.mit.edu	37	11	5914639	5914639	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5914639delA	uc001mbq.1	-							NM_033093	NP_149084			tripartite motif protein TRIM5 isoform delta						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	9652949	9652950	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9652949_9652950insT								WEE1 (41638 upstream) : SWAP70 (32678 downstream)																																			---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9732939	9732940	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9732939_9732940delTG	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870			SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)														---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9760416	9760416	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9760416delA	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870			SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11686205	11686205	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11686205delC								GALNTL4 (42644 upstream) : USP47 (176765 downstream)																																			---	---	---	---
MICAL2	9645	broad.mit.edu	37	11	12259181	12259181	+	Intron	DEL	C	-	-	rs112421686		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12259181delC	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron|MICAL2_uc001mkd.2_Intron|MICAL2_uc010rcj.1_Intron|MICAL2_uc001mkf.2_5'Flank	NM_014632	NP_055447			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)														---	---	---	---
ARNTL	406	broad.mit.edu	37	11	13351518	13351518	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13351518delG	uc001mkr.2	+						ARNTL_uc001mko.2_Intron|ARNTL_uc001mkp.2_Intron|ARNTL_uc001mkq.2_Intron|ARNTL_uc001mks.2_Intron|ARNTL_uc001mkt.2_Intron|ARNTL_uc001mku.2_Intron	NM_001178	NP_001169			aryl hydrocarbon receptor nuclear						circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14876895	14876895	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14876895delA	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913			phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15449222	15449223	+	IGR	DEL	AC	-	-	rs72209914		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15449222_15449223delAC								INSC (180470 upstream) : SOX6 (538773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15887495	15887496	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15887495_15887496insA								INSC (618743 upstream) : SOX6 (100500 downstream)																																			---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	17004380	17004381	+	Intron	INS	-	GA	GA	rs138817025	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17004380_17004381insGA	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19610060	19610061	+	Intron	INS	-	A	A	rs142179910	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19610060_19610061insA	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19697040	19697040	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19697040delT	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	21969226	21969227	+	IGR	INS	-	T	T	rs145456551	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21969226_21969227insT								NELL1 (371999 upstream) : ANO5 (245495 downstream)																																			---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24931795	24931795	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24931795delA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	26872440	26872441	+	IGR	INS	-	A	A	rs141310749	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26872440_26872441insA								SLC5A12 (127466 upstream) : FIBIN (143187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29509877	29509880	+	IGR	DEL	CACG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29509877_29509880delCACG								None (None upstream) : KCNA4 (521886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30936004	30936005	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30936004_30936005insA	uc001mss.1	-						uc009yjk.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																												OREG0020855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EIF3M	10480	broad.mit.edu	37	11	32602981	32602982	+	5'Flank	DEL	GT	-	-	rs72198658		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32602981_32602982delGT	uc001mtu.2	+						EIF3M_uc010ref.1_5'Flank	NM_006360	NP_006351			eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	33451556	33451559	+	IGR	DEL	CCTT	-	-	rs142044105	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33451556_33451559delCCTT								HIPK3 (75617 upstream) : C11orf41 (112318 downstream)																																			---	---	---	---
NAT10	55226	broad.mit.edu	37	11	34153221	34153221	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34153221delT	uc001mvk.2	+						NAT10_uc010ren.1_Intron	NM_024662	NP_078938			N-acetyltransferase 10 isoform a							nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)																---	---	---	---
PAMR1	25891	broad.mit.edu	37	11	35526457	35526458	+	Intron	INS	-	A	A	rs144117900	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35526457_35526458insA	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991			regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	35858279	35858279	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35858279delT								TRIM44 (27349 upstream) : LDLRAD3 (107333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37568398	37568398	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37568398delG								C11orf74 (872008 upstream) : None (None downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	41040850	41040850	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41040850delT	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
AGBL2	79841	broad.mit.edu	37	11	47738004	47738004	+	5'Flank	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47738004delA	uc001ngg.2	-						AGBL2_uc010rhq.1_5'Flank|AGBL2_uc001ngh.1_5'Flank	NM_024783	NP_079059			carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	47798194	47798195	+	IGR	INS	-	T	T	rs145957792		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47798194_47798195insT								FNBP4 (9201 upstream) : NUP160 (1476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48340488	48340489	+	IGR	INS	-	G	G	rs147472897	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48340488_48340489insG								OR4S1 (11785 upstream) : OR4C3 (6004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50014245	50014245	+	IGR	DEL	G	-	-	rs67980513		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50014245delG								OR4C12 (10208 upstream) : LOC441601 (224755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50755489	50755490	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50755489_50755490insT								LOC646813 (375686 upstream) : OR4A5 (655958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50779861	50779861	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50779861delG								LOC646813 (400058 upstream) : OR4A5 (631587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56073301	56073304	+	IGR	DEL	TTCT	-	-	rs78649026		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56073301_56073304delTTCT								OR8H1 (14763 upstream) : OR8K3 (12479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58475514	58475514	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58475514delA								ZFP91-CNTF (82311 upstream) : GLYAT (717 downstream)																																			---	---	---	---
MS4A14	84689	broad.mit.edu	37	11	60144987	60144987	+	5'Flank	DEL	A	-	-	rs75891237		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60144987delA	uc001npi.2	+						MS4A7_uc001npe.2_5'Flank|MS4A7_uc001npf.2_5'Flank|MS4A7_uc001npg.2_5'Flank|MS4A7_uc001nph.2_5'Flank|MS4A7_uc009ymx.1_5'Flank	NM_001079692	NP_001073160			membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity			breast(1)	1																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64479439	64479440	+	Intron	DEL	CT	-	-	rs75226572		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64479439_64479440delCT	uc001oar.2	-						NRXN2_uc001oas.2_Intron	NM_015080	NP_055895			neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	69011692	69011693	+	IGR	INS	-	T	T	rs141816275	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69011692_69011693insT								TPCN2 (81785 upstream) : MYEOV (49929 downstream)																																			---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70367750	70367751	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70367750_70367751delTG	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70404802	70404802	+	Intron	DEL	T	-	-	rs11333255		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70404802delT	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
P2RY2	5029	broad.mit.edu	37	11	72942438	72942439	+	Intron	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72942438_72942439delAA	uc001otj.2	+						P2RY2_uc001otk.2_Intron|P2RY2_uc001otl.2_Intron	NM_002564	NP_002555			purinergic receptor P2Y2						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)													---	---	---	---
P2RY6	5031	broad.mit.edu	37	11	73007404	73007411	+	Intron	DEL	GAGTAGCC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73007404_73007411delGAGTAGCC	uc001otm.2	+						P2RY6_uc001otn.2_Intron|P2RY6_uc001oto.2_Intron|P2RY6_uc001otp.2_Intron|P2RY6_uc001otq.2_Intron|P2RY6_uc001otr.2_Intron|P2RY6_uc001ots.2_Intron	NM_176796	NP_789766			pyrimidinergic receptor P2Y6						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	73706914	73706915	+	IGR	INS	-	G	G	rs138525857	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73706914_73706915insG								UCP2 (13025 upstream) : UCP3 (4415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	74291383	74291384	+	IGR	INS	-	T	T	rs11438019		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74291383_74291384insT								LIPT2 (86628 upstream) : POLD3 (12245 downstream)																																			---	---	---	---
GDPD5	81544	broad.mit.edu	37	11	75228499	75228500	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75228499_75228500insA	uc001owp.3	-						GDPD5_uc001owq.3_Intron	NM_030792	NP_110419			glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	75401199	75401200	+	IGR	INS	-	ACC	ACC	rs33916113		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75401199_75401200insACC								MAP6 (21720 upstream) : MOGAT2 (27734 downstream)																																			---	---	---	---
C11orf67	28971	broad.mit.edu	37	11	77538150	77538150	+	Intron	DEL	A	-	-	rs113210233		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77538150delA	uc001oyq.2	+						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron	NM_024684	NP_078960			hypothetical protein LOC28971												0	all_cancers(14;5.69e-19)|all_epithelial(13;2.15e-21)|Breast(9;1.16e-15)|Ovarian(111;0.152)		Epithelial(5;1.37e-49)|all cancers(3;5.58e-46)|BRCA - Breast invasive adenocarcinoma(5;7.26e-31)															---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	79098676	79098685	+	Intron	DEL	CCCTTCCCTA	-	-	rs139541976		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79098676_79098685delCCCTTCCCTA	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
RAB30	27314	broad.mit.edu	37	11	82752238	82752238	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82752238delA	uc001ozu.2	-						RAB30_uc010rst.1_Intron|RAB30_uc001ozv.2_Intron	NM_014488	NP_055303			RAB30, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	83111237	83111237	+	Intron	DEL	T	-	-	rs11327920		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83111237delT	uc001pag.2	+											Homo sapiens cDNA clone IMAGE:5296561.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	86450568	86450568	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86450568delA								ME3 (66890 upstream) : PRSS23 (60923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87916948	87916949	+	IGR	DEL	CC	-	-	rs66515967		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87916948_87916949delCC								RAB38 (8349 upstream) : CTSC (109812 downstream)																																			---	---	---	---
TRIM49	57093	broad.mit.edu	37	11	89536749	89536750	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89536749_89536750insT	uc001pdb.2	-							NM_020358	NP_065091			ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	90095449	90095451	+	IGR	DEL	TTC	-	-	rs140613889		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90095449_90095451delTTC								CHORDC1 (138917 upstream) : MIR1261 (506838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	93628545	93628545	+	IGR	DEL	T	-	-	rs68045242		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93628545delT								C11orf90 (44877 upstream) : HEPHL1 (125833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94494359	94494360	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94494359_94494360insT								PIWIL4 (139773 upstream) : AMOTL1 (7148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95316512	95316513	+	IGR	INS	-	G	G	rs150647946	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95316512_95316513insG								SESN3 (350807 upstream) : FAM76B (185593 downstream)																																			---	---	---	---
MAML2	84441	broad.mit.edu	37	11	95924934	95924935	+	Intron	INS	-	A	A	rs113967346		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95924934_95924935insA	uc001pfw.1	-							NM_032427	NP_115803			mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)						T	MECT1|CRTC3	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	11	97790008	97790008	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97790008delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98777587	98777587	+	IGR	DEL	C	-	-	rs142743840		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98777587delC								None (None upstream) : CNTN5 (114284 downstream)																																			---	---	---	---
YAP1	10413	broad.mit.edu	37	11	102096641	102096641	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102096641delT	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron|YAP1_uc010rup.1_Intron	NM_001130145	NP_001123617			Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	109410107	109410107	+	IGR	DEL	T	-	-	rs112344058		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109410107delT								C11orf87 (110269 upstream) : ZC3H12C (553819 downstream)																																			---	---	---	---
IL18	3606	broad.mit.edu	37	11	112031035	112031036	+	Intron	INS	-	T	T	rs139011588		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112031035_112031036insT	uc001pnb.1	-						IL18_uc009yym.1_Intron	NM_001562	NP_001553			interleukin 18 proprotein						angiogenesis|cell-cell signaling|chemokine biosynthetic process|granulocyte macrophage colony-stimulating factor biosynthetic process|interferon-gamma biosynthetic process|interleukin-13 biosynthetic process|interleukin-2 biosynthetic process|positive regulation of activated T cell proliferation|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-17 production|positive regulation of natural killer cell proliferation|positive regulation of NK T cell proliferation|regulation of cell adhesion|sleep|T-helper 1 type immune response|type 2 immune response	cytosol|extracellular space	cytokine activity|signal transducer activity				0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	113373859	113373859	+	IGR	DEL	A	-	-	rs71917483		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113373859delA								DRD2 (27446 upstream) : TMPRSS5 (184410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116252474	116252474	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116252474delT								CADM1 (877233 upstream) : BUD13 (366414 downstream)																																			---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117680619	117680620	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117680619_117680620delCA	uc001pri.1	-											Homo sapiens mRNA for KIAA1132 protein, partial cds.						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	119660837	119660838	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119660837_119660838insT								PVRL1 (61402 upstream) : TRIM29 (321157 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	119724744	119724744	+	IGR	DEL	C	-	-	rs116031411	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119724744delC								PVRL1 (125309 upstream) : TRIM29 (257251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122279363	122279363	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122279363delT								LOC399959 (40896 upstream) : UBASH3B (247035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122462303	122462303	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122462303delA								LOC399959 (223836 upstream) : UBASH3B (64095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	123958600	123958600	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123958600delC								OR10G7 (48892 upstream) : VWA5A (27511 downstream)																																			---	---	---	---
CHEK1	1111	broad.mit.edu	37	11	125500795	125500817	+	Intron	DEL	CATGTCACAAGCAGTGACACAAG	-	-	rs111527914		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125500795_125500817delCATGTCACAAGCAGTGACACAAG	uc009zbo.2	+						CHEK1_uc010sbh.1_Intron|CHEK1_uc010sbi.1_Intron|CHEK1_uc001qcf.3_Intron|CHEK1_uc009zbp.2_Intron|CHEK1_uc001qcg.3_Intron|CHEK1_uc009zbq.2_Intron|CHEK1_uc001qci.1_Intron	NM_001114122	NP_001107594			checkpoint kinase 1						cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)									Other_conserved_DNA_damage_response_genes					---	---	---	---
ETS1	2113	broad.mit.edu	37	11	128422617	128422618	+	Intron	INS	-	T	T	rs137915493	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128422617_128422618insT	uc001qej.2	-							NM_001143820	NP_001137292			v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132933463	132933464	+	Intron	INS	-	T	T	rs140822250	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132933463_132933464insT	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133120852	133120852	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133120852delG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
WNK1	65125	broad.mit.edu	37	12	885578	885579	+	Intron	INS	-	TG	TG	rs12367284		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:885578_885579insTG	uc001qio.3	+						WNK1_uc001qin.2_Intron|WNK1_uc001qip.3_Intron	NM_018979	NP_061852			WNK lysine deficient protein kinase 1						intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1561106	1561107	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1561106_1561107delAC	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	4966289	4966290	+	IGR	INS	-	TT	TT	rs139298792		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4966289_4966290insTT								KCNA6 (6012 upstream) : KCNA1 (52783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	5421306	5421306	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5421306delA								KCNA5 (265358 upstream) : NTF3 (119974 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5905635	5905636	+	Intron	INS	-	AC	AC	rs145933132	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5905635_5905636insAC	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7552014	7552014	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7552014delC	uc001qsy.2	-						CD163L1_uc010sge.1_Intron	NM_174941	NP_777601			scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7964544	7964544	+	IGR	DEL	A	-	-	rs35540081		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7964544delA								NANOG (15889 upstream) : SLC2A14 (1854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	10392033	10392033	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392033delT								GABARAPL1 (16311 upstream) : KLRD1 (65017 downstream)																																			---	---	---	---
ETV6	2120	broad.mit.edu	37	12	12194715	12194716	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12194715_12194716insA	uc001raa.1	+							NM_001987	NP_001978			ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)						T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	12	14352763	14352764	+	IGR	INS	-	C	C	rs150278280	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14352763_14352764insC								GRIN2B (219741 upstream) : ATF7IP (165847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	17426047	17426048	+	IGR	DEL	TC	-	-	rs3030666		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17426047_17426048delTC								LMO3 (663289 upstream) : RERGL (807756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19067718	19067718	+	IGR	DEL	G	-	-	rs67092576		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19067718delG								CAPZA3 (175597 upstream) : PLEKHA5 (214930 downstream)																																			---	---	---	---
SLCO1A2	6579	broad.mit.edu	37	12	21545966	21545967	+	Intron	INS	-	A	A	rs146589121	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21545966_21545967insA	uc001res.2	-						SLCO1A2_uc010siq.1_Intron	NM_134431	NP_602307			organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	25195211	25195216	+	IGR	DEL	CAAAGT	-	-	rs148303090		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25195211_25195216delCAAAGT								C12orf77 (44838 upstream) : LRMP (10025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34309095	34309096	+	IGR	INS	-	TT	TT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34309095_34309096insTT								ALG10 (127861 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38592468	38592468	+	IGR	DEL	C	-	-	rs148810205		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38592468delC								None (None upstream) : ALG10B (118089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43641135	43641136	+	IGR	DEL	GT	-	-	rs4456328		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43641135_43641136delGT								PRICKLE1 (657563 upstream) : ADAMTS20 (106877 downstream)																																			---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	50983768	50983769	+	Intron	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50983768_50983769delTC	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	51438836	51438837	+	IGR	DEL	TG	-	-	rs72345898		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51438836_51438837delTG								SLC11A2 (16778 upstream) : LETMD1 (3247 downstream)																																			---	---	---	---
POU6F1	5463	broad.mit.edu	37	12	51614360	51614360	+	5'Flank	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51614360delT	uc001rya.2	-							NM_002702	NP_002693			POU class 6 homeobox 1						brain development|heart development|muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
PRIM1	5557	broad.mit.edu	37	12	57126565	57126565	+	Intron	DEL	T	-	-	rs35430278		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57126565delT	uc001smd.2	-							NM_000946	NP_000937			DNA primase polypeptide 1						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	59853550	59853551	+	IGR	INS	-	GT	GT	rs148813348	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59853550_59853551insGT								LRIG3 (539288 upstream) : SLC16A7 (136297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63843858	63843859	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63843858_63843859insA								AVPR1A (297268 upstream) : DPY19L2 (108834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63933057	63933057	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63933057delG								AVPR1A (386467 upstream) : DPY19L2 (19636 downstream)																																			---	---	---	---
HMGA2	8091	broad.mit.edu	37	12	66343589	66343589	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66343589delA	uc001ssx.2	+						HMGA2_uc001ssw.1_Intron	NM_003483	NP_003474			high mobility group AT-hook 2 isoform a						cell division|chromatin organization|mitosis|multicellular organismal development|regulation of growth|transcription, DNA-dependent	chromatin	AT DNA binding		HMGA2/LPP(161)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/RAD51B(11)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/CCNB1IP1(2)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/COX6C(2)	soft_tissue(159)|bone(27)|salivary_gland(22)	208	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)				T	 LHFP|RAD51L1|LPP|HEI10|COX6C|CMKOR1|NFIB|ALDH2|CCNB1IP1|EBF1|WIF1|FHIT	lipoma|leiomyoma|pleiomorphic salivary gland adenoma								---	---	---	---
NUP107	57122	broad.mit.edu	37	12	69117915	69117915	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69117915delT	uc001suf.2	+						NUP107_uc001sug.2_Intron|NUP107_uc010stj.1_Intron	NM_020401	NP_065134			nucleoporin 107kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
RAB21	23011	broad.mit.edu	37	12	72169321	72169322	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72169321_72169322insT	uc001swt.2	+							NM_014999	NP_055814			RAB21, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	73082633	73082633	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73082633delG								TRHDE (23212 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77537004	77537005	+	IGR	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77537004_77537005delAA								E2F7 (77644 upstream) : NAV3 (688064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77876964	77876965	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77876964_77876965insT								E2F7 (417604 upstream) : NAV3 (348104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	78760797	78760799	+	IGR	DEL	TTC	-	-	rs149461333		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78760797_78760799delTTC								NAV3 (154009 upstream) : SYT1 (496974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80658572	80658573	+	IGR	INS	-	T	T	rs138227519	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80658572_80658573insT								PPP1R12A (329337 upstream) : PTPRQ (179553 downstream)																																			---	---	---	---
ACSS3	79611	broad.mit.edu	37	12	81648873	81648873	+	3'UTR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81648873delT	uc001szl.1	+	16					ACSS3_uc001szm.1_3'UTR|ACSS3_uc001szn.1_3'UTR	NM_024560	NP_078836			acyl-CoA synthetase short-chain family member 3							mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	86247407	86247408	+	IGR	INS	-	TA	TA	rs111957526		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86247407_86247408insTA								RASSF9 (17089 upstream) : NTS (20667 downstream)																																			---	---	---	---
MGAT4C	25834	broad.mit.edu	37	12	86960661	86960661	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86960661delC	uc001tal.3	-						MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron	NM_013244	NP_037376			alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	87550225	87550226	+	IGR	DEL	AC	-	-	rs35365603		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87550225_87550226delAC								MGAT4C (317544 upstream) : C12orf50 (823590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92778777	92778778	+	IGR	INS	-	T	T	rs138494935	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92778777_92778778insT								BTG1 (239104 upstream) : CLLU1OS (35092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	97801606	97801607	+	IGR	DEL	CT	-	-	rs147534966		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97801606_97801607delCT								NEDD1 (454145 upstream) : RMST (57192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98722853	98722853	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98722853delA								RMST (764060 upstream) : LOC100128191 (183900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98973873	98973876	+	IGR	DEL	GATA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98973873_98973876delGATA								TMPO (29752 upstream) : SLC25A3 (13527 downstream)																																			---	---	---	---
UTP20	27340	broad.mit.edu	37	12	101677760	101677760	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101677760delT	uc001tia.1	+						UTP20_uc009ztz.1_Intron	NM_014503	NP_055318			down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4																		---	---	---	---
C12orf48	55010	broad.mit.edu	37	12	102567656	102567656	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102567656delT	uc001tjf.2	+						C12orf48_uc001tjg.2_Intron|C12orf48_uc010swa.1_Intron|C12orf48_uc001tjh.2_Intron|C12orf48_uc010swb.1_Intron|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Intron|C12orf48_uc001tjk.2_Intron|C12orf48_uc009zud.2_Intron	NM_017915	NP_060385			hypothetical protein LOC55010						response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0																		---	---	---	---
IGF1	3479	broad.mit.edu	37	12	102858089	102858089	+	Intron	DEL	T	-	-	rs5742625		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102858089delT	uc001tjp.3	-						IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755			insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	103960089	103960090	+	IGR	INS	-	A	A	rs67403569		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103960089_103960090insA								C12orf42 (70340 upstream) : STAB2 (20979 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	105085268	105085268	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105085268delT	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108198040	108198041	+	IGR	INS	-	A	A	rs149199839	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108198040_108198041insA								ASCL4 (27620 upstream) : WSCD2 (325470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	108838440	108838440	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108838440delA								CMKLR1 (105346 upstream) : FICD (70611 downstream)																																			---	---	---	---
SVOP	55530	broad.mit.edu	37	12	109360428	109360428	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109360428delT	uc010sxh.1	-							NM_018711	NP_061181			SV2 related protein							cell junction|integral to membrane|synaptic vesicle membrane	ion transmembrane transporter activity				0																		---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109865122	109865122	+	Intron	DEL	A	-	-	rs34644066		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109865122delA	uc010sxn.1	+							NM_001101421	NP_001094891			myosin 1H							myosin complex	motor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	110073023	110073025	+	IGR	DEL	CAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110073023_110073025delCAC								MVK (37953 upstream) : C12orf34 (79165 downstream)																																			---	---	---	---
TRPV4	59341	broad.mit.edu	37	12	110268941	110268942	+	Intron	DEL	GT	-	-	rs144221928		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110268941_110268942delGT	uc001tpk.1	-						TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638			transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112657407	112657407	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112657407delT	uc009zwc.2	-						C12orf51_uc001ttr.1_Intron	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114659897	114659898	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114659897_114659898delAC								RBM19 (255721 upstream) : TBX5 (131838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	114854129	114854130	+	IGR	INS	-	A	A	rs150399205	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114854129_114854130insA								TBX5 (7882 upstream) : TBX3 (253929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115784293	115784294	+	IGR	INS	-	GAGG	GAGG	rs28508591		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115784293_115784294insGAGG								TBX3 (662324 upstream) : MED13L (612089 downstream)																																			---	---	---	---
MED13L	23389	broad.mit.edu	37	12	116523560	116523563	+	Intron	DEL	CACA	-	-	rs71442954		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116523560_116523563delCACA	uc001tvw.2	-							NM_015335	NP_056150			mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)														---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118161102	118161106	+	Intron	DEL	AAAGT	-	-	rs66963610		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118161102_118161106delAAAGT	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119872644	119872648	+	Intron	DEL	GCTCA	-	-	rs140982902		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119872644_119872648delGCTCA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
CCDC64	92558	broad.mit.edu	37	12	120484768	120484768	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120484768delT	uc001txl.1	+						CCDC64_uc001txk.2_Intron|CCDC64_uc009zwv.1_Intron	NM_207311	NP_997194			coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	120758405	120758409	+	IGR	DEL	TTTTG	-	-	rs113737834		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120758405_120758409delTTTTG								SIRT4 (7361 upstream) : PLA2G1B (1506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	121562993	121562994	+	IGR	INS	-	T	T	rs34717612		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121562993_121562994insT								OASL (86213 upstream) : P2RX7 (7684 downstream)																																			---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122760930	122760931	+	Intron	DEL	CA	-	-	rs34304993		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122760930_122760931delCA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucf.1_5'Flank	NM_002956	NP_002947			restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122766082	122766082	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122766082delA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_Intron	NM_002956	NP_002947			restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123097448	123097448	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123097448delT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
RILPL1	353116	broad.mit.edu	37	12	124017726	124017726	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124017726delG	uc001ufe.2	-	1	540	c.304delC	c.(304-306)CAGfs	p.Q102fs	RILPL1_uc010tas.1_Frame_Shift_Del_p.Q102fs	NM_178314	NP_847884	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	102	Potential.				neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124285563	124285564	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124285563_124285564insA	uc001uft.3	+						DNAH10_uc010tav.1_Intron|DNAH10_uc010taw.1_Intron	NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	126619340	126619340	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126619340delA								TMEM132B (475751 upstream) : LOC100128554 (307687 downstream)																																			---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131623898	131623898	+	3'UTR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131623898delC	uc001uit.3	+	25					GPR133_uc010tbm.1_3'UTR|GPR133_uc009zyo.2_3'UTR|GPR133_uc009zyp.2_RNA	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19642372	19642380	+	Intron	DEL	CATCATTAT	-	-	rs76934775		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19642372_19642380delCATCATTAT	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24589887	24589888	+	Intron	DEL	CA	-	-	rs140755270	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24589887_24589888delCA	uc001upd.1	+						C1QTNF9_uc001upe.2_Intron|uc001upc.2_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24869749	24869750	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24869749_24869750insA	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc010tcy.1_Intron|SPATA13_uc010tcz.1_Intron|SPATA13_uc010tda.1_Intron|SPATA13_uc001uph.2_Intron|SPATA13_uc010tdb.1_Intron|SPATA13_uc009zzz.1_Intron|SPATA13_uc001upi.1_5'Flank	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
C1QTNF9	338872	broad.mit.edu	37	13	24894860	24894860	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24894860delT	uc001upj.2	+						C1QTNF9_uc001upe.2_Intron	NM_178540	NP_848635			C1q and tumor necrosis factor related protein 9							collagen	hormone activity				0		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27925934	27925935	+	IGR	INS	-	TCCC	TCCC	rs9551362	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27925934_27925935insTCCC								RASL11A (78107 upstream) : GTF3A (72746 downstream)																																			---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29765550	29765550	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29765550delA	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
LOC100188949	100188949	broad.mit.edu	37	13	30922003	30922004	+	Intron	DEL	AA	-	-	rs67451666		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30922003_30922004delAA	uc001usu.2	-							NR_024464				full-length cDNA clone CS0DG007YC17 of B cells (Ramos cell line) of Homo sapiens (human).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	31740361	31740362	+	IGR	INS	-	GTGTGT	GTGTGT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31740361_31740362insGTGTGT								HSPH1 (3859 upstream) : B3GALTL (33750 downstream)																																			---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33229330	33229331	+	Intron	INS	-	T	T	rs140159005	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33229330_33229331insT	uc010abf.2	+						PDS5B_uc001uuo.2_Intron|PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	37955778	37955779	+	IGR	INS	-	T	T	rs142118108	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37955778_37955779insT								CSNK1A1L (275977 upstream) : POSTN (180941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	40693042	40693042	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40693042delA								COG6 (327240 upstream) : LOC646982 (228231 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43931701	43931701	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43931701delT	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_5'Flank|ENOX1_uc010tfm.1_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	45168861	45168862	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45168861_45168862insT								TSC22D1 (18160 upstream) : NUFIP1 (344522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	45322344	45322345	+	IGR	INS	-	A	A	rs151328672	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45322344_45322345insA								TSC22D1 (171643 upstream) : NUFIP1 (191039 downstream)																																			---	---	---	---
SUCLA2	8803	broad.mit.edu	37	13	48521410	48521411	+	Intron	DEL	AC	-	-	rs34458960		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48521410_48521411delAC	uc001vbs.2	-						SUCLA2_uc010tgb.1_Intron|SUCLA2_uc010tgc.1_Intron|SUCLA2_uc010tgd.1_Intron	NM_003850	NP_003841			succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)													---	---	---	---
ITM2B	9445	broad.mit.edu	37	13	48821298	48821298	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48821298delT	uc001vbz.3	+							NM_021999	NP_068839			integral membrane protein 2B						nervous system development	Golgi membrane|integral to membrane|nucleus|plasma membrane	beta-amyloid binding				0		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)														---	---	---	---
KPNA3	3839	broad.mit.edu	37	13	50363481	50363481	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50363481delT	uc001vdj.2	-							NM_002267	NP_002258			karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	51454450	51454450	+	IGR	DEL	T	-	-	rs112051218		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51454450delT								DLEU7 (36565 upstream) : RNASEH2B (29442 downstream)																																			---	---	---	---
CKAP2	26586	broad.mit.edu	37	13	53027099	53027099	+	5'Flank	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53027099delT	uc001vgv.2	+						VPS36_uc001vgq.2_5'Flank|VPS36_uc001vgs.2_5'Flank|CKAP2_uc001vgt.2_5'Flank|CKAP2_uc001vgu.2_5'Flank	NM_001098525	NP_001091995			cytoskeleton associated protein 2 isoform 2						apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	53520448	53520448	+	IGR	DEL	A	-	-	rs66501113		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53520448delA								PCDH8 (97674 upstream) : OLFM4 (82524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55624675	55624676	+	IGR	INS	-	CAAA	CAAA	rs145606879	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55624675_55624676insCAAA								MIR1297 (738492 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57261848	57261849	+	IGR	INS	-	A	A	rs10636095		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57261848_57261849insA								None (None upstream) : PRR20C (453203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59632863	59632864	+	IGR	INS	-	CACA	CACA	rs147081359	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59632863_59632864insCACA								None (None upstream) : DIAPH3 (606861 downstream)																																			---	---	---	---
TDRD3	81550	broad.mit.edu	37	13	61012802	61012802	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61012802delT	uc001via.2	+						TDRD3_uc010aef.2_Intron|TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421			tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	63621717	63621718	+	IGR	INS	-	G	G	rs111276312		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63621717_63621718insG								None (None upstream) : OR7E156P (689850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63633879	63633880	+	IGR	DEL	AG	-	-	rs141636043		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63633879_63633880delAG								None (None upstream) : OR7E156P (677688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63635788	63635788	+	IGR	DEL	T	-	-	rs140303608		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63635788delT								None (None upstream) : OR7E156P (675780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63640458	63640459	+	IGR	INS	-	A	A	rs149386528	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63640458_63640459insA								None (None upstream) : OR7E156P (671109 downstream)																																			---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67194609	67194610	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67194609_67194610delAC	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73529512	73529515	+	Intron	DEL	TGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73529512_73529515delTGTG	uc001vjc.2	+						PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	73801672	73801680	+	IGR	DEL	CCCAGTGTG	-	-	rs112176187		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73801672_73801680delCCCAGTGTG								KLF5 (149997 upstream) : KLF12 (458470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75202930	75202931	+	IGR	DEL	GG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75202930_75202931delGG								KLF12 (494536 upstream) : LOC647288 (608959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77384412	77384415	+	IGR	DEL	CTCT	-	-	rs145922803		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77384412_77384415delCTCT								LMO7 (950408 upstream) : KCTD12 (69889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	79766400	79766400	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79766400delT								RNF219 (531700 upstream) : RBM26 (127700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	79885517	79885518	+	IGR	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79885517_79885518delAA								RNF219 (650817 upstream) : RBM26 (8582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85847399	85847400	+	IGR	INS	-	AC	AC	rs141983771	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85847399_85847400insAC								None (None upstream) : SLITRK6 (519522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86215742	86215742	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86215742delA								None (None upstream) : SLITRK6 (151180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90579293	90579294	+	IGR	INS	-	TATC	TATC	rs148715220	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90579293_90579294insTATC								None (None upstream) : MIR622 (304142 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92862164	92862164	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92862164delG	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
TM9SF2	9375	broad.mit.edu	37	13	100160658	100160659	+	Intron	INS	-	AC	AC	rs61347104		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100160658_100160659insAC	uc001voj.1	+						TM9SF2_uc010afz.1_Intron	NM_004800	NP_004791			transmembrane 9 superfamily member 2 precursor						transport	endosome membrane|integral to plasma membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102954177	102954182	+	Intron	DEL	CACACA	-	-	rs111923575		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102954177_102954182delCACACA	uc001vpf.2	-						uc001vph.1_Intron|uc001vpg.1_Intron	NM_175929	NP_787125			fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	105702994	105702995	+	IGR	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105702994_105702995insG								None (None upstream) : DAOA (415221 downstream)																																			---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108291719	108291719	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108291719delA	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
ARHGEF7	8874	broad.mit.edu	37	13	111780878	111780878	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111780878delC	uc001vrs.2	+						ARHGEF7_uc001vrr.2_Intron|ARHGEF7_uc001vrt.2_Intron	NM_001113511	NP_001106983			PAK-interacting exchange factor beta isoform c						apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	112850189	112850192	+	IGR	DEL	TTCT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850189_112850192delTTCT								SOX1 (124169 upstream) : C13orf28 (180477 downstream)																																			---	---	---	---
GAS6	2621	broad.mit.edu	37	13	114544862	114544863	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114544862_114544863delCA	uc001vud.2	-						uc010tki.1_5'Flank	NM_000820	NP_000811			growth arrest-specific 6 isoform 1 precursor						cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	19024831	19024832	+	IGR	INS	-	G	G	rs149077501	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19024831_19024832insG								None (None upstream) : OR11H12 (352762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19034750	19034751	+	IGR	INS	-	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19034750_19034751insC								None (None upstream) : OR11H12 (342843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19034958	19034958	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19034958delG								None (None upstream) : OR11H12 (342636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19106611	19106611	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19106611delA								None (None upstream) : OR11H12 (270983 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20064807	20064808	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20064807_20064808insA								P704P (44535 upstream) : OR4Q3 (150779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20397096	20397096	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20397096delA								OR4K5 (7361 upstream) : OR4K1 (6730 downstream)																																			---	---	---	---
PARP2	10038	broad.mit.edu	37	14	20820034	20820035	+	Intron	DEL	AG	-	-	rs138419981		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20820034_20820035delAG	uc001vxc.2	+						PARP2_uc001vxd.2_Intron|PARP2_uc001vxb.1_Intron|PARP2_uc010tle.1_5'Flank	NM_005484	NP_005475			poly (ADP-ribose) polymerase family, member 2						protein ADP-ribosylation	nucleolus|nucleoplasm	DNA binding|NAD+ ADP-ribosyltransferase activity			ovary(1)|pancreas(1)	2	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)									Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					---	---	---	---
Unknown	0	broad.mit.edu	37	14	20945862	20945863	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20945862_20945863insT								PNP (616 upstream) : RNASE10 (27833 downstream)																																			---	---	---	---
SLC7A7	9056	broad.mit.edu	37	14	23272244	23272244	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23272244delT	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973			solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)														---	---	---	---
SLC7A7	9056	broad.mit.edu	37	14	23287817	23287818	+	Intron	INS	-	T	T	rs147610649	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23287817_23287818insT	uc001wgu.3	-						SLC7A7_uc001wgs.3_5'Flank|SLC7A7_uc001wgt.3_5'Flank|SLC7A7_uc001wgv.3_Intron	NM_001126106	NP_001119578			solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	24862224	24862225	+	IGR	INS	-	TT	TT	rs138569002	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24862224_24862225insTT								NFATC4 (13416 upstream) : NYNRIN (5767 downstream)																																			---	---	---	---
STXBP6	29091	broad.mit.edu	37	14	25392866	25392866	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25392866delT	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_Intron	NM_014178	NP_054897			amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	31953493	31953494	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31953493_31953494insT								HEATR5A (26813 upstream) : NUBPL (77097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34737812	34737812	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34737812delT								EGLN3 (317525 upstream) : C14orf147 (164333 downstream)																																			---	---	---	---
KIAA0391	9692	broad.mit.edu	37	14	35720062	35720062	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35720062delT	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487			mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)														---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37467025	37467025	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37467025delA	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	40423133	40423133	+	IGR	DEL	A	-	-	rs143886020		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40423133delA								FBXO33 (521429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44690412	44690415	+	IGR	DEL	GAAG	-	-	rs72383008		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44690412_44690415delGAAG								None (None upstream) : FSCB (282940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53914786	53914786	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53914786delT								DDHD1 (294740 upstream) : BMP4 (501671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57412539	57412540	+	IGR	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57412539_57412540delAA								OTX2 (135355 upstream) : EXOC5 (256656 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57779081	57779081	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57779081delC								MUDENG (22285 upstream) : NAA30 (78190 downstream)																																			---	---	---	---
MNAT1	4331	broad.mit.edu	37	14	61362583	61362584	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61362583_61362584insT	uc001xfd.2	+						MNAT1_uc001xfe.2_Intron	NM_002431	NP_002422			menage a trois 1 (CAK assembly factor)						cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein complex assembly|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cytoplasm|holo TFIIH complex	protein N-terminus binding|zinc ion binding			ovary(1)|lung(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.0174)									Direct_reversal_of_damage|NER					---	---	---	---
FUT8	2530	broad.mit.edu	37	14	65980937	65980938	+	Intron	INS	-	GT	GT	rs146245543	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65980937_65980938insGT	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron	NM_178155	NP_835368			fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	66714413	66714414	+	IGR	INS	-	TT	TT	rs76610528		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66714413_66714414insTT								FUT8 (504452 upstream) : C14orf53 (238695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	70025686	70025689	+	IGR	DEL	TTCT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70025686_70025689delTTCT								UPF0639 (30471 upstream) : C14orf162 (10843 downstream)																																			---	---	---	---
SLC8A3	6547	broad.mit.edu	37	14	70539772	70539773	+	Intron	INS	-	CCCTT	CCCTT	rs147980723	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70539772_70539773insCCCTT	uc001xly.2	-						SLC8A3_uc001xlu.2_Intron|SLC8A3_uc001xlv.2_Intron|SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Intron|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron|SLC8A3_uc001xma.2_Intron	NM_183002	NP_892114			solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)														---	---	---	---
SLC8A3	6547	broad.mit.edu	37	14	70597941	70597942	+	Intron	INS	-	A	A	rs147997788	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70597941_70597942insA	uc001xly.2	-						SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Intron|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron	NM_183002	NP_892114			solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)														---	---	---	---
PCNX	22990	broad.mit.edu	37	14	71424561	71424562	+	Intron	DEL	AG	-	-	rs67500056	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71424561_71424562delAG	uc001xmo.2	+						PCNX_uc001xmn.3_Intron|PCNX_uc010are.1_Intron	NM_014982	NP_055797			pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	75708411	75708412	+	IGR	INS	-	TGTG	TGTG	rs149245074	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75708411_75708412insTGTG								TMED10 (65062 upstream) : FOS (37069 downstream)																																			---	---	---	---
FLVCR2	55640	broad.mit.edu	37	14	76079443	76079443	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76079443delC	uc001xrs.2	+						FLVCR2_uc010tvd.1_Intron	NM_017791	NP_060261			feline leukemia virus subgroup C cellular						transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77191684	77191684	+	IGR	DEL	T	-	-	rs34634614		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77191684delT								ESRRB (223506 upstream) : VASH1 (36551 downstream)																																			---	---	---	---
C14orf166B	145497	broad.mit.edu	37	14	77322848	77322851	+	Intron	DEL	TGGA	-	-	rs148908037		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77322848_77322851delTGGA	uc001xsx.2	+						C14orf166B_uc010asn.1_Intron|C14orf166B_uc001xsw.2_Intron|C14orf166B_uc010tvh.1_Intron	NM_194287	NP_919263			hypothetical protein LOC145497												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	83355859	83355860	+	IGR	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83355859_83355860delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85739006	85739006	+	IGR	DEL	T	-	-	rs10711326		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85739006delT								None (None upstream) : FLRT2 (257482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86610056	86610056	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86610056delA								FLRT2 (515787 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86742550	86742551	+	IGR	INS	-	TAAC	TAAC	rs148039043	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86742550_86742551insTAAC								FLRT2 (648281 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	88489062	88489063	+	5'Flank	INS	-	CA	CA	rs147716116	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88489062_88489063insCA	uc001xvw.2	+											Homo sapiens cDNA clone IMAGE:4734409.																														---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89826695	89826698	+	Intron	DEL	AGGG	-	-	rs72339865		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89826695_89826698delAGGG	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	91999137	91999138	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91999137_91999138insA								SMEK1 (22324 upstream) : C14orf184 (39650 downstream)																																			---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92855327	92855328	+	Intron	INS	-	TT	TT	rs150882880	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92855327_92855328insTT	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932			solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
BTBD7	55727	broad.mit.edu	37	14	93767540	93767541	+	Intron	INS	-	T	T	rs78391208		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93767540_93767541insT	uc001ybo.2	-						BTBD7_uc001ybp.2_Intron|BTBD7_uc001ybr.2_Intron	NM_001002860	NP_001002860			BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95118553	95118554	+	IGR	INS	-	A	A	rs34082799		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95118553_95118554insA								SERPINA13 (5223 upstream) : GSC (116007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99554671	99554672	+	IGR	INS	-	ACACACAC	ACACACAC	rs142215240	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99554671_99554672insACACACAC								C14orf177 (370574 upstream) : BCL11B (80955 downstream)																																			---	---	---	---
TRAF3	7187	broad.mit.edu	37	14	103278066	103278073	+	Intron	DEL	GTGTGTGT	-	-	rs141367929		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103278066_103278073delGTGTGTGT	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777			TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	104680798	104680798	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104680798delA								KIF26A (33564 upstream) : C14orf180 (365258 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106515758	106515758	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106515758delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106518132	106518133	+	Intron	INS	-	AA	AA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106518132_106518133insAA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106784104	106784105	+	Intron	INS	-	T	T	rs147719885		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106784104_106784105insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106816592	106816593	+	Intron	INS	-	AC	AC	rs112484509		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106816592_106816593insAC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106927417	106927417	+	Intron	DEL	C	-	-	rs33910369		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106927417delC	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107118058	107118059	+	Intron	INS	-	AC	AC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107118058_107118059insAC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107153437	107153438	+	Intron	INS	-	A	A	rs141277239	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107153437_107153438insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20001340	20001340	+	IGR	DEL	A	-	-	rs112860886		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20001340delA								None (None upstream) : GOLGA6L6 (735754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20026881	20026881	+	IGR	DEL	A	-	-	rs112396864		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20026881delA								None (None upstream) : GOLGA6L6 (710213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20108501	20108502	+	IGR	INS	-	ATG	ATG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20108501_20108502insATG								None (None upstream) : GOLGA6L6 (628592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20319212	20319213	+	IGR	INS	-	A	A	rs146096706		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20319212_20319213insA								None (None upstream) : GOLGA6L6 (417881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	21929570	21929571	+	IGR	INS	-	A	A	rs139686724		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21929570_21929571insA								NF1P1 (794945 upstream) : LOC646214 (2943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22567508	22567509	+	IGR	INS	-	T	T	rs142681987	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22567508_22567509insT								MIR1268 (54228 upstream) : GOLGA8DP (134776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	23610060	23610061	+	5'Flank	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23610060_23610061insG	uc001ywf.2	-											DQ583953																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	24729061	24729064	+	IGR	DEL	ACAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24729061_24729064delACAC								PWRN2 (313966 upstream) : PWRN1 (49775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	29034834	29034834	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29034834delC								WHAMML2 (10549 upstream) : APBA2 (96334 downstream)																																			---	---	---	---
FAM189A1	23359	broad.mit.edu	37	15	29596997	29596997	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29596997delC	uc010azk.1	-							NM_015307	NP_056122			hypothetical protein LOC23359							integral to membrane					0																		---	---	---	---
OTUD7A	161725	broad.mit.edu	37	15	31802582	31802582	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31802582delT	uc001zfq.2	-						OTUD7A_uc001zfr.2_Intron	NM_130901	NP_570971			OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)														---	---	---	---
GREM1	26585	broad.mit.edu	37	15	33012280	33012281	+	Intron	DEL	GT	-	-	rs117055025	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33012280_33012281delGT	uc001zhe.1	+						uc001zhc.1_5'Flank|GREM1_uc001zhd.1_Intron|GREM1_uc010uby.1_Intron	NM_013372	NP_037504			gremlin-1 precursor						negative regulation of BMP signaling pathway|nervous system development|regulation of epithelial to mesenchymal transition	extracellular space	cytokine activity				0		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33607882	33607883	+	Intron	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33607882_33607883insG	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
AVEN	57099	broad.mit.edu	37	15	34166147	34166148	+	Intron	INS	-	C	C	rs140129166	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34166147_34166148insC	uc001zhj.2	-							NM_020371	NP_065104			cell death regulator aven						anti-apoptosis|apoptosis	endomembrane system|intracellular|membrane|membrane fraction	protein binding			kidney(1)	1		all_lung(180;1.78e-08)		all cancers(64;1.66e-15)|GBM - Glioblastoma multiforme(113;1.42e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0359)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	38718258	38718258	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38718258delA								SPRED1 (68809 upstream) : FAM98B (28070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	38722904	38722904	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38722904delT								SPRED1 (73455 upstream) : FAM98B (23424 downstream)																																			---	---	---	---
FSIP1	161835	broad.mit.edu	37	15	39939766	39939767	+	Intron	INS	-	C	C	rs138729464	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39939766_39939767insC	uc001zki.2	-							NM_152597	NP_689810			fibrous sheath interacting protein 1											ovary(2)|skin(1)	3		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)														---	---	---	---
CASC4	113201	broad.mit.edu	37	15	44588127	44588128	+	Intron	INS	-	AT	AT			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44588127_44588128insAT	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron|CASC4_uc010bdu.1_Intron	NM_138423	NP_612432			cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)														---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49148769	49148769	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49148769delA	uc001zxb.1	-						SHC4_uc010uey.1_Intron|SHC4_uc010uez.1_Intron	NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	57654729	57654729	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57654729delA								LOC283663 (54764 upstream) : CGNL1 (13976 downstream)																																			---	---	---	---
FAM63B	54629	broad.mit.edu	37	15	59140945	59140945	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59140945delA	uc002afj.2	+						FAM63B_uc002afi.2_Intron|FAM63B_uc002afk.2_Intron|FAM63B_uc002afl.2_Intron	NM_001040450	NP_001035540			hypothetical protein LOC54629 isoform a											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	60180618	60180620	+	IGR	DEL	AAA	-	-	rs28396591	byFrequency	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60180618_60180620delAAA								BNIP2 (198976 upstream) : FOXB1 (115801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73154330	73154330	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73154330delA								ADPGK (77663 upstream) : NEO1 (190545 downstream)																																			---	---	---	---
CYP1A2	1544	broad.mit.edu	37	15	75046316	75046316	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75046316delA	uc002ayr.1	+							NM_000761	NP_000752			cytochrome P450, family 1, subfamily A,						alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)													---	---	---	---
MPI	4351	broad.mit.edu	37	15	75182322	75182322	+	5'Flank	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75182322delG	uc002azc.1	+						MPI_uc010ulv.1_5'Flank|MPI_uc010ulw.1_5'Flank|MPI_uc002azd.1_5'Flank|MPI_uc010ulx.1_5'Flank|MPI_uc002aze.1_5'Flank	NM_002435	NP_002426			mannose-6- phosphate isomerase						dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	mannose-6-phosphate isomerase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
UBE2Q2	92912	broad.mit.edu	37	15	76147522	76147522	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76147522delT	uc002bbg.2	+						UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Intron	NM_173469	NP_775740			ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	79141884	79141885	+	IGR	INS	-	ACAT	ACAT	rs4353455	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79141884_79141885insACAT								ADAMTS7 (38111 upstream) : MORF4L1 (23287 downstream)																																			---	---	---	---
IL16	3603	broad.mit.edu	37	15	81577422	81577422	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81577422delT	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron|IL16_uc002bgi.1_Intron	NM_172217	NP_757366			interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	81780065	81780065	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81780065delT								TMC3 (113647 upstream) : MEX3B (554063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	86460546	86460546	+	IGR	DEL	T	-	-	rs67121361		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86460546delT								KLHL25 (122357 upstream) : AGBL1 (224696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	87846944	87846946	+	IGR	DEL	ATT	-	-	rs112792286		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87846944_87846946delATT								AGBL1 (274661 upstream) : NCRNA00052 (273214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88029193	88029194	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88029193_88029194insT								AGBL1 (456910 upstream) : NCRNA00052 (90966 downstream)																																			---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88455852	88455853	+	Intron	INS	-	CTCT	CTCT	rs143270035	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88455852_88455853insCTCT	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron	NM_001012338	NP_001012338			neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88504263	88504279	+	Intron	DEL	AACACAGGTGAAGTTTA	-	-	rs112913253		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88504263_88504279delAACACAGGTGAAGTTTA	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron	NM_001012338	NP_001012338			neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88998831	88998831	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88998831delT								NTRK3 (199170 upstream) : MRPL46 (3877 downstream)																																			---	---	---	---
RHCG	51458	broad.mit.edu	37	15	90024683	90024683	+	Intron	DEL	A	-	-	rs76730652		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90024683delA	uc002bnz.2	-						RHCG_uc002bny.2_5'Flank|RHCG_uc002boa.2_Intron|RHCG_uc010bnq.1_Intron	NM_016321	NP_057405			Rh family, C glycoprotein						amine transport|cellular ion homeostasis|epithelial cell differentiation|transepithelial ammonium transport	apical plasma membrane|basolateral plasma membrane|cytoplasmic vesicle|integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			kidney(1)	1	Lung NSC(78;0.0237)|all_lung(78;0.0478)																	---	---	---	---
UNC45A	55898	broad.mit.edu	37	15	91489774	91489774	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91489774delG	uc002bqg.2	+						UNC45A_uc002bqd.2_Intron|UNC45A_uc010uqr.1_5'Flank|UNC45A_uc002bqi.2_5'Flank	NM_018671	NP_061141			smooth muscle cell associated protein-1 isoform						cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93422987	93422989	+	IGR	DEL	AAA	-	-	rs34580235		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93422987_93422989delAAA								FAM174B (145683 upstream) : CHD2 (6444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96995290	96995291	+	IGR	INS	-	TCTCTC	TCTCTC	rs140234850	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96995290_96995291insTCTCTC								NR2F2 (111800 upstream) : SPATA8 (331388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98229147	98229148	+	IGR	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98229147_98229148delCA								SPATA8 (900303 upstream) : LOC91948 (56698 downstream)																																			---	---	---	---
LOC91948	91948	broad.mit.edu	37	15	98344970	98344970	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98344970delA	uc002buh.1	-						LOC91948_uc002bug.1_Intron	NR_024173				SubName: Full=Putative uncharacterized protein ENSP00000381347;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	101251160	101251160	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101251160delT								ASB7 (59258 upstream) : ALDH1A3 (168849 downstream)																																			---	---	---	---
ALDH1A3	220	broad.mit.edu	37	15	101434832	101434832	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101434832delC	uc002bwn.3	+						ALDH1A3_uc010bpb.2_Intron|uc002bwo.1_RNA	NM_000693	NP_000684			aldehyde dehydrogenase 1A3						retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)													---	---	---	---
C16orf73	254528	broad.mit.edu	37	16	1893699	1893699	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1893699delA	uc002cne.2	-						C16orf73_uc010uvq.1_Intron|C16orf73_uc010uvr.1_Intron	NM_152764	NP_689977			hypothetical protein LOC254528 isoform 2						meiosis	cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	5470986	5470988	+	Intron	DEL	TCC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5470986_5470988delTCC	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	5889733	5889733	+	IGR	DEL	T	-	-	rs79057655		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5889733delT								FAM86A (741944 upstream) : A2BP1 (179399 downstream)																																			---	---	---	---
ATF7IP2	80063	broad.mit.edu	37	16	10486196	10486196	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10486196delT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron	NM_024997	NP_079273			activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	10613496	10613497	+	IGR	DEL	CC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10613496_10613497delCC								ATF7IP2 (36002 upstream) : EMP2 (8783 downstream)																																			---	---	---	---
C16orf45	89927	broad.mit.edu	37	16	15575075	15575075	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15575075delA	uc002ddo.2	+							NM_033201	NP_149978			hypothetical protein LOC89927 isoform 1											ovary(1)	1																		---	---	---	---
KIAA0430	9665	broad.mit.edu	37	16	15704423	15704423	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15704423delA	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462			limkain b1							peroxisome	nucleotide binding|RNA binding				0																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17215250	17215251	+	Intron	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17215250_17215251delTG	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17557398	17557398	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17557398delA	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
C16orf62	57020	broad.mit.edu	37	16	19683665	19683665	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19683665delA	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron	NM_020314	NP_064710			hypothetical protein LOC57020							integral to membrane				ovary(1)	1																		---	---	---	---
LOC653786	653786	broad.mit.edu	37	16	22586480	22586481	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22586480_22586481insA	uc002dlh.3	+							NR_003676				RecName: Full=Otoancorin; Flags: Precursor;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	22693499	22693500	+	IGR	INS	-	A	A	rs138708297		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22693499_22693500insA								LOC653786 (105313 upstream) : HS3ST2 (132360 downstream)																																			---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	23995931	23995931	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23995931delA	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24741818	24741818	+	Intron	DEL	A	-	-	rs115981479		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24741818delA	uc002dmm.2	+							NM_014494	NP_055309			trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
IL21R	50615	broad.mit.edu	37	16	27440577	27440577	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27440577delT	uc002doq.1	+						IL21R_uc002dor.1_Intron|IL21R_uc002dos.1_Intron	NM_181078	NP_851564			interleukin 21 receptor precursor						natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4								T	BCL6	NHL								---	---	---	---
KIAA0556	23247	broad.mit.edu	37	16	27784595	27784595	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27784595delG	uc002dow.2	+							NM_015202	NP_056017			hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8																		---	---	---	---
GSG1L	146395	broad.mit.edu	37	16	27805330	27805331	+	Intron	INS	-	TTTG	TTTG	rs138140087	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27805330_27805331insTTTG	uc002doz.2	-						GSG1L_uc010bya.1_Intron|GSG1L_uc010bxz.1_Intron|GSG1L_uc002doy.2_Intron	NM_001109763	NP_001103233			GSG1-like isoform 1							integral to membrane				ovary(1)	1																		---	---	---	---
LOC595101	595101	broad.mit.edu	37	16	30341483	30341483	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30341483delA	uc002dxp.1	-							NR_002453				Homo sapiens cDNA FLJ39663 fis, clone SMINT2007187.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32407001	32407002	+	IGR	INS	-	T	T	rs140894241		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32407001_32407002insT								HERC2P4 (243127 upstream) : TP53TG3B (277839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32516050	32516054	+	IGR	DEL	GAAAA	-	-	rs149333899		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32516050_32516054delGAAAA								HERC2P4 (352176 upstream) : TP53TG3B (168787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32550598	32550599	+	IGR	DEL	CT	-	-	rs146554747		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32550598_32550599delCT								HERC2P4 (386724 upstream) : TP53TG3B (134242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32555998	32555998	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32555998delA								HERC2P4 (392124 upstream) : TP53TG3B (128843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32559704	32559704	+	IGR	DEL	T	-	-	rs79174964		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32559704delT								HERC2P4 (395830 upstream) : TP53TG3B (125137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33332034	33332034	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33332034delA								SLC6A10P (435571 upstream) : MIR1826 (633474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33413684	33413685	+	IGR	INS	-	TTT	TTT	rs138008730		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33413684_33413685insTTT								SLC6A10P (517221 upstream) : MIR1826 (551823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33583341	33583341	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33583341delA								SLC6A10P (686878 upstream) : MIR1826 (382167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33981693	33981693	+	IGR	DEL	T	-	-	rs112939643		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33981693delT								MIR1826 (16101 upstream) : UBE2MP1 (422109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46448230	46448230	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46448230delA								None (None upstream) : ANKRD26P1 (55019 downstream)																																			---	---	---	---
FTO	79068	broad.mit.edu	37	16	54131656	54131657	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54131656_54131657delAC	uc002ehr.2	+						FTO_uc010vha.1_Intron|FTO_uc010cbz.2_Intron|FTO_uc002ehs.2_Intron	NM_001080432	NP_001073901			fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	54345675	54345676	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54345675_54345676insT								IRX3 (25297 upstream) : IRX5 (619435 downstream)																																			---	---	---	---
LPCAT2	54947	broad.mit.edu	37	16	55543483	55543483	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55543483delG	uc002eie.3	+							NM_017839	NP_060309			lysophosphatidylcholine acyltransferase 2						cellular membrane organization|platelet activating factor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|Golgi stack|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding				0																		---	---	---	---
SLC6A2	6530	broad.mit.edu	37	16	55707170	55707170	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55707170delC	uc002eif.2	+						SLC6A2_uc010ccd.2_Intron|SLC6A2_uc002eig.2_Intron|SLC6A2_uc002eih.2_Intron|SLC6A2_uc002eii.2_Intron	NM_001043	NP_001034			solute carrier family 6 member 2						synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	57534961	57534961	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57534961delC								DOK4 (14576 upstream) : CCDC102A (11131 downstream)																																			---	---	---	---
KIFC3	3801	broad.mit.edu	37	16	57838818	57838819	+	5'Flank	DEL	TT	-	-	rs35708215		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57838818_57838819delTT	uc002emp.2	-						KIFC3_uc002emq.2_5'Flank|KIFC3_uc010vhz.1_5'Flank|KIFC3_uc002emr.1_Intron	NM_005550	NP_005541			kinesin family member C3 isoform 1						epithelial cell-cell adhesion|microtubule-based movement|visual perception|zonula adherens maintenance	centrosome|cytoplasmic vesicle membrane|kinesin complex|microtubule|zonula adherens	ATP binding|microtubule motor activity			central_nervous_system(2)|ovary(1)	3		all_neural(199;0.224)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	59039463	59039463	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59039463delA								GOT2 (271217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59155353	59155353	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59155353delT								GOT2 (387107 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60307536	60307537	+	IGR	DEL	TG	-	-	rs143729243		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60307536_60307537delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62581442	62581443	+	IGR	DEL	GT	-	-	rs140356229	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62581442_62581443delGT								CDH8 (511406 upstream) : None (None downstream)																																			---	---	---	---
DYNC1LI2	1783	broad.mit.edu	37	16	66757487	66757488	+	3'UTR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66757487_66757488insT	uc002eqb.1	-	13					DYNC1LI2_uc010vis.1_3'UTR	NM_006141	NP_006132			dynein, cytoplasmic, light intermediate						transport	centrosome|cytoplasmic dynein complex|microtubule	ATP binding|motor activity			central_nervous_system(3)|skin(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)														---	---	---	---
CES2	8824	broad.mit.edu	37	16	66978887	66978887	+	3'UTR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66978887delT	uc002eqr.2	+	12					CES2_uc002eqq.2_3'UTR|CES2_uc002eqs.2_3'UTR	NM_003869	NP_003860			carboxylesterase 2 isoform 1						catabolic process	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)														---	---	---	---
PSKH1	5681	broad.mit.edu	37	16	67949111	67949112	+	Intron	INS	-	GT	GT	rs149427599	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67949111_67949112insGT	uc002euv.2	+							NM_006742	NP_006733			protein serine kinase H1							endoplasmic reticulum membrane|Golgi apparatus|microtubule organizing center|nuclear speck|plasma membrane	ATP binding|protein serine/threonine kinase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)														---	---	---	---
SLC12A4	6560	broad.mit.edu	37	16	67983354	67983354	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67983354delA	uc002euz.2	-						SLC12A4_uc010ceu.2_Intron|SLC12A4_uc010vkh.1_Intron|SLC12A4_uc010vki.1_Intron|SLC12A4_uc010vkj.1_Intron|SLC12A4_uc002eva.2_Intron|SLC12A4_uc010cev.1_5'Flank|SLC12A4_uc002evb.2_Intron	NM_005072	NP_005063			solute carrier family 12, member 4 isoform a						cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---
SMPD3	55512	broad.mit.edu	37	16	68472583	68472583	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68472583delT	uc002ewa.2	-							NM_018667	NP_061137			neutral sphingomyelin phosphodiesterase 3						cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)													---	---	---	---
CDH1	999	broad.mit.edu	37	16	68826135	68826135	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68826135delT	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351			cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
NFAT5	10725	broad.mit.edu	37	16	69694714	69694714	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69694714delT	uc002exm.1	+						NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Intron|NFAT5_uc002exj.1_Intron|NFAT5_uc002exk.1_Intron|NFAT5_uc002exl.1_Intron|NFAT5_uc002exn.1_Intron	NM_006599	NP_006590			nuclear factor of activated T-cells 5 isoform c						excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
DDX19A	55308	broad.mit.edu	37	16	70351677	70351678	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70351677_70351678insA	uc002eys.2	+						DDX19B_uc010vly.1_Intron|DDX19B_uc010vlv.1_Intron|DDX19B_uc010vlw.1_Intron|DDX19B_uc002eyo.2_Intron|DDX19B_uc002eyp.2_Intron|DDX19B_uc002eyq.2_Intron|DDX19B_uc002eyr.2_Intron|DDX19B_uc010vlx.1_Intron|uc002eyt.2_Intron	NM_007242	NP_009173			DEAD (Asp-Glu-Ala-As) box polypeptide 19 isoform						mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	74236843	74236843	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74236843delA	uc002fcp.1	-											Homo sapiens, clone IMAGE:5167766, mRNA.																														---	---	---	---
RFWD3	55159	broad.mit.edu	37	16	74684373	74684373	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74684373delT	uc002fda.2	-						RFWD3_uc010cgq.2_Intron	NM_018124	NP_060594			ring finger and WD repeat domain 3						DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3																		---	---	---	---
WDR59	79726	broad.mit.edu	37	16	74936336	74936337	+	Intron	INS	-	A	A	rs145936015	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74936336_74936337insA	uc002fdh.1	-						WDR59_uc002fdf.1_Intron|WDR59_uc002fdg.1_Intron	NM_030581	NP_085058			WD repeat domain 59											ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	75247338	75247338	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75247338delT								CTRB2 (6266 upstream) : CTRB1 (5546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79731534	79731534	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79731534delT								MAF (96912 upstream) : DYNLRB2 (843320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	80976756	80976757	+	IGR	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80976756_80976757delAA								CDYL2 (138581 upstream) : C16orf61 (32944 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83342988	83342989	+	Intron	INS	-	T	T	rs144221361	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83342988_83342989insT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	85808480	85808482	+	IGR	DEL	AAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85808480_85808482delAAC								C16orf74 (23791 upstream) : COX4NB (3751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86096862	86096871	+	IGR	DEL	GGAAGGAGAG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86096862_86096871delGGAAGGAGAG								IRF8 (140653 upstream) : LOC732275 (268585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86277102	86277102	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86277102delT								IRF8 (320893 upstream) : LOC732275 (88354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88226355	88226357	+	IGR	DEL	CAG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88226355_88226357delCAG								BANP (115432 upstream) : ZNF469 (267522 downstream)																																			---	---	---	---
CDK10	8558	broad.mit.edu	37	16	89757692	89757692	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89757692delA	uc010cio.2	+						CDK10_uc002foa.2_Intron|CDK10_uc010cip.2_Intron|CDK10_uc010vpl.1_Intron|CDK10_uc002fob.2_Intron|CDK10_uc002fod.2_Intron|CDK10_uc002foe.2_Intron|CDK10_uc002fof.2_Intron|CDK10_uc002fog.3_Intron|CDK10_uc002foh.3_Intron	NM_052988	NP_443714			cyclin-dependent kinase 10 isoform a						negative regulation of cell proliferation|traversing start control point of mitotic cell cycle		ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	1608326	1608327	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1608326_1608327insT								PRPF8 (20150 upstream) : C17orf91 (6477 downstream)																																			---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2016559	2016559	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2016559delG	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2816589	2816590	+	Intron	INS	-	T	T	rs71359187		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2816589_2816590insT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900			RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
SPAG7	9552	broad.mit.edu	37	17	4867653	4867655	+	Intron	DEL	TTT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4867653_4867655delTTT	uc002gae.2	-						SPAG7_uc002gad.2_Intron|SPAG7_uc002gaf.2_Intron	NM_004890	NP_004881			sperm associated antigen 7							nucleus	nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C17orf87	388325	broad.mit.edu	37	17	5114820	5114820	+	Intron	DEL	A	-	-	rs77543539		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5114820delA	uc002gbh.2	-						uc002gbf.1_Intron|uc002gbg.1_Intron|C17orf87_uc010clb.1_Intron	NM_207103	NP_996986			hypothetical protein LOC388325							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	5832581	5832582	+	Intron	INS	-	T	T	rs139038325	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5832581_5832582insT	uc002gcm.2	+											Homo sapiens hypothetical protein LOC339166, mRNA (cDNA clone IMAGE:5163423), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	8292210	8292210	+	IGR	DEL	A	-	-	rs113584102		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8292210delA								RPL26 (5645 upstream) : RNF222 (1813 downstream)																																			---	---	---	---
GAS7	8522	broad.mit.edu	37	17	10016076	10016077	+	Intron	INS	-	AAAAAGAAAGAAAG	AAAAAGAAAGAAAG	rs149640007	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10016076_10016077insAAAAAGAAAGAAAG	uc002gmg.1	-						GAS7_uc010coh.1_Intron	NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10548361	10548362	+	Intron	INS	-	T	T	rs138797369		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10548361_10548362insT	uc002gmq.1	-							NM_002470	NP_002461			myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11513137	11513137	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11513137delG	uc002gne.2	+						DNAH9_uc002gnd.1_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	13538514	13538514	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13538514delA								HS3ST3A1 (33270 upstream) : CDRT15P (389301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13951779	13951779	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13951779delT	uc002goe.1	-											Homo sapiens cDNA FLJ25311 fis, clone SYN01066.																														---	---	---	---
COX10	1352	broad.mit.edu	37	17	14028648	14028648	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14028648delG	uc002gof.3	+						COX10_uc010vvs.1_Intron|COX10_uc010vvt.1_Intron	NM_001303	NP_001294			heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)														---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16069132	16069136	+	Intron	DEL	CTACC	-	-	rs112479163		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16069132_16069136delCTACC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	17203512	17203519	+	IGR	DEL	TGTGTGTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17203512_17203519delTGTGTGTG								COPS3 (18921 upstream) : NT5M (3161 downstream)																																			---	---	---	---
MYO15A	51168	broad.mit.edu	37	17	18044663	18044665	+	Intron	DEL	ATA	-	-	rs74811365		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18044663_18044665delATA	uc010vxh.1	+							NM_016239	NP_057323			myosin XV						sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)															OREG0024223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
RNF112	7732	broad.mit.edu	37	17	19314918	19314919	+	Intron	DEL	TT	-	-	rs35694276		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19314918_19314919delTT	uc010vyw.1	+						RNF112_uc010vyu.1_Intron|RNF112_uc010vyv.1_Intron|RNF112_uc010vyx.1_5'Flank	NM_007148	NP_009079			ring finger protein 112								GTP binding|GTPase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21223391	21223391	+	IGR	DEL	C	-	-	rs67148773		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223391delC								MAP2K3 (4842 upstream) : KCNJ12 (56308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21526577	21526578	+	IGR	INS	-	T	T	rs141423063		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21526577_21526578insT								C17orf51 (48846 upstream) : FAM27L (298792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22216386	22216386	+	IGR	DEL	C	-	-	rs139395717	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22216386delC								FLJ36000 (303316 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25265807	25265821	+	IGR	DEL	GAATCAAATGGAATT	-	-	rs144147151		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25265807_25265821delGAATCAAATGGAATT								None (None upstream) : WSB1 (355285 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25285867	25285868	+	IGR	INS	-	CCT	CCT	rs111946477		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25285867_25285868insCCT								None (None upstream) : WSB1 (335238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26595506	26595506	+	5'Flank	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26595506delC	uc002hac.2	-						uc002had.2_5'Flank|uc010wad.1_5'Flank|uc002hae.1_5'Flank|uc002haf.1_5'Flank|uc002hah.2_5'Flank|uc002hai.1_5'Flank|uc002haj.2_5'Flank|uc002hak.1_5'Flank|uc002hal.2_5'Flank|uc002ham.1_5'Flank					Homo sapiens cDNA clone IMAGE:5269062.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	27080049	27080050	+	IGR	INS	-	A	A	rs12325788		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27080049_27080050insA								TRAF4 (2074 upstream) : C17orf63 (2946 downstream)																																			---	---	---	---
SSH2	85464	broad.mit.edu	37	17	28015026	28015027	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28015026_28015027insT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron|SSH2_uc002heq.2_Intron|SSH2_uc002her.2_Intron|SSH2_uc010csc.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
CRLF3	51379	broad.mit.edu	37	17	29120865	29120865	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29120865delT	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070			cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	29920566	29920567	+	IGR	INS	-	AC	AC	rs138970331	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29920566_29920567insAC								MIR365-2 (18026 upstream) : C17orf79 (258318 downstream)																																			---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31664453	31664453	+	Intron	DEL	G	-	-	rs5820032		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31664453delG	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
TAF15	8148	broad.mit.edu	37	17	34151926	34151926	+	Intron	DEL	A	-	-	rs111802572		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34151926delA	uc002hkd.2	+						TAF15_uc010ctw.1_Intron|TAF15_uc002hkc.2_Intron	NM_139215	NP_631961			TBP-associated factor 15 isoform 1						positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)				T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								---	---	---	---
DUSP14	11072	broad.mit.edu	37	17	35871007	35871007	+	Intron	DEL	T	-	-	rs76363418		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35871007delT	uc002hnx.2	+						DUSP14_uc002hny.2_Intron|DUSP14_uc002hnz.2_Intron	NM_007026	NP_008957			dual specificity phosphatase 14								MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	41483728	41483728	+	IGR	DEL	T	-	-	rs67153015		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41483728delT								ARL4D (5225 upstream) : MIR2117 (38446 downstream)																																			---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44246690	44246693	+	Intron	DEL	AACT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44246690_44246693delAACT	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44269837	44269841	+	5'UTR	DEL	AAGAG	-	-	rs141752007		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44269837_44269841delAAGAG	uc002ikc.2	-	1					KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron|uc002ike.2_5'Flank	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	44339889	44339889	+	IGR	DEL	T	-	-	rs111453710		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44339889delT								KIAA1267 (37172 upstream) : ARL17B (23974 downstream)																																			---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46298511	46298511	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46298511delC	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	47027897	47027897	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47027897delT								SNF8 (5743 upstream) : GIP (8021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50623998	50623998	+	IGR	DEL	T	-	-	rs11286420		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50623998delT								CA10 (386621 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51068810	51068811	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51068810_51068811insA								CA10 (831433 upstream) : KIF2B (831428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52435702	52435703	+	IGR	DEL	TT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52435702_52435703delTT								KIF2B (533129 upstream) : TOM1L1 (542349 downstream)																																			---	---	---	---
MMD	23531	broad.mit.edu	37	17	53491918	53491921	+	Intron	DEL	CACA	-	-	rs145177163		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53491918_53491921delCACA	uc002iui.2	-							NM_012329	NP_036461			monocyte to macrophage						cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	53772749	53772752	+	IGR	DEL	AAAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53772749_53772752delAAAC								MMD (273408 upstream) : TMEM100 (24238 downstream)																																			---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56677920	56677921	+	Intron	INS	-	A	A	rs150442857		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56677920_56677921insA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
SKA2	348235	broad.mit.edu	37	17	57222716	57222716	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57222716delC	uc002ixd.2	-						SKA2_uc010dde.1_Intron|SKA2_uc002ixe.2_Intron	NM_182620	NP_872426			spindle and KT associated 2 isoform 1						cell division|chromosome segregation|mitotic anaphase|mitotic prometaphase|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytosol|spindle microtubule	microtubule binding				0																		---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	58829516	58829517	+	Intron	INS	-	GT	GT	rs146242699	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58829516_58829517insGT	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59414743	59414743	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59414743delG	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
MRC2	9902	broad.mit.edu	37	17	60719256	60719257	+	Intron	INS	-	TGTG	TGTG	rs138080924	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60719256_60719257insTGTG	uc002jad.2	+						MRC2_uc002jac.2_Intron	NM_006039	NP_006030			mannose receptor, C type 2						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
MARCH10	162333	broad.mit.edu	37	17	60870870	60870872	+	Intron	DEL	CAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60870870_60870872delCAC	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345			ring finger protein 190								ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	60986024	60986024	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60986024delA								MARCH10 (100319 upstream) : MIR633 (35552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	61006199	61006199	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61006199delT								MARCH10 (120494 upstream) : MIR633 (15377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	62113607	62113607	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62113607delT								ICAM2 (15613 upstream) : ERN1 (6783 downstream)																																			---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62864850	62864851	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62864850_62864851insT	uc002jey.2	-						LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron|LRRC37A3_uc010dek.1_Intron	NM_199340	NP_955372			leucine rich repeat containing 37, member A3							integral to membrane					0																		---	---	---	---
AXIN2	8313	broad.mit.edu	37	17	63622806	63622806	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63622806delT	uc010den.1	-							NM_004655	NP_004646			axin 2						cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2														Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64584443	64584443	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64584443delG	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	65763741	65763741	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65763741delT								NOL11 (23475 upstream) : BPTF (58039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69091743	69091744	+	IGR	INS	-	TGTG	TGTG	rs143009537	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69091743_69091744insTGTG								KCNJ2 (915562 upstream) : None (None downstream)																																			---	---	---	---
C17orf77	146723	broad.mit.edu	37	17	72583991	72583991	+	Intron	DEL	A	-	-	rs68081603		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72583991delA	uc002jla.1	+						CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673			hypothetical protein LOC146723							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	74776407	74776408	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74776407_74776408insT								MFSD11 (1071 upstream) : MGAT5B (88390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75723751	75723758	+	IGR	DEL	CTCTCTCA	-	-	rs68075023		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75723751_75723758delCTCTCTCA								SEPT9 (227075 upstream) : FLJ45079 (151351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	76256914	76256914	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76256914delC								LOC283999 (19847 upstream) : SOCS3 (95945 downstream)																																			---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77190836	77190841	+	Intron	DEL	GTGTGT	-	-	rs112462442		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77190836_77190841delGTGTGT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77310730	77310731	+	Intron	INS	-	T	T	rs140905387	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77310730_77310731insT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	80310229	80310229	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80310229delC								SECTM1 (18308 upstream) : TEX19 (6895 downstream)																																	OREG0024823	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80917237	80917238	+	Intron	INS	-	TG	TG	rs149535358	by1000genomes;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80917237_80917238insTG	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron|B3GNTL1_uc002kge.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
LPIN2	9663	broad.mit.edu	37	18	2982904	2982904	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2982904delA	uc002klo.2	-							NM_014646	NP_055461			lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	3364346	3364346	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3364346delG								MYL12B (86066 upstream) : TGIF1 (47726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10727629	10727630	+	IGR	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10727629_10727630delCA								FAM38B (25650 upstream) : GNAL (961506 downstream)																																			---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11697772	11697774	+	Intron	DEL	AAG	-	-	rs10591897		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11697772_11697774delAAG	uc002kqc.2	+							NM_182978	NP_892023			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
IMPA2	3613	broad.mit.edu	37	18	12002762	12002763	+	Intron	INS	-	A	A	rs57245640		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12002762_12002763insA	uc002kqp.1	+						IMPA2_uc002kqo.1_Intron|IMPA2_uc010dlb.1_Intron|IMPA2_uc002kqq.1_Intron	NM_014214	NP_055029			inositol(myo)-1(or 4)-monophosphatase 2						inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	13800249	13800249	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13800249delA								RNMT (35695 upstream) : MC5R (25516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14390382	14390382	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14390382delA								LOC284233 (47860 upstream) : CXADRP3 (87574 downstream)																																			---	---	---	---
GATA6	2627	broad.mit.edu	37	18	19762311	19762311	+	Intron	DEL	T	-	-	rs140283605		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19762311delT	uc002ktt.1	+						GATA6_uc002ktu.1_Intron	NM_005257	NP_005248			GATA binding protein 6						blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(3)	3	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)															---	---	---	---
CABLES1	91768	broad.mit.edu	37	18	20764273	20764274	+	Intron	DEL	GT	-	-	rs111324965		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20764273_20764274delGT	uc002kuc.2	+						CABLES1_uc002kub.2_Intron|CABLES1_uc002kud.2_Intron	NM_001100619	NP_001094089			Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21530815	21530815	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21530815delA	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
OSBPL1A	114876	broad.mit.edu	37	18	21792038	21792038	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21792038delT	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron|OSBPL1A_uc002kvf.3_Intron	NM_080597	NP_542164			oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	22211548	22211550	+	Intron	DEL	CTC	-	-	rs17187835	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22211548_22211550delCTC	uc002kvj.1	+											Homo sapiens cDNA FLJ42358 fis, clone UTERU2023262.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	25183402	25183403	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25183402_25183403insT								C18orf16 (412752 upstream) : CDH2 (347527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	25855882	25855883	+	IGR	INS	-	T	T	rs144247998	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25855882_25855883insT								CDH2 (98437 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	26782981	26782981	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26782981delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27866410	27866410	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27866410delA								None (None upstream) : MIR302F (12466 downstream)																																			---	---	---	---
KIAA1012	22878	broad.mit.edu	37	18	29439059	29439062	+	Intron	DEL	AAAC	-	-	rs113697766		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29439059_29439062delAAAC	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754			hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32454434	32454434	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32454434delA	uc010dmn.1	+						DTNA_uc002kxw.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381			dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34185857	34185857	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34185857delG	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron|FHOD3_uc002kzu.1_Intron|FHOD3_uc010dmz.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	35500305	35500305	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35500305delG								CELF4 (354305 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	35959871	35959871	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35959871delT								CELF4 (813871 upstream) : LOC647946 (827017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	36468643	36468644	+	IGR	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36468643_36468644delGA								None (None upstream) : LOC647946 (318244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38038987	38038988	+	IGR	DEL	AG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38038987_38038988delAG								LOC647946 (658705 upstream) : None (None downstream)																																			---	---	---	---
RIT2	6014	broad.mit.edu	37	18	40479421	40479421	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40479421delT	uc002lav.2	-						RIT2_uc010dnf.2_Intron	NM_002930	NP_002921			Ras-like without CAAX 2						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	41890578	41890578	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41890578delT								None (None upstream) : SETBP1 (369560 downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42491906	42491907	+	Intron	INS	-	CA	CA	rs145514189	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42491906_42491907insCA	uc010dni.2	+							NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
ST8SIA5	29906	broad.mit.edu	37	18	44290510	44290510	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44290510delT	uc002lcj.1	-						ST8SIA5_uc002lci.1_Intron|ST8SIA5_uc010xcy.1_Intron|ST8SIA5_uc010xcz.1_Intron|ST8SIA5_uc010dno.1_Intron	NM_013305	NP_037437			ST8 alpha-N-acetyl-neuraminide						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane				upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3																		---	---	---	---
ZBTB7C	201501	broad.mit.edu	37	18	45748308	45748308	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45748308delC	uc010dnw.2	-						ZBTB7C_uc010dny.1_Intron|ZBTB7C_uc010dnz.1_Intron|ZBTB7C_uc010dob.1_Intron|ZBTB7C_uc010doc.1_Intron|ZBTB7C_uc010dod.1_Intron|ZBTB7C_uc010doe.1_Intron|ZBTB7C_uc010dof.1_Intron|ZBTB7C_uc010dog.1_Intron|ZBTB7C_uc010doh.1_Intron|ZBTB7C_uc010doi.1_Intron|ZBTB7C_uc010doj.1_Intron|ZBTB7C_uc010dok.1_Intron|ZBTB7C_uc010dol.1_Intron|ZBTB7C_uc010doa.1_Intron|ZBTB7C_uc010don.1_Intron|ZBTB7C_uc010doo.1_Intron|ZBTB7C_uc010dop.1_Intron|ZBTB7C_uc010doq.1_Intron|ZBTB7C_uc010dor.1_Intron|ZBTB7C_uc010dos.1_Intron|ZBTB7C_uc010dot.1_Intron|ZBTB7C_uc010dou.1_Intron|ZBTB7C_uc010dom.1_Intron	NM_001039360	NP_001034449			zinc finger and BTB domain containing 7C							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
MEX3C	51320	broad.mit.edu	37	18	48713151	48713152	+	Intron	DEL	TT	-	-	rs139675862		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48713151_48713152delTT	uc002lfc.3	-							NM_016626	NP_057710			ring finger and KH domain containing 2							cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)														---	---	---	---
MBD2	8932	broad.mit.edu	37	18	51693464	51693464	+	Intron	DEL	A	-	-	rs34411987		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51693464delA	uc002lfg.1	-							NM_003927	NP_003918			methyl-CpG binding domain protein 2 isoform 1						transcription, DNA-dependent		C2H2 zinc finger domain binding|methyl-CpG binding|satellite DNA binding				0				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)	Hexobarbital(DB01355)													---	---	---	---
CCDC68	80323	broad.mit.edu	37	18	52597845	52597845	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52597845delC	uc002lfs.2	-						CCDC68_uc002lft.2_Intron	NM_001143829	NP_001137301			coiled-coil domain containing 68											skin(1)	1				Colorectal(16;0.0256)|READ - Rectum adenocarcinoma(59;0.21)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	53702337	53702337	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53702337delG								TCF4 (399152 upstream) : TXNL1 (567718 downstream)																																			---	---	---	---
ONECUT2	9480	broad.mit.edu	37	18	55145103	55145104	+	3'UTR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55145103_55145104insA	uc002lgo.2	+	2						NM_004852	NP_004843			one cut domain, family member 2						organ morphogenesis	nucleus	sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	56695134	56695134	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56695134delC								ZNF532 (41431 upstream) : LOC390858 (7837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	59269037	59269037	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59269037delG								CDH20 (46672 upstream) : RNF152 (213267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61138162	61138163	+	IGR	INS	-	GGAGGAGAAG	GGAGGAGAAG	rs143037043	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61138162_61138163insGGAGGAGAAG								VPS4B (48410 upstream) : SERPINB5 (5981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61944470	61944470	+	Intron	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61944470delG	uc002ljx.2	+											Homo sapiens hypothetical protein LOC284294, mRNA (cDNA clone IMAGE:4823205).																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	66024083	66024083	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66024083delG								DSEL (840116 upstream) : TMX3 (316844 downstream)																																			---	---	---	---
SOCS6	9306	broad.mit.edu	37	18	67971478	67971479	+	Intron	INS	-	AAG	AAG	rs142601197	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67971478_67971479insAAG	uc002lkr.1	+							NM_004232	NP_004223			suppressor of cytokine signaling 6						defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	72001564	72001565	+	IGR	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72001564_72001565delGA								CYB5A (42343 upstream) : FAM69C (101399 downstream)																																			---	---	---	---
ZNF407	55628	broad.mit.edu	37	18	72476008	72476008	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72476008delT	uc002llw.2	+						ZNF407_uc010xfc.1_Intron|ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227			zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	75167663	75167663	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75167663delT								GALR1 (185569 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75609150	75609150	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75609150delT								GALR1 (627056 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	77715231	77715231	+	IGR	DEL	T	-	-	rs141445945	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77715231delT								PQLC1 (3578 upstream) : HSBP1L1 (9351 downstream)																																			---	---	---	---
POLR2E	5434	broad.mit.edu	37	19	1094543	1094543	+	Intron	DEL	A	-	-	rs111734678		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1094543delA	uc002lre.3	-						POLR2E_uc010xgf.1_Intron	NM_002695	NP_002686			DNA directed RNA polymerase II polypeptide E						interspecies interaction between organisms|mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2557313	2557314	+	Intron	DEL	AC	-	-	rs76966814		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2557313_2557314delAC	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2602899	2602900	+	Intron	INS	-	TTTCTTTCTTTCT	TTTCTTTCTTTCT	rs151103355	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2602899_2602900insTTTCTTTCTTTCT	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	2726294	2726294	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2726294delA								DIRAS1 (4904 upstream) : SLC39A3 (5908 downstream)																																			---	---	---	---
CELF5	60680	broad.mit.edu	37	19	3267088	3267093	+	Intron	DEL	TGTGTG	-	-	rs72295446		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3267088_3267093delTGTGTG	uc002lxm.2	+						CELF5_uc002lxl.1_Intron|CELF5_uc010dtj.1_Intron|CELF5_uc010xhg.1_Intron	NM_021938	NP_068757			bruno-like 5, RNA binding protein						mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
CREB3L3	84699	broad.mit.edu	37	19	4166252	4166253	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4166252_4166253insT	uc002lzl.2	+						CREB3L3_uc002lzm.2_Intron|CREB3L3_uc010xib.1_Intron|CREB3L3_uc010xic.1_Intron	NM_032607	NP_115996			cAMP responsive element binding protein 3-like						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	4599135	4599136	+	IGR	INS	-	C	C	rs148979520	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4599135_4599136insC								SEMA6B (39364 upstream) : TNFAIP8L1 (40394 downstream)																																			---	---	---	---
ACSBG2	81616	broad.mit.edu	37	19	6148659	6148662	+	Intron	DEL	AAAA	-	-	rs72253336		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6148659_6148662delAAAA	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron	NM_030924	NP_112186			bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
C3	718	broad.mit.edu	37	19	6699254	6699255	+	Intron	INS	-	T	T	rs72994108	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6699254_6699255insT	uc002mfm.2	-							NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
INSR	3643	broad.mit.edu	37	19	7203594	7203594	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7203594delA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	8268986	8268987	+	IGR	INS	-	TT	TT	rs35835854		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8268986_8268987insTT								FBN3 (56605 upstream) : LASS4 (5230 downstream)																																			---	---	---	---
MUC16	94025	broad.mit.edu	37	19	8983265	8983266	+	Intron	INS	-	A	A	rs147856876	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8983265_8983266insA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9699425	9699425	+	IGR	DEL	T	-	-	rs139039734		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9699425delT								ZNF121 (4216 upstream) : ZNF561 (18578 downstream)																																			---	---	---	---
OLFM2	93145	broad.mit.edu	37	19	10003847	10003848	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10003847_10003848insT	uc002mmp.2	-							NM_058164	NP_477512			olfactomedin 2 precursor							extracellular region				large_intestine(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	12484639	12484640	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12484639_12484640insA								ZNF442 (8164 upstream) : ZNF799 (5371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13100121	13100121	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13100121delT								DAND5 (14554 upstream) : NFIX (6463 downstream)																																			---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13481768	13481768	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13481768delT	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
CLEC17A	388512	broad.mit.edu	37	19	14693778	14693779	+	5'Flank	DEL	TG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14693778_14693779delTG	uc010dzn.1	+						CLEC17A_uc002mzh.1_5'Flank|CLEC17A_uc010xnt.1_5'Flank|CLEC17A_uc010xnu.1_5'Flank|CLEC17A_uc010dzo.1_5'Flank					SubName: Full=CLEC17A protein;							cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0																		---	---	---	---
FCHO1	23149	broad.mit.edu	37	19	17896487	17896487	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17896487delA	uc010ebb.2	+						FCHO1_uc002nhg.3_Intron|FCHO1_uc002nhh.2_Intron|FCHO1_uc010xpw.1_Intron|FCHO1_uc002nhi.2_Intron|FCHO1_uc002nhj.2_Intron	NM_001161358	NP_001154830			FCH domain only 1 isoform b											breast(1)	1																		---	---	---	---
MAST3	23031	broad.mit.edu	37	19	18220371	18220374	+	Intron	DEL	GAGT	-	-	rs10580684		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18220371_18220374delGAGT	uc002nhz.3	+							NM_015016	NP_055831			microtubule associated serine/threonine kinase								ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5																		---	---	---	---
ZNF486	90649	broad.mit.edu	37	19	20283121	20283121	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20283121delT	uc002nou.2	+							NM_052852	NP_443084			zinc finger protein 486						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZNF826	664701	broad.mit.edu	37	19	20456156	20456156	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20456156delA	uc002now.1	-						ZNF826_uc010ecl.1_Intron					Homo sapiens cDNA FLJ44894 fis, clone BRAMY3000692, moderately similar to Zinc finger protein 91.												0																		---	---	---	---
ZNF708	7562	broad.mit.edu	37	19	21474216	21474216	+	3'UTR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21474216delA	uc002npq.1	-	4					ZNF708_uc002npr.1_3'UTR|ZNF708_uc010ecs.1_3'UTR	NM_021269	NP_067092			zinc finger protein 708						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	23692956	23692957	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23692956_23692957insA								ZNF91 (114687 upstream) : ZNF675 (142752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28504859	28504860	+	IGR	DEL	AA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28504859_28504860delAA								LOC148189 (220011 upstream) : LOC148145 (951180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29868527	29868528	+	Intron	INS	-	TA	TA	rs147965323	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29868527_29868528insTA	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	32116461	32116461	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32116461delC								TSHZ3 (276271 upstream) : ZNF507 (720053 downstream)																																			---	---	---	---
GPI	2821	broad.mit.edu	37	19	34855289	34855290	+	5'Flank	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34855289_34855290insT	uc002nvg.1	+						GPI_uc002nvf.2_5'Flank|GPI_uc010xrv.1_5'Flank|GPI_uc010xrw.1_5'Flank|GPI_uc010edl.1_5'Flank|GPI_uc002nvh.1_5'Flank	NM_000175	NP_000166			glucose phosphate isomerase						angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34996743	34996743	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34996743delC								WTIP (4659 upstream) : LOC643719 (70896 downstream)																																			---	---	---	---
NPHS1	4868	broad.mit.edu	37	19	36343207	36343208	+	5'Flank	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36343207_36343208delTC	uc002oby.2	-							NM_004646	NP_004637			nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	36488283	36488283	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36488283delA								SDHAF1 (1070 upstream) : C19orf46 (5719 downstream)																																			---	---	---	---
ZNF420	147923	broad.mit.edu	37	19	37607355	37607356	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37607355_37607356insT	uc002ofl.2	+							NM_144689	NP_653290			zinc finger protein 420						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
AKT2	208	broad.mit.edu	37	19	40753847	40753847	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40753847delA	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617			AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)					A		ovarian|pancreatic 								---	---	---	---
C19orf47	126526	broad.mit.edu	37	19	40837525	40837526	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40837525_40837526delAC	uc002oni.3	-						C19orf47_uc002ong.2_Intron|C19orf47_uc002onh.2_Intron	NM_178830	NP_849152			hypothetical protein LOC126526											ovary(1)|skin(1)	2			Lung(22;0.000636)															---	---	---	---
PPP1R13L	10848	broad.mit.edu	37	19	45905502	45905503	+	Intron	INS	-	T	T	rs149694246	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45905502_45905503insT	uc002pbn.2	-						PPP1R13L_uc002pbo.2_Intron|PPP1R13L_uc002pbp.2_Intron	NM_006663	NP_006654			protein phosphatase 1, regulatory subunit 13						apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)														---	---	---	---
OPA3	80207	broad.mit.edu	37	19	46067556	46067556	+	Intron	DEL	G	-	-	rs11327143		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46067556delG	uc002pck.3	-						OPA3_uc002pcj.3_Intron|OPA3_uc010xxk.1_Intron	NM_025136	NP_079412			OPA3 protein isoform b						response to stimulus|visual perception	mitochondrion					0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)														---	---	---	---
GNG8	94235	broad.mit.edu	37	19	47139091	47139094	+	5'Flank	DEL	GAGA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47139091_47139094delGAGA	uc010xyd.1	-							NM_033258	NP_150283			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	extracellular region|heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0		Ovarian(192;0.0798)|all_neural(266;0.107)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.000621)|Epithelial(262;0.0171)|GBM - Glioblastoma multiforme(486;0.0325)														---	---	---	---
SAE1	10055	broad.mit.edu	37	19	47686865	47686865	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47686865delT	uc002pgc.2	+						SAE1_uc002pgd.2_Intron|SAE1_uc010ekx.2_Intron|SAE1_uc010ekw.2_Intron|SAE1_uc010xyk.1_Intron|SAE1_uc002pge.2_Intron	NM_016402	NP_057486			SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;						protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity			ovary(1)	1		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)														---	---	---	---
SEC1	653677	broad.mit.edu	37	19	49146112	49146113	+	Intron	DEL	GA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49146112_49146113delGA	uc010xzv.1	+						SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|CA11_uc002pjz.1_Intron	NR_004401				SubName: Full=cDNA FLJ58287, highly similar to Galactoside 2-alpha-L-fucosyltransferase 2 (EC 2.4.1.69);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	52169987	52169990	+	IGR	DEL	AGAA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52169987_52169990delAGAA								SIGLEC14 (19855 upstream) : MIR99B (25875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	52212868	52212868	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52212868delA								NCRNA00085 (4426 upstream) : HAS1 (3497 downstream)																																			---	---	---	---
FPR2	2358	broad.mit.edu	37	19	52263446	52263450	+	5'Flank	DEL	TTCTT	-	-	rs114200169	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52263446_52263450delTTCTT	uc002pxr.2	+						FPR2_uc002pxs.3_5'Flank	NM_001005738	NP_001005738			formyl peptide receptor-like 1						cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4																		---	---	---	---
TMC4	147798	broad.mit.edu	37	19	54671790	54671790	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54671790delA	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775			transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)																	---	---	---	---
GP6	51206	broad.mit.edu	37	19	55546084	55546085	+	Intron	INS	-	AC	AC	rs143935276	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55546084_55546085insAC	uc002qik.2	-						GP6_uc002qil.2_Intron|GP6_uc010esq.2_Intron|RDH13_uc010esr.1_Intron	NM_016363	NP_057447			glycoprotein VI (platelet) isoform 2						enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)														---	---	---	---
NLRP11	204801	broad.mit.edu	37	19	56328531	56328532	+	Intron	INS	-	A	A	rs138129785	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56328531_56328532insA	uc010ygf.1	-						NLRP11_uc002qmb.2_Intron|NLRP11_uc002qmc.2_Intron|NLRP11_uc010ete.1_Intron	NM_145007	NP_659444			NLR family, pyrin domain containing 11								ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57199441	57199442	+	IGR	INS	-	TG	TG	rs148813339	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57199441_57199442insTG								ZNF835 (15195 upstream) : ZIM2 (86481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57209731	57209732	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57209731_57209732insT								ZNF835 (25485 upstream) : ZIM2 (76191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57212564	57212564	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57212564delT								ZNF835 (28318 upstream) : ZIM2 (73359 downstream)																																			---	---	---	---
ZNF17	7565	broad.mit.edu	37	19	57930252	57930252	+	Intron	DEL	T	-	-	rs5828722		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57930252delT	uc002qoo.1	+						ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Intron	NM_006959	NP_008890			zinc finger protein 17						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)														---	---	---	---
ZNF547	284306	broad.mit.edu	37	19	57976880	57976880	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57976880delT	uc002qpm.3	+											RecName: Full=Zinc finger protein 547;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3627840	3627841	+	3'UTR	INS	-	A	A	rs151276510	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3627840_3627841insA	uc002wim.2	+	29						NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	10989056	10989056	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10989056delC								JAG1 (334362 upstream) : BTBD3 (882421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12128291	12128291	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12128291delA								BTBD3 (221049 upstream) : SPTLC3 (861336 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15206768	15206769	+	Intron	INS	-	A	A	rs151273162	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15206768_15206769insA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15475406	15475411	+	Intron	DEL	GTGCGC	-	-	rs144032151	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15475406_15475411delGTGCGC	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
C20orf12	55184	broad.mit.edu	37	20	18386400	18386400	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18386400delT	uc010zsa.1	-						C20orf12_uc010zrz.1_Intron|C20orf12_uc002wqp.3_Intron|C20orf12_uc002wqr.3_Intron|C20orf12_uc002wqs.3_Intron|C20orf12_uc002wqq.3_Intron	NM_001099407	NP_001092877			hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)																---	---	---	---
RIN2	54453	broad.mit.edu	37	20	19902494	19902497	+	Intron	DEL	TTGT	-	-	rs66658465		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19902494_19902497delTTGT	uc002wro.1	+						RIN2_uc010gcu.1_Intron	NM_018993	NP_061866			Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20240560	20240562	+	Intron	DEL	CTG	-	-	rs143068070		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20240560_20240562delCTG	uc002wru.2	+						C20orf26_uc010zse.1_Intron|C20orf26_uc002wrw.2_Intron|C20orf26_uc002wrv.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	25225332	25225332	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25225332delT								ENTPD6 (17972 upstream) : PYGB (3374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25864547	25864548	+	IGR	INS	-	A	A	rs62214090	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25864547_25864548insA								FAM182B (15761 upstream) : LOC100134868 (125887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25909148	25909149	+	IGR	DEL	TG	-	-	rs28749330	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25909148_25909149delTG								FAM182B (60362 upstream) : LOC100134868 (81286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26107939	26107940	+	IGR	INS	-	TG	TG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26107939_26107940insTG								C20orf191 (13262 upstream) : MIR663 (80882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26124136	26124136	+	IGR	DEL	T	-	-	rs79586601		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26124136delT								C20orf191 (29459 upstream) : MIR663 (64686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26146665	26146665	+	IGR	DEL	C	-	-	rs78832111		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26146665delC								C20orf191 (51988 upstream) : MIR663 (42157 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26148258	26148258	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26148258delA								C20orf191 (53581 upstream) : MIR663 (40564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29545921	29545923	+	IGR	DEL	AGA	-	-	rs73620359		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29545921_29545923delAGA								None (None upstream) : FRG1B (65956 downstream)																																			---	---	---	---
EIF2S2	8894	broad.mit.edu	37	20	32696743	32696743	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32696743delT	uc002xaf.2	-						EIF2S2_uc002xag.2_Intron|EIF2S2_uc010ges.2_Intron	NM_003908	NP_003899			eukaryotic translation initiation factor 2 beta							cytosol|eukaryotic translation initiation factor 2 complex	metal ion binding|protein binding|translation initiation factor activity			large_intestine(1)	1																		---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33628931	33628931	+	Intron	DEL	T	-	-	rs67627695		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33628931delT	uc002xbk.2	-						TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	34642973	34642973	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34642973delT								LOC647979 (4091 upstream) : EPB41L1 (36453 downstream)																																			---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	34962127	34962127	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34962127delC	uc002xff.2	+							NM_014902	NP_055717			disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35786211	35786211	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35786211delT	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron|C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36608769	36608769	+	IGR	DEL	T	-	-	rs111853642		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36608769delT								VSTM2L (35024 upstream) : KIAA0406 (2656 downstream)																																			---	---	---	---
KIAA0406	9675	broad.mit.edu	37	20	36619508	36619508	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36619508delT	uc002xhl.2	-						KIAA0406_uc002xhm.2_Intron	NM_014657	NP_055472			hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
FAM83D	81610	broad.mit.edu	37	20	37575022	37575022	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37575022delA	uc002xjg.2	+							NM_030919	NP_112181			hypothetical protein LOC81610						cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	37773347	37773347	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37773347delA								DHX35 (104984 upstream) : LOC339568 (69077 downstream)																																			---	---	---	---
SYS1-DBNDD2	767557	broad.mit.edu	37	20	43998565	43998565	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43998565delT	uc002xnx.2	+						SYS1_uc002xnw.1_Intron	NM_001048225	NP_001041690			SCF apoptosis response protein 1 isoform a												0																		---	---	---	---
NCOA5	57727	broad.mit.edu	37	20	44710029	44710029	+	5'Flank	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44710029delG	uc002xrd.2	-						NCOA5_uc002xre.2_Intron	NM_020967	NP_066018			nuclear receptor coactivator 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	45017232	45017233	+	Intron	DEL	GT	-	-	rs145858299		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45017232_45017233delGT	uc002xrt.1	-						ELMO2_uc002xru.1_Intron|ELMO2_uc010zxr.1_Intron|ELMO2_uc010zxs.1_Intron|ELMO2_uc002xrw.2_5'Flank|ELMO2_uc002xrx.1_Intron	NM_133171	NP_573403			engulfment and cell motility 2						apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	45110534	45110534	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45110534delA								LOC100240726 (16603 upstream) : ZNF334 (19175 downstream)																																			---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47638971	47638979	+	Intron	DEL	AAAAAAAAC	-	-	rs141254504	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47638971_47638979delAAAAAAAAC	uc002xtx.3	+						ARFGEF2_uc010zyf.1_Intron	NM_006420	NP_006411			ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47949965	47949965	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47949965delA								C20orf199 (44172 upstream) : KCNB1 (38540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52416328	52416329	+	IGR	DEL	AC	-	-	rs33973027		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52416328_52416329delAC								ZNF217 (205527 upstream) : SUMO1P1 (74713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52461746	52461746	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52461746delT								ZNF217 (250945 upstream) : SUMO1P1 (29296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	60658554	60658556	+	IGR	DEL	CTT	-	-	rs139402419		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60658554_60658556delCTT								TAF4 (17688 upstream) : LSM14B (38961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	60662928	60662929	+	IGR	INS	-	C	C	rs141341559	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60662928_60662929insC								TAF4 (22062 upstream) : LSM14B (34588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9419053	9419054	+	IGR	INS	-	TTG	TTG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9419053_9419054insTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9673224	9673225	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9673224_9673225insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9673955	9673956	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9673955_9673956insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9833418	9833418	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9833418delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9838039	9838042	+	IGR	DEL	TGAT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9838039_9838042delTGAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10518372	10518374	+	Intron	DEL	AAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10518372_10518374delAAC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10745931	10745931	+	IGR	DEL	T	-	-	rs111734254		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10745931delT								None (None upstream) : TPTE (160812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10758392	10758392	+	IGR	DEL	C	-	-	rs71225086		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10758392delC								None (None upstream) : TPTE (148351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10827362	10827366	+	IGR	DEL	CACCC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10827362_10827366delCACCC								None (None upstream) : TPTE (79377 downstream)																																			---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10932215	10932215	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10932215delA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11068683	11068683	+	Intron	DEL	A	-	-	rs144359688		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11068683delA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	17293664	17293664	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17293664delT								USP25 (41287 upstream) : C21orf34 (149178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18757245	18757246	+	IGR	INS	-	T	T	rs145034151	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18757245_18757246insT								C21orf34 (775151 upstream) : CXADR (128084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23164088	23164088	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23164088delT	uc002yle.2	+											Homo sapiens, clone IMAGE:5547749, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	26829041	26829041	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26829041delC								NCRNA00158 (25028 upstream) : MIR155HG (105416 downstream)																																			---	---	---	---
APP	351	broad.mit.edu	37	21	27448681	27448681	+	Intron	DEL	T	-	-	rs78290459		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27448681delT	uc002ylz.2	-						APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron|APP_uc011acj.1_Intron	NM_000484	NP_000475			amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	28873873	28873874	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28873873_28873874insT								ADAMTS5 (534434 upstream) : NCRNA00113 (220824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29067741	29067744	+	IGR	DEL	TTTC	-	-	rs141440224	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29067741_29067744delTTTC								ADAMTS5 (728302 upstream) : NCRNA00113 (26954 downstream)																																			---	---	---	---
SYNJ1	8867	broad.mit.edu	37	21	34073926	34073926	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34073926delA	uc002yqh.2	-						SYNJ1_uc011ads.1_Intron|SYNJ1_uc002yqf.2_Intron|SYNJ1_uc002yqg.2_Intron|SYNJ1_uc002yqi.2_Intron	NM_003895	NP_003886			synaptojanin 1 isoform a								inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5																		---	---	---	---
SLC5A3	6526	broad.mit.edu	37	21	35461501	35461502	+	Intron	INS	-	T	T	rs149746520	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35461501_35461502insT	uc002yto.2	+						MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864			solute carrier family 5 (inositol transporters),							integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2																		---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36342719	36342719	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36342719delT	uc010gmu.2	-						RUNX1_uc002yut.1_Intron|RUNX1_uc010gmv.2_Intron|RUNX1_uc002yuj.3_Intron|RUNX1_uc002yuk.3_Intron|RUNX1_uc002yum.1_Intron|RUNX1_uc010gmw.1_Intron	NM_001754	NP_001745			runt-related transcription factor 1 isoform						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
RUNX1	861	broad.mit.edu	37	21	37050979	37050980	+	Intron	INS	-	ATGG	ATGG	rs145006650	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37050979_37050980insATGG	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
KCNJ6	3763	broad.mit.edu	37	21	39084941	39084948	+	Intron	DEL	CTCCCCTT	-	-	rs5843856		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39084941_39084948delCTCCCCTT	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231			potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	39405913	39405913	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39405913delA								KCNJ6 (117217 upstream) : DSCR4 (20401 downstream)																																			---	---	---	---
B3GALT5	10317	broad.mit.edu	37	21	41021583	41021583	+	Intron	DEL	A	-	-	rs5843971		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41021583delA	uc002yyb.1	+						B3GALT5_uc002yyf.1_Intron|B3GALT5_uc002yye.2_Intron|B3GALT5_uc002yyg.1_Intron|B3GALT5_uc010gol.1_Intron|B3GALT5_uc010gom.1_Intron|B3GALT5_uc002yyh.1_Intron	NM_033173	NP_149363			UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41760073	41760074	+	Intron	INS	-	AG	AG	rs147662189	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41760073_41760074insAG	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42020018	42020019	+	Intron	INS	-	C	C	rs138109176	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42020018_42020019insC	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	44254877	44254880	+	IGR	DEL	GTGT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44254877_44254880delGTGT								PDE9A (59261 upstream) : WDR4 (8326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44728691	44728691	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44728691delT								CRYAA (135778 upstream) : SIK1 (105707 downstream)																																			---	---	---	---
PFKL	5211	broad.mit.edu	37	21	45719081	45719082	+	5'Flank	DEL	AC	-	-	rs112373027		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45719081_45719082delAC	uc002zel.2	+						PFKL_uc002zek.2_5'Flank|PFKL_uc011afd.1_5'Flank	NM_002626	NP_002617			liver phosphofructokinase						fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)														---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47209354	47209355	+	Intron	DEL	AT	-	-	rs76697248		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47209354_47209355delAT	uc010gqb.2	+							NM_020528	NP_065389			poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
BID	637	broad.mit.edu	37	22	18229338	18229338	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18229338delA	uc002znd.1	-						BID_uc002znc.1_Intron|BID_uc002zne.1_Intron|BID_uc010gra.1_Intron|BID_uc002znf.1_Intron|BID_uc010grb.1_Intron|BID_uc010grc.1_Intron	NM_001196	NP_001187			BH3 interacting domain death agonist isoform 2						activation of pro-apoptotic gene products|establishment of protein localization in membrane|induction of apoptosis by intracellular signals|induction of apoptosis via death domain receptors|neuron apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|release of cytochrome c from mitochondria	cytosol|membrane fraction|mitochondrial outer membrane	death receptor binding				0		all_epithelial(15;0.198)		Lung(27;0.0419)														---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18483013	18483014	+	Intron	DEL	GA	-	-	rs111290439		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18483013_18483014delGA	uc002zng.3	-						MICAL3_uc002znh.2_Intron|MICAL3_uc002znl.1_Intron|MICAL3_uc010grf.2_Intron|MICAL3_uc011agm.1_Intron	NM_015241	NP_056056			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)														---	---	---	---
DGCR8	54487	broad.mit.edu	37	22	20083501	20083503	+	Intron	DEL	AGG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20083501_20083503delAGG	uc002zri.2	+						DGCR8_uc010grz.2_Intron|DGCR8_uc002zrj.2_Intron	NM_022720	NP_073557			DiGeorge syndrome critical region gene 8						primary miRNA processing	cytoplasm|cytoplasm|microtubule cytoskeleton|nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding				0	Colorectal(54;0.0993)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	21629400	21629400	+	IGR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21629400delC								LOC400891 (210945 upstream) : POM121L8P (7314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	23867305	23867305	+	IGR	DEL	T	-	-	rs34168486		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23867305delT								ZDHHC8P1 (122506 upstream) : IGLL1 (48010 downstream)																																			---	---	---	---
VPREB3	29802	broad.mit.edu	37	22	24098964	24098964	+	5'Flank	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24098964delA	uc002zxt.2	-							NM_013378	NP_037510			pre-B lymphocyte 3 precursor							endoplasmic reticulum					0		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)																---	---	---	---
SMARCB1	6598	broad.mit.edu	37	22	24165044	24165045	+	Intron	INS	-	C	C	rs150335837	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24165044_24165045insC	uc002zyb.2	+						SMARCB1_uc002zya.2_Intron|SMARCB1_uc002zyc.2_Intron|SMARCB1_uc002zyd.2_Intron	NM_003073	NP_003064			SWI/SNF related, matrix associated, actin						cell cycle|chromatin remodeling|DNA integration|interspecies interaction between organisms|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|retroviral genome replication|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleolus|nucleoplasm|SWI/SNF complex	p53 binding	p.?(3)		soft_tissue(193)|central_nervous_system(172)|haematopoietic_and_lymphoid_tissue(23)|meninges(5)|skin(5)|bone(4)|ovary(2)|endometrium(1)|lung(1)|pancreas(1)	407		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)						D|N|F|S		malignant rhabdoid 	malignant rhabdoid			Rhabdoid_Predisposition_syndrome|Schwannomatosis				---	---	---	---
Unknown	0	broad.mit.edu	37	22	25855682	25855683	+	Intron	INS	-	GT	GT	rs138963277	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25855682_25855683insGT	uc003abt.2	+						uc003abu.2_Intron|uc003abv.2_Intron					Homo sapiens cDNA clone IMAGE:3542716, partial cds.																														---	---	---	---
MN1	4330	broad.mit.edu	37	22	28198875	28198876	+	5'Flank	DEL	GT	-	-	rs66962557		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28198875_28198876delGT	uc003adj.2	-							NM_002430	NP_002421			meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10								T	ETV6	AML|meningioma								---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28812534	28812536	+	Intron	DEL	TTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28812534_28812536delTTG	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	29589654	29589655	+	IGR	INS	-	A	A	rs144852570	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29589654_29589655insA								KREMEN1 (25333 upstream) : EMID1 (12298 downstream)																																			---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30359381	30359382	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30359381_30359382insT	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576			myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)															---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32190871	32190872	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32190871_32190872insA	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alr.1_Intron|DEPDC5_uc011alt.1_Intron	NM_014662	NP_055477			DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8																		---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32302613	32302620	+	3'UTR	DEL	TTTGTTTG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32302613_32302620delTTTGTTTG	uc003als.2	+	42					DEPDC5_uc011als.1_3'UTR|DEPDC5_uc011alu.1_3'UTR|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alu.2_3'UTR|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_3'UTR|DEPDC5_uc011alx.1_3'UTR|DEPDC5_uc010gwk.2_3'UTR|DEPDC5_uc011aly.1_3'UTR	NM_014662	NP_055477			DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8																		---	---	---	---
C22orf24	25775	broad.mit.edu	37	22	32331039	32331042	+	Intron	DEL	AGAG	-	-	rs71639690		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32331039_32331042delAGAG	uc003aly.2	-						C22orf24_uc003alx.2_Intron	NM_015372	NP_056187			hypothetical protein LOC25775							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
C22orf42	150297	broad.mit.edu	37	22	32550003	32550004	+	Intron	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32550003_32550004delCA	uc003amd.2	-							NM_001010859	NP_001010859			chromosome 22 open reading frame 42											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	34625362	34625363	+	IGR	INS	-	CTCT	CTCT	rs146136578	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34625362_34625363insCTCT								LARGE (306778 upstream) : ISX (836766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34704569	34704571	+	IGR	DEL	GAA	-	-	rs16365		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34704569_34704571delGAA								LARGE (385985 upstream) : ISX (757558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35901263	35901264	+	IGR	INS	-	A	A	rs5995110		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35901263_35901264insA								MCM5 (80769 upstream) : RASD2 (36088 downstream)																																			---	---	---	---
GCAT	23464	broad.mit.edu	37	22	38209775	38209775	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38209775delT	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106			glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
TOMM22	56993	broad.mit.edu	37	22	39079921	39079921	+	3'UTR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39079921delT	uc003awe.2	+	4					uc003awd.2_5'Flank	NM_020243	NP_064628			mitochondrial import receptor Tom22						protein import into mitochondrial outer membrane	integral to membrane|integral to membrane of membrane fraction|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity|receptor activity				0	Melanoma(58;0.04)																	---	---	---	---
APOBEC3F	200316	broad.mit.edu	37	22	39443754	39443755	+	Intron	INS	-	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39443754_39443755insC	uc003aww.2	+							NM_145298	NP_660341			apolipoprotein B mRNA editing enzyme, catalytic						base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)																	---	---	---	---
WBP2NL	164684	broad.mit.edu	37	22	42338949	42338950	+	Intron	INS	-	ACA	ACA	rs150317302	by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42338949_42338950insACA	uc011ape.1	+						LOC339674_uc003bba.1_Intron|CENPM_uc003bbm.2_Intron|CENPM_uc003bbn.2_Intron|CENPM_uc003bbo.2_Intron	NM_152613	NP_689826			WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2																		---	---	---	---
SCUBE1	80274	broad.mit.edu	37	22	43676498	43676499	+	Intron	INS	-	TG	TG	rs66750465		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43676498_43676499insTG	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron|uc003bdv.2_Intron	NM_173050	NP_766638			signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	49334507	49334510	+	IGR	DEL	TTTC	-	-	rs3076045		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49334507_49334510delTTTC								FAM19A5 (186765 upstream) : C22orf34 (473666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49340060	49340063	+	IGR	DEL	AGAC	-	-	rs35145199		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49340060_49340063delAGAC								FAM19A5 (192318 upstream) : C22orf34 (468113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49796552	49796552	+	IGR	DEL	A	-	-	rs76997601		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49796552delA								FAM19A5 (648810 upstream) : C22orf34 (11624 downstream)																																			---	---	---	---
SAPS2	9701	broad.mit.edu	37	22	50802323	50802323	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50802323delT	uc003blc.2	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493			SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	523441	523444	+	IGR	DEL	TCTA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:523441_523444delTCTA								PPP2R3B (175814 upstream) : SHOX (61635 downstream)																																			---	---	---	---
CSF2RA	1438	broad.mit.edu	37	X	1404522	1404528	+	Intron	DEL	AGCTTGC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1404522_1404528delAGCTTGC	uc010nct.2	+						CSF2RA_uc011mhb.1_Intron|CSF2RA_uc004cpq.2_Intron|CSF2RA_uc004cpn.2_Intron|CSF2RA_uc004cpo.2_Intron|CSF2RA_uc010ncu.2_Intron|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Intron|CSF2RA_uc010ncv.2_Intron|CSF2RA_uc004cpr.2_Intron	NM_001161529	NP_001155001			colony stimulating factor 2 receptor alpha chain							extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)													---	---	---	---
SLC25A6	293	broad.mit.edu	37	X	1512211	1512228	+	5'Flank	DEL	TCCTTCCCTTTTCCTCTT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1512211_1512228delTCCTTCCCTTTTCCTCTT	uc004cpt.2	-						SLC25A6_uc004cpu.2_5'Flank	NM_001636	NP_001627			adenine nucleotide translocator 3						active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	3740982	3740985	+	Intron	DEL	GTGT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3740982_3740985delGTGT	uc004crj.2	-						uc011mhk.1_Intron					Homo sapiens similar to Serine/threonine-protein kinase PRKX (Protein kinase PKX1), mRNA (cDNA clone IMAGE:4124593), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	4317934	4317934	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4317934delA								PRKX (686273 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	6933582	6933582	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6933582delA								VCX3A (480423 upstream) : HDHD1A (33379 downstream)																																			---	---	---	---
STS	412	broad.mit.edu	37	X	7118995	7118996	+	Intron	INS	-	TGGA	TGGA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7118995_7118996insTGGA	uc004crw.2	+						STS_uc011mhp.1_Intron|STS_uc004crx.1_Intron					Homo sapiens cDNA, FLJ94694, highly similar to Homo sapiens steroid sulfatase (microsomal), arylsulfatase C,isozyme S (STS), mRNA.						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)									Ichthyosis				---	---	---	---
Unknown	0	broad.mit.edu	37	X	7511916	7511917	+	IGR	DEL	CA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7511916_7511917delCA								STS (239236 upstream) : VCX (298386 downstream)																																			---	---	---	---
SHROOM2	357	broad.mit.edu	37	X	9804636	9804637	+	Intron	INS	-	T	T	rs35880687		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9804636_9804637insT	uc004csu.1	+							NM_001649	NP_001640			apical protein of Xenopus-like						apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	14777925	14777925	+	IGR	DEL	A	-	-	rs141503936		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14777925delA								GLRA2 (27994 upstream) : FANCB (83604 downstream)																																			---	---	---	---
PIR	8544	broad.mit.edu	37	X	15440456	15440456	+	Intron	DEL	A	-	-	rs34503974		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15440456delA	uc004cwu.2	-						PIR_uc004cwv.2_Intron	NM_003662	NP_003653			pirin						transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	16574834	16574834	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16574834delT								GRPR (403194 upstream) : CTPS2 (31290 downstream)																																			---	---	---	---
SYAP1	94056	broad.mit.edu	37	X	16742278	16742278	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16742278delA	uc004cxp.2	+						SYAP1_uc004cxo.2_Intron|SYAP1_uc011miv.1_Intron	NM_032796	NP_116185			SYAP1 protein											skin(1)	1	Hepatocellular(33;0.0997)																	---	---	---	---
CDKL5	6792	broad.mit.edu	37	X	18570961	18570961	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18570961delA	uc004cym.2	+						CDKL5_uc004cyn.2_Intron	NM_003159	NP_003150			cyclin-dependent kinase-like 5						neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)																	---	---	---	---
PHEX	5251	broad.mit.edu	37	X	22136318	22136318	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22136318delT	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435			phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	24392330	24392330	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24392330delA								FAM48B1 (8790 upstream) : PDK3 (91014 downstream)																																			---	---	---	---
PCYT1B	9468	broad.mit.edu	37	X	24652872	24652873	+	Intron	INS	-	AAC	AAC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24652872_24652873insAAC	uc004dbi.2	-						PCYT1B_uc004dbk.3_Intron|PCYT1B_uc004dbj.2_Intron	NM_004845	NP_004836			choline phosphate cytidylyltransferase 1 beta							endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	25042243	25042246	+	IGR	DEL	CTTC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25042243_25042246delCTTC								ARX (8178 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	25944753	25944754	+	IGR	DEL	CT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25944753_25944754delCT								ARX (910688 upstream) : MAGEB18 (211709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	26828894	26828894	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26828894delT								VENTXP1 (249726 upstream) : SMEK3P (649434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	27138482	27138482	+	IGR	DEL	G	-	-	rs61521762		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27138482delG								VENTXP1 (559314 upstream) : SMEK3P (339846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	30813527	30813531	+	IGR	DEL	TTGCG	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30813527_30813531delTTGCG								GK (64803 upstream) : TAB3 (32029 downstream)																																			---	---	---	---
TAB3	257397	broad.mit.edu	37	X	30908387	30908387	+	5'Flank	DEL	T	-	-	rs113439309		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30908387delT	uc004dcj.2	-						TAB3_uc004dck.2_Intron|TAB3_uc010ngl.2_Intron	NM_152787	NP_690000			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DMD	1756	broad.mit.edu	37	X	31691351	31691351	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31691351delA	uc004dda.1	-						DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	33646011	33646012	+	IGR	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33646011_33646012insT								DMD (288285 upstream) : FAM47A (501863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	34589248	34589248	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34589248delT								FAM47A (438820 upstream) : TMEM47 (55935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	38007686	38007686	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38007686delA								SYTL5 (19614 upstream) : SRPX (907 downstream)																																			---	---	---	---
BCOR	54880	broad.mit.edu	37	X	39992707	39992707	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39992707delT	uc004dep.3	-						BCOR_uc004deo.3_Intron	NM_001123383	NP_001116855			BCL-6 interacting corepressor isoform a						heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	40298443	40298443	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40298443delA								BCOR (261861 upstream) : ATP6AP2 (141773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40766869	40766869	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40766869delT								LOC100132831 (74420 upstream) : USP9X (178019 downstream)																																			---	---	---	---
EFHC2	80258	broad.mit.edu	37	X	44139505	44139506	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44139505_44139506insA	uc004dgb.3	-							NM_025184	NP_079460			EF-hand domain (C-terminal) containing 2								calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	45569359	45569360	+	IGR	DEL	CT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45569359_45569360delCT								CXorf36 (509213 upstream) : MIR221 (36225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	47207143	47207144	+	IGR	DEL	TT	-	-	rs34119547		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47207143_47207144delTT								USP11 (99417 upstream) : ZNF157 (22855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	48036607	48036608	+	IGR	INS	-	GAAG	GAAG	rs72438713		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48036607_48036608insGAAG								SSX6 (56538 upstream) : SSX5 (9048 downstream)																																			---	---	---	---
GPKOW	27238	broad.mit.edu	37	X	48980281	48980282	+	5'Flank	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48980281_48980282insT	uc004dmr.2	-							NM_015698	NP_056513			G patch domain and KOW motifs							nucleus	nucleic acid binding			ovary(2)	2																		---	---	---	---
GAGE1	2543	broad.mit.edu	37	X	49354593	49354593	+	Intron	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49354593delC	uc004doj.2	+						GAGE1_uc011mnu.1_Intron|GAGE2A_uc004doi.3_Intron	NM_012196	NP_036328			G antigen 8						cellular defense response						0	Ovarian(276;0.236)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	51469020	51469020	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51469020delT								NUDT11 (229561 upstream) : GSPT2 (17477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61832078	61832078	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61832078delT								None (None upstream) : SPIN4 (735030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	62231262	62231262	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62231262delT								None (None upstream) : SPIN4 (335846 downstream)																																			---	---	---	---
HEPH	9843	broad.mit.edu	37	X	65435653	65435653	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65435653delT	uc011moz.1	+						HEPH_uc004dwn.2_Intron|HEPH_uc004dwo.2_Intron|HEPH_uc010nkr.2_Intron|HEPH_uc011mpa.1_Intron|HEPH_uc010nks.2_Intron	NM_138737	NP_620074			hephaestin isoform a						cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	65814088	65814089	+	IGR	INS	-	GC	GC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65814088_65814089insGC								HEPH (326860 upstream) : EDA2R (1394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68085962	68085963	+	IGR	INS	-	GTGT	GTGT	rs72148643		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68085962_68085963insGTGT								EFNB1 (19933 upstream) : PJA1 (294619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68314480	68314480	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68314480delA								EFNB1 (248451 upstream) : PJA1 (66102 downstream)																																	OREG0019839	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ITGB1BP2	26548	broad.mit.edu	37	X	70521864	70521865	+	Intron	INS	-	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70521864_70521865insT	uc004dzr.1	+						BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_5'UTR	NM_012278	NP_036410			integrin beta 1 binding protein 2						muscle organ development|signal transduction		SH3 domain binding			ovary(1)	1	Renal(35;0.156)																	---	---	---	---
PABPC1L2A	340529	broad.mit.edu	37	X	72297399	72297399	+	3'UTR	DEL	C	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72297399delC	uc004ebg.2	-	1						NM_001012977	NP_001012995			poly(A) binding protein, cytoplasmic 1-like 2A								nucleotide binding|RNA binding				0	Renal(35;0.156)																	---	---	---	---
NCRNA00183	554203	broad.mit.edu	37	X	73243678	73243678	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73243678delA	uc004ebp.2	+							NR_024582				Homo sapiens cDNA FLJ31610 fis, clone NT2RI2002865.												0																		---	---	---	---
SLC16A2	6567	broad.mit.edu	37	X	73654652	73654652	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73654652delT	uc004ebt.2	+							NM_006517	NP_006508			solute carrier family 16, member 2							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			breast(2)|ovary(1)	3					Pyruvic acid(DB00119)													---	---	---	---
KIAA2022	340533	broad.mit.edu	37	X	74001654	74001655	+	Intron	INS	-	GCCTTAGG	GCCTTAGG			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74001654_74001655insGCCTTAGG	uc004eby.2	-							NM_001008537	NP_001008537			hypothetical protein LOC340533						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	75425157	75425158	+	IGR	INS	-	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75425157_75425158insG								CXorf26 (27124 upstream) : MAGEE1 (222959 downstream)																																			---	---	---	---
ATRX	546	broad.mit.edu	37	X	76899420	76899420	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76899420delA	uc004ecp.3	-						ATRX_uc004ecq.3_Intron|ATRX_uc004eco.3_Intron	NM_000489	NP_000480			transcriptional regulator ATRX isoform 1						DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	X	82279017	82279018	+	IGR	INS	-	AAC	AAC	rs74949265		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82279017_82279018insAAC								None (None upstream) : POU3F4 (484251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	82741883	82741883	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82741883delA								None (None upstream) : POU3F4 (21386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	83795098	83795099	+	IGR	INS	-	AAAAC	AAAAC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83795098_83795099insAAAAC								HDX (37640 upstream) : UBE2DNL (394058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	88746657	88746662	+	IGR	DEL	ACACAC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88746657_88746662delACACAC								CPXCR1 (736874 upstream) : TGIF2LX (430278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	92717533	92717533	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92717533delG								PCDH11X (839307 upstream) : NAP1L3 (208396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	94487169	94487169	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:94487169delT								MIR548M (168944 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	97571402	97571403	+	IGR	INS	-	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97571402_97571403insC								DIAPH2 (715806 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	97668455	97668455	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97668455delA								DIAPH2 (812859 upstream) : None (None downstream)																																			---	---	---	---
PCDH19	57526	broad.mit.edu	37	X	99654981	99654982	+	Intron	DEL	AT	-	-	rs68038641		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99654981_99654982delAT	uc010nmz.2	-						PCDH19_uc004efw.3_Intron|PCDH19_uc004efx.3_Intron	NM_020766	NP_001098713			protocadherin 19 isoform b						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	99676297	99676298	+	IGR	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99676297_99676298insA								PCDH19 (11026 upstream) : TNMD (163492 downstream)																																			---	---	---	---
SYTL4	94121	broad.mit.edu	37	X	99930891	99930892	+	3'UTR	DEL	AT	-	-	rs67841104		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99930891_99930892delAT	uc004egd.3	-	19					SYTL4_uc004egc.2_3'UTR|SYTL4_uc010nnb.2_3'UTR|SYTL4_uc010nnc.2_3'UTR|SYTL4_uc004ege.3_3'UTR|SYTL4_uc004egf.3_3'UTR	NM_080737	NP_542775			synaptotagmin-like 4						exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100355736	100355736	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100355736delT	uc004egx.2	+						CENPI_uc011mrg.1_Intron|CENPI_uc004egy.2_5'Flank	NM_006733	NP_006724			centromere protein I						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	104413098	104413103	+	Intron	DEL	GTGTGT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104413098_104413103delGTGTGT	uc004elz.1	+							NM_017416	NP_059112			interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	106272247	106272248	+	IGR	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106272247_106272248delAC								MORC4 (28805 upstream) : RBM41 (35402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	106663139	106663140	+	IGR	DEL	TC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106663139_106663140delTC								CXorf41 (175667 upstream) : PRPS1 (208514 downstream)																																			---	---	---	---
TSC22D3	1831	broad.mit.edu	37	X	106989638	106989639	+	Intron	DEL	AC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106989638_106989639delAC	uc004enh.2	-						TSC22D3_uc004eni.2_Intron|TSC22D3_uc004enj.2_Intron	NM_198057	NP_932174			TSC22 domain family, member 3 isoform 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	114665404	114665404	+	IGR	DEL	G	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114665404delG								LUZP4 (123285 upstream) : PLS3 (129802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	115048421	115048422	+	Intron	INS	-	GTTA	GTTA	rs143010570		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115048421_115048422insGTTA	uc004eqg.1	-											Homo sapiens hypothetical protein LOC642776, mRNA (cDNA clone IMAGE:3533146), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	115769642	115769643	+	IGR	INS	-	AT	AT	rs10658209		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115769642_115769643insAT								CXorf61 (175505 upstream) : None (None downstream)																																			---	---	---	---
SEPT6	23157	broad.mit.edu	37	X	118781196	118781196	+	Intron	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118781196delA	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron|MIR766_hsa-mir-766|MI0003836_5'Flank	NM_015129	NP_055944			septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4																		---	---	---	---
UPF3B	65109	broad.mit.edu	37	X	118985712	118985712	+	Intron	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118985712delT	uc004erz.1	-						UPF3B_uc004esa.1_Intron	NM_080632	NP_542199			UPF3 regulator of nonsense transcripts homolog B						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3																		---	---	---	---
XIAP	331	broad.mit.edu	37	X	122995588	122995589	+	Intron	INS	-	AT	AT	rs10694788		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122995588_122995589insAT	uc010nqu.2	+						XIAP_uc004etx.2_Intron|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158			baculoviral IAP repeat-containing protein 4						anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2														X-linked_Lymphoproliferative_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	X	129422634	129422634	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129422634delT								ZNF280C (19761 upstream) : SLC25A14 (51276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	130728486	130728487	+	IGR	DEL	TG	-	-	rs72292575		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130728486_130728487delTG								IGSF1 (15613 upstream) : LOC286467 (108192 downstream)																																			---	---	---	---
GPC4	2239	broad.mit.edu	37	X	132457516	132457517	+	Intron	INS	-	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132457516_132457517insA	uc004exc.1	-						GPC4_uc011mvg.1_Intron	NM_001448	NP_001439			glypican 4 precursor						anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133506075	133506075	+	5'Flank	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133506075delA	uc004exj.2	+						PHF6_uc004exk.2_5'Flank|PHF6_uc011mvk.1_5'Flank|PHF6_uc004exh.2_5'Flank|PHF6_uc010nrr.2_5'Flank|PHF6_uc004exi.2_5'Flank	NM_001015877	NP_001015877			PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	135930817	135930818	+	IGR	INS	-	T	T	rs57631572		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135930817_135930818insT								ARHGEF6 (67314 upstream) : RBMX (20535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	136183141	136183142	+	IGR	INS	-	TGA	TGA			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136183141_136183142insTGA								GPR101 (69308 upstream) : ZIC3 (465204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139333314	139333315	+	IGR	INS	-	CA	CA	rs72115502		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139333314_139333315insCA								CXorf66 (285637 upstream) : SOX3 (251837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139807041	139807042	+	IGR	INS	-	AC	AC			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139807041_139807042insAC								RP1-177G6.2 (10054 upstream) : CDR1 (58383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	141641390	141641390	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141641390delA								MAGEC2 (348314 upstream) : SPANXN4 (472314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146081673	146081673	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146081673delT								CXorf51 (189749 upstream) : MIR513C (189549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	150192021	150192022	+	IGR	INS	-	T	T	rs34005723		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150192021_150192022insT								HMGB3 (32775 upstream) : GPR50 (153037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	150485356	150485356	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150485356delA								GPR50 (135426 upstream) : VMA21 (80349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	154487028	154487028	+	IGR	DEL	T	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154487028delT								VBP1 (18932 upstream) : RAB39B (499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9931309	9931311	+	IGR	DEL	TTC	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9931309_9931311delTTC								TTTY22 (280455 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10030646	10030646	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10030646delA								TTTY22 (379792 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10054312	10054312	+	IGR	DEL	A	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054312delA								TTTY22 (403458 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13137611	13137615	+	IGR	DEL	TTTCA	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13137611_13137615delTTTCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13272775	13272776	+	IGR	DEL	TT	-	-			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13272775_13272776delTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13285655	13285656	+	IGR	INS	-	GA	GA	rs113499634		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13285655_13285656insGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59030837	59030837	+	IGR	DEL	T	-	-	rs147048784		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59030837delT								None (None upstream) : None (None downstream)																																			---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4834483	4834483	+	Intron	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4834483G>A	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
MTHFR	4524	broad.mit.edu	37	1	11856383	11856383	+	Silent	SNP	C	A	A	rs141060174		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11856383C>A	uc001atc.1	-	5	844	c.660G>T	c.(658-660)GCG>GCT	p.A220A	MTHFR_uc001atb.1_Silent_p.A243A	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	220					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)													---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16907981	16907981	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16907981T>C	uc009vos.1	-	15	2201	c.1313A>G	c.(1312-1314)GAC>GGC	p.D438G	NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Missense_Mutation_p.D167G	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	438	NBPF 2.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27100312	27100312	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27100312C>T	uc001bmv.1	+	17	4397	c.4024C>T	c.(4024-4026)CAG>TAG	p.Q1342*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1341*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1342*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q959*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.Q188*|ARID1A_uc009vsm.1_5'UTR|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1342	Gln-rich.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
TMCO2	127391	broad.mit.edu	37	1	40713691	40713691	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40713691G>T	uc001cfe.2	+	1	119	c.26G>T	c.(25-27)TGG>TTG	p.W9L		NM_001008740	NP_001008740	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	9						integral to membrane				ovary(1)	1	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)															---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	41979293	41979293	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41979293C>A	uc001cgz.3	-	8	6812	c.5599G>T	c.(5599-5601)GAG>TAG	p.E1867*	HIVEP3_uc001cha.3_Nonsense_Mutation_p.E1867*|HIVEP3_uc001cgy.2_RNA	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer	1867	Acidic 3.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
PTCH2	8643	broad.mit.edu	37	1	45298004	45298004	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45298004C>A	uc010olf.1	-	3	287	c.275G>T	c.(274-276)CGG>CTG	p.R92L	PTCH2_uc010olg.1_5'UTR	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	92	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity	p.R92P(1)		lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)													Basal_Cell_Nevus_syndrome				---	---	---	---
ANKRD13C	81573	broad.mit.edu	37	1	70761845	70761845	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70761845G>T	uc001dex.3	-	8	1347	c.1021C>A	c.(1021-1023)CAG>AAG	p.Q341K	ANKRD13C_uc009wbk.2_Missense_Mutation_p.Q306K	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	341					protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0																		---	---	---	---
MOV10	4343	broad.mit.edu	37	1	113241043	113241043	+	Silent	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113241043G>A	uc001eck.2	+	16	2721	c.2451G>A	c.(2449-2451)AAG>AAA	p.K817K	MOV10_uc001ecl.2_Intron|MOV10_uc001ecn.2_Silent_p.K817K|MOV10_uc001ecm.2_Silent_p.K757K	NM_001130079	NP_001123551	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	817					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)														---	---	---	---
NGF	4803	broad.mit.edu	37	1	115829244	115829244	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115829244G>A	uc001efu.1	-	3	342	c.173C>T	c.(172-174)GCG>GTG	p.A58V		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	58					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)													---	---	---	---
CD58	965	broad.mit.edu	37	1	117087145	117087145	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117087145A>T	uc001egm.2	-	2	273	c.152T>A	c.(151-153)TTA>TAA	p.L51*	CD58_uc001egn.2_RNA|CD58_uc010owy.1_Nonsense_Mutation_p.L51*|CD58_uc001ego.1_RNA|CD58_uc001egp.3_Nonsense_Mutation_p.L51*	NM_001779	NP_001770	P19256	LFA3_HUMAN	CD58 molecule isoform 1	51	Extracellular (Potential).				blood coagulation|cell-cell adhesion|leukocyte migration	anchored to membrane|integral to plasma membrane	protein binding				0	Lung SC(450;0.225)	all_cancers(81;0.000363)|all_lung(203;0.000118)|all_epithelial(167;0.000149)|Lung NSC(69;0.000577)		Lung(183;0.0086)|LUSC - Lung squamous cell carcinoma(189;0.0528)|Colorectal(144;0.0775)|all cancers(265;0.109)|Epithelial(280;0.118)|COAD - Colon adenocarcinoma(174;0.121)														---	---	---	---
HMGCS2	3158	broad.mit.edu	37	1	120298075	120298075	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120298075C>A	uc001eid.2	-	6	1213	c.1162G>T	c.(1162-1164)GGG>TGG	p.G388W	HMGCS2_uc010oxj.1_Missense_Mutation_p.G346W|HMGCS2_uc001eie.2_Missense_Mutation_p.G296W	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	388					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)														---	---	---	---
FLG	2312	broad.mit.edu	37	1	152279066	152279066	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152279066G>T	uc001ezu.1	-	3	8332	c.8296C>A	c.(8296-8298)CGC>AGC	p.R2766S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2766	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
NES	10763	broad.mit.edu	37	1	156645022	156645022	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156645022C>A	uc001fpq.2	-	2	1027	c.894G>T	c.(892-894)GAG>GAT	p.E298D		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	298	Coil 2B.|Rod.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
FCRL5	83416	broad.mit.edu	37	1	157514169	157514169	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157514169G>T	uc001fqu.2	-	5	885	c.727C>A	c.(727-729)CCG>ACG	p.P243T	FCRL5_uc009wsm.2_Missense_Mutation_p.P243T|FCRL5_uc010phv.1_Missense_Mutation_p.P243T|FCRL5_uc010phw.1_Missense_Mutation_p.P158T|FCRL5_uc001fqv.1_Missense_Mutation_p.P243T|FCRL5_uc010phx.1_5'UTR	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	243	Extracellular (Potential).|Ig-like C2-type 2.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)																---	---	---	---
ATP1A4	480	broad.mit.edu	37	1	160151739	160151739	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160151739G>T	uc001fve.3	+	20	3366	c.2887G>T	c.(2887-2889)GGG>TGG	p.G963W	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.G466W|ATP1A4_uc001fvh.2_Missense_Mutation_p.G99W	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	963	Helical; (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
DCAF8	50717	broad.mit.edu	37	1	160188115	160188115	+	Missense_Mutation	SNP	C	A	A	rs142007100	byFrequency	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160188115C>A	uc001fvo.2	-	13	1988	c.1676G>T	c.(1675-1677)CGG>CTG	p.R559L	DCAF8_uc001fvn.2_Missense_Mutation_p.R559L|DCAF8_uc009wth.2_Missense_Mutation_p.R559L|DCAF8_uc010pjb.1_Missense_Mutation_p.R559L|DCAF8_uc010pjc.1_Missense_Mutation_p.R713L	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	559						CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2																		---	---	---	---
SLAMF1	6504	broad.mit.edu	37	1	160589609	160589609	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160589609T>C	uc001fwl.3	-	5	1167	c.821A>G	c.(820-822)GAA>GGA	p.E274G	SLAMF1_uc010pjk.1_Intron|SLAMF1_uc010pjl.1_Intron|SLAMF1_uc010pjm.1_Intron	NM_003037	NP_003028	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family	274	Cytoplasmic (Potential).|Ig-like V-type.				interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)															---	---	---	---
ARHGAP30	257106	broad.mit.edu	37	1	161022247	161022247	+	Missense_Mutation	SNP	C	A	A	rs149524176	byFrequency	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161022247C>A	uc001fxl.2	-	8	1269	c.923G>T	c.(922-924)CGG>CTG	p.R308L	ARHGAP30_uc001fxk.2_Missense_Mutation_p.R308L|ARHGAP30_uc001fxm.2_Missense_Mutation_p.R154L|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_Missense_Mutation_p.R154L	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	308					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
FMO4	2329	broad.mit.edu	37	1	171293414	171293414	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171293414C>A	uc001gho.2	+	5	676	c.459C>A	c.(457-459)CCC>CCA	p.P153P		NM_002022	NP_002013	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	153					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			kidney(2)|skin(1)	3	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
EDEM3	80267	broad.mit.edu	37	1	184663564	184663564	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184663564T>A	uc010pok.1	-	20	2693	c.2432A>T	c.(2431-2433)GAT>GTT	p.D811V	EDEM3_uc010pol.1_RNA|EDEM3_uc010pom.1_Missense_Mutation_p.D827V	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like	811					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1																		---	---	---	---
RNF2	6045	broad.mit.edu	37	1	185068944	185068944	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185068944C>T	uc001grc.1	+	6	992	c.759C>T	c.(757-759)AAC>AAT	p.N253N	RNF2_uc001grd.1_Silent_p.N181N|RNF2_uc001gre.1_RNA	NM_007212	NP_009143	Q99496	RING2_HUMAN	ring finger protein 2	253					histone H2A monoubiquitination|transcription, DNA-dependent	MLL1 complex|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			breast(1)	1		Breast(1374;0.000496)		Colorectal(1306;6.9e-08)|KIRC - Kidney renal clear cell carcinoma(1967;8.12e-06)														---	---	---	---
LOC642587	642587	broad.mit.edu	37	1	209603813	209603813	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209603813C>A	uc009xcn.2	+	3	538	c.155C>A	c.(154-156)CCA>CAA	p.P52Q	LOC642587_uc010psk.1_5'Flank|MIR205_hsa-mir-205|MI0000285_5'Flank	NM_001104548	NP_001098018			hypothetical protein LOC642587												0				OV - Ovarian serous cystadenocarcinoma(81;0.0422)														---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216496837	216496837	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216496837T>A	uc001hku.1	-	8	1916	c.1529A>T	c.(1528-1530)GAC>GTC	p.D510V	USH2A_uc001hkv.2_Missense_Mutation_p.D510V	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	510	Laminin N-terminal.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
AIDA	64853	broad.mit.edu	37	1	222843513	222843513	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222843513C>T	uc001hnn.2	-	9	991	c.786G>A	c.(784-786)GAG>GAA	p.E262E	AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Silent_p.E238E	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	262					dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0																		---	---	---	---
TLR5	7100	broad.mit.edu	37	1	223285929	223285929	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223285929G>A	uc001hnv.1	-	4	891	c.445C>T	c.(445-447)CGC>TGC	p.R149C	TLR5_uc001hnw.1_Missense_Mutation_p.R149C	NM_003268	NP_003259	O60602	TLR5_HUMAN	toll-like receptor 5 precursor	149	LRR 3.|Extracellular (Potential).				cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity			ovary(2)|lung(1)|skin(1)	4				GBM - Glioblastoma multiforme(131;0.0851)														---	---	---	---
TAF5L	27097	broad.mit.edu	37	1	229730651	229730651	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229730651C>A	uc001htq.2	-	5	1329	c.1163G>T	c.(1162-1164)TGG>TTG	p.W388L		NM_014409	NP_055224	O75529	TAF5L_HUMAN	PCAF associated factor 65 beta isoform a	388	WD 3.				histone H3 acetylation|transcription from RNA polymerase II promoter	STAGA complex|transcription factor TFTC complex	sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)																---	---	---	---
NID1	4811	broad.mit.edu	37	1	236141194	236141194	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236141194C>A	uc001hxo.2	-	20	3819	c.3717G>T	c.(3715-3717)TTG>TTT	p.L1239F	NID1_uc009xgd.2_Missense_Mutation_p.L1106F|NID1_uc009xgc.2_Missense_Mutation_p.L320F	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	1239	EGF-like 6.				cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
OR2T4	127074	broad.mit.edu	37	1	248525601	248525601	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525601T>G	uc001ieh.1	+	1	719	c.719T>G	c.(718-720)CTC>CGC	p.L240R		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	240	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
OR2G6	391211	broad.mit.edu	37	1	248685218	248685218	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685218A>C	uc001ien.1	+	1	271	c.271A>C	c.(271-273)ACC>CCC	p.T91P		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11735458	11735458	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11735458C>T	uc002rbk.1	+	12	2078	c.1778C>T	c.(1777-1779)ACG>ATG	p.T593M	GREB1_uc002rbo.1_Missense_Mutation_p.T227M	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	593						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
APOB	338	broad.mit.edu	37	2	21230685	21230685	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21230685C>A	uc002red.2	-	26	9183	c.9055G>T	c.(9055-9057)GGG>TGG	p.G3019W		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3019					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	p.G3019E(1)		ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---
LHCGR	3973	broad.mit.edu	37	2	48956370	48956370	+	Intron	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48956370G>C	uc002rwu.3	-						GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_Intron	NM_000233	NP_000224			luteinizing hormone/choriogonadotropin receptor						male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)									Familial_Male-Limited_Precocious_Puberty				---	---	---	---
TFCP2L1	29842	broad.mit.edu	37	2	122004496	122004496	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122004496C>A	uc002tmx.2	-	6	648	c.555G>T	c.(553-555)AAG>AAT	p.K185N	TFCP2L1_uc010flr.2_Missense_Mutation_p.K185N	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9	185					female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)																	---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133542728	133542728	+	Silent	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133542728T>G	uc002ttp.2	-	14	2030	c.1656A>C	c.(1654-1656)CCA>CCC	p.P552P	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	552							protein binding				0																		---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145147018	145147018	+	Nonstop_Mutation	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145147018T>G	uc002tvu.2	-	10	4125	c.3645A>C	c.(3643-3645)TAA>TAC	p.*1215Y	ZEB2_uc002tvv.2_Nonstop_Mutation_p.*1209Y|ZEB2_uc010zbm.1_Nonstop_Mutation_p.*1186Y|ZEB2_uc010fnp.2_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	1215						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145156205	145156205	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145156205G>A	uc002tvu.2	-	8	3029	c.2549C>T	c.(2548-2550)TCT>TTT	p.S850F	ZEB2_uc002tvv.2_Missense_Mutation_p.S844F|ZEB2_uc010zbm.1_Missense_Mutation_p.S821F|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.S879F	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	850						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
TANC1	85461	broad.mit.edu	37	2	160086388	160086388	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160086388C>A	uc002uag.2	+	27	4725	c.4451C>A	c.(4450-4452)CCT>CAT	p.P1484H	TANC1_uc010zcm.1_3'UTR|TANC1_uc010fon.2_Missense_Mutation_p.P328H	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1484						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
LASS6	253782	broad.mit.edu	37	2	169622151	169622151	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169622151C>A	uc002ueb.1	+	9	1019	c.895C>A	c.(895-897)CCT>ACT	p.P299T	LASS6_uc002uec.1_Missense_Mutation_p.P299T	NM_203463	NP_982288	Q6ZMG9	CERS6_HUMAN	longevity assurance homolog 6	299	TLC.|Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1																		---	---	---	---
FASTKD1	79675	broad.mit.edu	37	2	170401265	170401265	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170401265C>A	uc002uev.3	-	9	2170	c.1782G>T	c.(1780-1782)TTG>TTT	p.L594F	FASTKD1_uc002uew.3_RNA|FASTKD1_uc002uex.3_Missense_Mutation_p.L580F	NM_024622	NP_078898	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	594					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(4)	4																		---	---	---	---
PRKRA	8575	broad.mit.edu	37	2	179315135	179315135	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179315135C>A	uc002umf.2	-	2	270	c.69G>T	c.(67-69)TTG>TTT	p.L23F	PRKRA_uc002umd.2_5'UTR|PRKRA_uc002ume.2_Missense_Mutation_p.L12F|PRKRA_uc002umg.2_5'UTR|DFNB59_uc002umi.3_5'Flank|DFNB59_uc002umj.3_5'Flank	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double	23	Sufficient for self-association and interaction with TARBP2.				immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179582662	179582662	+	Intron	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179582662A>G	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133378	NP_596869			titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
MYO1B	4430	broad.mit.edu	37	2	192227095	192227095	+	Missense_Mutation	SNP	C	T	T	rs139382265		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192227095C>T	uc010fsg.2	+	9	1018	c.763C>T	c.(763-765)CGG>TGG	p.R255W	MYO1B_uc002usq.2_Missense_Mutation_p.R255W|MYO1B_uc002usr.2_Missense_Mutation_p.R255W|MYO1B_uc002uss.1_Missense_Mutation_p.R255W	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	255	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)															---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197187203	197187203	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197187203C>A	uc002utm.1	-	7	1066	c.883G>T	c.(883-885)GGT>TGT	p.G295C	HECW2_uc002utl.1_5'UTR	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	295					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
CASP10	843	broad.mit.edu	37	2	202073970	202073970	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202073970C>T	uc002uxl.1	+	9	1518	c.1100C>T	c.(1099-1101)TCG>TTG	p.S367L	CASP10_uc002uxj.1_Missense_Mutation_p.S367L|CASP10_uc002uxk.1_Missense_Mutation_p.S324L|CASP10_uc010fta.1_Missense_Mutation_p.S300L|CASP10_uc002uxm.1_Missense_Mutation_p.S324L|CASP10_uc010ftb.1_RNA	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein	367					apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6																		---	---	---	---
CHRND	1144	broad.mit.edu	37	2	233396285	233396285	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233396285G>A	uc002vsw.2	+	9	970	c.966G>A	c.(964-966)ATG>ATA	p.M322I	CHRND_uc010zmg.1_Missense_Mutation_p.M307I|CHRND_uc010fyc.2_Missense_Mutation_p.M195I|CHRND_uc010zmh.1_Missense_Mutation_p.M128I	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	322	Helical; (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)														---	---	---	---
UGT1A4	54657	broad.mit.edu	37	2	234628204	234628204	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234628204G>T	uc002vux.2	+	1	767	c.738G>T	c.(736-738)GTG>GTT	p.V246V	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Silent_p.V246V	NM_007120	NP_009051	P22310	UD14_HUMAN	UDP glycosyltransferase 1 family, polypeptide A4	246					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)													---	---	---	---
NEK10	152110	broad.mit.edu	37	3	27326407	27326407	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27326407A>G	uc003cdt.1	-	22	2109	c.1835T>C	c.(1834-1836)CTT>CCT	p.L612P	NEK10_uc003cds.1_Missense_Mutation_p.L9P	NM_199347	NP_955379	Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10 isoform 3	612	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13																		---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46306638	46306638	+	Splice_Site	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46306638G>T	uc003cpg.1	+	4	533	c.-10_splice	c.e4-1		CCR3_uc003cpi.1_Splice_Site|CCR3_uc003cpj.1_Splice_Site|CCR3_uc003cpk.1_Splice_Site_p.R18_splice|CCR3_uc010hjb.1_Splice_Site_p.G15_splice|CCR3_uc003cpl.1_Splice_Site_p.R30_splice	NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
CELSR3	1951	broad.mit.edu	37	3	48699826	48699826	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48699826C>A	uc003cul.2	-	1	523	c.242G>T	c.(241-243)AGG>ATG	p.R81M	CELSR3_uc003cuf.1_Missense_Mutation_p.R151M	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	81	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)														---	---	---	---
C3orf67	200844	broad.mit.edu	37	3	58849420	58849420	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58849420G>C	uc003dkt.1	-	12	1491	c.1082C>G	c.(1081-1083)TCA>TGA	p.S361*	C3orf67_uc003dks.1_Nonsense_Mutation_p.S176*|uc003dku.1_Intron|C3orf67_uc003dkv.1_Nonsense_Mutation_p.S176*|C3orf67_uc003dkw.2_Nonsense_Mutation_p.S256*	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	361											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62189576	62189576	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62189576C>A	uc003dlb.2	+	12	2826	c.2107C>A	c.(2107-2109)CGC>AGC	p.R703S	PTPRG_uc003dlc.2_Missense_Mutation_p.R703S	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	703	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity	p.R703R(1)		ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
UBA3	9039	broad.mit.edu	37	3	69127031	69127031	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69127031C>A	uc003dno.2	-	3	121	c.101G>T	c.(100-102)TGG>TTG	p.W34L	UBA3_uc003dnq.2_Missense_Mutation_p.W20L|UBA3_uc011bfy.1_5'UTR|UBA3_uc011bfz.1_5'UTR	NM_003968	NP_003959	Q8TBC4	UBA3_HUMAN	ubiquitin-activating enzyme 3 isoform 1	34					protein neddylation|proteolysis	nucleus	acid-amino acid ligase activity|ATP binding|protein heterodimerization activity			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)														---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69244389	69244389	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69244389C>A	uc003dnv.2	-	15	1651	c.1361G>T	c.(1360-1362)CGG>CTG	p.R454L	FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Missense_Mutation_p.R106L|FRMD4B_uc011bga.1_Missense_Mutation_p.R298L	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	454						cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
NR1I2	8856	broad.mit.edu	37	3	119534283	119534283	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119534283C>A	uc003edj.2	+	7	2890	c.1051C>A	c.(1051-1053)CCA>ACA	p.P351T	NR1I2_uc003edi.2_Missense_Mutation_p.P314T|NR1I2_uc003edk.2_Missense_Mutation_p.P390T|NR1I2_uc003edl.2_Missense_Mutation_p.P239T	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	351	Ligand-binding.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)													---	---	---	---
GTF2E1	2960	broad.mit.edu	37	3	120469649	120469649	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120469649G>T	uc003edz.3	+	2	364	c.250G>T	c.(250-252)GGG>TGG	p.G84W	GTF2E1_uc003edy.2_Missense_Mutation_p.G84W	NM_005513	NP_005504	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1,	84	HTH TFE/IIEalpha-type.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.159)														---	---	---	---
FBXO40	51725	broad.mit.edu	37	3	121345655	121345655	+	Silent	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121345655T>G	uc003eeg.2	+	4	2238	c.2028T>G	c.(2026-2028)ACT>ACG	p.T676T		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	676					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)														---	---	---	---
ILDR1	286676	broad.mit.edu	37	3	121725886	121725886	+	Missense_Mutation	SNP	G	A	A	rs148962924		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121725886G>A	uc003ees.2	-	2	287	c.181C>T	c.(181-183)CGC>TGC	p.R61C	ILDR1_uc003eeq.2_Missense_Mutation_p.R73C|ILDR1_uc003eer.2_Missense_Mutation_p.R61C|ILDR1_uc010hrg.2_Missense_Mutation_p.R61C	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor	61	Extracellular (Potential).|Ig-like V-type.					cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)														---	---	---	---
PARP15	165631	broad.mit.edu	37	3	122354929	122354929	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122354929C>T	uc003efm.2	+	12	2085	c.2019C>T	c.(2017-2019)CTC>CTT	p.L673L	PARP15_uc003efn.2_Silent_p.L478L|PARP15_uc003efo.1_Silent_p.L420L|PARP15_uc003efp.1_Silent_p.L439L|PARP15_uc011bjt.1_Silent_p.L370L	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	651	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)														---	---	---	---
ASTE1	28990	broad.mit.edu	37	3	130744009	130744009	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130744009G>T	uc003env.1	-	3	584	c.142C>A	c.(142-144)CGG>AGG	p.R48R	NEK11_uc003enx.2_5'Flank|NEK11_uc003eny.2_5'Flank|NEK11_uc003eoa.2_5'Flank|NEK11_uc003enz.2_5'Flank|NEK11_uc010htn.2_5'Flank|NEK11_uc011blk.1_5'Flank|NEK11_uc011bll.1_5'Flank|NEK11_uc003enw.1_5'Flank|NEK11_uc011blm.1_5'Flank|ASTE1_uc010htm.1_Silent_p.R48R|ASTE1_uc011blj.1_RNA	NM_014065	NP_054784	Q2TB18	ASTE1_HUMAN	asteroid homolog 1	48					DNA repair		nuclease activity				0																		---	---	---	---
DNAJC13	23317	broad.mit.edu	37	3	132203505	132203505	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132203505C>A	uc003eor.2	+	29	3321	c.3256C>A	c.(3256-3258)CAT>AAT	p.H1086N		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1086							heat shock protein binding			ovary(1)|breast(1)	2																		---	---	---	---
PIK3CB	5291	broad.mit.edu	37	3	138402591	138402591	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138402591G>T	uc011bmq.1	-	16	2354	c.2354C>A	c.(2353-2355)CCT>CAT	p.P785H	PIK3CB_uc011bmn.1_Missense_Mutation_p.P297H|PIK3CB_uc011bmo.1_Missense_Mutation_p.P231H|PIK3CB_uc011bmp.1_Missense_Mutation_p.P372H	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	785					activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
P2RY12	64805	broad.mit.edu	37	3	151056389	151056389	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151056389A>C	uc003eyw.1	-	2	461	c.245T>G	c.(244-246)CTT>CGT	p.L82R	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY12_uc011boa.1_Missense_Mutation_p.L82R|P2RY12_uc003eyx.1_Missense_Mutation_p.L82R	NM_176876	NP_795345	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y12	82	Extracellular (Potential).				platelet activation	integral to membrane|plasma membrane	guanyl-nucleotide exchange factor activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Ticlopidine(DB00208)|Treprostinil(DB00374)													---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	156009817	156009817	+	Intron	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156009817C>A	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Missense_Mutation_p.R41S|KCNAB1_uc010hvt.1_Missense_Mutation_p.R41S	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	A	A	rs121913284		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178921553T>A	uc003fjk.2	+	5	1192	c.1035T>A	c.(1033-1035)AAT>AAA	p.N345K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	345					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.N345K(29)|p.N345I(2)|p.N345S(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)				57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
LIPH	200879	broad.mit.edu	37	3	185252783	185252783	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185252783C>A	uc003fpm.2	-	2	297	c.187G>T	c.(187-189)GGG>TGG	p.G63W	LIPH_uc010hyh.2_Missense_Mutation_p.G63W	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor	63					lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
ATP13A3	79572	broad.mit.edu	37	3	194168581	194168581	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194168581C>A	uc003fty.3	-	12	1710	c.1308G>T	c.(1306-1308)GAG>GAT	p.E436D	ATP13A3_uc003ftz.1_Missense_Mutation_p.E142D	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	436					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)														---	---	---	---
ADD1	118	broad.mit.edu	37	4	2896375	2896375	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2896375G>A	uc003gfr.2	+	6	846	c.658G>A	c.(658-660)GGC>AGC	p.G220S	ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Missense_Mutation_p.G220S|ADD1_uc003gfo.2_Missense_Mutation_p.G220S|ADD1_uc003gfp.2_Missense_Mutation_p.G220S|ADD1_uc003gfq.2_Missense_Mutation_p.G220S|ADD1_uc003gfs.2_Missense_Mutation_p.G220S|ADD1_uc003gft.3_Missense_Mutation_p.G220S|ADD1_uc003gfu.2_5'UTR	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a	220					actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
TLR10	81793	broad.mit.edu	37	4	38775655	38775655	+	Silent	SNP	C	A	A	rs138959039		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38775655C>A	uc003gti.2	-	2	1936	c.1557G>T	c.(1555-1557)GCG>GCT	p.A519A	TLR10_uc003gtj.2_Silent_p.A519A|TLR10_uc003gtk.2_Silent_p.A519A	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	519	Extracellular (Potential).				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2																		---	---	---	---
GABRA4	2557	broad.mit.edu	37	4	46967137	46967137	+	Silent	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46967137A>C	uc003gxg.2	-	8	1123	c.984T>G	c.(982-984)GCT>GCG	p.A328A		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	328	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)													---	---	---	---
ARHGAP24	83478	broad.mit.edu	37	4	86863361	86863361	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86863361C>A	uc003hpk.2	+	5	983	c.534C>A	c.(532-534)GGC>GGA	p.G178G	ARHGAP24_uc003hpj.2_Silent_p.G178G|ARHGAP24_uc003hpl.2_Silent_p.G83G|ARHGAP24_uc010ikf.2_Silent_p.G93G|ARHGAP24_uc003hpm.2_Silent_p.G85G	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	178	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)														---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94006274	94006274	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94006274G>T	uc011cdt.1	+	3	631	c.373G>T	c.(373-375)GGG>TGG	p.G125W	GRID2_uc010ikx.2_Missense_Mutation_p.G125W|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_RNA	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	125	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
ANK2	287	broad.mit.edu	37	4	114277296	114277296	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114277296C>A	uc003ibe.3	+	38	7622	c.7522C>A	c.(7522-7524)CGG>AGG	p.R2508R	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Silent_p.R2523R	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2475					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126372620	126372620	+	Silent	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126372620T>G	uc003ifj.3	+	9	10449	c.10449T>G	c.(10447-10449)GTT>GTG	p.V3483V	FAT4_uc011cgp.1_Silent_p.V1781V|FAT4_uc003ifi.1_Silent_p.V961V	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3483	Cadherin 33.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
PCDH18	54510	broad.mit.edu	37	4	138451299	138451299	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138451299G>T	uc003ihe.3	-	1	2331	c.1944C>A	c.(1942-1944)CCC>CCA	p.P648P	PCDH18_uc003ihf.3_Silent_p.P641P|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Silent_p.P428P|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	648	Cadherin 6.|Extracellular (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)																	---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	32048689	32048689	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32048689A>C	uc003jhl.2	+	8	1952	c.1564A>C	c.(1564-1566)ATG>CTG	p.M522L	PDZD2_uc003jhm.2_Missense_Mutation_p.M522L|PDZD2_uc011cnx.1_Missense_Mutation_p.M348L	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	522					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35793298	35793298	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35793298A>C	uc003jjo.2	+	32	4703	c.4592A>C	c.(4591-4593)GAG>GCG	p.E1531A	SPEF2_uc003jjp.1_Missense_Mutation_p.E1017A|SPEF2_uc003jjr.2_Missense_Mutation_p.E586A	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1531					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
F2RL1	2150	broad.mit.edu	37	5	76129192	76129192	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76129192C>A	uc003keo.2	+	2	935	c.760C>A	c.(760-762)CCA>ACA	p.P254T		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	254	Helical; Name=5; (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)														---	---	---	---
SPZ1	84654	broad.mit.edu	37	5	79616605	79616605	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616605C>G	uc003kgn.2	+	1	816	c.571C>G	c.(571-573)CAG>GAG	p.Q191E	uc011ctk.1_RNA	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	191	Basic motif (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)														---	---	---	---
ELL2	22936	broad.mit.edu	37	5	95278735	95278735	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95278735G>A	uc003klr.3	-	2	516	c.166C>T	c.(166-168)CCT>TCT	p.P56S		NM_012081	NP_036213	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	56					regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				central_nervous_system(1)	1		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)														---	---	---	---
LOX	4015	broad.mit.edu	37	5	121405747	121405747	+	Splice_Site	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121405747C>T	uc003ksu.2	-	6	1622	c.1247_splice	c.e6+1	p.P416_splice	LOX_uc010jcp.2_Splice_Site_p.P119_splice|LOX_uc010jcq.2_Splice_Site_p.P119_splice|LOX_uc011cwk.1_Splice_Site_p.P186_splice|LOX_uc010jcr.2_Splice_Site_p.P119_splice	NM_002317	NP_002308			lysyl oxidase preproprotein						protein modification process	extracellular space	copper ion binding|protein-lysine 6-oxidase activity			lung(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)														---	---	---	---
SNCAIP	9627	broad.mit.edu	37	5	121785553	121785553	+	Missense_Mutation	SNP	C	T	T	rs143440334		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121785553C>T	uc003ksw.1	+	9	1812	c.1606C>T	c.(1606-1608)CGT>TGT	p.R536C	SNCAIP_uc011cwl.1_Missense_Mutation_p.R94C|SNCAIP_uc003ksx.1_Missense_Mutation_p.R583C|SNCAIP_uc003ksy.1_Missense_Mutation_p.R170C|SNCAIP_uc003ksz.1_Missense_Mutation_p.R170C|SNCAIP_uc010jcu.2_Missense_Mutation_p.R132C|SNCAIP_uc011cwm.1_Missense_Mutation_p.R170C|SNCAIP_uc003kta.1_Missense_Mutation_p.R168C|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Missense_Mutation_p.R230C|SNCAIP_uc010jcx.1_Missense_Mutation_p.R476C|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Missense_Mutation_p.R52C	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	536	Potential.				cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)														---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127727788	127727788	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127727788C>T	uc003kuu.2	-	11	1965	c.1526G>A	c.(1525-1527)CGC>CAC	p.R509H	FBN2_uc003kuv.2_Missense_Mutation_p.R476H	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	509	EGF-like 6.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
KDM3B	51780	broad.mit.edu	37	5	137760008	137760008	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137760008G>T	uc003lcy.1	+	16	4417	c.4217G>T	c.(4216-4218)CGG>CTG	p.R1406L	KDM3B_uc010jew.1_Missense_Mutation_p.R1062L|KDM3B_uc011cys.1_Missense_Mutation_p.R438L	NM_016604	NP_057688	Q7LBC6	KDM3B_HUMAN	jumonji domain containing 1B	1406					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11																		---	---	---	---
PCDHA7	56141	broad.mit.edu	37	5	140215142	140215142	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215142C>A	uc003lhq.2	+	1	1174	c.1174C>A	c.(1174-1176)CGC>AGC	p.R392S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.R392S	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	392	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB8	56128	broad.mit.edu	37	5	140558614	140558614	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558614C>A	uc011dai.1	+	1	1185	c.999C>A	c.(997-999)ACC>ACA	p.T333T	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	333	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHGA11	56105	broad.mit.edu	37	5	140801462	140801462	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140801462G>A	uc003lkq.1	+	1	926	c.668G>A	c.(667-669)CGA>CAA	p.R223Q	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.R223Q|PCDHGA11_uc003lkp.1_Missense_Mutation_p.R223Q	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	223	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDH1	5097	broad.mit.edu	37	5	141244865	141244865	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141244865G>T	uc003llq.2	-	3	1148	c.1031C>A	c.(1030-1032)CCG>CAG	p.P344Q	PCDH1_uc003llp.2_Missense_Mutation_p.P344Q|PCDH1_uc011dbf.1_Missense_Mutation_p.P322Q	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	344	Extracellular (Potential).|Cadherin 3.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)														---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146080690	146080690	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146080690G>A	uc003loe.2	-	2	611	c.86C>T	c.(85-87)ACG>ATG	p.T29M	PPP2R2B_uc010jgm.2_Missense_Mutation_p.T18M|PPP2R2B_uc003log.3_Missense_Mutation_p.T29M|PPP2R2B_uc003lof.3_Missense_Mutation_p.T29M|PPP2R2B_uc003loi.3_Missense_Mutation_p.T32M|PPP2R2B_uc003loh.3_Missense_Mutation_p.T29M|PPP2R2B_uc003loj.3_Missense_Mutation_p.T9M|PPP2R2B_uc003lok.3_Missense_Mutation_p.T18M|PPP2R2B_uc011dbu.1_Missense_Mutation_p.T35M|PPP2R2B_uc011dbv.1_Missense_Mutation_p.T87M	NM_004576	NP_004567	Q00005	2ABB_HUMAN	beta isoform of regulatory subunit B55, protein	29	WD 1.				apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
C5orf40	408263	broad.mit.edu	37	5	156770548	156770548	+	5'UTR	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156770548G>A	uc003lwu.2	-	2					CYFIP2_uc003lwq.2_Intron|CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001001343	NP_001001343			hypothetical protein LOC408263							integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
GABRP	2568	broad.mit.edu	37	5	170222299	170222299	+	Missense_Mutation	SNP	C	A	A	rs145233692		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170222299C>A	uc003mau.2	+	5	526	c.328C>A	c.(328-330)CGC>AGC	p.R110S	GABRP_uc011dev.1_Missense_Mutation_p.R110S	NM_014211	NP_055026	O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	110	Extracellular (Potential).					cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			breast(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	9908827	9908827	+	RNA	SNP	G	A	A	rs145100001		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9908827G>A	uc003myg.1	-	3		c.255C>T			uc010jog.1_Silent_p.Y64Y|uc003myh.1_Silent_p.Y89Y|uc003myi.2_RNA|uc003myj.1_Silent_p.Y89Y|uc003myk.1_RNA|uc003myn.2_Silent_p.Y89Y|uc010joi.1_Silent_p.Y157Y|uc010joh.1_RNA|uc011dif.1_Silent_p.Y93Y|uc011dig.1_Silent_p.Y89Y					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
SLC17A4	10050	broad.mit.edu	37	6	25771209	25771209	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25771209C>A	uc003nfe.2	+	6	794	c.675C>A	c.(673-675)ACC>ACA	p.T225T	SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Silent_p.T162T|SLC17A4_uc010jqa.2_5'Flank	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	225					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1																		---	---	---	---
MSH5	4439	broad.mit.edu	37	6	31726898	31726898	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31726898C>A	uc003nwv.1	+	16	1430	c.1351C>A	c.(1351-1353)CGC>AGC	p.R451S	MSH5_uc003nwt.1_Missense_Mutation_p.R468S|MSH5_uc003nwu.1_Missense_Mutation_p.R451S|MSH5_uc003nww.1_Missense_Mutation_p.R451S|MSH5_uc003nwx.1_Missense_Mutation_p.R468S|MSH5_uc011dof.1_Missense_Mutation_p.R150S|MSH5_uc003nwy.1_Missense_Mutation_p.R125S|MSH5_uc003nwz.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	451					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3													Direct_reversal_of_damage|MMR					---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39507802	39507802	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39507802G>A	uc003oot.2	-	13	1717	c.1622C>T	c.(1621-1623)TCC>TTC	p.S541F	KIF6_uc010jwz.1_5'UTR|KIF6_uc010jxa.1_Missense_Mutation_p.S332F|KIF6_uc011dua.1_Missense_Mutation_p.S541F|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	541					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
OPN5	221391	broad.mit.edu	37	6	47759622	47759622	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47759622C>T	uc003ozc.2	+	3	340	c.335C>T	c.(334-336)GCT>GTT	p.A112V	OPN5_uc003ozd.2_5'UTR	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	112	Helical; Name=3; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1																		---	---	---	---
SEC63	11231	broad.mit.edu	37	6	108204347	108204347	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108204347C>T	uc003psc.3	-	17	1947	c.1678G>A	c.(1678-1680)GCT>ACT	p.A560T	SEC63_uc003psb.3_Missense_Mutation_p.A420T	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	560	Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)														---	---	---	---
GPR6	2830	broad.mit.edu	37	6	110300498	110300498	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110300498G>T	uc011eaw.1	+	2	363	c.183G>T	c.(181-183)TCG>TCT	p.S61S	GPR6_uc011eav.1_Silent_p.S76S|GPR6_uc003ptu.2_Silent_p.S61S	NM_005284	NP_005275	P46095	GPR6_HUMAN	G protein-coupled receptor 6	61	Extracellular (Potential).					integral to plasma membrane					0		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)														---	---	---	---
C6orf186	728464	broad.mit.edu	37	6	110620213	110620213	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110620213C>A	uc010kdu.1	-	4	698	c.698G>T	c.(697-699)CGG>CTG	p.R233L	C6orf186_uc003pub.2_Missense_Mutation_p.R36L	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	233						extracellular region					0																		---	---	---	---
MED23	9439	broad.mit.edu	37	6	131936492	131936492	+	Intron	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131936492G>T	uc003qcs.1	-						MED23_uc003qcq.2_Intron|MED23_uc003qct.1_Intron|MED23_uc011ecb.1_Intron	NM_004830	NP_004821			mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152523002	152523002	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152523002G>T	uc010kiw.2	-	127	23704	c.23102C>A	c.(23101-23103)CCG>CAG	p.P7701Q	SYNE1_uc010kiv.2_Missense_Mutation_p.P2225Q|SYNE1_uc003qos.3_Missense_Mutation_p.P2225Q|SYNE1_uc003qot.3_Missense_Mutation_p.P7630Q|SYNE1_uc003qou.3_Missense_Mutation_p.P7701Q|SYNE1_uc003qor.3_Missense_Mutation_p.P601Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7701	Cytoplasmic (Potential).|Spectrin 26.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
MYCT1	80177	broad.mit.edu	37	6	153043339	153043339	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153043339C>A	uc003qpd.3	+	2	667	c.659C>A	c.(658-660)CCG>CAG	p.P220Q	MYCT1_uc010kjc.1_Missense_Mutation_p.P172Q|MYCT1_uc003qpc.3_Missense_Mutation_p.P220Q	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	220						nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)														---	---	---	---
HEATR2	54919	broad.mit.edu	37	7	794250	794250	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:794250G>T	uc010krz.1	+	5	1069	c.1049G>T	c.(1048-1050)CGG>CTG	p.R350L	HEATR2_uc003siz.2_Missense_Mutation_p.R218L	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	350							protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)														---	---	---	---
C7orf25	79020	broad.mit.edu	37	7	42971765	42971765	+	5'UTR	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42971765C>A	uc010kxr.2	-	1					PSMA2_uc003thy.2_5'UTR|PSMA2_uc010kxt.2_5'UTR|PSMA2_uc003thz.1_5'UTR|MRPL32_uc003tia.2_5'Flank|MRPL32_uc003tib.2_5'Flank|MRPL32_uc003tic.2_5'Flank	NM_001099858	NP_001093328			hypothetical protein LOC79020 a											skin(1)	1																		---	---	---	---
DTX2	113878	broad.mit.edu	37	7	76112315	76112315	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76112315C>A	uc003uff.3	+	5	1315	c.759C>A	c.(757-759)TCC>TCA	p.S253S	DTX2_uc011kgk.1_Silent_p.S162S|DTX2_uc003ufg.3_Silent_p.S253S|DTX2_uc003ufh.3_Silent_p.S253S|DTX2_uc003ufj.3_Silent_p.S253S	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	253					Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77764359	77764359	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77764359G>T	uc003ugx.2	-	17	3264	c.3010C>A	c.(3010-3012)CTT>ATT	p.L1004I	MAGI2_uc003ugy.2_Missense_Mutation_p.L990I|MAGI2_uc010ldx.1_Missense_Mutation_p.L597I	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	1004	PDZ 5.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81635132	81635132	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81635132C>A	uc003uhr.1	-	17	1720	c.1464G>T	c.(1462-1464)ATG>ATT	p.M488I		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	488	Extracellular (Potential).|Cache.					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
C7orf64	84060	broad.mit.edu	37	7	92164116	92164116	+	Silent	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92164116G>A	uc003ulz.2	+	4	890	c.849G>A	c.(847-849)GAG>GAA	p.E283E	C7orf64_uc003uma.2_Silent_p.E283E	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060	283							nucleotide binding			ovary(2)	2																		---	---	---	---
ZNF3	7551	broad.mit.edu	37	7	99672820	99672820	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99672820G>T	uc003usq.2	-	5	516	c.209C>A	c.(208-210)CCT>CAT	p.P70H	ZNF3_uc003usp.2_Missense_Mutation_p.P70H|ZNF3_uc003usr.2_Missense_Mutation_p.P70H|ZNF3_uc010lgj.2_Missense_Mutation_p.P34H|ZNF3_uc003uss.2_Missense_Mutation_p.P77H|ZNF3_uc003ust.3_Missense_Mutation_p.P70H	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2	70	KRAB.				cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	100552305	100552305	+	RNA	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100552305C>A	uc003uxk.1	+	1		c.1556C>A			uc003uxl.1_Silent_p.P252P					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																														---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100679310	100679310	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100679310C>T	uc003uxp.1	+	3	4666	c.4613C>T	c.(4612-4614)CCT>CTT	p.P1538L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1538	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|23.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
RELN	5649	broad.mit.edu	37	7	103338452	103338452	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103338452C>A	uc003vca.2	-	10	1151	c.991G>T	c.(991-993)GAA>TAA	p.E331*	RELN_uc010liz.2_Nonsense_Mutation_p.E331*	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	331					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity	p.E331K(1)		ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
SRPK2	6733	broad.mit.edu	37	7	104809719	104809719	+	Intron	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104809719A>G	uc003vct.2	-						SRPK2_uc003vcu.2_Intron|SRPK2_uc003vcv.2_Intron|SRPK2_uc003vcw.1_Intron	NM_182691	NP_872633			serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127979297	127979297	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127979297C>A	uc003vmp.2	-	3	471	c.356G>T	c.(355-357)CGG>CTG	p.R119L	RBM28_uc011koj.1_Intron|RBM28_uc011kok.1_Missense_Mutation_p.R66L	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	119	RRM 2.				mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
TNPO3	23534	broad.mit.edu	37	7	128610227	128610227	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128610227C>A	uc003vol.1	-	20	2947	c.2573G>T	c.(2572-2574)TGG>TTG	p.W858L	TNPO3_uc010llx.1_Missense_Mutation_p.W269L|TNPO3_uc003vom.1_Missense_Mutation_p.W792L|TNPO3_uc010lly.1_Missense_Mutation_p.W892L|TNPO3_uc010llz.1_Missense_Mutation_p.W794L	NM_012470	NP_036602	Q9Y5L0	TNPO3_HUMAN	transportin 3	858					splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
ACCN3	9311	broad.mit.edu	37	7	150746116	150746116	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150746116C>T	uc003win.2	+	1	512	c.144C>T	c.(142-144)GCC>GCT	p.A48A	ACCN3_uc003wio.2_Silent_p.A48A|ACCN3_uc003wip.2_Silent_p.A48A|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	48	Helical; (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151261254	151261254	+	Silent	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151261254A>C	uc003wkk.2	-	14	2105	c.1494T>G	c.(1492-1494)CTT>CTG	p.L498L	PRKAG2_uc003wki.2_Silent_p.L257L|PRKAG2_uc011kvl.1_Silent_p.L373L|PRKAG2_uc003wkj.2_Silent_p.L454L|PRKAG2_uc003wkl.2_Silent_p.L46L	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	498					ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
C8orf79	57604	broad.mit.edu	37	8	12878836	12878836	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12878836C>A	uc010lsq.2	+	5	1140	c.648C>A	c.(646-648)GGC>GGA	p.G216G	C8orf79_uc011kxw.1_Intron|C8orf79_uc003wwj.3_Silent_p.G129G|C8orf79_uc010lsr.2_Silent_p.G90G	NM_020844	NP_065895	Q9P272	K1456_HUMAN	hypothetical protein LOC57604 isoform 1	216							methyltransferase activity				0																		---	---	---	---
CHRNA2	1135	broad.mit.edu	37	8	27320907	27320907	+	Silent	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27320907A>G	uc010lur.2	-	6	1662	c.1053T>C	c.(1051-1053)AAT>AAC	p.N351N	CHRNA2_uc011lal.1_Silent_p.N336N|CHRNA2_uc010lus.2_Silent_p.N153N	NM_000742	NP_000733	Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha	351	Helical; (Potential).					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(1)	1		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Gallamine Triethiodide(DB00483)|Levallorphan(DB00504)|Mecamylamine(DB00657)|Metocurine(DB01336)|Metocurine Iodide(DB00416)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Rocuronium(DB00728)|Tubocurarine(DB01199)													---	---	---	---
KCNU1	157855	broad.mit.edu	37	8	36780063	36780063	+	Silent	SNP	C	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36780063C>G	uc010lvw.2	+	24	2739	c.2652C>G	c.(2650-2652)CTC>CTG	p.L884L	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	884	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)														---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48613005	48613005	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48613005C>A	uc003xqd.2	+	12	1735	c.1726C>A	c.(1726-1728)CCA>ACA	p.P576T	KIAA0146_uc011ldb.1_Missense_Mutation_p.P576T|KIAA0146_uc010lxs.2_Missense_Mutation_p.P51T|KIAA0146_uc011ldc.1_Missense_Mutation_p.P506T|KIAA0146_uc011ldd.1_Missense_Mutation_p.P516T|KIAA0146_uc003xqe.2_Missense_Mutation_p.P51T|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Missense_Mutation_p.P265T|KIAA0146_uc010lxt.2_Missense_Mutation_p.P265T|KIAA0146_uc011ldf.1_Missense_Mutation_p.P81T|KIAA0146_uc011ldg.1_Missense_Mutation_p.P66T|KIAA0146_uc010lxv.1_Missense_Mutation_p.P70T	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	576											0		Lung NSC(58;0.175)																---	---	---	---
NSMAF	8439	broad.mit.edu	37	8	59520349	59520349	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59520349C>A	uc003xtt.2	-	11	952	c.738G>T	c.(736-738)AGG>AGT	p.R246S	NSMAF_uc011lee.1_Missense_Mutation_p.R277S|NSMAF_uc003xtu.2_Missense_Mutation_p.R246S	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	246	GRAM.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)																---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61655087	61655087	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61655087C>T	uc003xue.2	+	2	1573	c.1096C>T	c.(1096-1098)CCC>TCC	p.P366S		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	366					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
EYA1	2138	broad.mit.edu	37	8	72123487	72123487	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72123487T>G	uc003xys.3	-	16	1889	c.1602A>C	c.(1600-1602)AAA>AAC	p.K534N	EYA1_uc003xyr.3_Missense_Mutation_p.K499N|EYA1_uc003xyt.3_Missense_Mutation_p.K501N|EYA1_uc010lzf.2_Missense_Mutation_p.K461N|EYA1_uc003xyu.2_Missense_Mutation_p.K534N|EYA1_uc011lfe.1_Missense_Mutation_p.K528N|EYA1_uc003xyv.2_Missense_Mutation_p.K412N	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	534					double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)															---	---	---	---
GRHL2	79977	broad.mit.edu	37	8	102649139	102649139	+	Silent	SNP	G	T	T	rs34550163	byFrequency;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102649139G>T	uc010mbu.2	+	12	1830	c.1500G>T	c.(1498-1500)ACG>ACT	p.T500T		NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3	500						cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)															---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102731683	102731683	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102731683C>A	uc003yke.2	-	2	544	c.175G>T	c.(175-177)GGG>TGG	p.G59W	NCALD_uc003ykf.2_Missense_Mutation_p.G59W|NCALD_uc003ykg.2_Missense_Mutation_p.G59W|NCALD_uc003ykh.2_Missense_Mutation_p.G59W|NCALD_uc003yki.2_Missense_Mutation_p.G59W|NCALD_uc003ykj.2_Missense_Mutation_p.G59W|NCALD_uc003ykk.2_Missense_Mutation_p.G59W|NCALD_uc003ykl.2_Missense_Mutation_p.G59W	NM_032041	NP_114430	P61601	NCALD_HUMAN	neurocalcin delta	59					synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
DPYS	1807	broad.mit.edu	37	8	105456579	105456579	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105456579C>T	uc003yly.3	-	4	819	c.690G>A	c.(688-690)ACG>ACA	p.T230T		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	230					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
ANXA13	312	broad.mit.edu	37	8	124710680	124710680	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124710680C>A	uc003yqu.2	-	4	379	c.306G>T	c.(304-306)CTG>CTT	p.L102L	ANXA13_uc003yqt.2_Silent_p.L143L	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a	102	Annexin 2.				cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	3856146	3856146	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3856146G>T	uc003zhw.1	-	8	2065	c.1871C>A	c.(1870-1872)CCC>CAC	p.P624H	GLIS3_uc003zhx.1_Missense_Mutation_p.P779H|GLIS3_uc010mhf.1_Missense_Mutation_p.P173H|GLIS3_uc003zhv.1_RNA|GLIS3_uc003zhy.1_Missense_Mutation_p.P557H	NM_152629	NP_689842	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3 isoform b	624					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
PTAR1	375743	broad.mit.edu	37	9	72338471	72338471	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72338471G>T	uc004ahj.3	-	6	740	c.718C>A	c.(718-720)CGC>AGC	p.R240S	PTAR1_uc004ahi.2_Missense_Mutation_p.R161S	NM_001099666	NP_001093136	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat	240	PFTA 4.				protein prenylation		protein prenyltransferase activity			central_nervous_system(1)	1																		---	---	---	---
C9orf41	138199	broad.mit.edu	37	9	77614730	77614730	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77614730C>A	uc004ajq.2	-	4	800	c.647G>T	c.(646-648)TGG>TTG	p.W216L	C9orf41_uc011lsi.1_Intron	NM_152420	NP_689633	Q8N4J0	CI041_HUMAN	hypothetical protein LOC138199	216										ovary(1)|skin(1)	2																		---	---	---	---
GCNT1	2650	broad.mit.edu	37	9	79117387	79117387	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79117387C>A	uc010mpf.2	+	3	431	c.90C>A	c.(88-90)TCC>TCA	p.S30S	GCNT1_uc010mpg.2_Silent_p.S30S|GCNT1_uc010mph.2_Silent_p.S30S|GCNT1_uc004akf.3_Silent_p.S30S|GCNT1_uc010mpi.2_Silent_p.S30S|GCNT1_uc004akh.3_Silent_p.S30S	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	30	Helical; Signal-anchor for type II membrane protein; (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0																		---	---	---	---
GNA14	9630	broad.mit.edu	37	9	80144155	80144155	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80144155C>A	uc004aku.2	-	2	662	c.139G>T	c.(139-141)GGG>TGG	p.G47W		NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14	47	GTP (By similarity).				activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2																		---	---	---	---
PTPN3	5774	broad.mit.edu	37	9	112166833	112166833	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112166833G>T	uc004bed.2	-	19	1960	c.1848C>A	c.(1846-1848)CCC>CCA	p.P616P	PTPN3_uc004beb.2_Silent_p.P485P|PTPN3_uc004bec.2_Silent_p.P440P|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Silent_p.P571P|PTPN3_uc011lwh.1_Silent_p.P462P|PTPN3_uc011lwd.1_Silent_p.P84P|PTPN3_uc011lwe.1_Silent_p.P329P|PTPN3_uc011lwf.1_Silent_p.P284P	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	616					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3																		---	---	---	---
TRAF1	7185	broad.mit.edu	37	9	123671515	123671515	+	Missense_Mutation	SNP	C	A	A	rs61749211	byFrequency	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123671515C>A	uc004bku.1	-	7	1597	c.1025G>T	c.(1024-1026)CGG>CTG	p.R342L	TRAF1_uc011lyg.1_Missense_Mutation_p.R220L|TRAF1_uc010mvl.1_Missense_Mutation_p.R342L	NM_005658	NP_005649	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	342	MATH.				apoptosis|positive regulation of NF-kappaB transcription factor activity|protein complex assembly|regulation of apoptosis|signal transduction	cytoplasm	protein binding|zinc ion binding			skin(2)|ovary(1)	3																		---	---	---	---
C9orf9	11092	broad.mit.edu	37	9	135765336	135765336	+	3'UTR	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135765336C>A	uc004cbx.1	+	4					C9orf9_uc004cby.1_Intron|C9orf9_uc004cbz.1_3'UTR	NM_018956	NP_061829			Rsb-66 protein									p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)														---	---	---	---
TSC1	7248	broad.mit.edu	37	9	135786402	135786402	+	Silent	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135786402G>C	uc004cca.2	-	11	1362	c.1128C>G	c.(1126-1128)GTC>GTG	p.V376V	TSC1_uc004ccb.3_Silent_p.V376V|TSC1_uc011mcq.1_Silent_p.V325V|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Silent_p.V255V|TSC1_uc004ccc.1_Silent_p.V376V|TSC1_uc004ccd.2_3'UTR|TSC1_uc004cce.1_3'UTR	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	376					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)				D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				---	---	---	---
C9orf86	55684	broad.mit.edu	37	9	139726264	139726264	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139726264C>A	uc004cji.1	+	6	818	c.550C>A	c.(550-552)CGA>AGA	p.R184R	C9orf86_uc004cjm.2_Silent_p.R184R|C9orf86_uc004cjh.2_Silent_p.R184R|C9orf86_uc004cjj.1_Silent_p.R184R|C9orf86_uc004cjk.1_RNA|C9orf86_uc010nbr.1_Silent_p.R184R|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_Silent_p.R69R	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	184	Small GTPase-like.				small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)														---	---	---	---
NDOR1	27158	broad.mit.edu	37	9	140108734	140108734	+	Silent	SNP	C	A	A	rs147663463		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140108734C>A	uc004clw.2	+	6	702	c.591C>A	c.(589-591)CCC>CCA	p.P197P	NDOR1_uc004clx.2_Silent_p.P197P|NDOR1_uc011mes.1_Silent_p.P197P|NDOR1_uc004cly.2_Silent_p.P163P	NM_014434	NP_055249	Q9UHB4	NDOR1_HUMAN	NADPH dependent diflavin oxidoreductase 1	197					cell death	cytosol|intermediate filament cytoskeleton|nucleus|perinuclear region of cytoplasm	flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding|oxidoreductase activity|protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)														---	---	---	---
PITRM1	10531	broad.mit.edu	37	10	3197782	3197782	+	Splice_Site	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3197782C>T	uc010qah.1	-	13	1557	c.1525_splice	c.e13+1	p.G509_splice	PITRM1_uc001igr.1_Splice_Site_p.G541_splice|PITRM1_uc001igt.1_Splice_Site_p.G541_splice|PITRM1_uc009xhv.1_Splice_Site_p.G106_splice|PITRM1_uc001igu.1_Splice_Site_p.G533_splice|PITRM1_uc010qai.1_Splice_Site_p.G512_splice|PITRM1_uc001igw.1_Splice_Site_p.G541_splice					SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1																		---	---	---	---
ANKRD30A	91074	broad.mit.edu	37	10	37431019	37431019	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37431019C>A	uc001iza.1	+	7	1125	c.1026C>A	c.(1024-1026)CCC>CCA	p.P342P		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	398						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---
ZNF33B	7582	broad.mit.edu	37	10	43089593	43089593	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43089593G>T	uc001jaf.1	-	5	920	c.805C>A	c.(805-807)CCA>ACA	p.P269T	ZNF33B_uc009xmg.1_Intron|ZNF33B_uc001jae.1_Intron|ZNF33B_uc001jag.1_Missense_Mutation_p.P157T|ZNF33B_uc001jad.2_Intron	NM_006955	NP_008886	Q06732	ZN33B_HUMAN	zinc finger protein 33B	269						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43292386	43292386	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292386A>C	uc001jaj.2	+	10	2052	c.1694A>C	c.(1693-1695)AAG>ACG	p.K565T		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	565					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43292525	43292525	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292525G>C	uc001jaj.2	+	10	2191	c.1833G>C	c.(1831-1833)GAG>GAC	p.E611D		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	611					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
ZWINT	11130	broad.mit.edu	37	10	58118565	58118565	+	Splice_Site	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58118565C>T	uc001jjx.1	-	6	660	c.623_splice	c.e6+1	p.R208_splice	ZWINT_uc001jjy.1_Intron|ZWINT_uc001jka.1_Splice_Site_p.R208_splice|ZWINT_uc009xoy.1_Splice_Site	NM_007057	NP_008988			ZW10 interactor isoform a						cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding				0																		---	---	---	---
DNAJC12	56521	broad.mit.edu	37	10	69565402	69565402	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69565402C>A	uc001jnb.2	-	4	609	c.441G>T	c.(439-441)ACG>ACT	p.T147T		NM_021800	NP_068572	Q9UKB3	DJC12_HUMAN	J domain containing protein 1 isoform a	147					protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1																		---	---	---	---
ANXA11	311	broad.mit.edu	37	10	81925888	81925888	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81925888C>A	uc001kbq.1	-	9	1635	c.810G>T	c.(808-810)ATG>ATT	p.M270I	ANXA11_uc010qlx.1_Missense_Mutation_p.M370I|ANXA11_uc001kbr.1_Missense_Mutation_p.M270I|ANXA11_uc001kbs.1_Missense_Mutation_p.M270I|ANXA11_uc001kbt.1_Missense_Mutation_p.M270I|ANXA11_uc010qly.1_Missense_Mutation_p.M237I|ANXA11_uc009xsq.1_Missense_Mutation_p.M274I|ANXA11_uc001kbu.1_Missense_Mutation_p.M270I	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11	270					cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)															---	---	---	---
PDE6C	5146	broad.mit.edu	37	10	95380726	95380726	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95380726C>A	uc001kiu.3	+	3	850	c.712C>A	c.(712-714)CGA>AGA	p.R238R		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	238					visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)																---	---	---	---
GBF1	8729	broad.mit.edu	37	10	104129973	104129973	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104129973C>A	uc001kux.1	+	27	3619	c.3379C>A	c.(3379-3381)CAG>AAG	p.Q1127K	GBF1_uc001kuy.1_Missense_Mutation_p.Q1127K|GBF1_uc001kuz.1_Missense_Mutation_p.Q1128K	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1127					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108459010	108459010	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108459010T>C	uc001kym.2	-	9	1383	c.1375A>G	c.(1375-1377)AGA>GGA	p.R459G	SORCS1_uc001kyl.2_Missense_Mutation_p.R459G|SORCS1_uc009xxs.2_Missense_Mutation_p.R459G|SORCS1_uc001kyn.1_Missense_Mutation_p.R459G|SORCS1_uc001kyo.2_Missense_Mutation_p.R459G	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	459	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
TDRD1	56165	broad.mit.edu	37	10	115959035	115959035	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115959035C>T	uc001lbg.1	+	4	641	c.488C>T	c.(487-489)CCT>CTT	p.P163L	TDRD1_uc001lbf.2_Missense_Mutation_p.P154L|TDRD1_uc001lbh.1_Missense_Mutation_p.P154L|TDRD1_uc001lbi.1_Missense_Mutation_p.P154L	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	163					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)														---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123970525	123970525	+	Silent	SNP	C	A	A	rs151005188		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123970525C>A	uc001lfv.2	+	9	6945	c.6585C>A	c.(6583-6585)CCC>CCA	p.P2195P	TACC2_uc001lfw.2_Silent_p.P341P|TACC2_uc009xzx.2_Silent_p.P2150P|TACC2_uc010qtv.1_Silent_p.P2199P|TACC2_uc001lfx.2_5'UTR|TACC2_uc001lfy.2_5'UTR|TACC2_uc001lfz.2_Silent_p.P273P|TACC2_uc001lga.2_Silent_p.P273P|TACC2_uc009xzy.2_Silent_p.P273P|TACC2_uc001lgb.2_Silent_p.P230P|TACC2_uc010qtw.1_Silent_p.P290P	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	2195						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
FANK1	92565	broad.mit.edu	37	10	127697933	127697933	+	Intron	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127697933T>G	uc001ljh.3	+						FANK1_uc009yan.2_Intron|FANK1_uc001lji.2_3'UTR	NM_145235	NP_660278			fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)																---	---	---	---
OR52E6	390078	broad.mit.edu	37	11	5862742	5862742	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862742C>A	uc010qzq.1	-	1	386	c.386G>T	c.(385-387)TGC>TTC	p.C129F	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	129	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
TP53I11	9537	broad.mit.edu	37	11	44956429	44956429	+	3'UTR	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44956429G>T	uc001myi.2	-	10					TP53I11_uc001myf.1_Intron|TP53I11_uc001myj.2_3'UTR|TP53I11_uc001myk.2_3'UTR|TP53I11_uc001myl.2_3'UTR|TP53I11_uc001mym.2_3'UTR	NM_006034	NP_006025			p53-induced protein						negative regulation of cell proliferation|response to stress	integral to membrane				ovary(1)	1																		---	---	---	---
OR9G9	504191	broad.mit.edu	37	11	56468143	56468143	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468143G>A	uc010rjn.1	+	1	280	c.280G>A	c.(280-282)GCT>ACT	p.A94T		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---
PGA3	643834	broad.mit.edu	37	11	60971081	60971081	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60971081C>T	uc001nqx.2	+	1	98	c.45C>T	c.(43-45)TGC>TGT	p.C15C	PGA3_uc010rld.1_Silent_p.C15C	NM_001079807	NP_001073275			pepsinogen 3, group I precursor											ovary(1)|skin(1)	2																		---	---	---	---
SLC22A8	9376	broad.mit.edu	37	11	62762237	62762237	+	Intron	SNP	C	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62762237C>G	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Intron|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245			solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3																		---	---	---	---
MARK2	2011	broad.mit.edu	37	11	63672270	63672270	+	Silent	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63672270G>A	uc001nxw.2	+	16	2268	c.1689G>A	c.(1687-1689)CAG>CAA	p.Q563Q	MARK2_uc001nxx.2_Silent_p.Q509Q|MARK2_uc001nxy.2_Silent_p.Q508Q|MARK2_uc001nxv.3_Silent_p.Q508Q|MARK2_uc001nxz.3_Silent_p.Q529Q|MARK2_uc009yoy.2_Silent_p.Q483Q	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2	563					cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3																		---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63987708	63987708	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63987708C>A	uc001nyl.2	+	11	1382	c.1233C>A	c.(1231-1233)CCC>CCA	p.P411P	FERMT3_uc001nym.2_Silent_p.P407P	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	411	PH.|FERM.				integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1																		---	---	---	---
MALAT1	378938	broad.mit.edu	37	11	65269711	65269711	+	RNA	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269711A>G	uc010roh.1	+	1		c.4479A>G			uc001ody.2_RNA|MALAT1_uc001odz.2_RNA	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0																		---	---	---	---
GRM5	2915	broad.mit.edu	37	11	88780590	88780590	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780590A>G	uc001pcq.2	-	1	651	c.451T>C	c.(451-453)TCC>CCC	p.S151P	GRM5_uc009yvm.2_Missense_Mutation_p.S151P|GRM5_uc009yvn.1_Missense_Mutation_p.S151P	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	151	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)													---	---	---	---
NCAM1	4684	broad.mit.edu	37	11	113076865	113076865	+	Silent	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113076865G>A	uc009yyq.1	+	5	931	c.237G>A	c.(235-237)GGG>GGA	p.G79G	NCAM1_uc001pno.2_Silent_p.G79G	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3	197	Ig-like C2-type 2.|Extracellular (Potential).				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)														---	---	---	---
HINFP	25988	broad.mit.edu	37	11	119003857	119003857	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119003857G>T	uc001pvp.2	+	10	1256	c.1067G>T	c.(1066-1068)CGG>CTG	p.R356L	HINFP_uc001pvq.2_Missense_Mutation_p.R356L|HINFP_uc001pvr.2_Missense_Mutation_p.R109L	NM_015517	NP_056332	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	356	C2H2-type 9.				DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4																		---	---	---	---
C12orf32	83695	broad.mit.edu	37	12	2994576	2994576	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2994576C>A	uc001qlh.2	+	2	212	c.44C>A	c.(43-45)CCG>CAG	p.P15Q	TULP3_uc010sef.1_Intron|C12orf32_uc010see.1_Missense_Mutation_p.P15Q|C12orf32_uc001qli.2_Intron	NR_027363				RecName: Full=Uncharacterized protein C12orf32;												0			OV - Ovarian serous cystadenocarcinoma(31;0.000622)															---	---	---	---
CHD4	1108	broad.mit.edu	37	12	6690956	6690956	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690956C>A	uc001qpo.2	-	31	4704	c.4540G>T	c.(4540-4542)GGG>TGG	p.G1514W	CHD4_uc001qpn.2_Missense_Mutation_p.G1507W|CHD4_uc001qpp.2_Missense_Mutation_p.G1539W|uc001qpq.1_Intron|SCARNA11_uc001qpr.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1514					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2																		---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7302142	7302142	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7302142G>T	uc001qsr.2	+	14	2376	c.2098G>T	c.(2098-2100)GAG>TAG	p.E700*	CLSTN3_uc001qss.2_Nonsense_Mutation_p.E712*	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	700	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1																		---	---	---	---
CSDA	8531	broad.mit.edu	37	12	10856654	10856654	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10856654G>T	uc001qyt.2	-	7	1117	c.874C>A	c.(874-876)CGT>AGT	p.R292S	CSDA_uc001qyu.2_Missense_Mutation_p.R223S	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	292					negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)																	---	---	---	---
KIAA0528	9847	broad.mit.edu	37	12	22623829	22623829	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22623829A>C	uc001rfq.2	-	21	2603	c.2375T>G	c.(2374-2376)GTC>GGC	p.V792G	KIAA0528_uc010sir.1_Missense_Mutation_p.V607G|KIAA0528_uc010sis.1_Missense_Mutation_p.V792G|KIAA0528_uc010sit.1_Missense_Mutation_p.V794G|KIAA0528_uc010siu.1_Missense_Mutation_p.V792G|KIAA0528_uc001rfr.2_Missense_Mutation_p.V783G	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	792							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
DDX23	9416	broad.mit.edu	37	12	49237789	49237789	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49237789C>A	uc001rsm.2	-	3	345	c.254G>T	c.(253-255)CGG>CTG	p.R85L		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	85	Arg-rich.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6																		---	---	---	---
OR10P1	121130	broad.mit.edu	37	12	56031172	56031172	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56031172C>T	uc010spq.1	+	1	497	c.497C>T	c.(496-498)TCT>TTT	p.S166F		NM_206899	NP_996782	Q8NGE3	O10P1_HUMAN	olfactory receptor, family 10, subfamily P,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
ITGA7	3679	broad.mit.edu	37	12	56091746	56091746	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56091746C>A	uc001shh.2	-	8	1489	c.1269G>T	c.(1267-1269)CTG>CTT	p.L423L	ITGA7_uc001shg.2_Silent_p.L419L|ITGA7_uc010sps.1_Silent_p.L326L|ITGA7_uc009znw.2_5'Flank|ITGA7_uc009znx.2_Silent_p.L306L	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	463	FG-GAP 6.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
ERBB3	2065	broad.mit.edu	37	12	56481946	56481946	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56481946C>A	uc001sjh.2	+	7	1067	c.874C>A	c.(874-876)CAT>AAT	p.H292N	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.H233N|ERBB3_uc001sji.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	292	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)															---	---	---	---
LRIG3	121227	broad.mit.edu	37	12	59274492	59274492	+	Nonsense_Mutation	SNP	C	A	A	rs60376933	byFrequency;by1000genomes	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59274492C>A	uc001sqr.2	-	13	1918	c.1672G>T	c.(1672-1674)GAG>TAG	p.E558*	LRIG3_uc009zqh.2_Nonsense_Mutation_p.E498*|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	558	Ig-like C2-type 1.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)															---	---	---	---
CPSF6	11052	broad.mit.edu	37	12	69652867	69652867	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69652867C>A	uc001sut.3	+	6	1302	c.1192C>A	c.(1192-1194)CCT>ACT	p.P398T	CPSF6_uc001suu.3_Missense_Mutation_p.P435T|CPSF6_uc010stk.1_Missense_Mutation_p.P29T	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	398	Pro-rich.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)															---	---	---	---
DAO	1610	broad.mit.edu	37	12	109281277	109281277	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109281277C>A	uc001tnr.3	+	3	399	c.246C>A	c.(244-246)CCC>CCA	p.P82P	DAO_uc001tnq.3_Silent_p.P82P|DAO_uc009zvb.2_Intron|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	82					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2																		---	---	---	---
WDR66	144406	broad.mit.edu	37	12	122361822	122361822	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122361822C>A	uc009zxk.2	+	3	815	c.673C>A	c.(673-675)CGG>AGG	p.R225R		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	225							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
PARP4	143	broad.mit.edu	37	13	25051999	25051999	+	Intron	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25051999G>C	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428			poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---
CSNK1A1L	122011	broad.mit.edu	37	13	37679276	37679276	+	Missense_Mutation	SNP	C	A	A	rs112114979		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37679276C>A	uc001uwm.1	-	1	526	c.118G>T	c.(118-120)GGC>TGC	p.G40C		NM_145203	NP_660204	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	40	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)	1		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)														---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60545059	60545059	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60545059A>G	uc001vht.2	-	16	2105	c.1886T>C	c.(1885-1887)ATC>ACC	p.I629T	DIAPH3_uc001vhu.2_Missense_Mutation_p.I366T|DIAPH3_uc001vhv.2_Missense_Mutation_p.I207T	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	629	FH1.|Pro-rich.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111111150	111111150	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111111150G>A	uc001vqx.2	+	22	1754	c.1465G>A	c.(1465-1467)GAC>AAC	p.D489N		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	489	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113485748	113485748	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113485748G>T	uc001vsi.3	+	13	1369	c.1281G>T	c.(1279-1281)AAG>AAT	p.K427N	ATP11A_uc001vsj.3_Missense_Mutation_p.K427N|ATP11A_uc001vsm.1_Missense_Mutation_p.K303N	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	427	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
KHNYN	23351	broad.mit.edu	37	14	24906308	24906308	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24906308G>T	uc001wph.3	+	8	2056	c.1854G>T	c.(1852-1854)CAG>CAT	p.Q618H	KHNYN_uc010tpc.1_Missense_Mutation_p.Q659H|KHNYN_uc010alw.2_Missense_Mutation_p.Q618H	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	618										ovary(2)|liver(1)	3																OREG0022628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FKBP3	2287	broad.mit.edu	37	14	45590824	45590824	+	Splice_Site	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45590824C>A	uc010tqf.1	-	4	392	c.319_splice	c.e4-1	p.G107_splice		NM_002013	NP_002004			FK506 binding protein 3, 25kDa						protein folding	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|receptor activity				0																		---	---	---	---
GPR137C	283554	broad.mit.edu	37	14	53067069	53067069	+	Intron	SNP	T	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53067069T>A	uc001wzu.3	+						GPR137C_uc001wzt.3_Intron	NM_001099652	NP_001093122			G protein-coupled receptor 137C							integral to membrane					0	Breast(41;0.0716)																	---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58563555	58563555	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58563555G>T	uc001xdc.2	-	5	2087	c.1976C>A	c.(1975-1977)CCT>CAT	p.P659H	C14orf37_uc010tro.1_Missense_Mutation_p.P697H|C14orf37_uc001xdd.2_Missense_Mutation_p.P659H	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	659	Extracellular (Potential).					integral to membrane	binding				0																		---	---	---	---
C14orf43	91748	broad.mit.edu	37	14	74205475	74205475	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74205475C>A	uc001xot.2	-	2	2020	c.1237G>T	c.(1237-1239)GGG>TGG	p.G413W	C14orf43_uc001xou.2_Missense_Mutation_p.G413W|C14orf43_uc010tud.1_Missense_Mutation_p.G413W|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	413					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)														---	---	---	---
TMEM63C	57156	broad.mit.edu	37	14	77705811	77705811	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77705811A>T	uc001xtf.2	+	11	994	c.782A>T	c.(781-783)AAC>ATC	p.N261I	TMEM63C_uc010asq.1_Missense_Mutation_p.N261I	NM_020431	NP_065164	Q9P1W3	TM63C_HUMAN	transmembrane protein 63C	261						integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)														---	---	---	---
SMEK1	55671	broad.mit.edu	37	14	91929222	91929222	+	Splice_Site	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91929222C>A	uc001xzn.2	-	12	2653	c.1831_splice	c.e12-1	p.E611_splice	SMEK1_uc001xzm.2_Splice_Site_p.E598_splice|SMEK1_uc001xzo.2_Splice_Site_p.E598_splice|SMEK1_uc010atz.2_Splice_Site_p.E372_splice|SMEK1_uc001xzp.1_Splice_Site	NM_032560	NP_115949			SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)														---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105405849	105405849	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405849C>T	uc010axc.1	-	7	16059	c.15939G>A	c.(15937-15939)ATG>ATA	p.M5313I	AHNAK2_uc001ypx.2_Missense_Mutation_p.M5213I	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5313						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105416275	105416275	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105416275G>T	uc010axc.1	-	7	5633	c.5513C>A	c.(5512-5514)CCA>CAA	p.P1838Q	AHNAK2_uc001ypx.2_Missense_Mutation_p.P1738Q	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1838						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106757729	106757729	+	RNA	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106757729T>C	uc010tyt.1	-	472		c.16336A>G								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20170078	20170078	+	IGR	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170078T>G								None (None upstream) : GOLGA6L6 (567016 downstream)																																			---	---	---	---
EXD1	161829	broad.mit.edu	37	15	41476550	41476550	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41476550C>A	uc001znk.2	-	10	1315	c.1124G>T	c.(1123-1125)GGG>GTG	p.G375V	EXD1_uc001znj.2_Missense_Mutation_p.G173V|EXD1_uc010ucv.1_Missense_Mutation_p.G433V	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	375					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1																		---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51837907	51837907	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51837907C>A	uc002abf.2	-	8	1028	c.803G>T	c.(802-804)TGG>TTG	p.W268L	DMXL2_uc010ufy.1_Missense_Mutation_p.W268L|DMXL2_uc010bfa.2_Missense_Mutation_p.W268L	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	268	WD 3.					cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
MNS1	55329	broad.mit.edu	37	15	56736815	56736815	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56736815C>A	uc002adr.2	-	5	678	c.513G>T	c.(511-513)AAG>AAT	p.K171N	MNS1_uc010bfo.2_Missense_Mutation_p.K39N|TEX9_uc002adp.2_Intron|TEX9_uc010ugl.1_Intron	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	171	Potential.|Glu-rich.				meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)														---	---	---	---
CGNL1	84952	broad.mit.edu	37	15	57731225	57731225	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57731225G>T	uc002aeg.2	+	2	1104	c.1028G>T	c.(1027-1029)CGG>CTG	p.R343L	CGNL1_uc010bfw.2_Missense_Mutation_p.R343L	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	343	Head.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---
ITGA11	22801	broad.mit.edu	37	15	68661546	68661546	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68661546C>T	uc002ari.2	-	3	328	c.241G>A	c.(241-243)GGG>AGG	p.G81R	ITGA11_uc010bib.2_Missense_Mutation_p.G81R	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	81	FG-GAP 1.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)													---	---	---	---
IREB2	3658	broad.mit.edu	37	15	78758725	78758725	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78758725C>A	uc002bdr.2	+	5	685	c.523C>A	c.(523-525)CGA>AGA	p.R175R	IREB2_uc010unb.1_5'UTR|IREB2_uc002bdq.2_Silent_p.R175R	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	175							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)														---	---	---	---
IREB2	3658	broad.mit.edu	37	15	78783018	78783018	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78783018G>T	uc002bdr.2	+	18	2401	c.2239G>T	c.(2239-2241)GGA>TGA	p.G747*	IREB2_uc010unb.1_Nonsense_Mutation_p.G497*	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	747							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)														---	---	---	---
C15orf32	145858	broad.mit.edu	37	15	93015418	93015418	+	Silent	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93015418T>C	uc002brc.1	+	1	512	c.40T>C	c.(40-42)TTG>CTG	p.L14L	C15orf32_uc010bod.1_RNA	NM_153040	NP_694585	Q32M92	CO032_HUMAN	hypothetical protein LOC145858	14										ovary(1)	1	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)															---	---	---	---
SRRM2	23524	broad.mit.edu	37	16	2812936	2812936	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2812936C>A	uc002crk.2	+	11	2956	c.2407C>A	c.(2407-2409)CAA>AAA	p.Q803K	SRRM2_uc002crj.1_Missense_Mutation_p.Q707K|SRRM2_uc002crl.1_Missense_Mutation_p.Q803K|SRRM2_uc010bsu.1_Missense_Mutation_p.Q707K	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	803	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
ALG1	56052	broad.mit.edu	37	16	5130981	5130981	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5130981C>A	uc002cym.2	+	10	1037	c.996C>A	c.(994-996)CTC>CTA	p.L332L	ALG1_uc002cyj.2_Silent_p.L221L|ALG1_uc002cyn.2_Silent_p.L332L|ALG1_uc010bue.2_Silent_p.L221L|ALG1_uc010uxy.1_Silent_p.L221L	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase	332	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)																---	---	---	---
SETD1A	9739	broad.mit.edu	37	16	30976237	30976237	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30976237C>A	uc002ead.1	+	7	1860	c.1174C>A	c.(1174-1176)CCC>ACC	p.P392T		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	392	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3																		---	---	---	---
NOL3	8996	broad.mit.edu	37	16	67208858	67208858	+	Intron	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67208858G>A	uc010vjd.1	+						NOL3_uc010vjc.1_Intron|NOL3_uc002erp.2_Intron					RecName: Full=Nucleolar protein 3; AltName: Full=Apoptosis repressor with CARD; AltName: Full=Muscle-enriched cytoplasmic protein;          Short=Myp; AltName: Full=Nucleolar protein of 30 kDa;          Short=Nop30;						anti-apoptosis|apoptosis|mRNA processing|RNA splicing	cytosol|nucleolus	identical protein binding|RNA binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)														---	---	---	---
KCTD19	146212	broad.mit.edu	37	16	67327781	67327781	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67327781G>T	uc002esu.2	-	12	1935	c.1884C>A	c.(1882-1884)CCC>CCA	p.P628P	KCTD19_uc002est.2_Silent_p.P400P|KCTD19_uc010vjj.1_Silent_p.P371P	NM_001100915	NP_001094385	Q17RG1	KCD19_HUMAN	potassium channel tetramerisation domain	628						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)														---	---	---	---
TSNAXIP1	55815	broad.mit.edu	37	16	67860358	67860358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67860358C>A	uc002euj.2	+	11	1526	c.1132C>A	c.(1132-1134)CCT>ACT	p.P378T	TSNAXIP1_uc010vjz.1_Missense_Mutation_p.P255T|TSNAXIP1_uc002euf.3_Missense_Mutation_p.P111T|TSNAXIP1_uc010vka.1_Missense_Mutation_p.P432T|TSNAXIP1_uc010vkb.1_Missense_Mutation_p.P363T|TSNAXIP1_uc002eug.3_Missense_Mutation_p.P86T|TSNAXIP1_uc002euh.3_Missense_Mutation_p.P86T|TSNAXIP1_uc002eui.3_Missense_Mutation_p.P86T|TSNAXIP1_uc002euk.2_Missense_Mutation_p.P111T	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein	378					cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)														---	---	---	---
SMPD3	55512	broad.mit.edu	37	16	68405903	68405903	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68405903G>A	uc002ewa.2	-	3	604	c.182C>T	c.(181-183)GCC>GTC	p.A61V	SMPD3_uc010cfe.2_Missense_Mutation_p.A61V|SMPD3_uc010vlh.1_Missense_Mutation_p.A61V	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	neutral sphingomyelin phosphodiesterase 3	61	Cytoplasmic (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)													---	---	---	---
GPS2	2874	broad.mit.edu	37	17	7216156	7216156	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7216156C>A	uc002gfv.1	-	10	1166	c.903G>T	c.(901-903)TCG>TCT	p.S301S	GPS2_uc002gfw.1_Silent_p.S263S|GPS2_uc002gfx.1_Silent_p.S301S|NEURL4_uc002gfy.1_RNA|GPS2_uc002gfz.1_Silent_p.S301S	NM_004489	NP_004480	Q13227	GPS2_HUMAN	G protein pathway suppressor 2	301					cell cycle|inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of transcription from RNA polymerase II promoter	transcriptional repressor complex	GTPase inhibitor activity|protein binding|transcription corepressor activity			ovary(2)|pancreas(1)	3		Prostate(122;0.157)																---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17919899	17919899	+	Missense_Mutation	SNP	C	A	A	rs113192268		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17919899C>A	uc010vxd.1	+	15	1865	c.1486C>A	c.(1486-1488)CGC>AGC	p.R496S	LRRC48_uc002gsb.2_Missense_Mutation_p.R496S|ATPAF2_uc002gsd.1_Intron	NM_001130090	NP_001123562	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48 isoform a	496						cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
ERAL1	26284	broad.mit.edu	37	17	27182138	27182138	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27182138G>T	uc002hcy.1	+	1	96	c.86G>T	c.(85-87)CGG>CTG	p.R29L	ERAL1_uc002hcx.1_Missense_Mutation_p.R29L|ERAL1_uc002hcz.1_RNA|ERAL1_uc002hda.1_5'Flank|ERAL1_uc002hdb.1_5'Flank	NM_005702	NP_005693	O75616	ERAL1_HUMAN	Era-like 1	29					ribosomal small subunit assembly	mitochondrial inner membrane|mitochondrial matrix	GTP binding|ribosomal small subunit binding|rRNA binding			skin(1)	1	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)															---	---	---	---
C17orf75	64149	broad.mit.edu	37	17	30658894	30658894	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30658894C>A	uc002hhg.2	-	10	1110	c.1079G>T	c.(1078-1080)GGA>GTA	p.G360V		NM_022344	NP_071739	Q9HAS0	NJMU_HUMAN	hypothetical protein LOC64149	360					spermatogenesis					ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)															---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	31039074	31039074	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31039074G>T	uc002hho.1	-	16	2065	c.2053C>A	c.(2053-2055)CGA>AGA	p.R685R	MYO1D_uc002hhp.1_Silent_p.R685R	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	685						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
STAC2	342667	broad.mit.edu	37	17	37371249	37371249	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37371249C>A	uc002hrs.2	-	6	946	c.727G>T	c.(727-729)GGG>TGG	p.G243W	STAC2_uc010cvt.2_Missense_Mutation_p.G101W	NM_198993	NP_945344	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	243					intracellular signal transduction		metal ion binding			pancreas(1)	1																		---	---	---	---
TMUB2	79089	broad.mit.edu	37	17	42266857	42266857	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42266857C>A	uc002ifo.2	+	3	660	c.503C>A	c.(502-504)CCT>CAT	p.P168H	C17orf65_uc002ifn.2_5'Flank|TMUB2_uc002ifp.2_Missense_Mutation_p.P148H|TMUB2_uc010wiu.1_Missense_Mutation_p.P111H|TMUB2_uc002ifq.2_Missense_Mutation_p.P168H|TMUB2_uc002ifr.2_Intron|TMUB2_uc002ifs.2_Intron|TMUB2_uc002ift.2_Missense_Mutation_p.P148H|TMUB2_uc002ifu.2_Intron|TMUB2_uc002ifv.2_Missense_Mutation_p.P148H|TMUB2_uc002ifw.1_Missense_Mutation_p.P148H|TMUB2_uc002ifx.2_Intron|TMUB2_uc002ify.2_RNA	NM_001076674	NP_001070142	Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain	168						integral to membrane				lung(1)	1		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)														---	---	---	---
SEPT4	5414	broad.mit.edu	37	17	56599003	56599003	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56599003C>A	uc002iwm.1	-	8	1048	c.920G>T	c.(919-921)CGG>CTG	p.R307L	SEPT4_uc002iwk.1_Missense_Mutation_p.R160L|SEPT4_uc010wnw.1_Missense_Mutation_p.R160L|SEPT4_uc002iwl.1_Missense_Mutation_p.R160L|SEPT4_uc002iwn.1_Missense_Mutation_p.R208L|SEPT4_uc002iwo.1_Missense_Mutation_p.R288L|SEPT4_uc002iwp.1_3'UTR|SEPT4_uc010wnx.1_Missense_Mutation_p.R322L|SEPT4_uc010wny.1_Missense_Mutation_p.R299L|SEPT4_uc010dcy.1_3'UTR	NM_004574	NP_004565	O43236	SEPT4_HUMAN	septin 4 isoform 1	307					apoptosis|cell cycle|cytokinesis|regulation of apoptosis	cytoskeleton|mitochondrion|nucleus	GTP binding|GTPase activity|protein binding|structural molecule activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
SLC16A6	9120	broad.mit.edu	37	17	66267383	66267383	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66267383C>A	uc002jgz.1	-	5	1106	c.918G>T	c.(916-918)CTG>CTT	p.L306L	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Silent_p.L306L	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	306	Helical; (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)													---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66871845	66871845	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66871845G>A	uc002jhp.2	-	34	4459	c.4280C>T	c.(4279-4281)ACG>ATG	p.T1427M	ABCA8_uc002jhq.2_Missense_Mutation_p.T1467M|ABCA8_uc010wqq.1_Missense_Mutation_p.T1462M	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	1427	ABC transporter 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)																	---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13059272	13059272	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13059272C>A	uc010xac.1	+	21	4529	c.4449C>A	c.(4447-4449)ACC>ACA	p.T1483T	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Silent_p.T1008T|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_5'UTR|CEP192_uc002krs.1_Silent_p.T1224T	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1483										ovary(4)|pancreas(1)	5																		---	---	---	---
KLHL14	57565	broad.mit.edu	37	18	30257157	30257157	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30257157C>A	uc002kxm.1	-	8	2113	c.1725G>T	c.(1723-1725)GTG>GTT	p.V575V	KLHL14_uc010dmd.1_Silent_p.V124V	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	575	Kelch 6.					cytosol|endoplasmic reticulum membrane				ovary(1)	1																		---	---	---	---
KIAA1328	57536	broad.mit.edu	37	18	34753042	34753042	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34753042C>A	uc002kzz.2	+	9	1543	c.1521C>A	c.(1519-1521)TCC>TCA	p.S507S	KIAA1328_uc002lab.2_Silent_p.S259S|KIAA1328_uc002lac.1_Silent_p.S366S|KIAA1328_uc010dnc.1_RNA	NM_020776	NP_065827	Q86T90	K1328_HUMAN	hypothetical protein LOC57536	507										central_nervous_system(1)	1				COAD - Colon adenocarcinoma(74;0.195)														---	---	---	---
SYT4	6860	broad.mit.edu	37	18	40850508	40850508	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40850508A>G	uc002law.2	-	4	1445	c.1076T>C	c.(1075-1077)GTC>GCC	p.V359A	SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Missense_Mutation_p.V341A|SYT4_uc010dnh.2_RNA	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	359	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5																		---	---	---	---
FECH	2235	broad.mit.edu	37	18	55221494	55221494	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55221494C>A	uc002lgq.3	-	9	1192	c.1075G>T	c.(1075-1077)GAG>TAG	p.E359*	FECH_uc002lgp.3_Nonsense_Mutation_p.E365*|FECH_uc002lgr.3_Nonsense_Mutation_p.E217*	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	359					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)																---	---	---	---
MALT1	10892	broad.mit.edu	37	18	56348448	56348448	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56348448G>T	uc002lhm.1	+	2	514	c.256G>T	c.(256-258)GGA>TGA	p.G86*	MALT1_uc002lhn.1_Nonsense_Mutation_p.G86*	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	86	Death.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4								T	BIRC3	MALT								---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57134024	57134024	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57134024C>A	uc002lib.2	-	5	570	c.500G>T	c.(499-501)CGG>CTG	p.R167L		NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	167	EGF-like; calcium-binding (Potential).				lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
CDH20	28316	broad.mit.edu	37	18	59203815	59203815	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59203815G>T	uc010dps.1	+	7	1373	c.1361G>T	c.(1360-1362)CGG>CTG	p.R454L	CDH20_uc002lif.2_Missense_Mutation_p.R448L	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	454	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)																---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74587629	74587629	+	Intron	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74587629G>T	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron|ZNF236_uc002lmk.1_Intron	NM_007345	NP_031371			zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)												OREG0025069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TMIGD2	126259	broad.mit.edu	37	19	4292681	4292681	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4292681G>T	uc002lzx.1	-	5	810	c.764C>A	c.(763-765)CCC>CAC	p.P255H	TMIGD2_uc010dtv.1_Missense_Mutation_p.P251H	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	255	Pro-rich.|Cytoplasmic (Potential).					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
FBN3	84467	broad.mit.edu	37	19	8194043	8194043	+	Intron	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8194043G>T	uc002mjf.2	-							NM_032447	NP_115823			fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9007843	9007843	+	Silent	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9007843A>C	uc002mkp.2	-	42	39585	c.39381T>G	c.(39379-39381)GGT>GGG	p.G13127G	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13129	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9087035	9087035	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087035C>A	uc002mkp.2	-	1	4984	c.4780G>T	c.(4780-4782)GGG>TGG	p.G1594W		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1594	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10291077	10291077	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10291077G>T	uc002mng.2	-	4	574	c.394C>A	c.(394-396)CTT>ATT	p.L132I	DNMT1_uc010xlc.1_Missense_Mutation_p.L132I|DNMT1_uc002mnh.2_Missense_Mutation_p.L11I|DNMT1_uc010xld.1_Missense_Mutation_p.L132I|DNMT1_uc010dxb.1_RNA	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	132	Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)													---	---	---	---
TMEM205	374882	broad.mit.edu	37	19	11453650	11453650	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11453650G>T	uc002mrb.2	-	4	599	c.411C>A	c.(409-411)CCC>CCA	p.P137P	TMEM205_uc002mra.2_Silent_p.P137P|TMEM205_uc002mqz.2_Silent_p.P137P|TMEM205_uc002mrc.2_Silent_p.P137P	NM_001145416	NP_001138888	Q6UW68	TM205_HUMAN	transmembrane protein 205	137						integral to membrane					0																		---	---	---	---
BEST2	54831	broad.mit.edu	37	19	12866250	12866250	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12866250G>A	uc002mux.2	+	5	694	c.694G>A	c.(694-696)GTA>ATA	p.V232I		NM_017682	NP_060152	Q8NFU1	BEST2_HUMAN	vitelliform macular dystrophy 2-like 1	232					membrane depolarization|sensory perception of smell	chloride channel complex|cilium|plasma membrane	chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
OR10H2	26538	broad.mit.edu	37	19	15838859	15838859	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15838859G>T	uc002nbm.2	+	1	26	c.6G>T	c.(4-6)CTG>CTT	p.L2L		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)																	---	---	---	---
OR10H2	26538	broad.mit.edu	37	19	15839222	15839222	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839222C>T	uc002nbm.2	+	1	389	c.369C>T	c.(367-369)TAC>TAT	p.Y123Y		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)																	---	---	---	---
SSBP4	170463	broad.mit.edu	37	19	18538736	18538736	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18538736C>T	uc002niy.2	+	4	461	c.223C>T	c.(223-225)CCT>TCT	p.P75S	SSBP4_uc010ebp.2_Missense_Mutation_p.P75S|SSBP4_uc002niz.2_Missense_Mutation_p.P75S	NM_032627	NP_116016	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4 isoform a	75						nucleus	single-stranded DNA binding				0																		---	---	---	---
ZNF492	57615	broad.mit.edu	37	19	22846716	22846716	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22846716G>A	uc002nqw.3	+	4	489	c.245G>A	c.(244-246)AGA>AAA	p.R82K		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	82					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)																---	---	---	---
ZNF492	57615	broad.mit.edu	37	19	22846743	22846743	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22846743G>A	uc002nqw.3	+	4	516	c.272G>A	c.(271-273)TGT>TAT	p.C91Y		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	91					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)																---	---	---	---
WDR88	126248	broad.mit.edu	37	19	33647307	33647307	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33647307C>T	uc002nui.2	+	7	934	c.856C>T	c.(856-858)CAT>TAT	p.H286Y		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	286	WD 5.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)																	---	---	---	---
TBCB	1155	broad.mit.edu	37	19	36616653	36616653	+	Missense_Mutation	SNP	C	A	A	rs1801989		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36616653C>A	uc002odg.1	+	6	1279	c.704C>A	c.(703-705)CCG>CAG	p.P235Q	TBCB_uc002odh.1_Missense_Mutation_p.P216Q	NM_001281	NP_001272	Q99426	TBCB_HUMAN	cytoskeleton associated protein 1	235					'de novo' posttranslational protein folding|cell differentiation|nervous system development	cytoplasm|microtubule	protein binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)															---	---	---	---
CAPN12	147968	broad.mit.edu	37	19	39234790	39234790	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39234790C>A	uc002ojd.1	-	1	325	c.16G>T	c.(16-18)GGG>TGG	p.G6W		NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12	6					proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)															---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43411874	43411874	+	Missense_Mutation	SNP	G	T	T	rs142652144	byFrequency	TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43411874G>T	uc002ovj.1	-	4	891	c.839C>A	c.(838-840)CCG>CAG	p.P280Q	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Missense_Mutation_p.P287Q|PSG6_uc002ovi.2_Missense_Mutation_p.P281Q|PSG6_uc010xwk.1_Missense_Mutation_p.P120Q|PSG11_uc002ovk.1_Intron|PSG6_uc002ove.1_Missense_Mutation_p.P70Q|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Missense_Mutation_p.P280Q	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	280	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
MEIS3	56917	broad.mit.edu	37	19	47910682	47910682	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47910682G>A	uc002pgu.2	-	9	1309	c.862C>T	c.(862-864)CCG>TCG	p.P288S	MEIS3_uc010xyp.1_RNA|MEIS3_uc002pgo.2_Missense_Mutation_p.P87S|MEIS3_uc002pgp.2_Missense_Mutation_p.P120S|MEIS3_uc002pgq.2_Missense_Mutation_p.P369S|MEIS3_uc002pgr.2_Missense_Mutation_p.P156S|MEIS3_uc002pgt.2_Missense_Mutation_p.P271S|MEIS3_uc002pgv.2_Missense_Mutation_p.P317S|MEIS3_uc002pgs.2_Missense_Mutation_p.P334S|MEIS3_uc010eld.2_Missense_Mutation_p.P334S	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN	Meis1, myeloid ecotropic viral integration site	288	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)														---	---	---	---
GYS1	2997	broad.mit.edu	37	19	49481383	49481383	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49481383C>A	uc002plp.2	-	9	1442	c.1201G>T	c.(1201-1203)GGG>TGG	p.G401W	GYS1_uc010xzy.1_Missense_Mutation_p.G34W|GYS1_uc010emm.2_Missense_Mutation_p.G337W|GYS1_uc010xzz.1_Missense_Mutation_p.G321W|GYS1_uc010yaa.1_RNA	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1	401					glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)														---	---	---	---
GYS1	2997	broad.mit.edu	37	19	49485544	49485544	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49485544C>A	uc002plp.2	-	7	1271	c.1030G>T	c.(1030-1032)GAG>TAG	p.E344*	GYS1_uc010xzy.1_5'UTR|GYS1_uc010emm.2_Nonsense_Mutation_p.E280*|GYS1_uc010xzz.1_Nonsense_Mutation_p.E264*|GYS1_uc010yaa.1_RNA	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1	344					glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)														---	---	---	---
SLC6A16	28968	broad.mit.edu	37	19	49812266	49812266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49812266G>T	uc002pmz.2	-	7	1330	c.1096C>A	c.(1096-1098)CAG>AAG	p.Q366K	SLC6A16_uc002pna.2_Missense_Mutation_p.Q366K|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	366						integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53678815	53678815	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53678815T>G	uc010eqm.1	-	3	125	c.25A>C	c.(25-27)ACA>CCA	p.T9P		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	Error:Variant_position_missing_in_Q9H7R5_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
LILRA1	11024	broad.mit.edu	37	19	55106758	55106758	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55106758G>T	uc002qgh.1	+	5	734	c.552G>T	c.(550-552)GTG>GTT	p.V184V	LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Silent_p.V184V	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	184	Ig-like C2-type 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)														---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56539808	56539808	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539808C>T	uc002qmj.2	+	7	2209	c.2209C>T	c.(2209-2211)CGG>TGG	p.R737W	NLRP5_uc002qmi.2_Missense_Mutation_p.R718W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	737	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
ZIM3	114026	broad.mit.edu	37	19	57646715	57646715	+	Silent	SNP	C	A	A	rs147762906		TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57646715C>A	uc002qnz.1	-	5	1376	c.990G>T	c.(988-990)ACG>ACT	p.T330T		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	330					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
ZNF419	79744	broad.mit.edu	37	19	58004449	58004449	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58004449T>C	uc002qov.2	+	5	764	c.524T>C	c.(523-525)CTC>CCC	p.L175P	ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Missense_Mutation_p.L176P|ZNF419_uc010etz.1_Missense_Mutation_p.L163P|ZNF419_uc010eua.1_Missense_Mutation_p.L162P|ZNF419_uc002qow.2_Missense_Mutation_p.L143P|ZNF419_uc010eub.1_Missense_Mutation_p.L130P|ZNF419_uc010euc.1_Missense_Mutation_p.L129P	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2	175					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)														---	---	---	---
C20orf194	25943	broad.mit.edu	37	20	3245153	3245153	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3245153A>C	uc002wii.2	-	31	2855	c.2804T>G	c.(2803-2805)CTG>CGG	p.L935R	C20orf194_uc002wij.3_Missense_Mutation_p.L674R|C20orf194_uc002wik.2_Missense_Mutation_p.L609R	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943	935											0																		---	---	---	---
PROCR	10544	broad.mit.edu	37	20	33764014	33764014	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33764014C>T	uc002xbt.2	+	3	550	c.366C>T	c.(364-366)CCC>CCT	p.P122P	EDEM2_uc010zuv.1_Intron|PROCR_uc010zuw.1_Silent_p.P159P	NM_006404	NP_006395	Q9UNN8	EPCR_HUMAN	endothelial protein C receptor precursor	122	Extracellular (Potential).				antigen processing and presentation|blood coagulation|immune response	integral to plasma membrane|MHC class I protein complex	receptor activity				0			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)													---	---	---	---
MMP24	10893	broad.mit.edu	37	20	33842457	33842457	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33842457G>T	uc002xbu.2	+	4	720	c.717G>T	c.(715-717)GGG>GGT	p.G239G	EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681	Q9Y5R2	MMP24_HUMAN	matrix metalloproteinase 24 preproprotein	239	Extracellular (Potential).				proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)															---	---	---	---
PLCG1	5335	broad.mit.edu	37	20	39792012	39792012	+	Intron	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39792012C>A	uc002xjp.1	+						PLCG1_uc002xjo.1_Intron|PLCG1_uc010zwe.1_5'Flank|PLCG1_uc010ggf.2_5'Flank	NM_182811	NP_877963			phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)																---	---	---	---
GNAS	2778	broad.mit.edu	37	20	57478739	57478739	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57478739G>A	uc002xzw.2	+	5	2539	c.2254G>A	c.(2254-2256)GCC>ACC	p.A752T	GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Missense_Mutation_p.A50T|GNAS_uc002xzx.2_Missense_Mutation_p.A50T|GNAS_uc010gjr.2_5'UTR|GNAS_uc002xzy.2_Missense_Mutation_p.A35T|GNAS_uc002yaa.2_Missense_Mutation_p.A95T|GNAS_uc010zzt.1_Missense_Mutation_p.A110T|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_5'UTR|GNAS_uc002yae.2_Missense_Mutation_p.A34T	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	109					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)					Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			---	---	---	---
YTHDF1	54915	broad.mit.edu	37	20	61834910	61834910	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61834910C>T	uc002yeh.2	-	4	676	c.382G>A	c.(382-384)GCG>ACG	p.A128T	YTHDF1_uc011aaq.1_Missense_Mutation_p.A78T	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	128										ovary(2)	2																		---	---	---	---
DNAJC5	80331	broad.mit.edu	37	20	62562244	62562244	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62562244G>T	uc002yhf.2	+	4	532	c.362G>T	c.(361-363)TGC>TTC	p.C121F	DNAJC5_uc002yhg.1_Missense_Mutation_p.C121F|DNAJC5_uc002yhh.2_RNA	NM_025219	NP_079495	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	121	Poly-Cys.				neurotransmitter secretion|protein folding	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|melanosome|plasma membrane	heat shock protein binding|unfolded protein binding			pancreas(1)	1	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)																	---	---	---	---
C21orf7	56911	broad.mit.edu	37	21	30521537	30521537	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30521537C>A	uc002yne.2	+	6	669	c.398C>A	c.(397-399)CCT>CAT	p.P133H	C21orf7_uc011acr.1_RNA|C21orf7_uc002ynd.2_RNA|C21orf7_uc010gln.2_RNA|C21orf7_uc002ynf.2_Missense_Mutation_p.P133H|C21orf7_uc010glo.2_5'UTR|C21orf7_uc002yng.2_Missense_Mutation_p.P33H|C21orf7_uc010glp.2_RNA	NM_020152	NP_064537	P57077	TAK1L_HUMAN	chromosome 21 open reading frame 7	133						cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)														---	---	---	---
DSCR10	259234	broad.mit.edu	37	21	39580446	39580446	+	RNA	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39580446G>T	uc010gnt.1	+	3		c.568G>T				NR_027695				Homo sapiens DSCR10 mRNA, complete cds.												0																		---	---	---	---
SEPT5	5413	broad.mit.edu	37	22	19709340	19709340	+	Intron	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19709340C>A	uc002zpv.1	+						SEPT5_uc002zpw.1_Intron|SEPT5_uc002zpx.1_Intron|SEPT5_uc002zpy.1_Intron|SEPT5_uc002zpz.1_5'Flank	NM_002688	NP_002679			septin 5						cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)																	---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22786707	22786707	+	RNA	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22786707A>C	uc011aim.1	+	67		c.6890A>C								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24459431	24459431	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24459431G>T	uc002zzi.1	+	14	1833	c.1706G>T	c.(1705-1707)CGG>CTG	p.R569L	CABIN1_uc002zzj.1_Missense_Mutation_p.R519L|CABIN1_uc002zzl.1_Missense_Mutation_p.R569L	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	569					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
MORC2	22880	broad.mit.edu	37	22	31330837	31330837	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31330837C>A	uc003aje.1	-	20	3302	c.1938G>T	c.(1936-1938)GAG>GAT	p.E646D		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	708							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
C22orf42	150297	broad.mit.edu	37	22	32546313	32546313	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32546313G>T	uc003amd.2	-	7	688	c.647C>A	c.(646-648)CCG>CAG	p.P216Q		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	216										ovary(1)|skin(1)	2																		---	---	---	---
MYH9	4627	broad.mit.edu	37	22	36716282	36716282	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36716282G>T	uc003apg.2	-	9	1226	c.995C>A	c.(994-996)CCA>CAA	p.P332Q	MYH9_uc003aph.1_Missense_Mutation_p.P196Q	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	332	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11								T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				---	---	---	---
CSF2RB	1439	broad.mit.edu	37	22	37325437	37325437	+	Intron	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37325437C>T	uc003aqa.3	+						CSF2RB_uc003aqc.3_Intron	NM_000395	NP_000386			colony stimulating factor 2 receptor, beta						respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)													---	---	---	---
VCX3A	51481	broad.mit.edu	37	X	6451795	6451795	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451795C>T	uc004crs.2	-	3	859	c.552G>A	c.(550-552)CCG>CCA	p.P184P	VCX3A_uc010ndk.1_Intron	NM_016379	NP_057463	Q9NNX9	VCX3_HUMAN	variable charge, X-linked 3A	184	Glu-rich.				brain development	nucleolus					0																		---	---	---	---
BMX	660	broad.mit.edu	37	X	15554528	15554528	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15554528C>A	uc004cww.2	+	13	1388	c.1200C>A	c.(1198-1200)CCC>CCA	p.P400P	BMX_uc004cwx.3_Silent_p.P400P|BMX_uc004cwy.3_Silent_p.P400P	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	400					cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)																	---	---	---	---
RBBP7	5931	broad.mit.edu	37	X	16887277	16887277	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16887277G>T	uc004cxt.2	-	2	441	c.83C>A	c.(82-84)CCG>CAG	p.P28Q	RBBP7_uc004cxs.1_Missense_Mutation_p.P72Q|RBBP7_uc004cxu.2_Missense_Mutation_p.P28Q	NM_002893	NP_002884	Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	28					cell proliferation|cellular heat acclimation|CenH3-containing nucleosome assembly at centromere|DNA replication|multicellular organismal development|negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex|NuRD complex	protein binding			upper_aerodigestive_tract(1)|ovary(1)	2	Hepatocellular(33;0.0997)																	---	---	---	---
CDKL5	6792	broad.mit.edu	37	X	18622032	18622032	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18622032G>A	uc004cym.2	+	12	1241	c.988G>A	c.(988-990)GGC>AGC	p.G330S	CDKL5_uc004cyn.2_Missense_Mutation_p.G330S	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	330					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)																	---	---	---	---
DMD	1756	broad.mit.edu	37	X	31241156	31241156	+	Intron	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31241156A>C	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc004dcm.1_Intron|DMD_uc004dcn.1_Intron|DMD_uc004dco.1_Intron|DMD_uc004dcp.1_Intron|DMD_uc011mkb.1_Intron|DMD_uc010ngm.2_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
CASK	8573	broad.mit.edu	37	X	41393980	41393980	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41393980G>T	uc004dfl.3	-	24	2327	c.2281C>A	c.(2281-2283)CGG>AGG	p.R761R	CASK_uc004dfj.3_Silent_p.R306R|CASK_uc004dfk.3_Silent_p.R581R|CASK_uc004dfm.3_Silent_p.R738R|CASK_uc004dfn.3_Silent_p.R737R	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein	766	Guanylate kinase-like.				cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6																		---	---	---	---
PLP2	5355	broad.mit.edu	37	X	49029563	49029563	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49029563A>G	uc004dmx.2	+	2	259	c.184A>G	c.(184-186)ATT>GTT	p.I62V		NM_002668	NP_002659	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic	62	Helical; (Potential).|MARVEL.				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity				0																		---	---	---	---
RRAGB	10325	broad.mit.edu	37	X	55748614	55748614	+	Intron	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55748614C>A	uc004dup.2	+						RRAGB_uc004duq.2_Intron	NM_016656	NP_057740			Ras-related GTP binding B long isoform						cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|signal transduction	Golgi apparatus|lysosome|nucleus	GTP binding|protein binding				0																		---	---	---	---
ACRC	93953	broad.mit.edu	37	X	70823772	70823772	+	Silent	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823772C>A	uc004eae.2	+	8	1146	c.645C>A	c.(643-645)CCC>CCA	p.P215P	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	215	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)																	---	---	---	---
KLHL4	56062	broad.mit.edu	37	X	86868966	86868966	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86868966G>A	uc004efb.2	+	2	691	c.509G>A	c.(508-510)CGT>CAT	p.R170H	KLHL4_uc004efa.2_Missense_Mutation_p.R170H	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	170						cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5																		---	---	---	---
RPA4	29935	broad.mit.edu	37	X	96139714	96139714	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96139714G>T	uc004efv.3	+	1	703	c.405G>T	c.(403-405)ACG>ACT	p.T135T	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	135					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0													Other_identified_genes_with_known_or_suspected_DNA_repair_function					---	---	---	---
NOX1	27035	broad.mit.edu	37	X	100117215	100117215	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100117215C>A	uc004egj.2	-	7	955	c.749G>T	c.(748-750)TGG>TTG	p.W250L	uc010nnf.2_Intron|NOX1_uc004egl.3_Missense_Mutation_p.W250L|NOX1_uc010nne.2_Missense_Mutation_p.W213L	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	250	Ferric oxidoreductase.|Extracellular (Potential).				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1																		---	---	---	---
GPRASP1	9737	broad.mit.edu	37	X	101911301	101911301	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101911301G>C	uc004ejj.3	+	5	3261	c.2460G>C	c.(2458-2460)GAG>GAC	p.E820D	GPRASP1_uc004eji.3_Missense_Mutation_p.E820D|GPRASP1_uc010nod.2_Missense_Mutation_p.E820D	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	820	Glu-rich.					cytoplasm	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
MUM1L1	139221	broad.mit.edu	37	X	105450369	105450369	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105450369G>T	uc004emf.1	+	4	1593	c.944G>T	c.(943-945)AGG>ATG	p.R315M	MUM1L1_uc004emg.1_Missense_Mutation_p.R315M	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	315										ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
PSMD10	5716	broad.mit.edu	37	X	107331326	107331326	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107331326C>A	uc004enp.1	-	3	315	c.217G>T	c.(217-219)GGT>TGT	p.G73C	PSMD10_uc004enq.1_Missense_Mutation_p.G73C|PSMD10_uc010nph.1_Intron	NM_002814	NP_002805	O75832	PSD10_HUMAN	proteasome 26S non-ATPase subunit 10 isoform 1	73	Interaction with RELA.|ANK 3.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cytoplasmic sequestering of NF-kappaB|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of MAPKKK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of release of cytochrome c from mitochondria|negative regulation of transcription from RNA polymerase II promoter|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus|proteasome regulatory particle	transcription factor binding			ovary(1)	1																		---	---	---	---
COL4A6	1288	broad.mit.edu	37	X	107448711	107448711	+	Splice_Site	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107448711C>A	uc004enw.3	-	11	752	c.649_splice	c.e11-1	p.G217_splice	COL4A6_uc004env.3_Splice_Site_p.G216_splice|COL4A6_uc011msn.1_Splice_Site_p.G216_splice|COL4A6_uc010npk.2_Splice_Site_p.G216_splice	NM_001847	NP_001838			type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
GUCY2F	2986	broad.mit.edu	37	X	108718617	108718617	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108718617G>T	uc004eod.3	-	2	825	c.549C>A	c.(547-549)TTC>TTA	p.F183L	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	183	Extracellular (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8																OREG0019905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KLHL13	90293	broad.mit.edu	37	X	117033062	117033062	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117033062C>A	uc004eql.2	-	7	1839	c.1777G>T	c.(1777-1779)GGG>TGG	p.G593W	KLHL13_uc004eqk.2_Missense_Mutation_p.G542W|KLHL13_uc011mtn.1_Missense_Mutation_p.G433W|KLHL13_uc011mto.1_Missense_Mutation_p.G587W|KLHL13_uc011mtp.1_Missense_Mutation_p.G595W|KLHL13_uc004eqm.2_Missense_Mutation_p.G542W|KLHL13_uc011mtq.1_Missense_Mutation_p.G577W	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	593	Kelch 6.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2																		---	---	---	---
KLHL13	90293	broad.mit.edu	37	X	117054233	117054233	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117054233G>C	uc004eql.2	-	3	403	c.341C>G	c.(340-342)TCT>TGT	p.S114C	KLHL13_uc004eqk.2_Missense_Mutation_p.S63C|KLHL13_uc011mtn.1_Translation_Start_Site|KLHL13_uc011mto.1_Missense_Mutation_p.S108C|KLHL13_uc011mtp.1_Missense_Mutation_p.S116C|KLHL13_uc004eqm.2_Missense_Mutation_p.S63C|KLHL13_uc011mtq.1_Missense_Mutation_p.S98C	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	114	BTB.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2																		---	---	---	---
KIAA1210	57481	broad.mit.edu	37	X	118221164	118221164	+	Silent	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118221164C>T	uc004era.3	-	11	4029	c.4029G>A	c.(4027-4029)CAG>CAA	p.Q1343Q		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1343										ovary(4)|skin(1)	5																		---	---	---	---
ENOX2	10495	broad.mit.edu	37	X	129771394	129771394	+	Intron	SNP	A	C	C			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129771394A>C	uc004evw.2	-						ENOX2_uc004evx.2_Intron|ENOX2_uc004evy.2_Intron|ENOX2_uc004evv.2_Intron	NM_182314	NP_872114			ecto-NOX disulfide-thiol exchanger 2 isoform b						cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130412692	130412692	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130412692C>A	uc004ewd.2	-	12	2022	c.1784G>T	c.(1783-1785)TGG>TTG	p.W595L	IGSF1_uc004ewe.3_Missense_Mutation_p.W589L|IGSF1_uc004ewf.2_Missense_Mutation_p.W575L	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	595	Extracellular (Potential).|Ig-like C2-type 6.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
GPC4	2239	broad.mit.edu	37	X	132436946	132436946	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132436946G>T	uc004exc.1	-	9	1832	c.1620C>A	c.(1618-1620)CTC>CTA	p.L540L	GPC4_uc011mvg.1_Silent_p.L470L	NM_001448	NP_001439	O75487	GPC4_HUMAN	glypican 4 precursor	540					anatomical structure morphogenesis|cell proliferation	anchored to membrane|external side of plasma membrane|extracellular space|insoluble fraction|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135741463	135741463	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135741463G>T	uc004faa.2	+	5	747	c.675G>T	c.(673-675)TTG>TTT	p.L225F	CD40LG_uc010nsd.2_Missense_Mutation_p.L204F	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand	225	Extracellular (Potential).				anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
Unknown	0	broad.mit.edu	37	X	136112305	136112305	+	IGR	SNP	C	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136112305C>T								RBMX (149366 upstream) : GPR101 (3 downstream)																																			---	---	---	---
IDS	3423	broad.mit.edu	37	X	148577997	148577997	+	Silent	SNP	G	T	T			TCGA-BR-4253-01	TCGA-BR-4253-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148577997G>T	uc011mxe.1	-	6	957	c.759C>A	c.(757-759)CCC>CCA	p.P253P	IDS_uc011mxf.1_Silent_p.P163P|IDS_uc011mxg.1_Silent_p.P42P|IDS_uc010nsu.1_Intron|IDS_uc004fcw.3_Silent_p.P42P|IDS_uc011mxh.1_Silent_p.P253P|IDS_uc011mxi.1_RNA	NM_000202	NP_000193	P22304	IDS_HUMAN	iduronate-2-sulfatase isoform a precursor	253						lysosome	iduronate-2-sulfatase activity|metal ion binding				0	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)																	---	---	---	---
