Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
ATAD3B	83858	broad.mit.edu	37	1	1427999	1428000	+	Intron	INS	-	C	C	rs113548232		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1427999_1428000insC	uc001afv.2	+						ATAD3B_uc001afx.2_Intron|ATAD3B_uc001afy.2_Intron	NM_031921	NP_114127			AAA-ATPase  TOB3								ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)														---	---	---	---
CDK11B	984	broad.mit.edu	37	1	1648506	1648507	+	Intron	INS	-	T	T	rs138068049	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1648506_1648507insT	uc001agv.1	-						CDK11B_uc001ags.1_5'Flank|CDK11B_uc001agt.1_5'Flank|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
SLC35E2B	728661	broad.mit.edu	37	1	1675459	1675460	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1675459_1675460insA	uc001ahh.3	-						SLC35E2_uc001ahy.2_Intron|SLC35E2_uc001ahz.2_Intron|SLC35E2_uc001aib.1_Intron	NM_001110781	NP_001104251			similar to solute carrier family 35, member E2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	1883304	1883305	+	IGR	INS	-	T	T	rs145942259	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1883304_1883305insT								TMEM52 (32564 upstream) : KIAA1751 (1447 downstream)																																			---	---	---	---
PRKCZ	5590	broad.mit.edu	37	1	1988169	1988169	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1988169delT	uc001aiq.2	+							NM_002744	NP_002735			protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2861204	2861211	+	IGR	DEL	TGTGTGTC	-	-	rs111603921		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2861204_2861211delTGTGTGTC								MMEL1 (296723 upstream) : ACTRT2 (76835 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2881741	2881742	+	IGR	INS	-	CCAT	CCAT	rs143800544	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2881741_2881742insCCAT								MMEL1 (317260 upstream) : ACTRT2 (56304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4458576	4458579	+	IGR	DEL	GTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4458576_4458579delGTGT								LOC100133612 (624699 upstream) : LOC284661 (13532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4954314	4954315	+	IGR	INS	-	A	A	rs34715990		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4954314_4954315insA								AJAP1 (110464 upstream) : NPHP4 (968555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5055987	5055988	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5055987_5055988insA								AJAP1 (212137 upstream) : NPHP4 (866882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5374337	5374338	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5374337_5374338insT								AJAP1 (530487 upstream) : NPHP4 (548532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5729173	5729173	+	5'Flank	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5729173delC	uc001alp.1	-											Homo sapiens cDNA FLJ43088 fis, clone BRTHA3025826.																														---	---	---	---
KCNAB2	8514	broad.mit.edu	37	1	6061357	6061358	+	Intron	DEL	CA	-	-	rs149851659		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6061357_6061358delCA	uc009vlv.1	+							NM_003636	NP_003627			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CHD5	26038	broad.mit.edu	37	1	6180963	6180964	+	Intron	INS	-	A	A	rs150515182		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6180963_6180964insA	uc001amb.1	-						CHD5_uc001alz.1_Intron|CHD5_uc001ama.1_Intron	NM_015557	NP_056372			chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	6780412	6780412	+	IGR	DEL	T	-	-	rs111481603		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6780412delT								DNAJC11 (18446 upstream) : CAMTA1 (64972 downstream)																																			---	---	---	---
PER3	8863	broad.mit.edu	37	1	7899022	7899025	+	Intron	DEL	ACTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7899022_7899025delACTT	uc001aoo.2	+						PER3_uc001aop.2_Intron|PER3_uc010nzw.1_Intron	NM_016831	NP_058515			period 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
NMNAT1	64802	broad.mit.edu	37	1	10008709	10008710	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10008709_10008710insT	uc001aqp.2	+							NM_022787	NP_073624			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	nucleoplasm	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity|protein binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
NMNAT1	64802	broad.mit.edu	37	1	10012363	10012364	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10012363_10012364insA	uc001aqp.2	+							NM_022787	NP_073624			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	nucleoplasm	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity|protein binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
RBP7	116362	broad.mit.edu	37	1	10068501	10068502	+	Intron	INS	-	T	T	rs112928878		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068501_10068502insT	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192			retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)													---	---	---	---
UBE4B	10277	broad.mit.edu	37	1	10150851	10150852	+	Intron	INS	-	TG	TG	rs141450760	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10150851_10150852insTG	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032			ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)														---	---	---	---
KIF1B	23095	broad.mit.edu	37	1	10425063	10425064	+	Intron	INS	-	AA	AA	rs57088720		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10425063_10425064insAA	uc001aqx.3	+						KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889			kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
MASP2	10747	broad.mit.edu	37	1	11102454	11102473	+	Intron	DEL	TGGATGGATGGATGGATGGA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11102454_11102473delTGGATGGATGGATGGATGGA	uc001aru.2	-							NM_006610	NP_006601			mannan-binding lectin serine protease 2 isoform						complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)														---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11276711	11276711	+	Intron	DEL	A	-	-	rs34042645		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11276711delA	uc001asd.2	-							NM_004958	NP_004949			FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	11398244	11398249	+	IGR	DEL	CCTCCT	-	-	rs111285752	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11398244_11398249delCCTCCT								UBIAD1 (49754 upstream) : PTCHD2 (141046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11524376	11524377	+	IGR	INS	-	T	T	rs143341727		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11524376_11524377insT								UBIAD1 (175886 upstream) : PTCHD2 (14918 downstream)																																			---	---	---	---
PTCHD2	57540	broad.mit.edu	37	1	11582676	11582708	+	Intron	DEL	CCCAGCCAGAGCCCAGCCAGAGCCCAGCCAGGG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11582676_11582708delCCCAGCCAGAGCCCAGCCAGAGCCCAGCCAGGG	uc001ash.3	+						PTCHD2_uc001asi.1_Intron	NM_020780	NP_065831			patched domain containing 2						cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11690692	11690692	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11690692delT								PTCHD2 (93053 upstream) : FBXO2 (17758 downstream)																																			---	---	---	---
NPPA	4878	broad.mit.edu	37	1	11906969	11906969	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11906969delC	uc001ati.2	-						CLCN6_uc010oav.1_Intron|CLCN6_uc010oaw.1_Intron|CLCN6_uc010oax.1_Intron|CLCN6_uc010oay.1_Intron|CLCN6_uc010oaz.1_Intron|CLCN6_uc010oba.1_Intron	NM_006172	NP_006163			natriuretic peptide precursor A preproprotein						cGMP biosynthetic process|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size	extracellular region	hormone activity			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TNFRSF8	943	broad.mit.edu	37	1	12130203	12130203	+	Intron	DEL	G	-	-	rs35249351		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12130203delG	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron	NM_001243	NP_001234			tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	12590355	12590355	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12590355delT								VPS13D (18259 upstream) : DHRS3 (37585 downstream)																																			---	---	---	---
C1orf158	93190	broad.mit.edu	37	1	12815354	12815354	+	Intron	DEL	A	-	-	rs34558133		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12815354delA	uc001auh.2	+						C1orf158_uc010obe.1_Intron	NM_152290	NP_689503			hypothetical protein LOC93190											ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PDPN	10630	broad.mit.edu	37	1	13910742	13910744	+	Intron	DEL	GGA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13910742_13910744delGGA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_5'Flank|PDPN_uc009voc.2_5'Flank|PDPN_uc001ave.2_5'Flank|PDPN_uc001avf.2_5'Flank	NM_006474	NP_006465			lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)														---	---	---	---
PDPN	10630	broad.mit.edu	37	1	13928822	13928823	+	Intron	INS	-	A	A	rs79967160		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13928822_13928823insA	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_Intron|PDPN_uc009voc.2_Intron|PDPN_uc001ave.2_Intron|PDPN_uc001avf.2_Intron	NM_006474	NP_006465			lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)														---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15332287	15332288	+	Intron	INS	-	A	A	rs36037344		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15332287_15332288insA	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron|KAZ_uc001avo.2_Intron|KAZ_uc001avp.2_Intron|KAZ_uc001avq.2_Intron|KAZ_uc001avr.2_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
C1orf126	200197	broad.mit.edu	37	1	15476824	15476825	+	Intron	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15476824_15476825delTT	uc001avv.3	-						C1orf126_uc009voh.2_Intron|TMEM51_uc001avw.3_5'Flank|TMEM51_uc010obk.1_5'Flank	NR_027136				Homo sapiens cDNA FLJ23703 fis, clone HEP10820.												0																		---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15677459	15677459	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15677459delT	uc001awb.2	+						FHAD1_uc001awd.1_Intron|FHAD1_uc010obl.1_Intron|FHAD1_uc001awe.1_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
DNAJC16	23341	broad.mit.edu	37	1	15897508	15897509	+	3'UTR	INS	-	A	A	rs144943473		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15897508_15897509insA	uc001aws.2	+	15					DNAJC16_uc001awt.2_3'UTR|DNAJC16_uc001awu.2_Intron	NM_015291	NP_056106			DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)														---	---	---	---
SPEN	23013	broad.mit.edu	37	1	16186937	16186938	+	Intron	INS	-	GT	GT	rs141891929	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16186937_16186938insGT	uc001axk.1	+							NM_015001	NP_055816			spen homolog, transcriptional regulator						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	16830924	16830925	+	IGR	INS	-	C	C	rs149450255	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16830924_16830925insC								CROCCL2 (11728 upstream) : NBPF1 (59487 downstream)																																			---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17234271	17234272	+	Intron	INS	-	A	A	rs144504920		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17234271_17234272insA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17242151	17242154	+	Intron	DEL	AAGG	-	-	rs67622072		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17242151_17242154delAAGG	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17283224	17283225	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17283224_17283225delAA	uc001azt.2	+						CROCC_uc001azu.2_Intron	NM_014675	NP_055490			ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17485821	17485822	+	IGR	DEL	TG	-	-	rs72089158		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17485821_17485822delTG								PADI2 (39873 upstream) : PADI1 (45799 downstream)																																			---	---	---	---
ACTL8	81569	broad.mit.edu	37	1	18112212	18112212	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18112212delT	uc001bat.2	+							NM_030812	NP_110439			actin-like 8							cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)														---	---	---	---
CAPZB	832	broad.mit.edu	37	1	19729554	19729555	+	Intron	INS	-	A	A	rs137965209	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19729554_19729555insA	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron	NM_004930	NP_004921			F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	19898699	19898699	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19898699delT								CAPZB (86707 upstream) : C1orf151 (24768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	20175574	20175574	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20175574delA								RNF186 (33803 upstream) : OTUD3 (33314 downstream)																																			---	---	---	---
PLA2G2F	64600	broad.mit.edu	37	1	20473944	20473945	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20473944_20473945insT	uc009vpp.1	+							NM_022819	NP_073730			phospholipase A2, group IIF						lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)														---	---	---	---
PINK1	65018	broad.mit.edu	37	1	20963855	20963855	+	Intron	DEL	A	-	-	rs34096583		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20963855delA	uc001bdm.2	+							NM_032409	NP_115785			PTEN induced putative kinase 1 precursor						cell death|intracellular protein kinase cascade|mitochondrion degradation|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of release of cytochrome c from mitochondria|regulation of protein complex assembly|regulation of protein ubiquitination|response to stress	cytosol|integral to membrane|mitochondrial outer membrane	ATP binding|C3HC4-type RING finger domain binding|calcium-dependent protein kinase activity|magnesium ion binding|protein serine/threonine kinase activity|ubiquitin protein ligase binding			ovary(2)|central_nervous_system(1)	3		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
DDOST	1650	broad.mit.edu	37	1	20985350	20985350	+	Intron	DEL	T	-	-	rs112536606		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20985350delT	uc001bdo.1	-						DDOST_uc009vpw.1_Intron|DDOST_uc010odd.1_Intron|DDOST_uc010ode.1_Intron	NM_005216	NP_005207			dolichyl-diphosphooligosaccharide-protein						innate immune response|post-translational protein modification|response to cytokine stimulus|T cell activation	integral to membrane|microsome|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	21125859	21125860	+	IGR	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21125859_21125860delGA								HP1BP3 (12060 upstream) : EIF4G3 (7116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	21524014	21524014	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21524014delT								EIF4G3 (20674 upstream) : ECE1 (19726 downstream)																																			---	---	---	---
ECE1	1889	broad.mit.edu	37	1	21667435	21667436	+	Intron	INS	-	G	G	rs141326669	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21667435_21667436insG	uc001bem.2	-							NM_001113348	NP_001106819			endothelin converting enzyme 1 isoform 4						bradykinin catabolic process|calcitonin catabolic process|ear development|embryonic digit morphogenesis|endothelin maturation|heart development|positive regulation of receptor recycling|substance P catabolic process	early endosome|external side of plasma membrane|integral to membrane|intrinsic to endosome membrane|membrane fraction|perinuclear region of cytoplasm|plasma membrane|Weibel-Palade body	metal ion binding|metalloendopeptidase activity|protein homodimerization activity			ovary(2)|skin(1)	3		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)														---	---	---	---
RAP1GAP	5909	broad.mit.edu	37	1	21935884	21935885	+	Intron	INS	-	A	A	rs34097078		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21935884_21935885insA	uc001bex.2	-						RAP1GAP_uc001bev.2_Intron|RAP1GAP_uc001bew.2_Intron|RAP1GAP_uc001bey.2_Intron	NM_002885	NP_002876			RAP1 GTPase activating protein isoform c						regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)														---	---	---	---
CELA3B	23436	broad.mit.edu	37	1	22315389	22315389	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22315389delA	uc001bfk.2	+						CELA3B_uc009vqf.2_Intron	NM_007352	NP_031378			elastase 3B, pancreatic preproprotein						cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
CELA3A	10136	broad.mit.edu	37	1	22336810	22336811	+	Intron	INS	-	A	A	rs144521300	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22336810_22336811insA	uc001bfl.2	+							NM_005747	NP_005738			elastase 3A, pancreatic preproprotein						cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	22514281	22514282	+	IGR	INS	-	T	T	rs35946822		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22514281_22514282insT								WNT4 (43896 upstream) : ZBTB40 (264062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	22569938	22569938	+	IGR	DEL	G	-	-	rs66593903		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22569938delG								WNT4 (99553 upstream) : ZBTB40 (208406 downstream)																																			---	---	---	---
EPHA8	2046	broad.mit.edu	37	1	22896876	22896879	+	Intron	DEL	CGCG	-	-	rs111649976	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22896876_22896879delCGCG	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387			ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
C1QA	712	broad.mit.edu	37	1	22960197	22960198	+	5'Flank	INS	-	AAAC	AAAC	rs149908835	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22960197_22960198insAAAC	uc001bfy.2	+							NM_015991	NP_057075			complement component 1, q subcomponent, A chain						cell-cell signaling|complement activation, classical pathway|innate immune response	collagen|complement component C1 complex					0		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)													---	---	---	---
KDM1A	23028	broad.mit.edu	37	1	23367466	23367466	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23367466delA	uc001bgi.2	+						KDM1A_uc001bgj.2_Intron	NM_015013	NP_055828			lysine-specific histone demethylase 1 isoform b						blood coagulation|muscle cell development|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of protein binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin	androgen receptor binding|chromatin binding|enzyme binding|flavin adenine dinucleotide binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-K9 specific)|ligand-dependent nuclear receptor transcription coactivator activity|MyoD binding|oxidoreductase activity|p53 binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2																		---	---	---	---
LUZP1	7798	broad.mit.edu	37	1	23416094	23416095	+	Intron	INS	-	T	T	rs139904517	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23416094_23416095insT	uc001bgk.2	-						LUZP1_uc010odv.1_Intron	NM_033631	NP_361013			leucine zipper protein 1							nucleus					0		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	23509400	23509400	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23509400delT								LUZP1 (5099 upstream) : HTR1D (8989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	24446240	24446241	+	IGR	INS	-	A	A	rs144226799	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24446240_24446241insA								MYOM3 (7575 upstream) : IL22RA1 (20 downstream)																																			---	---	---	---
RCAN3	11123	broad.mit.edu	37	1	24856500	24856500	+	Intron	DEL	C	-	-	rs11340138		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24856500delC	uc001bjj.2	+						RCAN3_uc009vrd.2_Intron|RCAN3_uc009vre.2_Intron|RCAN3_uc009vrf.2_Intron|RCAN3_uc009vrg.2_Intron	NM_013441	NP_038469			Down syndrome critical region gene 1-like 2						anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)														---	---	---	---
C1orf130	400746	broad.mit.edu	37	1	24903472	24903472	+	Intron	DEL	C	-	-	rs60098808	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24903472delC	uc001bjk.1	+							NM_001010980	NP_001010980			chromosome 1 open reading frame 130							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.0119)|all_lung(284;0.0154)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0439)|OV - Ovarian serous cystadenocarcinoma(117;1.48e-24)|Colorectal(126;6.93e-08)|COAD - Colon adenocarcinoma(152;3.69e-06)|GBM - Glioblastoma multiforme(114;0.00036)|BRCA - Breast invasive adenocarcinoma(304;0.00189)|KIRC - Kidney renal clear cell carcinoma(1967;0.00382)|STAD - Stomach adenocarcinoma(196;0.00521)|READ - Rectum adenocarcinoma(331;0.0659)|Lung(427;0.144)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	26492829	26492830	+	IGR	INS	-	GT	GT	rs147539483	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26492829_26492830insGT								GRRP1 (3711 upstream) : ZNF593 (3558 downstream)																																			---	---	---	---
ZNF683	257101	broad.mit.edu	37	1	26698094	26698094	+	Intron	DEL	A	-	-	rs111632057		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26698094delA	uc001bmg.1	-						ZNF683_uc001bmh.1_Intron|ZNF683_uc009vsj.1_Intron	NM_173574	NP_775845			zinc finger protein 683						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)														---	---	---	---
SNHG12	85028	broad.mit.edu	37	1	28906819	28906820	+	Intron	INS	-	A	A	rs147786269		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28906819_28906820insA	uc001bqk.2	-						SNHG12_uc001bql.2_Intron|SNHG12_uc001bqm.2_RNA|SNHG12_uc001bqn.2_RNA|SNHG12_uc001bqo.2_Intron|SNHG12_uc001bqp.2_Intron|SNORD99_uc001bqq.1_5'Flank|SNORA61_uc001bqr.2_5'Flank	NR_024127				Homo sapiens PNAS-123 mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	30232714	30232717	+	IGR	DEL	CACA	-	-	rs138305527		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30232714_30232717delCACA								PTPRU (579399 upstream) : MATN1 (951409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30660743	30660743	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30660743delG								None (None upstream) : MATN1 (523383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31974307	31974308	+	IGR	INS	-	A	A	rs143232060	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31974307_31974308insA								SERINC2 (66783 upstream) : LOC284551 (9728 downstream)																																			---	---	---	---
TINAGL1	64129	broad.mit.edu	37	1	32022484	32022485	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32022484_32022485insA	uc001bsz.2	+							NM_022164	NP_071447			tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)														---	---	---	---
HCRTR1	3061	broad.mit.edu	37	1	32093780	32093780	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32093780delA	uc010ogl.1	+							NM_001525	NP_001516			orexin receptor 1						feeding behavior|neuropeptide signaling pathway|synaptic transmission	integral to plasma membrane				ovary(1)	1		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)														---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34314411	34314412	+	Intron	INS	-	T	T	rs67652191		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34314411_34314412insT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
ZMYM4	9202	broad.mit.edu	37	1	35740218	35740218	+	Intron	DEL	A	-	-	rs12136526		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35740218delA	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron	NM_005095	NP_005086			zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
ZMYM4	9202	broad.mit.edu	37	1	35796410	35796410	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35796410delT	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron	NM_005095	NP_005086			zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
EIF2C1	26523	broad.mit.edu	37	1	36353262	36353262	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36353262delT	uc001bzl.2	+						EIF2C1_uc001bzk.2_Intron	NM_012199	NP_036331			eukaryotic translation initiation factor 2C, 1						negative regulation of translation involved in gene silencing by miRNA|nuclear-transcribed mRNA catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|polysome	protein binding|RNA binding			ovary(2)|skin(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
THRAP3	9967	broad.mit.edu	37	1	36744253	36744253	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36744253delG	uc001cae.3	+						THRAP3_uc001caf.3_Intron|THRAP3_uc001cag.1_Intron	NM_005119	NP_005110			thyroid hormone receptor associated protein 3						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)						T	USP6	aneurysmal bone cysts								---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37316431	37316432	+	Intron	INS	-	G	G	rs145376961	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37316431_37316432insG	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	38123141	38123141	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38123141delG								RSPO1 (22650 upstream) : C1orf109 (24109 downstream)																																			---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38329489	38329489	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38329489delT	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Intron	NM_005540	NP_005531			inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
RRAGC	64121	broad.mit.edu	37	1	39316516	39316517	+	Intron	INS	-	T	T	rs112541442		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39316516_39316517insT	uc001ccq.2	-						RRAGC_uc010oim.1_Intron|RRAGC_uc001ccr.2_Intron	NM_022157	NP_071440			Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	40162238	40162239	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40162238_40162239delTC								HPCAL4 (5149 upstream) : PPIE (42291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	40177925	40177925	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40177925delA								HPCAL4 (20836 upstream) : PPIE (26605 downstream)																																			---	---	---	---
RIMS3	9783	broad.mit.edu	37	1	41132731	41132731	+	5'Flank	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41132731delA	uc001cfu.1	-						RIMS3_uc001cfv.1_5'Flank	NM_014747	NP_055562			regulating synaptic membrane exocytosis 3						neurotransmitter transport	cell junction|synapse					0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	41389304	41389304	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41389304delG								CITED4 (61286 upstream) : CTPS (55703 downstream)																																			---	---	---	---
CTPS	1503	broad.mit.edu	37	1	41465888	41465892	+	Intron	DEL	TGTTT	-	-	rs151020855		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41465888_41465892delTGTTT	uc001cgk.3	+						CTPS_uc010ojo.1_Intron|CTPS_uc001cgl.3_Intron|CTPS_uc010ojq.1_Intron|CTPS_uc009vwe.2_Intron	NM_001905	NP_001896			CTP synthase						CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)													---	---	---	---
SCMH1	22955	broad.mit.edu	37	1	41507105	41507110	+	Intron	DEL	ATTATA	-	-	rs3831834		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41507105_41507110delATTATA	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864			sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42316961	42316976	+	Intron	DEL	TTTTTTTTTTTTTTTT	-	-	rs78196602		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42316961_42316976delTTTTTTTTTTTTTTTT	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001chb.1_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42683199	42683199	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42683199delA	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42722201	42722208	+	Intron	DEL	CTTCACAC	-	-	rs113103243		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42722201_42722208delCTTCACAC	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	44672874	44672875	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44672874_44672875insA								KLF17 (72067 upstream) : DMAP1 (6250 downstream)																																			---	---	---	---
KIF2C	11004	broad.mit.edu	37	1	45206451	45206452	+	Intron	INS	-	T	T	rs35083631		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45206451_45206452insT	uc001cmg.3	+						KIF2C_uc010olb.1_Intron	NM_006845	NP_006836			kinesin family member 2C						blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
ZSWIM5	57643	broad.mit.edu	37	1	45601540	45601541	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45601540_45601541insT	uc001cnd.2	-							NM_020883	NP_065934			zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
TESK2	10420	broad.mit.edu	37	1	45948420	45948420	+	Intron	DEL	G	-	-	rs35383618		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45948420delG	uc001cns.1	-						TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Intron|TESK2_uc010olp.1_Intron	NM_007170	NP_009101			testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	45994342	45994342	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45994342delA								PRDX1 (6733 upstream) : AKR1A1 (22156 downstream)																																			---	---	---	---
MAST2	23139	broad.mit.edu	37	1	46404889	46404890	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46404889_46404890delTG	uc001cov.2	+						MAST2_uc001cow.2_Intron|MAST2_uc001cox.1_Intron|MAST2_uc001coy.1_Intron|MAST2_uc001coz.1_Intron|MAST2_uc009vya.2_Intron	NM_015112	NP_055927			microtubule associated serine/threonine kinase						regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)																	---	---	---	---
LRRC41	10489	broad.mit.edu	37	1	46756930	46756930	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46756930delA	uc001cpn.2	-						LRRC41_uc010omb.1_Intron|LRRC41_uc001cpo.1_Intron	NM_006369	NP_006360			MUF1 protein											ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	47191215	47191216	+	IGR	INS	-	TG	TG	rs142748965	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47191215_47191216insTG								KIAA0494 (6479 upstream) : CYP4B1 (73454 downstream)																																	OREG0013465	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CYP4B1	1580	broad.mit.edu	37	1	47280497	47280498	+	Intron	INS	-	AACT	AACT	rs3841797		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47280497_47280498insAACT	uc001cqm.3	+						CYP4B1_uc009vyl.1_Intron|CYP4B1_uc001cqn.3_Intron|CYP4B1_uc009vym.2_Intron|CYP4B1_uc010omk.1_Intron	NM_000779	NP_000770			cytochrome P450, family 4, subfamily B,						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
CYP4Z2P	163720	broad.mit.edu	37	1	47332641	47332641	+	Intron	DEL	A	-	-	rs34700016		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47332641delA	uc001cqo.1	-							NR_002788				Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar to CYTOCHROME P450 4A1 (EC 1.14.15.3).												0																		---	---	---	---
TAL1	6886	broad.mit.edu	37	1	47702431	47702432	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47702431_47702432insTT	uc001crb.1	-											Homo sapiens cDNA, FLJ97467.						basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1								T	TRD@|SIL	lymphoblastic leukemia/biphasic								---	---	---	---
CMPK1	51727	broad.mit.edu	37	1	47798735	47798735	+	5'Flank	DEL	T	-	-	rs148340811		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47798735delT	uc001cri.2	+						CMPK1_uc010omp.1_5'Flank|CMPK1_uc010omq.1_5'Flank|CMPK1_uc001crh.2_5'Flank	NM_016308	NP_057392			UMP-CMP kinase 1 isoform a						nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	48548983	48548984	+	IGR	INS	-	C	C	rs67589058		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48548983_48548984insC								FOXD2 (642621 upstream) : SKINTL (18403 downstream)																																			---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49295140	49295140	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49295140delC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49337025	49337026	+	Intron	INS	-	TGTG	TGTG	rs138337930	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49337025_49337026insTGTG	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50582084	50582085	+	Intron	DEL	GC	-	-	rs72056896		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50582084_50582085delGC	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52726898	52726899	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52726898_52726899insT	uc001cto.2	+						ZFYVE9_uc001ctn.2_Intron|ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	53630053	53630054	+	IGR	INS	-	AAAA	AAAA	rs144699903	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53630053_53630054insAAAA								SLC1A7 (21764 upstream) : CPT2 (32047 downstream)																																			---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54063583	54063584	+	Intron	INS	-	A	A	rs150138170	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54063583_54063584insA	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
CDCP2	200008	broad.mit.edu	37	1	54618135	54618135	+	Intron	DEL	A	-	-	rs67181791		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54618135delA	uc001cwv.1	-							NM_201546	NP_963840			CUB domain containing protein 2 precursor							extracellular region				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	55745124	55745124	+	IGR	DEL	T	-	-	rs67460835		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55745124delT								USP24 (64362 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	55963517	55963517	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55963517delA								USP24 (282755 upstream) : PPAP2B (996916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	56481890	56481891	+	IGR	INS	-	C	C	rs140928704	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56481890_56481891insC								USP24 (801128 upstream) : PPAP2B (478542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	56604358	56604359	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56604358_56604359delTG								USP24 (923596 upstream) : PPAP2B (356074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	56956403	56956403	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56956403delT								None (None upstream) : PPAP2B (4030 downstream)																																			---	---	---	---
PRKAA2	5563	broad.mit.edu	37	1	57170379	57170381	+	Intron	DEL	ATC	-	-	rs5774298		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57170379_57170381delATC	uc001cyk.3	+							NM_006252	NP_006243			AMP-activated protein kinase alpha 2 catalytic						carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57987781	57987782	+	Intron	INS	-	A	A	rs146600778	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57987781_57987782insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58908111	58908112	+	Intron	INS	-	CACATCCAC	CACATCCAC	rs706435	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58908111_58908112insCACATCCAC	uc001cyt.1	-							NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	59273975	59273975	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59273975delT	uc001czf.2	+						uc010oop.1_Intron					Homo sapiens cDNA FLJ30588 fis, clone BRAWH2008128.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	59679778	59679778	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59679778delT								LOC729467 (67299 upstream) : FGGY (82847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	60667388	60667389	+	IGR	INS	-	GT	GT	rs150220214	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60667388_60667389insGT								C1orf87 (127962 upstream) : NFIA (875557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	62100787	62100787	+	IGR	DEL	A	-	-	rs112456702		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62100787delA								NFIA (172328 upstream) : TM2D1 (45932 downstream)																																			---	---	---	---
INADL	10207	broad.mit.edu	37	1	62299776	62299776	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62299776delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
ROR1	4919	broad.mit.edu	37	1	64606857	64606857	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64606857delA	uc001dbj.2	+						ROR1_uc001dbi.3_Intron|uc001dbl.2_Intron	NM_005012	NP_005003			receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19																		---	---	---	---
JAK1	3716	broad.mit.edu	37	1	65343013	65343013	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65343013delT	uc001dbu.1	-						JAK1_uc009wam.1_Intron|JAK1_uc001dbv.2_RNA	NM_002227	NP_002218			janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)				Mis		ALL								---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65719035	65719036	+	5'Flank	INS	-	TG	TG	rs138371865	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65719035_65719036insTG	uc001dcc.1	+						uc001dcb.1_5'Flank	NM_014787	NP_055602			DnaJ (Hsp40) homolog, subfamily C, member 6						cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65834367	65834368	+	Intron	INS	-	CTTCCTCCTCCT	CTTCCTCCTCCT	rs141270845	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65834367_65834368insCTTCCTCCTCCT	uc001dcd.1	+						DNAJC6_uc001dcc.1_Intron|DNAJC6_uc010opc.1_Intron|DNAJC6_uc001dce.1_Intron	NM_014787	NP_055602			DnaJ (Hsp40) homolog, subfamily C, member 6						cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	69514508	69514509	+	IGR	INS	-	TG	TG	rs148503397	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69514508_69514509insTG								DEPDC1 (551709 upstream) : LRRC7 (518359 downstream)																																			---	---	---	---
LRRC40	55631	broad.mit.edu	37	1	70661053	70661054	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70661053_70661054insA	uc001der.1	-							NM_017768	NP_060238			leucine rich repeat containing 40											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	71648173	71648173	+	Intron	DEL	T	-	-	rs76799657		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71648173delT	uc001dfu.1	+											Homo sapiens cDNA clone IMAGE:6592429, partial cds.																														---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72644772	72644772	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72644772delC	uc001dfw.2	-						NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	73098593	73098594	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73098593_73098594delAC								NEGR1 (350188 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73648098	73648099	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73648098_73648099delTG								NEGR1 (899693 upstream) : LRRIQ3 (843605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	75544868	75544868	+	IGR	DEL	T	-	-	rs11333295		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75544868delT								TYW3 (312510 upstream) : LHX8 (49251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	79132681	79132682	+	IGR	INS	-	GCTTTGG	GCTTTGG	rs146041624	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79132681_79132682insGCTTTGG								IFI44 (2920 upstream) : ELTD1 (222769 downstream)																																			---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	81932361	81932362	+	Intron	INS	-	GT	GT	rs143018020	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81932361_81932362insGT	uc001dis.2	+											SubName: Full=cDNA FLJ41428 fis, clone BRHIP2005236, highly similar to Latrophilin-2;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85836292	85836293	+	Intron	INS	-	A	A	rs148336620	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85836292_85836293insA	uc001dlb.2	-						DDAH1_uc001dlc.2_Intron|uc001dla.1_Intron|DDAH1_uc010osb.1_Intron|DDAH1_uc009wco.2_Intron	NM_012137	NP_036269			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85989831	85989832	+	Intron	INS	-	G	G	rs139714427	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85989831_85989832insG	uc001dlc.2	-							NM_001134445	NP_001127917			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	88838905	88838907	+	IGR	DEL	TTT	-	-	rs10559427		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88838905_88838907delTTT								None (None upstream) : PKN2 (311015 downstream)																																			---	---	---	---
GLMN	11146	broad.mit.edu	37	1	92725036	92725037	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92725036_92725037insC	uc001dor.2	-						GLMN_uc009wdg.2_Intron|GLMN_uc001dos.2_Intron	NM_053274	NP_444504			glomulin						muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)										Multiple_Glomus_Tumors_(of_the_Skin)_Familial				---	---	---	---
EVI5	7813	broad.mit.edu	37	1	92990824	92990825	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92990824_92990825insTT	uc001dox.2	-						EVI5_uc010otf.1_Intron	NM_005665	NP_005656			ecotropic viral integration site 5						cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	96818102	96818109	+	IGR	DEL	TGTGTGTG	-	-	rs72306011		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96818102_96818109delTGTGTGTG								None (None upstream) : PTBP2 (369066 downstream)																																			---	---	---	---
DPYD	1806	broad.mit.edu	37	1	97983742	97983743	+	Intron	INS	-	ACAC	ACAC	rs139302701	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97983742_97983743insACAC	uc001drv.2	-							NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	103689332	103689333	+	IGR	INS	-	GTGA	GTGA	rs144554752	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103689332_103689333insGTGA								COL11A1 (115280 upstream) : RNPC3 (379245 downstream)																																			---	---	---	---
AMY2B	280	broad.mit.edu	37	1	104136578	104136578	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104136578delC	uc001dus.1	+											Homo sapiens mRNA for KIAA1839 protein, partial cds.						carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	104929555	104929556	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104929555_104929556delAG								AMY1A (722383 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	106793518	106793519	+	IGR	INS	-	GGATATAGAG	GGATATAGAG	rs147454262	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106793518_106793519insGGATATAGAG								None (None upstream) : PRMT6 (805748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	106868681	106868683	+	IGR	DEL	AAA	-	-	rs71742751		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106868681_106868683delAAA								None (None upstream) : PRMT6 (730584 downstream)																																			---	---	---	---
FNDC7	163479	broad.mit.edu	37	1	109265600	109265601	+	Intron	INS	-	T	T	rs149280696	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109265600_109265601insT	uc001dvx.2	+						FNDC7_uc010ova.1_Intron	NM_001144937	NP_001138409			fibronectin type III domain containing 7							extracellular region				ovary(1)|skin(1)	2		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)														---	---	---	---
GNAI3	2773	broad.mit.edu	37	1	110098586	110098589	+	Intron	DEL	GTGT	-	-	rs146630879	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110098586_110098589delGTGT	uc001dxz.2	+							NM_006496	NP_006487			guanine nucleotide binding protein (G protein),						cell cycle|cell division|inhibition of adenylate cyclase activity by G-protein signaling pathway|platelet activation|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			ovary(1)	1		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)														---	---	---	---
C1orf103	55791	broad.mit.edu	37	1	111497298	111497298	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111497298delA	uc001eaa.2	-						C1orf103_uc001dzz.2_5'Flank|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842			receptor-interacting factor 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)														---	---	---	---
OVGP1	5016	broad.mit.edu	37	1	111960803	111960803	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111960803delT	uc001eba.2	-						OVGP1_uc001eaz.2_Intron|OVGP1_uc010owb.1_Intron	NM_002557	NP_002548			oviductal glycoprotein 1 precursor						chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119005004	119005007	+	IGR	DEL	CCTC	-	-	rs77161089	byFrequency;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119005004_119005007delCCTC								SPAG17 (277156 upstream) : TBX15 (420659 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120558407	120558410	+	Intron	DEL	GTCA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120558407_120558410delGTCA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	120627425	120627425	+	IGR	DEL	G	-	-	rs111900640		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120627425delG								NOTCH2 (15149 upstream) : FAM72B (211580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142559278	142559279	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142559278_142559279insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142604363	142604363	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142604363delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142607969	142607970	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142607969_142607970insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143139104	143139104	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143139104delT	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143177288	143177289	+	Intron	INS	-	A	A	rs111418855		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143177288_143177289insA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143502547	143502548	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143502547_143502548delAG								None (None upstream) : LOC100286793 (145091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143878633	143878633	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143878633delC								PPIAL4G (110752 upstream) : FAM72D (17819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	144071984	144071984	+	Intron	DEL	A	-	-	rs71582761		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144071984delA	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144681814	144681814	+	Intron	DEL	G	-	-	rs67467472		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144681814delG	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144860877	144860878	+	Intron	INS	-	AT	AT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144860877_144860878insAT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144908640	144908641	+	Intron	INS	-	G	G	rs149429786		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144908640_144908641insG	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145052001	145052002	+	Intron	DEL	CT	-	-	rs141001382		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145052001_145052002delCT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145388855	145388856	+	Intron	INS	-	TT	TT	rs35286255		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145388855_145388856insTT	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	147206658	147206659	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147206658_147206659insT								ACP6 (64024 upstream) : GJA5 (21673 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148001178	148001180	+	Intron	DEL	AGG	-	-	rs35235086		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001178_148001180delAGG	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	149224233	149224234	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149224233_149224234insT								LOC645166 (271179 upstream) : LOC388692 (55242 downstream)																																			---	---	---	---
LOC388692	388692	broad.mit.edu	37	1	149287128	149287129	+	RNA	DEL	CT	-	-	rs140343451		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149287128_149287129delCT	uc010pbf.1	+	1		c.7653_7654delCT			LOC388692_uc001esg.3_5'Flank	NR_027002				Homo sapiens cDNA FLJ13580 fis, clone PLACE1008851.												0																		---	---	---	---
LOC728855	728855	broad.mit.edu	37	1	149650445	149650446	+	Intron	INS	-	A	A	rs148594868		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149650445_149650446insA	uc009wlc.2	+						LOC728855_uc009wld.2_Intron|uc001eso.1_RNA					Homo sapiens mRNA, chromosome 1 specific transcript KIAA0493.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	149867693	149867694	+	IGR	INS	-	A	A	rs72203145		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149867693_149867694insA								HIST2H2AB (8227 upstream) : BOLA1 (3461 downstream)																																			---	---	---	---
MTMR11	10903	broad.mit.edu	37	1	149904850	149904850	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149904850delT	uc001etl.3	-						MTMR11_uc001etm.1_Intron|MTMR11_uc010pbm.1_Intron|MTMR11_uc010pbn.1_Intron	NM_001145862	NP_001139334			myotubularin related protein 11 isoform a								phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
RPRD2	23248	broad.mit.edu	37	1	150334248	150334249	+	5'Flank	INS	-	T	T	rs113651550		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150334248_150334249insT	uc009wlr.2	+						RPRD2_uc010pcc.1_5'Flank|RPRD2_uc001eup.3_5'Flank	NM_015203	NP_056018			Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1																		---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150907300	150907300	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150907300delT	uc001evu.2	+						SETDB1_uc009wmf.2_Intron|SETDB1_uc001evv.2_Intron|SETDB1_uc001evw.3_Intron|SETDB1_uc009wmg.1_Intron	NM_001145415	NP_001138887			SET domain, bifurcated 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152302139	152302140	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152302139_152302140delTG	uc001ezv.2	+											Homo sapiens cDNA FLJ31869 fis, clone NT2RP7002151.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	152371506	152371507	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152371506_152371507delCA								FLG2 (39024 upstream) : CRNN (10212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152958945	152958948	+	IGR	DEL	TCTC	-	-	rs67468856		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152958945_152958948delTCTC								SPRR1A (656 upstream) : SPRR3 (15275 downstream)																																			---	---	---	---
NUP210L	91181	broad.mit.edu	37	1	154086619	154086619	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154086619delA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191			nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)															---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154837829	154837829	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154837829delA	uc001ffp.2	-						KCNN3_uc009wox.1_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
RAG1AP1	55974	broad.mit.edu	37	1	155130051	155130052	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155130051_155130052insTT	uc010pey.1	+							NM_018845				recombination activating gene 1 activating						positive regulation of gene expression, epigenetic	Golgi membrane|integral to membrane|plasma membrane	glucoside transmembrane transporter activity				0	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
GON4L	54856	broad.mit.edu	37	1	155794553	155794554	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155794553_155794554insA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc001fme.2_Intron	NM_001037533	NP_001032622			gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)																	---	---	---	---
RAB25	57111	broad.mit.edu	37	1	156028820	156028821	+	5'Flank	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156028820_156028821insT	uc001fnc.2	+							NM_020387	NP_065120			RAB25						positive regulation of cell proliferation|protein transport|pseudopodium organization|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|pseudopodium membrane	GTP binding|identical protein binding				0	Hepatocellular(266;0.158)|all_neural(408;0.195)																	---	---	---	---
LMNA	4000	broad.mit.edu	37	1	156056184	156056185	+	Intron	INS	-	CT	CT	rs148859457	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156056184_156056185insCT	uc001fnf.1	+							NM_005572	NP_005563			lamin A/C isoform 2						cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)													Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				---	---	---	---
SLC25A44	9673	broad.mit.edu	37	1	156173490	156173491	+	Intron	INS	-	T	T	rs72298327		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156173490_156173491insT	uc001fnp.2	+						SLC25A44_uc010phc.1_Intron|SLC25A44_uc009wrr.2_Intron|SLC25A44_uc010phd.1_Intron|SLC25A44_uc010phe.1_Intron	NM_014655	NP_055470			solute carrier family 25, member 44						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	Hepatocellular(266;0.158)																	---	---	---	---
C1orf61	10485	broad.mit.edu	37	1	156398244	156398245	+	Intron	INS	-	AC	AC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156398244_156398245insAC	uc001fou.1	-						C1orf61_uc001fov.1_Intron|C1orf61_uc001fow.1_Intron|C1orf61_uc001fox.1_Intron|C1orf61_uc001foy.1_Intron|C1orf61_uc001fpa.2_Intron	NM_006365	NP_006356			transcriptional activator of the c-fos promoter							nucleus				skin(1)	1	Hepatocellular(266;0.158)																	---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156515295	156515296	+	Intron	INS	-	T	T	rs111440978		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156515295_156515296insT	uc001fpf.2	-							NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
HDGF	3068	broad.mit.edu	37	1	156735265	156735266	+	Intron	DEL	TT	-	-	rs72051061		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156735265_156735266delTT	uc009wsf.2	-						PRCC_uc001fqa.2_5'Flank|PRCC_uc001fqb.2_5'Flank	NM_001126051	NP_001119523			hepatoma-derived growth factor isoform c						cell proliferation|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	DNA binding|growth factor activity|heparin binding|nucleotide binding			lung(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)														---	---	---	---
PEAR1	375033	broad.mit.edu	37	1	156862373	156862373	+	5'Flank	DEL	T	-	-	rs11307619		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156862373delT	uc001fqj.1	+							NM_001080471	NP_001073940			platelet endothelial aggregation receptor 1							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	157434890	157434891	+	IGR	DEL	CT	-	-	rs66507077		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157434890_157434891delCT								ETV3 (326507 upstream) : FCRL5 (48277 downstream)																																			---	---	---	---
FCRL5	83416	broad.mit.edu	37	1	157510316	157510316	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157510316delA	uc001fqu.2	-						FCRL5_uc009wsm.2_Intron|FCRL5_uc010phv.1_Intron|FCRL5_uc010phw.1_Intron|FCRL5_uc001fqv.1_Intron|FCRL5_uc010phx.1_Intron	NM_031281	NP_112571			Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	157917576	157917577	+	Intron	INS	-	AG	AG	rs137920413	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157917576_157917577insAG	uc001frl.1	+											Homo sapiens cDNA FLJ32876 fis, clone TESTI2004073.																														---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	157969858	157969858	+	Intron	DEL	T	-	-	rs12123469	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157969858delT	uc001frn.3	+						KIRREL_uc010pib.1_Intron	NM_018240	NP_060710			kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	158312451	158312451	+	IGR	DEL	T	-	-	rs113070732		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158312451delT								CD1B (11130 upstream) : CD1E (10803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158842663	158842666	+	IGR	DEL	ATGG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158842663_158842666delATGG								MNDA (23393 upstream) : PYHIN1 (58676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	159407139	159407139	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159407139delA	uc001fts.3	-						OR10J1_uc010piv.1_5'Flank					Homo sapiens, clone IMAGE:3917623, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	159615445	159615446	+	IGR	DEL	TG	-	-	rs111295013		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159615445_159615446delTG								APCS (56785 upstream) : CRP (66634 downstream)																																			---	---	---	---
TOMM40L	84134	broad.mit.edu	37	1	161208255	161208256	+	Intron	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161208255_161208256delAG	uc009wuf.1	+						NR1I3_uc001fzf.2_5'Flank|NR1I3_uc001fzg.2_5'Flank|NR1I3_uc001fzh.2_5'Flank|NR1I3_uc001fzi.2_5'Flank|NR1I3_uc001fzj.2_5'Flank|NR1I3_uc001fzk.2_5'Flank|NR1I3_uc001fzl.2_5'Flank|NR1I3_uc001fzm.2_5'Flank|NR1I3_uc001fzn.2_5'Flank|NR1I3_uc009wug.2_5'Flank|NR1I3_uc001fzp.2_5'Flank|NR1I3_uc001fzo.2_5'Flank|NR1I3_uc001fzq.2_5'Flank|NR1I3_uc001fzr.2_5'Flank|NR1I3_uc001fzs.2_5'Flank|NR1I3_uc001fzt.2_5'Flank|NR1I3_uc001fzu.2_5'Flank|NR1I3_uc001fzv.2_5'Flank|NR1I3_uc001fzw.2_5'Flank|NR1I3_uc001fzx.2_5'Flank|NR1I3_uc001fzy.2_5'Flank|NR1I3_uc001fzz.2_5'Flank|NR1I3_uc001gaa.2_5'Flank|NR1I3_uc001gab.2_5'Flank|NR1I3_uc001gac.2_5'Flank|NR1I3_uc010pkm.1_5'Flank|NR1I3_uc010pkn.1_5'Flank	NM_032174				translocase of outer mitochondrial membrane 40						protein transport	mitochondrial outer membrane|pore complex	porin activity|voltage-gated anion channel activity			large_intestine(1)	1	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	161499355	161499355	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161499355delT								HSPA6 (2670 upstream) : FCGR3A (12198 downstream)																																			---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162131387	162131387	+	Intron	DEL	T	-	-	rs66461421		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162131387delT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	162593282	162593283	+	IGR	INS	-	T	T	rs35747439		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162593282_162593283insT								UAP1 (23650 upstream) : DDR2 (8945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163352007	163352008	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163352007_163352008delTG								NUF2 (26454 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163904283	163904284	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163904283_163904284insA								NUF2 (578730 upstream) : PBX1 (624518 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164589719	164589720	+	Intron	DEL	GT	-	-	rs71703351		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164589719_164589720delGT	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164740818	164740818	+	Intron	DEL	A	-	-	rs3215011		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164740818delA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	165356776	165356777	+	IGR	INS	-	TCTGTG	TCTGTG	rs147619100	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165356776_165356777insTCTGTG								LMX1A (31301 upstream) : RXRG (13574 downstream)																																			---	---	---	---
UCK2	7371	broad.mit.edu	37	1	165817898	165817899	+	Intron	DEL	CA	-	-	rs77004702		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165817898_165817899delCA	uc001gdp.2	+						UCK2_uc010plb.1_Intron	NM_012474	NP_036606			uridine-cytidine kinase 2						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity			ovary(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	166535071	166535072	+	IGR	DEL	TG	-	-	rs10543397		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166535071_166535072delTG								FAM78B (398865 upstream) : FMO9P (38081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166628829	166628829	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166628829delT								FMO9P (34358 upstream) : POGK (179895 downstream)																																			---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167283436	167283437	+	Intron	INS	-	A	A	rs78226448		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167283436_167283437insA	uc001gec.2	+						POU2F1_uc010plg.1_Intron|POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	167769000	167769001	+	IGR	INS	-	T	T	rs147012668	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167769000_167769001insT								MPZL1 (7845 upstream) : ADCY10 (9837 downstream)																																			---	---	---	---
NME7	29922	broad.mit.edu	37	1	169320323	169320324	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169320323_169320324delCA	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron|NME7_uc001gfv.1_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
C1orf114	57821	broad.mit.edu	37	1	169385411	169385412	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169385411_169385412delCA	uc001gga.1	-						C1orf114_uc001gfz.1_Intron|C1orf114_uc009wvq.1_Intron	NM_021179	NP_067002			hypothetical protein LOC57821												0	all_hematologic(923;0.208)																	---	---	---	---
C1orf112	55732	broad.mit.edu	37	1	169714458	169714459	+	Intron	INS	-	C	C	rs139151183	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169714458_169714459insC	uc001ggj.2	+											Homo sapiens cDNA FLJ10706 fis, clone NT2RP3000852.												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
KIFAP3	22920	broad.mit.edu	37	1	170032021	170032022	+	Intron	INS	-	T	T	rs150314794	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170032021_170032022insT	uc001ggv.2	-						KIFAP3_uc010ply.1_Intron|KIFAP3_uc001ggw.1_Intron	NM_014970	NP_055785			kinesin-associated protein 3						blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	170089184	170089185	+	IGR	INS	-	GT	GT	rs146853607	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170089184_170089185insGT								KIFAP3 (45305 upstream) : METTL11B (26003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170203518	170203535	+	IGR	DEL	CACACACACACACACGTG	-	-	rs71800949		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170203518_170203535delCACACACACACACACGTG								METTL11B (66595 upstream) : LOC284688 (37012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170281927	170281927	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170281927delT								LOC284688 (28578 upstream) : GORAB (219336 downstream)																																			---	---	---	---
PRRX1	5396	broad.mit.edu	37	1	170659265	170659265	+	Intron	DEL	C	-	-	rs72073556		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170659265delC	uc001ghf.2	+						PRRX1_uc001ghe.2_Intron	NM_022716	NP_073207			paired mesoderm homeobox 1 isoform pmx-1b							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171519129	171519129	+	Intron	DEL	T	-	-	rs67131565		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171519129delT	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171527517	171527518	+	Intron	INS	-	G	G	rs145672533	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171527517_171527518insG	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron|BAT2L2_uc010pmi.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171546911	171546912	+	Intron	INS	-	AA	AA	rs10659826		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171546911_171546912insAA	uc010pmg.1	+						BAT2L2_uc010pmh.1_Intron|BAT2L2_uc010pmi.1_Intron|BAT2L2_uc010pmj.1_5'Flank	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172122738	172122739	+	Intron	INS	-	CTAA	CTAA	rs142423658	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172122738_172122739insCTAA	uc001gie.2	+						DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
KLHL20	27252	broad.mit.edu	37	1	173754282	173754283	+	Intron	DEL	TA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173754282_173754283delTA	uc001gjc.2	+						KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Intron	NM_014458	NP_055273			kelch-like 20						cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174223235	174223236	+	Intron	INS	-	T	T	rs74676801		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174223235_174223236insT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174529274	174529274	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174529274delA	uc001gjx.2	+							NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174837114	174837114	+	Intron	DEL	T	-	-	rs71825527		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174837114delT	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron|RABGAP1L_uc001gke.3_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
TNN	63923	broad.mit.edu	37	1	175081383	175081384	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175081383_175081384insT	uc001gkl.1	+							NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
TNR	7143	broad.mit.edu	37	1	175351043	175351043	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175351043delT	uc001gkp.1	-						TNR_uc009wwu.1_Intron	NM_003285	NP_003276			tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)																	---	---	---	---
RFWD2	64326	broad.mit.edu	37	1	175949820	175949820	+	Intron	DEL	T	-	-	rs79160076		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175949820delT	uc001gku.1	-						RFWD2_uc001gkv.1_Intron|RFWD2_uc001gkw.1_Intron|RFWD2_uc009wwv.2_Intron|RFWD2_uc001gkt.1_Intron	NM_022457	NP_071902			ring finger and WD repeat domain 2 isoform a						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177206055	177206055	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177206055delA	uc001glf.2	+							NM_021165	NP_066988			family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	177420292	177420293	+	IGR	INS	-	T	T	rs138635537	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177420292_177420293insT								FAM5B (168735 upstream) : SEC16B (477196 downstream)																																			---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180285447	180285450	+	Intron	DEL	GTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180285447_180285450delGTGT	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180371937	180371938	+	Intron	INS	-	A	A	rs67401011		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180371937_180371938insA	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181954987	181954987	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181954987delA								CACNA1E (184274 upstream) : ZNF648 (68720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	182264632	182264633	+	IGR	INS	-	AGAGAG	AGAGAG	rs147662369	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182264632_182264633insAGAGAG								ZNF648 (233785 upstream) : GLUL (87036 downstream)																																			---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183039830	183039830	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183039830delT	uc001gpy.3	+						LAMC1_uc001gpx.2_Intron	NM_002293	NP_002284			laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183239022	183239022	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183239022delT	uc001gqc.1	-						NMNAT2_uc009wye.1_Intron|NMNAT2_uc001gqb.1_Intron	NM_015039	NP_055854			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185997857	185997858	+	Intron	INS	-	T	T	rs11415987		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185997857_185997858insT	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	187501073	187501073	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187501073delA								PLA2G4A (542968 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	190689707	190689708	+	IGR	DEL	TT	-	-	rs34006267		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190689707_190689708delTT								FAM5C (242948 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191035352	191035352	+	IGR	DEL	A	-	-	rs5779561		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191035352delA								FAM5C (588593 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	198584966	198584966	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198584966delT								ATP6V1G3 (74891 upstream) : PTPRC (23171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	198918980	198918980	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198918980delA								MIR181A1 (90698 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200204434	200204434	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200204434delT								FAM58B (20791 upstream) : ZNF281 (170992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200491346	200491346	+	IGR	DEL	T	-	-	rs35052903		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200491346delT								ZNF281 (112180 upstream) : KIF14 (29279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200509652	200509653	+	IGR	INS	-	CCAT	CCAT	rs140780848	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200509652_200509653insCCAT								ZNF281 (130486 upstream) : KIF14 (10972 downstream)																																			---	---	---	---
IPO9	55705	broad.mit.edu	37	1	201846615	201846616	+	3'UTR	INS	-	CACA	CACA	rs145764983	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201846615_201846616insCACA	uc001gwz.2	+	24						NM_018085	NP_060555			importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	201861903	201861903	+	IGR	DEL	G	-	-	rs35664943		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201861903delG								SHISA4 (477 upstream) : LMOD1 (3682 downstream)																																			---	---	---	---
LMOD1	25802	broad.mit.edu	37	1	201909876	201909877	+	Intron	INS	-	T	T	rs34009358		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201909876_201909877insT	uc001gxb.2	-						LMOD1_uc010ppu.1_Intron	NM_012134	NP_036266			leiomodin 1 (smooth muscle)						muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
PTPN7	5778	broad.mit.edu	37	1	202120653	202120654	+	Intron	INS	-	T	T	rs143817229	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202120653_202120654insT	uc001gxm.1	-						PTPN7_uc001gxl.1_Intron|PTPN7_uc001gxn.1_Intron|PTPN7_uc010ppv.1_Intron|PTPN7_uc010ppw.1_Intron|PTPN7_uc010ppx.1_Intron|PTPN7_uc010ppy.1_Intron|PTPN7_uc001gxo.1_Intron	NM_002832	NP_002823			protein tyrosine phosphatase, non-receptor type							cytosol|internal side of plasma membrane	protein binding|protein tyrosine phosphatase activity			skin(1)	1																		---	---	---	---
LGR6	59352	broad.mit.edu	37	1	202173818	202173818	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173818delC	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10																		---	---	---	---
PPP1R12B	4660	broad.mit.edu	37	1	202441276	202441276	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202441276delA	uc001gya.1	+						PPP1R12B_uc001gxz.1_Intron|PPP1R12B_uc001gyb.1_Intron|PPP1R12B_uc001gyc.1_Intron	NM_002481	NP_002472			protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	202789594	202789594	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202789594delT	uc001gyh.2	+											Homo sapiens hypothetical protein LOC641515, mRNA (cDNA clone MGC:33633 IMAGE:4827085), complete cds.																														---	---	---	---
FMOD	2331	broad.mit.edu	37	1	203213114	203213115	+	Intron	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203213114_203213115delAG	uc010pqi.1	-						CHIT1_uc001gzm.1_Intron	NM_002023				fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)															---	---	---	---
LRRN2	10446	broad.mit.edu	37	1	204645505	204645506	+	Intron	INS	-	G	G	rs5000782		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204645505_204645506insG	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron	NM_006338	NP_006329			leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)															---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204808654	204808654	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204808654delG	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron	NM_001005388	NP_001005388			neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
NUAK2	81788	broad.mit.edu	37	1	205290030	205290031	+	Intron	INS	-	CT	CT	rs148782332	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205290030_205290031insCT	uc001hce.2	-							NM_030952	NP_112214			NUAK family, SNF1-like kinase, 2						actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	207463747	207463747	+	IGR	DEL	C	-	-	rs66765558		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207463747delC								C4BPA (145439 upstream) : CD55 (31070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207535327	207535327	+	IGR	DEL	A	-	-	rs11307618		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207535327delA								CD55 (1018 upstream) : CR2 (92343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207919713	207919713	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207919713delT								CR1L (21660 upstream) : CD46 (5689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209990067	209990068	+	IGR	INS	-	GTGTGA	GTGTGA	rs147099410	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209990067_209990068insGTGTGA								IRF6 (10585 upstream) : C1orf107 (11265 downstream)																																			---	---	---	---
C1orf107	27042	broad.mit.edu	37	1	210007340	210007340	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210007340delC	uc001hhr.1	+						C1orf107_uc009xcu.1_Intron	NM_014388	NP_055203			digestive-organ expansion factor homolog						multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	210462507	210462508	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210462507_210462508insT								SERTAD4 (46069 upstream) : HHAT (39098 downstream)																																			---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210543508	210543517	+	Intron	DEL	TTTTTTTTTT	-	-	rs71695246		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210543508_210543517delTTTTTTTTTT	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron	NM_001122834	NP_001116306			hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210754120	210754121	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210754120_210754121insA	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306			hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212024661	212024661	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212024661delA								LPGAT1 (20547 upstream) : INTS7 (90037 downstream)																																			---	---	---	---
TMEM206	55248	broad.mit.edu	37	1	212578045	212578046	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212578045_212578046insT	uc001hjc.3	-						TMEM206_uc010pte.1_Intron	NM_018252	NP_060722			transmembrane protein 206							integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	214132997	214132998	+	Intron	DEL	GG	-	-	rs340861	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214132997_214132998delGG	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																														---	---	---	---
PTPN14	5784	broad.mit.edu	37	1	214636669	214636670	+	Intron	DEL	AG	-	-	rs146991891		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214636669_214636670delAG	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392			protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---
KCNK2	3776	broad.mit.edu	37	1	215206778	215206778	+	Intron	DEL	T	-	-	rs77898940		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215206778delT	uc001hko.2	+						KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron	NM_001017424	NP_001017424			potassium channel, subfamily K, member 2 isoform								outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)													---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216217366	216217367	+	Intron	INS	-	CTT	CTT	rs141401153	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216217366_216217367insCTT	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216296923	216296923	+	Intron	DEL	T	-	-	rs11310661		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216296923delT	uc001hku.1	-							NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216363840	216363841	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216363840_216363841insT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
GPATCH2	55105	broad.mit.edu	37	1	217772677	217772677	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217772677delA	uc001hlf.1	-							NM_018040	NP_060510			G patch domain containing 2							intracellular	nucleic acid binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)														---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217985037	217985038	+	Intron	INS	-	A	A	rs34981943		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217985037_217985038insA	uc001hlh.1	+						SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219291535	219291536	+	Intron	INS	-	AC	AC	rs142962383	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219291535_219291536insAC	uc001hlp.2	-											Homo sapiens cDNA clone IMAGE:6189076.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219573842	219573842	+	IGR	DEL	T	-	-	rs113708670		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219573842delT								LYPLAL1 (187636 upstream) : SLC30A10 (284927 downstream)																																			---	---	---	---
SLC30A10	55532	broad.mit.edu	37	1	219932424	219932438	+	Intron	DEL	GAAGGAAGAAAGGGA	-	-	rs59479381	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219932424_219932438delGAAGGAAGAAAGGGA	uc001hlu.1	-											Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)														---	---	---	---
RAB3GAP2	25782	broad.mit.edu	37	1	220418466	220418467	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220418466_220418467insA	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron|RAB3GAP2_uc010pum.1_Intron	NM_012414	NP_036546			rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	222599778	222599778	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222599778delA								DUSP10 (684317 upstream) : HHIPL2 (95824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224262210	224262211	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs143257946	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224262210_224262211insTTCCTTCC								TP53BP2 (228536 upstream) : FBXO28 (39580 downstream)																																			---	---	---	---
WDR26	80232	broad.mit.edu	37	1	224599406	224599407	+	Intron	INS	-	T	T	rs67168562		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599406_224599407insT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_5'Flank	NM_025160	NP_079436			WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	225093663	225093666	+	IGR	DEL	ACAG	-	-	rs148867553	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225093663_225093666delACAG								CNIH3 (165414 upstream) : DNAH14 (23690 downstream)																																			---	---	---	---
SRP9	6726	broad.mit.edu	37	1	225963591	225963592	+	5'Flank	DEL	GT	-	-	rs139640255		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225963591_225963592delGT	uc001hpg.2	+						SRP9_uc001hpf.3_5'Flank|SRP9_uc001hph.2_5'Flank|SRP9_uc001hpi.3_5'Flank|SRP9_uc001hpj.1_5'Flank	NM_003133	NP_003124			signal recognition particle 9kDa isoform 2						negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0																		---	---	---	---
TMEM63A	9725	broad.mit.edu	37	1	226064354	226064357	+	Intron	DEL	TTGG	-	-	rs138211694		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226064354_226064357delTTGG	uc001hpm.1	-						TMEM63A_uc010pvi.1_Intron	NM_014698	NP_055513			transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)																	---	---	---	---
LEFTY2	7044	broad.mit.edu	37	1	226130085	226130085	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226130085delT	uc001hpt.1	-						LEFTY2_uc010pvk.1_5'Flank|LEFTY2_uc009xek.1_5'Flank	NM_003240	NP_003231			endometrial bleeding associated factor						cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	226209714	226209715	+	IGR	INS	-	TGTGTG	TGTGTG	rs140009395	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226209714_226209715insTGTGTG								C1orf55 (22648 upstream) : H3F3A (40706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226393232	226393232	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226393232delA								ACBD3 (18809 upstream) : MIXL1 (18151 downstream)																																			---	---	---	---
LIN9	286826	broad.mit.edu	37	1	226428088	226428088	+	Intron	DEL	T	-	-	rs71754689		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226428088delT	uc001hqa.2	-						LIN9_uc001hqb.2_Intron|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Intron	NM_173083	NP_775106			lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)														---	---	---	---
LIN9	286826	broad.mit.edu	37	1	226460957	226460958	+	Intron	INS	-	T	T	rs151180730		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226460957_226460958insT	uc001hqa.2	-						LIN9_uc001hqb.2_Intron|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Intron	NM_173083	NP_775106			lin-9 homolog						cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	226612784	226612784	+	IGR	DEL	T	-	-	rs66462312		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226612784delT								PARP1 (16983 upstream) : C1orf95 (123717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	227003749	227003749	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227003749delA								ITPKB (76873 upstream) : PSEN2 (54524 downstream)																																			---	---	---	---
WNT3A	89780	broad.mit.edu	37	1	228224079	228224080	+	Intron	DEL	TG	-	-	rs35733653		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228224079_228224080delTG	uc001hrq.1	+						WNT3A_uc001hrp.1_Intron	NM_033131	NP_149122			wingless-type MMTV integration site family,						axis specification|cell proliferation in forebrain|cell-cell signaling|cellular response to retinoic acid|convergent extension|dermatome development|dorsal/ventral neural tube patterning|embryonic pattern specification|extracellular matrix organization|hemopoietic stem cell proliferation|hippocampus development|inner ear morphogenesis|mammary gland development|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of neuron projection development|notochord development|palate development|paraxial mesodermal cell fate commitment|positive regulation of catenin import into nucleus|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of receptor internalization|positive regulation of transcription from RNA polymerase II promoter|signalosome assembly|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuroblast division|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled-2 binding|receptor agonist activity|signal transducer activity|transcription coactivator activity			ovary(1)	1		Prostate(94;0.0405)																---	---	---	---
RNF187	149603	broad.mit.edu	37	1	228673071	228673071	+	5'Flank	DEL	T	-	-	rs11333214		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228673071delT	uc001htb.2	+						RNF187_uc001htc.2_5'Flank	NM_001010858	NP_001010858			ring finger protein 187						positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K48-linked ubiquitination	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	228715155	228715155	+	IGR	DEL	A	-	-	rs77452388		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228715155delA								RNF187 (31267 upstream) : DUSP5P (65502 downstream)																																			---	---	---	---
PGBD5	79605	broad.mit.edu	37	1	230502115	230502115	+	Intron	DEL	T	-	-	rs36023212		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230502115delT	uc010pwb.1	-						PGBD5_uc001htv.2_Intron	NM_024554	NP_078830			piggyBac transposable element derived 5							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)														---	---	---	---
EGLN1	54583	broad.mit.edu	37	1	231544761	231544762	+	Intron	INS	-	A	A	rs139596905	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231544761_231544762insA	uc001huv.2	-						EGLN1_uc001huu.3_Intron	NM_022051	NP_071334			egl nine homolog 1						negative regulation of sequence-specific DNA binding transcription factor activity|oxygen homeostasis|response to hypoxia	cytosol	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-proline dioxygenase activity|protein binding|zinc ion binding				0		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)			Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	232729462	232729463	+	IGR	INS	-	AC	AC	rs147305364	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232729462_232729463insAC								SIPA1L2 (78219 upstream) : KIAA1383 (211175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233025457	233025457	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233025457delT								KIAA1383 (79365 upstream) : C1orf57 (60913 downstream)																																			---	---	---	---
C1orf57	84284	broad.mit.edu	37	1	233099578	233099583	+	Intron	DEL	TCTCTG	-	-	rs113570810		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233099578_233099583delTCTCTG	uc001hvj.1	+						C1orf57_uc001hvi.2_Intron|C1orf57_uc009xft.1_Intron	NM_032324	NP_115700			nucleoside-triphosphatase C1orf57								ATP binding|nucleoside-triphosphatase activity|nucleotide phosphatase activity|transferase activity				0		all_cancers(173;0.0818)|Prostate(94;0.137)																---	---	---	---
KCNK1	3775	broad.mit.edu	37	1	233800054	233800055	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233800054_233800055insT	uc010pxo.1	+						KCNK1_uc001hvw.2_Intron|KCNK1_uc001hvx.2_Intron	NM_002245	NP_002236			potassium channel, subfamily K, member 1							voltage-gated potassium channel complex	inward rectifier potassium channel activity			central_nervous_system(1)	1		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine(DB00908)													---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234112360	234112361	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234112360_234112361insT	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234525248	234525248	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234525248delT								C1orf31 (5458 upstream) : TARBP1 (1812 downstream)																																			---	---	---	---
TARBP1	6894	broad.mit.edu	37	1	234598433	234598434	+	Intron	INS	-	A	A	rs35604890		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234598433_234598434insA	uc001hwd.2	-							NM_005646	NP_005637			TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234631739	234631739	+	IGR	DEL	G	-	-	rs58123567		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234631739delG								TARBP1 (16890 upstream) : IRF2BP2 (108278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234633960	234633961	+	IGR	INS	-	G	G	rs113469061		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234633960_234633961insG								TARBP1 (19111 upstream) : IRF2BP2 (106056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234772703	234772704	+	IGR	INS	-	T	T	rs112977196		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234772703_234772704insT								IRF2BP2 (27432 upstream) : TOMM20 (499956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234854084	234854087	+	Intron	DEL	TGTG	-	-	rs138747065		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234854084_234854087delTGTG	uc001hwi.1	+											Homo sapiens cDNA FLJ46067 fis, clone TESOP2002110.																														---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235337358	235337358	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235337358delT	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hwp.2_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235399808	235399821	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs67613138		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235399808_235399821delTGTGTGTGTGTGTG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	235696262	235696262	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235696262delT								B3GALNT2 (28481 upstream) : GNG4 (14725 downstream)																																			---	---	---	---
GNG4	2786	broad.mit.edu	37	1	235756248	235756248	+	Intron	DEL	T	-	-	rs112562478		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235756248delT	uc001hxe.3	-						GNG4_uc009xfz.2_Intron|GNG4_uc001hxh.3_Intron	NM_001098722	NP_001092192			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236469931	236469931	+	IGR	DEL	T	-	-	rs71975071		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236469931delT								ERO1LB (24592 upstream) : EDARADD (87749 downstream)																																			---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236577755	236577755	+	Intron	DEL	T	-	-	rs34360581		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236577755delT	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860			EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
ACTN2	88	broad.mit.edu	37	1	236905585	236905586	+	Intron	INS	-	GGGAACG	GGGAACG	rs148628512	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236905585_236905586insGGGAACG	uc001hyf.2	+						ACTN2_uc001hyg.2_Intron|ACTN2_uc009xgi.1_Intron|ACTN2_uc010pxu.1_Intron|ACTN2_uc001hyh.2_Intron	NM_001103	NP_001094			actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237666133	237666134	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237666133_237666134insA	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237861222	237861223	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237861222_237861223insC	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
GREM2	64388	broad.mit.edu	37	1	240767609	240767610	+	Intron	INS	-	TG	TG	rs149122735	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240767609_240767610insTG	uc001hys.2	-							NM_022469	NP_071914			gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)															---	---	---	---
KMO	8564	broad.mit.edu	37	1	241751176	241751177	+	Intron	INS	-	GGAG	GGAG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241751176_241751177insGGAG	uc009xgp.2	+						KMO_uc001hyy.2_Intron|KMO_uc009xgo.1_Intron	NM_003679	NP_003670			kynurenine 3-monooxygenase						pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241832200	241832200	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241832200delA	uc001hze.1	+											RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242083383	242083384	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242083383_242083384delTT								EXO1 (30336 upstream) : MAP1LC3C (75408 downstream)																																			---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242397432	242397433	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242397432_242397433insA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242545430	242545431	+	Intron	INS	-	AAAA	AAAA	rs34582650		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242545430_242545431insAAAA	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	244379845	244379845	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244379845delT								ZNF238 (159069 upstream) : C1orf100 (136092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	244564895	244564895	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244564895delT								C1orf100 (12504 upstream) : ADSS (6902 downstream)																																			---	---	---	---
ADSS	159	broad.mit.edu	37	1	244572632	244572633	+	3'UTR	INS	-	A	A	rs140156508	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244572632_244572633insA	uc001iaj.2	-	13						NM_001126	NP_001117			adenylosuccinate synthase						AMP biosynthetic process|immune system process|purine base metabolic process	cytosol|plasma membrane	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(2)|kidney(1)	3	all_cancers(71;2.17e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)	all_cancers(173;0.0896)|all_epithelial(177;0.172)	all cancers(7;9.71e-08)|GBM - Glioblastoma multiforme(7;1.28e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.0014)		L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	244930079	244930080	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244930079_244930080delTC								PPPDE1 (57747 upstream) : FAM36A (68559 downstream)																																			---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246221658	246221658	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246221658delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
ZNF670	93474	broad.mit.edu	37	1	247226155	247226157	+	Intron	DEL	GAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247226155_247226157delGAA	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990			zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	247370156	247370156	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247370156delT								ZNF124 (34838 upstream) : VN1R5 (49218 downstream)																																			---	---	---	---
NLRP3	114548	broad.mit.edu	37	1	247581609	247581610	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247581609_247581610insT	uc001icr.2	+						NLRP3_uc001ics.2_5'UTR|NLRP3_uc001icu.2_5'UTR|NLRP3_uc001icw.2_5'UTR|NLRP3_uc001icv.2_5'UTR|NLRP3_uc010pyw.1_5'UTR|NLRP3_uc001ict.1_5'UTR	NM_001079821	NP_001073289			NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)															---	---	---	---
NLRP3	114548	broad.mit.edu	37	1	247604432	247604439	+	Intron	DEL	TCTTTCTT	-	-	rs11801392		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247604432_247604439delTCTTTCTT	uc001icr.2	+						NLRP3_uc001ics.2_Intron|NLRP3_uc001icu.2_Intron|NLRP3_uc001icw.2_Intron|NLRP3_uc001icv.2_Intron|NLRP3_uc010pyw.1_Intron	NM_001079821	NP_001073289			NLR family, pyrin domain containing 3 isoform a						detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	247649998	247649998	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247649998delA								OR2B11 (34714 upstream) : OR2W5 (4432 downstream)																																			---	---	---	---
TPO	7173	broad.mit.edu	37	2	1443924	1443939	+	Intron	DEL	GTGCTGCGTTTCCACC	-	-	rs62105618		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1443924_1443939delGTGCTGCGTTTCCACC	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron	NM_000547	NP_000538			thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)													---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1894417	1894417	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1894417delA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc010ewl.1_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2101945	2101946	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2101945_2101946delAC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3081701	3081702	+	Intron	INS	-	GA	GA	rs142573535	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3081701_3081702insGA	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3203521	3203522	+	Intron	DEL	GT	-	-	rs5828969		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3203521_3203522delGT	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301			tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4756073	4756073	+	IGR	DEL	C	-	-	rs67970930		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4756073delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4945876	4945877	+	IGR	INS	-	TG	TG	rs145874192	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4945876_4945877insTG								None (None upstream) : SOX11 (886922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4950223	4950224	+	IGR	INS	-	AT	AT	rs146324171	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4950223_4950224insAT								None (None upstream) : SOX11 (882575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5248984	5248984	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5248984delT								None (None upstream) : SOX11 (583815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5272920	5272920	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5272920delT								None (None upstream) : SOX11 (559879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6456727	6456727	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6456727delT								LOC400940 (328363 upstream) : CMPK2 (523776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7471481	7471482	+	IGR	DEL	CA	-	-	rs111889706		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7471481_7471482delCA								RNF144A (287174 upstream) : LOC339788 (591076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7583837	7583841	+	Intron	DEL	TTTTC	-	-	rs148481376		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7583837_7583841delTTTTC	uc002qyv.2	+											Homo sapiens cDNA FLJ35971 fis, clone TESTI2013257.																														---	---	---	---
LOC339788	339788	broad.mit.edu	37	2	8078690	8078691	+	Intron	INS	-	TCA	TCA	rs142389264	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8078690_8078691insTCA	uc010yit.1	-						LOC339788_uc002qyw.2_Intron	NR_015405				Homo sapiens cDNA clone IMAGE:4183352.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	10658497	10658498	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10658497_10658498delCA								ODC1 (70044 upstream) : NOL10 (52396 downstream)																																			---	---	---	---
NOL10	79954	broad.mit.edu	37	2	10754104	10754105	+	Intron	INS	-	A	A	rs34761084		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10754104_10754105insA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron	NM_024894	NP_079170			nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	10847874	10847874	+	IGR	DEL	T	-	-	rs147166409		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10847874delT								NOL10 (17762 upstream) : ATP6V1C2 (13901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	11253787	11253788	+	Intron	INS	-	CTT	CTT	rs140505789	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11253787_11253788insCTT	uc002raz.1	-						uc002rba.1_Intron					Homo sapiens cDNA FLJ33534 fis, clone BRAMY2007411.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	11972857	11972857	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11972857delA								LPIN1 (5326 upstream) : TRIB2 (884141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13579609	13579610	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13579609_13579610delTG								TRIB2 (696753 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14042144	14042144	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14042144delA								None (None upstream) : FAM84A (730712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14682092	14682093	+	IGR	INS	-	A	A	rs67387157		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14682092_14682093insA								None (None upstream) : FAM84A (90763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15835808	15835809	+	Intron	INS	-	TGTATA	TGTATA	rs143405572	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15835808_15835809insTGTATA	uc002rcf.1	+											Homo sapiens cDNA FLJ36206 fis, clone TESTI2028662.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	16693975	16693975	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16693975delT								MYCN (606847 upstream) : FAM49A (39926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19083292	19083295	+	IGR	DEL	ACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19083292_19083295delACAC								NT5C1B (312454 upstream) : OSR1 (467952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20568687	20568688	+	IGR	INS	-	A	A	rs75525124		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20568687_20568688insA								PUM2 (18224 upstream) : RHOB (78147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21371196	21371198	+	IGR	DEL	TCT	-	-	rs145582061		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21371196_21371198delTCT								APOB (104251 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23067351	23067351	+	IGR	DEL	A	-	-	rs112680999		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23067351delA								None (None upstream) : KLHL29 (688104 downstream)																																			---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25104680	25104681	+	Intron	DEL	GT	-	-	rs5829947		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25104680_25104681delGT	uc002rfs.3	-						ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027			adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)																	---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25885521	25885524	+	Intron	DEL	ACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25885521_25885524delACAC	uc002rgh.2	-						DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
CGREF1	10669	broad.mit.edu	37	2	27339406	27339407	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27339406_27339407insA	uc010eys.1	-						CGREF1_uc002rip.1_Intron|CGREF1_uc002rir.1_Intron|CGREF1_uc002ris.2_Intron	NM_006569	NP_006560			cell growth regulator with EF-hand domain 1						cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
TRIM54	57159	broad.mit.edu	37	2	27506550	27506550	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27506550delT	uc002rjo.2	+						TRIM54_uc002rjn.2_Intron	NM_187841	NP_912730			ring finger protein 30 isoform 2						cell differentiation|microtubule-based process|multicellular organismal development|negative regulation of microtubule depolymerization	microtubule|sarcomere	signal transducer activity|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
GTF3C2	2976	broad.mit.edu	37	2	27561328	27561329	+	Intron	DEL	CA	-	-	rs67450764		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27561328_27561329delCA	uc002rjv.1	-						GTF3C2_uc002rju.1_Intron|GTF3C2_uc002rjw.1_Intron|GTF3C2_uc010eyz.1_Intron	NM_001521	NP_001512			general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28261448	28261449	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28261448_28261449delTG	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28338982	28338983	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28338982_28338983insA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
FAM179A	165186	broad.mit.edu	37	2	29229057	29229058	+	Intron	INS	-	TG	TG	rs140493398	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29229057_29229058insTG	uc010ezl.2	+						FAM179A_uc010ymm.1_Intron	NM_199280	NP_954974			hypothetical protein LOC165186								binding			ovary(3)|skin(1)	4																		---	---	---	---
TTC27	55622	broad.mit.edu	37	2	32892000	32892001	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32892000_32892001insT	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205			tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1																		---	---	---	---
TTC27	55622	broad.mit.edu	37	2	32954568	32954568	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32954568delG	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205			tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	33965166	33965167	+	IGR	INS	-	TTG	TTG	rs147457138	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33965166_33965167insTTG								MYADML (11882 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34258266	34258266	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34258266delA								MYADML (304982 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36070093	36070094	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36070093_36070094insA								None (None upstream) : CRIM1 (513303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37691047	37691047	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37691047delT								QPCT (90583 upstream) : CDC42EP3 (179696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37810766	37810767	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37810766_37810767delGT								QPCT (210302 upstream) : CDC42EP3 (59976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	37998616	37998616	+	IGR	DEL	A	-	-	rs112121172		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37998616delA								CDC42EP3 (99290 upstream) : FAM82A1 (153846 downstream)																																			---	---	---	---
GALM	130589	broad.mit.edu	37	2	38954043	38954044	+	Intron	INS	-	G	G	rs147460646		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38954043_38954044insG	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
GALM	130589	broad.mit.edu	37	2	38956002	38956003	+	Intron	INS	-	T	T	rs146925813	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38956002_38956003insT	uc002rqy.2	+							NM_138801	NP_620156			galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)																---	---	---	---
SOS1	6654	broad.mit.edu	37	2	39337180	39337181	+	Intron	INS	-	GT	GT	rs55974731		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39337180_39337181insGT	uc002rrk.3	-						SOS1_uc010ynr.1_Intron	NM_005633	NP_005624			son of sevenless homolog 1						apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)												Noonan_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	40191717	40191717	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40191717delG	uc002rrw.2	+											Homo sapiens cDNA clone IMAGE:5223469, partial cds.																														---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40498320	40498321	+	Intron	INS	-	C	C	rs138396968	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40498320_40498321insC	uc002rrx.2	-						SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40677491	40677492	+	Intron	INS	-	GT	GT	rs141272449	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40677491_40677492insGT	uc002rsa.2	-						SLC8A1_uc002rsd.3_Intron|SLC8A1_uc010fan.1_Intron|SLC8A1_uc002rsc.1_Intron	NM_001112802	NP_001106273			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	41411794	41411795	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41411794_41411795delAC								SLC8A1 (672219 upstream) : PKDCC (863366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41426306	41426307	+	IGR	INS	-	A	A	rs147683709	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41426306_41426307insA								SLC8A1 (686731 upstream) : PKDCC (848854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42250313	42250314	+	IGR	INS	-	C	C	rs146806880	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42250313_42250314insC								None (None upstream) : PKDCC (24847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42260108	42260109	+	IGR	INS	-	CA	CA	rs137950505	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42260108_42260109insCA								None (None upstream) : PKDCC (15052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42264223	42264224	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42264223_42264224insA								None (None upstream) : PKDCC (10937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42336751	42336751	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42336751delA								PKDCC (51085 upstream) : EML4 (59739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42632583	42632583	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42632583delT								COX7A2L (36433 upstream) : KCNG3 (36576 downstream)																																			---	---	---	---
DYNC2LI1	51626	broad.mit.edu	37	2	44036104	44036105	+	Intron	DEL	AC	-	-	rs72468813		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44036104_44036105delAC	uc002rtk.2	+						DYNC2LI1_uc002rtl.2_Intron|DYNC2LI1_uc010ynz.1_Intron	NM_016008	NP_057092			dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46297781	46297782	+	Intron	INS	-	A	A	rs142685256	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46297781_46297782insA	uc002rut.2	+							NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47534449	47534449	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47534449delT	uc002rvu.1	-											Homo sapiens cDNA FLJ37024 fis, clone BRACE2010837.									p.?(1)																					---	---	---	---
Unknown	0	broad.mit.edu	37	2	47624723	47624723	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47624723delT								EPCAM (10558 upstream) : MSH2 (5483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	48339891	48339891	+	IGR	DEL	G	-	-	rs35029265		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48339891delG								FBXO11 (207077 upstream) : FOXN2 (201904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	48532820	48532821	+	IGR	DEL	TC	-	-	rs67037107		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48532820_48532821delTC								FBXO11 (400006 upstream) : FOXN2 (8974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	50084235	50084235	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50084235delA								FSHR (702605 upstream) : NRXN1 (61409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51831595	51831596	+	IGR	INS	-	ATG	ATG	rs112757455		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51831595_51831596insATG								NRXN1 (571921 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52029474	52029475	+	IGR	INS	-	A	A	rs140686963	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52029474_52029475insA								NRXN1 (769800 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52809940	52809940	+	IGR	DEL	A	-	-	rs5831217		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52809940delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53827265	53827266	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53827265_53827266insT								None (None upstream) : ASB3 (69852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	56248911	56248912	+	Intron	DEL	GT	-	-	rs66882594		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56248911_56248912delGT	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	57045911	57045912	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57045911_57045912insA								CCDC85A (432603 upstream) : None (None downstream)																																			---	---	---	---
PEX13	5194	broad.mit.edu	37	2	61250922	61250923	+	Intron	INS	-	TTTG	TTTG	rs149541555	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61250922_61250923insTTTG	uc002sau.3	+							NM_002618	NP_002609			peroxisomal biogenesis factor 13						cerebral cortex cell migration|fatty acid alpha-oxidation|locomotory behavior|microtubule-based peroxisome localization|neuron migration|protein import into peroxisome matrix, docking|suckling behavior	integral to peroxisomal membrane|membrane fraction	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)															---	---	---	---
UGP2	7360	broad.mit.edu	37	2	64108483	64108486	+	Intron	DEL	ACAC	-	-	rs67013357		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64108483_64108486delACAC	uc002scm.2	+						UGP2_uc002scl.2_Intron|UGP2_uc010ypx.1_Intron	NM_006759	NP_006750			UDP-glucose pyrophosphorylase 2 isoform a						glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	65835461	65835464	+	Intron	DEL	AAAC	-	-	rs111812275		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65835461_65835464delAAAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67021171	67021172	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67021171_67021172delTG								MEIS1 (221281 upstream) : ETAA1 (603270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	69166117	69166117	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69166117delT								BMP10 (67468 upstream) : GKN2 (6248 downstream)																																			---	---	---	---
ADD2	119	broad.mit.edu	37	2	70866139	70866139	+	Intron	DEL	A	-	-	rs71822335		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70866139delA	uc010fds.1	-							NM_001617				adducin 2 isoform a						actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3																		---	---	---	---
NOTO	344022	broad.mit.edu	37	2	73427664	73427664	+	5'Flank	DEL	T	-	-	rs112145162		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73427664delT	uc010yrd.1	+							NM_001134462	NP_001127934			notochord homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
TET3	200424	broad.mit.edu	37	2	74296717	74296717	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74296717delT	uc002skb.3	+						TET3_uc010fez.1_Intron	NM_144993	NP_659430			tet oncogene family member 3								metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
SLC4A5	57835	broad.mit.edu	37	2	74539367	74539368	+	Intron	DEL	TA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74539367_74539368delTA	uc002sko.1	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002skn.2_Intron|SLC4A5_uc010ffc.1_Intron|SLC4A5_uc002skp.1_Intron|SLC4A5_uc002sks.1_Intron	NM_021196	NP_067019			sodium bicarbonate transporter 4 isoform a							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9																		---	---	---	---
LOXL3	84695	broad.mit.edu	37	2	74777883	74777884	+	Intron	DEL	TA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74777883_74777884delTA	uc002smp.1	-						LOXL3_uc002smo.1_5'Flank|LOXL3_uc010ffm.1_Intron|LOXL3_uc002smq.1_Intron|LOXL3_uc010ffn.1_Intron|DOK1_uc002smr.2_Intron	NM_032603	NP_115992			lysyl oxidase-like 3 precursor							extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	76145164	76145165	+	IGR	INS	-	AT	AT	rs145720110	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76145164_76145165insAT								C2orf3 (207053 upstream) : LRRTM4 (829693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78352398	78352398	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78352398delA	uc002snu.3	-											Homo sapiens cDNA clone IMAGE:4816654.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	79228861	79228862	+	IGR	INS	-	TATTTATT	TATTTATT	rs148880549	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79228861_79228862insTATTTATT								None (None upstream) : REG3G (23964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	79381405	79381406	+	IGR	DEL	TG	-	-	rs58315354		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79381405_79381406delTG								REG1P (15852 upstream) : REG3A (2727 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80194243	80194244	+	Intron	INS	-	GT	GT	rs144199004	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80194243_80194244insGT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80503515	80503516	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80503515_80503516insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82077438	82077438	+	IGR	DEL	C	-	-	rs35641648		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82077438delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82892221	82892221	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82892221delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83394144	83394145	+	IGR	INS	-	AAC	AAC	rs5832562		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83394144_83394145insAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	84284732	84284732	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84284732delA								None (None upstream) : FUNDC2P2 (233074 downstream)																																			---	---	---	---
PTCD3	55037	broad.mit.edu	37	2	86353367	86353367	+	Intron	DEL	G	-	-	rs74981615		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86353367delG	uc002sqw.2	+						PTCD3_uc010ytc.1_Intron|PTCD3_uc002sqx.1_Intron	NM_017952	NP_060422			pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1																		---	---	---	---
VPS24	51652	broad.mit.edu	37	2	86853456	86853456	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86853456delA	uc010ytl.1	-						RNF103_uc002srn.2_5'Flank|RNF103_uc002srp.2_5'Flank	NM_001005753	NP_001005753			vacuolar protein sorting 24 isoform 2						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90403394	90403395	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90403394_90403395insA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91974753	91974755	+	IGR	DEL	AAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91974753_91974755delAAC								GGT8P (4600 upstream) : FKSG73 (154404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91987417	91987418	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91987417_91987418insT								GGT8P (17264 upstream) : FKSG73 (141741 downstream)																																			---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98794439	98794440	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98794439_98794440insA	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98845978	98845978	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98845978delT	uc002syo.2	+						VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron|VWA3B_uc002syq.1_Intron|VWA3B_uc002syr.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
MGAT4A	11320	broad.mit.edu	37	2	99273380	99273380	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99273380delT	uc002sze.2	-						MGAT4A_uc010yvm.1_Intron|MGAT4A_uc010fil.2_Intron|MGAT4A_uc010fim.1_Intron	NM_012214	NP_036346			alpha-1,3-mannosyl-glycoprotein						N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1																		---	---	---	---
MITD1	129531	broad.mit.edu	37	2	99786400	99786400	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99786400delG	uc002szs.1	-						MRPL30_uc002szl.1_Intron|MRPL30_uc002szr.2_Intron	NM_138798	NP_620153			MIT, microtubule interacting and transport,						protein transport	late endosome membrane				large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	100764777	100764778	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100764777_100764778delAC								AFF3 (5740 upstream) : LONRF2 (124976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	100765729	100765729	+	IGR	DEL	A	-	-	rs67495794		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100765729delA								AFF3 (6692 upstream) : LONRF2 (124025 downstream)																																			---	---	---	---
NPAS2	4862	broad.mit.edu	37	2	101601328	101601329	+	Intron	INS	-	T	T	rs35103130		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101601328_101601329insT	uc002tap.1	+						NPAS2_uc010yvt.1_Intron|NPAS2_uc010fit.1_Intron	NM_002518	NP_002509			neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4																OREG0014839	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	101828223	101828223	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101828223delT								TBC1D8 (60377 upstream) : C2orf29 (41122 downstream)																																			---	---	---	---
MAP4K4	9448	broad.mit.edu	37	2	102400726	102400727	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102400726_102400727delGT	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron	NM_145687	NP_663720			mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	104202158	104202161	+	IGR	DEL	AGAA	-	-	rs57104605		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104202158_104202161delAGAA								TMEM182 (768022 upstream) : LOC150568 (848644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106284208	106284209	+	IGR	INS	-	T	T	rs72095704		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106284208_106284209insT								FHL2 (228978 upstream) : NCK2 (77145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108845409	108845410	+	IGR	INS	-	T	T	rs139674827	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108845409_108845410insT								SLC5A7 (214970 upstream) : SULT1C3 (18241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	109678611	109678612	+	IGR	DEL	AT	-	-	rs144760040		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109678611_109678612delAT								EDAR (72783 upstream) : SH3RF3 (67385 downstream)																																			---	---	---	---
LOC541471	541471	broad.mit.edu	37	2	112061039	112061040	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112061039_112061040insT	uc002the.2	-											Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0																		---	---	---	---
LOC541471	541471	broad.mit.edu	37	2	112118511	112118511	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112118511delA	uc002the.2	-											Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0																		---	---	---	---
LOC541471	541471	broad.mit.edu	37	2	112252633	112252633	+	RNA	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112252633delA	uc002the.2	-	1		c.60delT			LOC541471_uc010yxl.1_RNA|LOC541471_uc002thf.3_RNA					Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0																		---	---	---	---
IL1F5	26525	broad.mit.edu	37	2	113819152	113819153	+	Intron	INS	-	AT	AT	rs142039683	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113819152_113819153insAT	uc002tis.2	+						IL1F5_uc002tit.2_Intron	NM_173170	NP_775262			interleukin 1 family, member 5							extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114524493	114524494	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114524493_114524494insA								SLC35F5 (10093 upstream) : ACTR3 (123043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	114821710	114821717	+	IGR	DEL	ACACACAC	-	-	rs71969969		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114821710_114821717delACACACAC								ACTR3 (105543 upstream) : DPP10 (378182 downstream)																																			---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115376959	115376960	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115376959_115376960delTG	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115856152	115856152	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115856152delA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	118468940	118468941	+	IGR	DEL	TC	-	-	rs148890415		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118468940_118468941delTC								None (None upstream) : DDX18 (103314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119160633	119160634	+	IGR	INS	-	CCAGCCATCTCCT	CCAGCCATCTCCT	rs150269527	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119160633_119160634insCCAGCCATCTCCT								INSIG2 (293037 upstream) : EN1 (439114 downstream)																																			---	---	---	---
GLI2	2736	broad.mit.edu	37	2	121712728	121712728	+	Intron	DEL	C	-	-	rs77066773		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121712728delC	uc010flp.2	+						GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261			GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	122948401	122948401	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122948401delC								TSN (422975 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	123130643	123130643	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123130643delT								TSN (605217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124550872	124550872	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124550872delA								None (None upstream) : CNTNAP5 (231992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124566132	124566133	+	IGR	INS	-	C	C	rs143137253	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124566132_124566133insC								None (None upstream) : CNTNAP5 (216731 downstream)																																			---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125394230	125394231	+	Intron	DEL	TC	-	-	rs10199562		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125394230_125394231delTC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125476520	125476521	+	Intron	INS	-	A	A	rs35290858		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125476520_125476521insA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	126654206	126654209	+	IGR	DEL	TGTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126654206_126654209delTGTG								CNTNAP5 (981345 upstream) : GYPC (759475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126820948	126820948	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126820948delT								None (None upstream) : GYPC (592736 downstream)																																			---	---	---	---
PLEKHB2	55041	broad.mit.edu	37	2	131908349	131908350	+	Intron	DEL	AC	-	-	rs144656322		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131908349_131908350delAC	uc002tsh.2	+											SubName: Full=Putative uncharacterized protein PLEKHB2;							membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)														---	---	---	---
CCDC74A	90557	broad.mit.edu	37	2	132286014	132286014	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132286014delG	uc002tta.2	+						CCDC74A_uc010fnb.1_Intron|CCDC74A_uc002ttb.2_Intron	NM_138770	NP_620125			coiled-coil domain containing 74A											skin(1)	1																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133007958	133007959	+	Intron	INS	-	ACA	ACA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133007958_133007959insACA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133027339	133027340	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133027339_133027340insA								NCRNA00164 (11797 upstream) : GPR39 (146807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133113907	133113907	+	IGR	DEL	G	-	-	rs10928369		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133113907delG								NCRNA00164 (98365 upstream) : GPR39 (60240 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134161458	134161459	+	Intron	INS	-	TG	TG	rs138024785	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134161458_134161459insTG	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	136813160	136813160	+	IGR	DEL	G	-	-	rs34229667		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136813160delG								DARS (69938 upstream) : CXCR4 (58760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	138908599	138908600	+	IGR	DEL	GG	-	-	rs5834603		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138908599_138908600delGG								HNMT (134666 upstream) : SPOPL (350750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	139733363	139733364	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139733363_139733364insA								NXPH2 (195552 upstream) : None (None downstream)																																			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142192033	142192033	+	Intron	DEL	T	-	-	rs112320313		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142192033delT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143056525	143056538	+	IGR	DEL	TGTGTGTGTGTGTG	-	-	rs72499334		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143056525_143056538delTGTGTGTGTGTGTG								LRP1B (167255 upstream) : KYNU (578657 downstream)																																			---	---	---	---
KYNU	8942	broad.mit.edu	37	2	143770868	143770869	+	Intron	DEL	TG	-	-	rs72349700		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143770868_143770869delTG	uc002tvl.2	+						KYNU_uc010fnm.2_Intron	NM_003937	NP_003928			kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	146022999	146023000	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146022999_146023000delTG								ZEB2 (745068 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	146636424	146636425	+	IGR	INS	-	A	A	rs148038739	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146636424_146636425insA								None (None upstream) : PABPC1P2 (708200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148253431	148253431	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148253431delA								PABPC1P2 (904874 upstream) : ACVR2A (348655 downstream)																																			---	---	---	---
MBD5	55777	broad.mit.edu	37	2	149245310	149245311	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149245310_149245311delAC	uc002twm.3	+						MBD5_uc010zbs.1_Intron|MBD5_uc010fns.2_Intron|MBD5_uc002two.2_Intron|MBD5_uc002twp.2_Intron	NM_018328	NP_060798			methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	152096381	152096381	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152096381delA								RND3 (752201 upstream) : RBM43 (8348 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152564229	152564229	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152564229delT	uc010fnx.2	-						NEB_uc010fny.1_5'Flank	NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	153887327	153887327	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153887327delG								ARL6IP6 (269560 upstream) : RPRM (446525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154014284	154014284	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154014284delT								ARL6IP6 (396517 upstream) : RPRM (319568 downstream)																																			---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154995714	154995714	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154995714delG	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_5'Flank	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	158788272	158788273	+	IGR	INS	-	ACACACACACACAC	ACACACACACACAC	rs143090766	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158788272_158788273insACACACACACACAC								ACVR1 (55898 upstream) : UPP2 (63418 downstream)																																			---	---	---	---
ITGB6	3694	broad.mit.edu	37	2	161003597	161003599	+	Intron	DEL	AAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161003597_161003599delAAA	uc002ubh.2	-						ITGB6_uc010fow.1_Intron|ITGB6_uc010fou.2_Intron|ITGB6_uc010zcq.1_Intron|ITGB6_uc010fov.1_Intron	NM_000888	NP_000879			integrin, beta 6 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
ITGB6	3694	broad.mit.edu	37	2	161014630	161014631	+	Intron	INS	-	A	A	rs140729069	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161014630_161014631insA	uc002ubh.2	-						ITGB6_uc010fow.1_Intron|ITGB6_uc010fou.2_Intron|ITGB6_uc010zcq.1_Intron|ITGB6_uc010fov.1_Intron	NM_000888	NP_000879			integrin, beta 6 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
KCNH7	90134	broad.mit.edu	37	2	163306344	163306344	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163306344delT	uc002uch.1	-						KCNH7_uc002uci.2_Intron	NM_033272	NP_150375			potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)													---	---	---	---
COBLL1	22837	broad.mit.edu	37	2	165594242	165594242	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165594242delA	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron	NM_014900	NP_055715			COBL-like 1											ovary(2)|pancreas(1)	3																OREG0015041	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
GALNT3	2591	broad.mit.edu	37	2	166638115	166638115	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166638115delA	uc010fph.1	-						GALNT3_uc010fpi.1_Intron|GALNT3_uc002udi.2_Intron	NM_004482	NP_004473			polypeptide N-acetylgalactosaminyltransferase 3						protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	Golgi cisterna membrane|integral to membrane|membrane fraction|nucleus|perinuclear region of cytoplasm	calcium ion binding|manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
SCN1A	6323	broad.mit.edu	37	2	166894121	166894124	+	Intron	DEL	GTTT	-	-	rs139551129		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166894121_166894124delGTTT	uc010zcz.1	-						SCN1A_uc002udo.3_Intron|SCN1A_uc010fpk.2_Intron	NM_006920	NP_008851			sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	167732506	167732506	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167732506delA								SCN7A (381789 upstream) : XIRP2 (12491 downstream)																																			---	---	---	---
LASS6	253782	broad.mit.edu	37	2	169320684	169320685	+	Intron	INS	-	TG	TG	rs74271829		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169320684_169320685insTG	uc002ueb.1	+						LASS6_uc002uec.1_Intron	NM_203463	NP_982288			longevity assurance homolog 6							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170209328	170209328	+	Intron	DEL	A	-	-	rs35272876		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170209328delA	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
PPIG	9360	broad.mit.edu	37	2	170463102	170463102	+	Intron	DEL	A	-	-	rs72103490		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170463102delA	uc002uez.2	+						PPIG_uc010fpx.2_Intron|PPIG_uc010fpy.2_Intron|PPIG_uc002ufa.2_Intron|PPIG_uc002ufb.2_Intron|PPIG_uc002ufc.1_Intron|PPIG_uc002ufd.2_Intron	NM_004792	NP_004783			peptidylprolyl isomerase G						protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)													---	---	---	---
PPIG	9360	broad.mit.edu	37	2	170474512	170474514	+	Intron	DEL	TTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170474512_170474514delTTC	uc002uez.2	+						PPIG_uc010fpx.2_Intron|PPIG_uc010fpy.2_Intron|PPIG_uc002ufa.2_Intron|PPIG_uc002ufb.2_Intron|PPIG_uc002ufc.1_Intron|PPIG_uc002ufd.2_Intron	NM_004792	NP_004783			peptidylprolyl isomerase G						protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)													---	---	---	---
KLHL23	151230	broad.mit.edu	37	2	170604210	170604211	+	Intron	INS	-	T	T	rs142585288	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170604210_170604211insT	uc002ufh.1	+						KLHL23_uc002ufi.1_Intron|uc002ufj.3_5'Flank	NM_144711	NP_653312			kelch-like 23												0																		---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170834110	170834111	+	Intron	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170834110_170834111delGA	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron	NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	172170328	172170328	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172170328delG								TLK1 (82504 upstream) : METTL8 (3587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	173041435	173041435	+	IGR	DEL	T	-	-	rs66988282		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173041435delT								DLX2 (73957 upstream) : ITGA6 (250647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	173150721	173150722	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173150721_173150722delTC								DLX2 (183243 upstream) : ITGA6 (141360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174485840	174485843	+	IGR	DEL	GATG	-	-	rs148592491		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174485840_174485843delGATG								CDCA7 (252122 upstream) : SP3 (287416 downstream)																																			---	---	---	---
ATF2	1386	broad.mit.edu	37	2	176026492	176026492	+	Intron	DEL	T	-	-	rs66614968		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176026492delT	uc002ujl.2	-						ATF2_uc010fqv.2_Intron|ATF2_uc002ujv.2_Intron|ATF2_uc002ujm.2_Intron|ATF2_uc002ujn.2_Intron|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_Intron|ATF2_uc002ujq.2_Intron|ATF2_uc002ujr.2_Intron|ATF2_uc010fqu.2_Intron|ATF2_uc002ujs.2_Intron|ATF2_uc002ujt.2_Intron|ATF2_uc002uju.2_Intron|ATF2_uc002ujw.1_Intron|ATF2_uc002ujx.1_Intron|ATF2_uc002ujy.1_Intron	NM_001880	NP_001871			activating transcription factor 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)															---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178894278	178894279	+	Intron	INS	-	A	A	rs147449086	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178894278_178894279insA	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
Unknown	0	broad.mit.edu	37	2	180772818	180772819	+	IGR	INS	-	TGTG	TGTG	rs142594543	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180772818_180772819insTGTG								ZNF385B (46586 upstream) : CWC22 (36785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	181536227	181536228	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181536227_181536228insT								CWC22 (664387 upstream) : UBE2E3 (308884 downstream)																																			---	---	---	---
CERKL	375298	broad.mit.edu	37	2	182403223	182403234	+	Intron	DEL	GCCTCTAGAACA	-	-	rs3217651		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182403223_182403234delGCCTCTAGAACA	uc002unx.2	-						CERKL_uc002uny.2_Intron|CERKL_uc010zfm.1_Intron|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002unw.2_Intron	NM_001030311	NP_001025482			ceramide kinase-like isoform b						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	182716761	182716762	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182716761_182716762insC								CERKL (171380 upstream) : SSFA2 (39710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184052687	184052687	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184052687delT								NUP35 (26280 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188139546	188139546	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188139546delT								ZSWIM2 (425649 upstream) : CALCRL (68305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188644959	188644959	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188644959delT								TFPI (225740 upstream) : GULP1 (511645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	188794024	188794024	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188794024delA								TFPI (374805 upstream) : GULP1 (362580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194533771	194533772	+	IGR	INS	-	TG	TG	rs142895655	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194533771_194533772insTG								PCGEM1 (892150 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195374345	195374345	+	IGR	DEL	T	-	-	rs112587633		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195374345delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	196106388	196106391	+	IGR	DEL	AAGG	-	-	rs144111052		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196106388_196106391delAAGG								None (None upstream) : SLC39A10 (415141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	200855269	200855270	+	IGR	INS	-	ACACAC	ACACAC	rs141292816	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200855269_200855270insACACAC								C2orf47 (26424 upstream) : SPATS2L (315334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	201663079	201663079	+	IGR	DEL	C	-	-	rs79728980		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201663079delC								AOX2P (4117 upstream) : BZW1 (13533 downstream)																																			---	---	---	---
CFLAR	8837	broad.mit.edu	37	2	201980243	201980243	+	5'Flank	DEL	A	-	-	rs112347482		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201980243delA	uc002uxb.3	+						CFLAR_uc002uwy.2_5'Flank|CFLAR_uc002uwz.2_5'Flank|CFLAR_uc002uxa.3_5'Flank|CFLAR_uc010zhk.1_5'Flank|CFLAR_uc002uxc.3_5'Flank|CFLAR_uc010zhl.1_5'Flank	NM_003879	NP_003870			CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0																		---	---	---	---
ALS2CR12	130540	broad.mit.edu	37	2	202179010	202179011	+	Intron	INS	-	A	A	rs112930786		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202179010_202179011insA	uc010ftg.2	-						ALS2CR12_uc002uya.3_Intron|ALS2CR12_uc010fth.2_Intron	NM_139163	NP_631902			amyotrophic lateral sclerosis 2 (juvenile)						regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
ALS2	57679	broad.mit.edu	37	2	202614892	202614892	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202614892delA	uc002uyo.2	-						ALS2_uc002uyp.3_Intron|ALS2_uc002uyq.2_Intron	NM_020919	NP_065970			alsin isoform 1						cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7																		---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205579045	205579045	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205579045delT	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PLEKHM3	389072	broad.mit.edu	37	2	208840471	208840471	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208840471delC	uc002vcl.2	-						PLEKHM3_uc002vcm.2_Intron	NM_001080475	NP_001073944			pleckstrin homology domain containing, family M,						intracellular signal transduction		metal ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	209714048	209714048	+	IGR	DEL	G	-	-	rs66734329		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209714048delG								PTH2R (9230 upstream) : MAP2 (574723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	210244916	210244921	+	IGR	DEL	TGTTTA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210244916_210244921delTGTTTA								PTH2R (540098 upstream) : MAP2 (43850 downstream)																																			---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212489798	212489798	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212489798delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214490384	214490386	+	Intron	DEL	TAC	-	-	rs74181306	by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214490384_214490386delTAC	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
BARD1	580	broad.mit.edu	37	2	215595861	215595862	+	Intron	INS	-	A	A	rs141721839	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215595861_215595862insA	uc002veu.2	-						BARD1_uc010zjm.1_Intron	NM_000465	NP_000456			BRCA1 associated RING domain 1						cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)										Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	217420305	217420306	+	IGR	INS	-	G	G	rs139799976	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217420305_217420306insG								RPL37A (54119 upstream) : IGFBP2 (77821 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	218879590	218879593	+	IGR	DEL	GGAC	-	-	rs61462261		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218879590_218879593delGGAC								TNS1 (11872 upstream) : RUFY4 (20118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220767470	220767471	+	IGR	INS	-	G	G	rs112798084		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220767470_220767471insG								SLC4A3 (260769 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220959429	220959460	+	IGR	DEL	CTCCCTCCCTCCCTTTCTTCCTCCCTCCCTTT	-	-	rs6147181	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220959429_220959460delCTCCCTCCCTCCCTTTCTTCCTCCCTCCCTTT								SLC4A3 (452728 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221183391	221183392	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221183391_221183392delCA								SLC4A3 (676690 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	221866397	221866398	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221866397_221866398delAC								None (None upstream) : EPHA4 (416351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222070521	222070522	+	IGR	INS	-	AC	AC	rs34343223		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222070521_222070522insAC								None (None upstream) : EPHA4 (212227 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224485606	224485607	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224485606_224485607delGT								SCG2 (18485 upstream) : AP1S3 (134441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224541529	224541530	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224541529_224541530insT								SCG2 (74408 upstream) : AP1S3 (78518 downstream)																																			---	---	---	---
KIAA1486	57624	broad.mit.edu	37	2	226263340	226263341	+	5'Flank	INS	-	AG	AG	rs149619606	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226263340_226263341insAG	uc002voe.2	+						KIAA1486_uc010fxa.1_5'Flank	NM_020864	NP_065915			hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)														---	---	---	---
RHBDD1	84236	broad.mit.edu	37	2	227826258	227826259	+	Intron	INS	-	T	T	rs150544676	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227826258_227826259insT	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652			rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)														---	---	---	---
WDR69	164781	broad.mit.edu	37	2	228782907	228782908	+	Intron	INS	-	CAT	CAT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228782907_228782908insCAT	uc002vpn.1	+						WDR69_uc010zlw.1_Intron|WDR69_uc002vpo.1_Intron	NM_178821	NP_849143			WD repeat domain 69											breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)														---	---	---	---
DNER	92737	broad.mit.edu	37	2	230356667	230356668	+	Intron	DEL	AC	-	-	rs140359241		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230356667_230356668delAC	uc002vpv.2	-						DNER_uc010zly.1_Intron	NM_139072	NP_620711			delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
DNER	92737	broad.mit.edu	37	2	230487272	230487273	+	Intron	INS	-	GTAA	GTAA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230487272_230487273insGTAA	uc002vpv.2	-							NM_139072	NP_620711			delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
PDE6D	5147	broad.mit.edu	37	2	232639304	232639304	+	Intron	DEL	T	-	-	rs141853180		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232639304delT	uc002vse.1	-						PDE6D_uc002vsf.1_Intron	NM_002601	NP_002592			phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	233218548	233218549	+	IGR	INS	-	CA	CA	rs140136542	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233218548_233218549insCA								DIS3L2 (16641 upstream) : ALPP (24799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235264580	235264581	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235264580_235264581delTT								SPP2 (278804 upstream) : ARL4C (137107 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236832154	236832155	+	Intron	INS	-	CCCCA	CCCCA	rs138759403	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236832154_236832155insCCCCA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
IQCA1	79781	broad.mit.edu	37	2	237352622	237352623	+	Intron	INS	-	T	T	rs36033008		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237352622_237352623insT	uc002vvz.1	-						IQCA1_uc002vwb.2_Intron|IQCA1_uc002vwa.1_Intron|IQCA1_uc010zni.1_Intron	NM_024726	NP_079002			IQ motif containing with AAA domain 1								ATP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	238123197	238123198	+	IGR	INS	-	C	C	rs142583126	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238123197_238123198insC								COPS8 (115710 upstream) : COL6A3 (109457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239675873	239675873	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239675873delG								ASB1 (314983 upstream) : TWIST2 (80800 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240147439	240147440	+	Intron	INS	-	C	C	rs144031467	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240147439_240147440insC	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	240813800	240813801	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240813800_240813801delCT								HDAC4 (490454 upstream) : NDUFA10 (86357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241143929	241143929	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241143929delA								OTOS (63856 upstream) : GPC1 (231186 downstream)																																			---	---	---	---
DUSP28	285193	broad.mit.edu	37	2	241500981	241500982	+	Intron	INS	-	TG	TG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241500981_241500982insTG	uc002vzg.2	+						ANKMY1_uc002vzd.1_5'Flank|ANKMY1_uc010fze.1_5'Flank|ANKMY1_uc002vze.2_5'Flank|ANKMY1_uc002vzf.2_5'Flank|DUSP28_uc002vzh.2_3'UTR	NM_001033575	NP_001028747			dual specificity phosphatase 28								protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-31)|all cancers(36;5.56e-29)|OV - Ovarian serous cystadenocarcinoma(60;7.57e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.06e-06)|Lung(119;0.00164)|Colorectal(34;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.00802)|COAD - Colon adenocarcinoma(134;0.0311)														---	---	---	---
SNED1	25992	broad.mit.edu	37	2	241957350	241957351	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241957350_241957351insA	uc002wah.1	+							NM_001080437	NP_001073906			6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	337243	337244	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:337243_337244insT	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	385533	385533	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:385533delA	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	637393	637393	+	Intron	DEL	A	-	-	rs34011054		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:637393delA	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2672417	2672417	+	Intron	DEL	C	-	-	rs34326367		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2672417delC	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	4990197	4990198	+	Intron	INS	-	TGTG	TGTG	rs72437035		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4990197_4990198insTGTG	uc003bqe.1	-						uc010hce.1_Intron					Homo sapiens cDNA FLJ32330 fis, clone PROST2004742.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	5262218	5262219	+	IGR	INS	-	TTTTT	TTTTT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5262218_5262219insTTTTT								EDEM1 (569 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	5725505	5725505	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5725505delT								EDEM1 (463856 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	5725635	5725636	+	IGR	INS	-	TC	TC	rs138882067	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5725635_5725636insTC								EDEM1 (463986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6139256	6139257	+	IGR	INS	-	AC	AC	rs140510269	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6139256_6139257insAC								EDEM1 (877607 upstream) : GRM7 (763545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6472560	6472560	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6472560delT								None (None upstream) : GRM7 (430242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	8641267	8641267	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8641267delC								LOH3CR2A (25687 upstream) : C3orf32 (20002 downstream)																																			---	---	---	---
C3orf32	51066	broad.mit.edu	37	3	8785961	8785962	+	Intron	INS	-	T	T	rs35889837		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8785961_8785962insT	uc003bqz.2	-						CAV3_uc003bra.2_Intron|CAV3_uc003brb.2_Intron	NM_015931	NP_057015			hypothetical protein LOC51066											skin(1)	1																		---	---	---	---
TATDN2	9797	broad.mit.edu	37	3	10324455	10324464	+	Intron	DEL	TTTTTTTTTT	-	-	rs111592536		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10324455_10324464delTTTTTTTTTT	uc011ats.1	+						TATDN2_uc011att.1_Intron|TATDN2_uc011atu.1_Intron|TATDN2_uc011atv.1_Intron|GHRLOS_uc011atw.1_Intron|GHRLOS_uc011atx.1_Intron|GHRLOS_uc011aty.1_Intron|GHRLOS_uc011atz.1_Intron|GHRLOS_uc011aua.1_Intron|GHRLOS_uc010hdl.2_Intron|GHRLOS_uc011aub.1_Intron|GHRLOS_uc010hdm.2_Intron|GHRLOS_uc011auc.1_Intron|GHRLOS_uc011aud.1_Intron|GHRLOS_uc011aue.1_Intron|GHRLOS_uc011auf.1_Intron|GHRLOS_uc011aug.1_Intron|C3orf42_uc010hcz.2_5'Flank|GHRLOS_uc011auh.1_5'Flank|GHRLOS_uc011aui.1_5'Flank|GHRLOS_uc011auj.1_5'Flank|GHRLOS_uc010hdn.2_5'Flank					Synthetic construct DNA, clone: pF1KSDA0218, Homo sapiens TATDN2 gene for TatD DNase domain-containing deoxyribonuclease 2, complete cds, without stop codon, in Flexi system.							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	11107253	11107256	+	IGR	DEL	TGTG	-	-	rs55855023		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11107253_11107256delTGTG								SLC6A1 (26319 upstream) : HRH1 (71523 downstream)																																			---	---	---	---
ATG7	10533	broad.mit.edu	37	3	11559737	11559737	+	Intron	DEL	G	-	-	rs34253168		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11559737delG	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386			APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	12292701	12292701	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12292701delT								SYN2 (59171 upstream) : PPARG (36648 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	13789290	13789291	+	IGR	DEL	CA	-	-	rs112104693		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13789290_13789291delCA								LOC285375 (1158 upstream) : WNT7A (70791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	13839312	13839313	+	IGR	INS	-	GGA	GGA	rs139021716	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13839312_13839313insGGA								LOC285375 (51180 upstream) : WNT7A (20769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	14664037	14664038	+	IGR	INS	-	GTGT	GTGT	rs141160932	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14664037_14664038insGTGT								GRIP2 (80449 upstream) : C3orf19 (29215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	16822648	16822649	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16822648_16822649insT								DAZL (175642 upstream) : PLCL2 (21510 downstream)																																			---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17262695	17262696	+	Intron	INS	-	T	T	rs149928668	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17262695_17262696insT	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17779317	17779318	+	Intron	INS	-	A	A	rs78644364		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17779317_17779318insA	uc003cbf.2	-						TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19191841	19191842	+	Intron	INS	-	T	T	rs79985414		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19191841_19191842insT	uc003cbk.1	+						KCNH8_uc011awe.1_Intron|KCNH8_uc010hex.1_Intron	NM_144633	NP_653234			potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
RAB5A	5868	broad.mit.edu	37	3	19988759	19988761	+	5'UTR	DEL	CGG	-	-	rs71710230		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19988759_19988761delCGG	uc003cbn.2	+	1					EFHB_uc003cbm.2_5'Flank|RAB5A_uc010hey.2_RNA|RAB5A_uc011awg.1_5'UTR	NM_004162	NP_004153			RAB5A, member RAS oncogene family						blood coagulation|protein transport|receptor internalization|regulation of filopodium assembly|small GTPase mediated signal transduction	early endosome membrane|melanosome|plasma membrane	GDP binding|GTP binding|GTPase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	21068492	21068495	+	IGR	DEL	TGTG	-	-	rs35807341		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21068492_21068495delTGTG								SGOL1 (840809 upstream) : VENTXP7 (378723 downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22074649	22074649	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22074649delT	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22229947	22229947	+	Intron	DEL	T	-	-	rs113890117		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22229947delT	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
UBE2E2	7325	broad.mit.edu	37	3	23266734	23266734	+	Intron	DEL	T	-	-	rs35016740		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23266734delT	uc003ccg.2	+						UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866			ubiquitin-conjugating enzyme E2E 2						ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0																		---	---	---	---
UBE2E2	7325	broad.mit.edu	37	3	23346345	23346346	+	Intron	DEL	GT	-	-	rs71945776		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23346345_23346346delGT	uc003ccg.2	+						UBE2E2_uc010hfc.2_Intron	NM_152653	NP_689866			ubiquitin-conjugating enzyme E2E 2						ISG15-protein conjugation|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination	nucleolus	ATP binding|ISG15 ligase activity|ubiquitin-protein ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	23671813	23671816	+	IGR	DEL	AGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23671813_23671816delAGAA								UBE2E2 (39517 upstream) : UBE2E1 (175623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	23805029	23805030	+	IGR	INS	-	A	A	rs139401992	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23805029_23805030insA								UBE2E2 (172733 upstream) : UBE2E1 (42409 downstream)																																			---	---	---	---
RARB	5915	broad.mit.edu	37	3	25566228	25566228	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25566228delT	uc011awl.1	+						RARB_uc003cdi.1_Intron|RARB_uc003cdh.2_Intron	NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28427423	28427423	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28427423delT	uc003ceh.2	+							NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29365331	29365331	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29365331delT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29499458	29499458	+	Intron	DEL	A	-	-	rs68182823		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29499458delA	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29698255	29698255	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29698255delA	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29940227	29940228	+	Intron	INS	-	GTGT	GTGT	rs145413086	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29940227_29940228insGTGT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
Unknown	0	broad.mit.edu	37	3	30202966	30202967	+	IGR	DEL	TC	-	-	rs34105501		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30202966_30202967delTC								RBMS3 (156347 upstream) : TGFBR2 (445027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30576112	30576113	+	IGR	INS	-	ACAC	ACAC	rs144679257	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30576112_30576113insACAC								RBMS3 (529493 upstream) : TGFBR2 (71881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	31275417	31275418	+	IGR	INS	-	A	A	rs34390723		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31275417_31275418insA								GADL1 (339264 upstream) : STT3B (299073 downstream)																																			---	---	---	---
OSBPL10	114884	broad.mit.edu	37	3	31917048	31917048	+	Intron	DEL	A	-	-	rs72430410		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31917048delA	uc003cev.2	-						OSBPL10_uc011axf.1_Intron	NM_017784	NP_060254			oxysterol-binding protein-like protein 10						lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	32247542	32247542	+	IGR	DEL	T	-	-	rs71843950		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32247542delT								GPD1L (37346 upstream) : CMTM8 (32629 downstream)																																			---	---	---	---
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257			CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
CLASP2	23122	broad.mit.edu	37	3	33614404	33614404	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33614404delT	uc003cfu.2	-						CLASP2_uc003cfs.2_Intron|CLASP2_uc003cft.2_Intron|CLASP2_uc010hgb.2_Intron|CLASP2_uc011axt.1_Intron	NM_015097	NP_055912			CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	34302015	34302015	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34302015delG								PDCD6IP (390821 upstream) : None (None downstream)																																			---	---	---	---
SLC22A14	9389	broad.mit.edu	37	3	38340045	38340046	+	Intron	INS	-	TG	TG	rs139864892	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38340045_38340046insTG	uc010hhc.1	+							NM_004803	NP_004794			organic cation transporter like 4							integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	39037307	39037310	+	IGR	DEL	TCTG	-	-	rs57106365		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39037307_39037310delTCTG								SCN11A (45255 upstream) : WDR48 (56197 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	39207320	39207321	+	IGR	DEL	GT	-	-	rs11457856		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39207320_39207321delGT								CSRNP1 (11267 upstream) : XIRP1 (17386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	39690710	39690710	+	IGR	DEL	A	-	-	rs11341192		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39690710delA								MOBP (122855 upstream) : MYRIP (160593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41040639	41040640	+	IGR	INS	-	TG	TG	rs148110189	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41040639_41040640insTG								ZNF621 (459596 upstream) : CTNNB1 (195761 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41567674	41567676	+	Intron	DEL	TCG	-	-	rs79193176		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41567674_41567676delTCG	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41914066	41914066	+	Intron	DEL	C	-	-	rs34528810		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41914066delC	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
SEC22C	9117	broad.mit.edu	37	3	42620032	42620035	+	Intron	DEL	ACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42620032_42620035delACAC	uc003clj.2	-						SEC22C_uc003clh.2_Intron|SEC22C_uc011azo.1_Intron|SEC22C_uc010hic.2_Intron|SEC22C_uc003cli.2_Intron	NM_032970	NP_116752			SEC22 vesicle trafficking protein homolog C						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	43803816	43803818	+	IGR	DEL	AAA	-	-	rs34005124		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43803816_43803818delAAA								ABHD5 (39600 upstream) : MIR138-1 (351886 downstream)																																			---	---	---	---
ZNF445	353274	broad.mit.edu	37	3	44560500	44560500	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44560500delT	uc011azw.1	-							NM_181489	NP_852466			zinc finger protein 445						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)														---	---	---	---
ZNF197	10168	broad.mit.edu	37	3	44672900	44672900	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44672900delT	uc003cnm.2	+						ZNF197_uc003cnn.2_Intron|ZNF197_uc003cno.2_Intron|ZNF197_uc003cnp.2_Intron	NM_006991	NP_008922			zinc finger protein 197 isoform 1						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|skin(1)	4				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)														---	---	---	---
LARS2	23395	broad.mit.edu	37	3	45446603	45446604	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45446603_45446604insT	uc003cop.1	+						LARS2_uc010hit.1_Intron	NM_015340	NP_056155			leucyl-tRNA synthetase 2, mitochondrial						leucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|leucine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)													---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47328943	47328946	+	Intron	DEL	GTGT	-	-	rs72174010		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47328943_47328946delGTGT	uc003crd.2	+						KLHL18_uc003crb.2_RNA|KLHL18_uc003crc.2_Intron|KLHL18_uc011bav.1_Intron	NM_025010	NP_079286			kelch-like 18												0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
PTPN23	25930	broad.mit.edu	37	3	47428893	47428894	+	Intron	INS	-	A	A	rs34969941		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47428893_47428894insA	uc003crf.1	+						PTPN23_uc011baw.1_Intron|PTPN23_uc011bax.1_Intron|PTPN23_uc011bay.1_Intron	NM_015466	NP_056281			protein tyrosine phosphatase, non-receptor type						cilium morphogenesis	cilium|cytoplasmic membrane-bounded vesicle|microtubule basal body	protein tyrosine phosphatase activity			breast(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
SMARCC1	6599	broad.mit.edu	37	3	47704703	47704710	+	Intron	DEL	AGGAAGGA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47704703_47704710delAGGAAGGA	uc003crq.2	-						SMARCC1_uc011bbc.1_Intron|SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065			SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	48194405	48194406	+	IGR	INS	-	AC	AC	rs142557435	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48194405_48194406insAC								MAP4 (63636 upstream) : CDC25A (4262 downstream)																																			---	---	---	---
ZNF589	51385	broad.mit.edu	37	3	48291967	48291967	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48291967delT	uc003csl.3	+						ZNF589_uc010hjt.1_Intron|ZNF589_uc003csn.2_Intron|ZNF589_uc011bbg.1_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173			zinc finger protein 589						regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
ZNF589	51385	broad.mit.edu	37	3	48323408	48323408	+	Intron	DEL	A	-	-	rs79563867		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48323408delA	uc011bbg.1	+						ZNF589_uc003csn.2_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173			zinc finger protein 589						regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
ZNF589	51385	broad.mit.edu	37	3	48327578	48327578	+	Intron	DEL	T	-	-	rs148494610		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48327578delT	uc011bbg.1	+						ZNF589_uc003csn.2_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173			zinc finger protein 589						regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
PFKFB4	5210	broad.mit.edu	37	3	48563450	48563451	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48563450_48563451delAC	uc003ctv.2	-						PFKFB4_uc003ctw.2_Intron|PFKFB4_uc010hkc.2_Intron|PFKFB4_uc003ctx.2_Intron|PFKFB4_uc010hkb.2_Intron|PFKFB4_uc011bbm.1_Intron|PFKFB4_uc011bbn.1_Intron	NM_004567	NP_004558			6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	49389750	49389751	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49389750_49389751insA								USP4 (12214 upstream) : GPX1 (4860 downstream)																																			---	---	---	---
RHOA	387	broad.mit.edu	37	3	49411307	49411308	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49411307_49411308insA	uc003cwu.2	-						RHOA_uc010hku.2_Intron	NM_001664	NP_001655			ras homolog gene family, member A precursor						axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
BSN	8927	broad.mit.edu	37	3	49708804	49708807	+	3'UTR	DEL	CAAA	-	-	rs35637631		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49708804_49708807delCAAA	uc003cxe.3	+	12					APEH_uc010hkw.1_5'Flank|APEH_uc003cxf.2_5'Flank	NM_003458	NP_003449			bassoon protein						synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
IP6K1	9807	broad.mit.edu	37	3	49770690	49770692	+	Intron	DEL	AAA	-	-	rs35825980		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49770690_49770692delAAA	uc003cxm.1	-						IP6K1_uc003cxn.1_Intron|IP6K1_uc011bcv.1_Intron|IP6K1_uc003cxo.2_Intron	NM_153273	NP_695005			inositol hexakisphosphate kinase 1 isoform 1						phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0																		---	---	---	---
CDHR4	389118	broad.mit.edu	37	3	49839614	49839615	+	5'Flank	INS	-	T	T	rs146977980	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49839614_49839615insT	uc010hkz.2	-						CDHR4_uc003cxp.2_5'Flank|CDHR4_uc011bcw.1_5'Flank|C3orf54_uc003cxq.1_5'Flank	NM_001007540	NP_001007541			cadherin-like 29 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
MON1A	84315	broad.mit.edu	37	3	49948641	49948641	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49948641delA	uc003cxz.2	-						MON1A_uc003cya.2_Intron|MON1A_uc003cyb.2_Intron	NM_032355	NP_115731			MON1 homolog A isoform a								protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	51563533	51563533	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51563533delT								VPRBP (29532 upstream) : RAD54L2 (12063 downstream)																																			---	---	---	---
RAD54L2	23132	broad.mit.edu	37	3	51616604	51616604	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51616604delT	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron	NM_015106	NP_055921			RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	54071353	54071353	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54071353delC								SELK (145364 upstream) : CACNA2D3 (85340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	54089539	54089540	+	IGR	INS	-	T	T	rs146817956	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54089539_54089540insT								SELK (163550 upstream) : CACNA2D3 (67153 downstream)																																			---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54930317	54930317	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54930317delT	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|uc003dhk.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
ARF4	378	broad.mit.edu	37	3	57577199	57577199	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57577199delT	uc003dix.3	-						ARF4_uc003diy.3_Intron|ARF4_uc010hnd.2_Intron|ARF4_uc003diz.3_Intron	NM_001660	NP_001651			ADP-ribosylation factor 4						protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0449)|Kidney(284;0.0561)														---	---	---	---
SLMAP	7871	broad.mit.edu	37	3	57799689	57799689	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57799689delT	uc003dje.1	+						SLMAP_uc003djc.1_Intron|SLMAP_uc003djd.1_Intron|SLMAP_uc003djf.1_Intron	NM_007159	NP_009090			sarcolemma associated protein						muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	59562255	59562255	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59562255delC								C3orf67 (526497 upstream) : FHIT (172783 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60674159	60674160	+	Intron	INS	-	T	T	rs6795921		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60674159_60674160insT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61559704	61559704	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61559704delT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc003dla.3_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
C3orf14	57415	broad.mit.edu	37	3	62309900	62309900	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62309900delA	uc003dlf.2	+						C3orf14_uc010hnq.2_Intron|C3orf14_uc003dlg.2_Intron	NM_020685	NP_065736			hypothetical protein LOC57415											central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64856947	64856948	+	Intron	INS	-	T	T	rs144740910	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64856947_64856948insT	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65575513	65575513	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65575513delA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
C3orf64	285203	broad.mit.edu	37	3	69059101	69059101	+	Intron	DEL	C	-	-	rs66939647		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69059101delC	uc003dnl.2	-						C3orf64_uc003dnk.2_Intron|C3orf64_uc011bfw.1_Intron|C3orf64_uc003dnm.1_Intron	NM_173654	NP_775925			AER61 glycosyltransferase							extracellular region	transferase activity, transferring glycosyl groups			ovary(1)	1		Lung NSC(201;0.126)		BRCA - Breast invasive adenocarcinoma(55;4.61e-05)|Epithelial(33;0.000291)|LUSC - Lung squamous cell carcinoma(21;0.0127)|KIRC - Kidney renal clear cell carcinoma(39;0.216)														---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71255770	71255770	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71255770delA	uc003dol.2	-						FOXP1_uc003dom.2_Intron|FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003dop.2_Intron|FOXP1_uc003doq.1_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71372124	71372124	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71372124delT	uc003dop.2	-						FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003doq.1_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	3	75510803	75510804	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75510803_75510804delAG								FAM86D (26537 upstream) : MIR1324 (169110 downstream)																																			---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75803458	75803458	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75803458delA	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695			zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75805352	75805352	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75805352delG	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695			zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	76942462	76942463	+	IGR	INS	-	ACAC	ACAC	rs147788647	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76942462_76942463insACAC								None (None upstream) : ROBO2 (146831 downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77265366	77265366	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77265366delG	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77359135	77359138	+	Intron	DEL	AGAC	-	-	rs71824819		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77359135_77359138delAGAC	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	78399179	78399180	+	IGR	INS	-	T	T	rs150344530	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78399179_78399180insT								ROBO2 (702518 upstream) : ROBO1 (247208 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	78437908	78437908	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78437908delA								ROBO2 (741247 upstream) : ROBO1 (208480 downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	79791642	79791643	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79791642_79791643delCT	uc003dqe.2	-							NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	79820934	79820935	+	IGR	DEL	TC	-	-	rs67424736		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79820934_79820935delTC								ROBO1 (3875 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80856732	80856733	+	IGR	INS	-	AAC	AAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80856732_80856733insAAC								None (None upstream) : GBE1 (682117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82201548	82201548	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82201548delA	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	82829227	82829230	+	IGR	DEL	AACT	-	-	rs71616435		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82829227_82829230delAACT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	83572549	83572549	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83572549delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	86297756	86297757	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86297756_86297757insA								CADM2 (179808 upstream) : VGLL3 (689368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87788751	87788752	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87788751_87788752delCT								POU1F1 (463014 upstream) : HTR1F (242974 downstream)																																			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89471343	89471344	+	Intron	DEL	AC	-	-	rs139628568		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89471343_89471344delAC	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
LOC255025	255025	broad.mit.edu	37	3	94785712	94785712	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94785712delA	uc003drn.2	+											Homo sapiens hypothetical protein LOC255025, mRNA (cDNA clone IMAGE:5267157).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	95711155	95711155	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95711155delC								LOC255025 (816076 upstream) : EPHA6 (822270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95816911	95816912	+	IGR	DEL	TA	-	-	rs149951540		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95816911_95816912delTA								LOC255025 (921832 upstream) : EPHA6 (716513 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96611828	96611829	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96611828_96611829delGT	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	98863807	98863808	+	IGR	INS	-	TGTA	TGTA	rs150458604	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98863807_98863808insTGTA								DCBLD2 (243274 upstream) : COL8A1 (493646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99230101	99230101	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99230101delT								DCBLD2 (609568 upstream) : COL8A1 (127353 downstream)																																			---	---	---	---
COL8A1	1295	broad.mit.edu	37	3	99500974	99500975	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99500974_99500975insA	uc003dtg.1	+						COL8A1_uc003dth.1_Intron|COL8A1_uc003dti.1_Intron	NM_001850	NP_001841			alpha 1 type VIII collagen precursor						angiogenesis|cell adhesion	basement membrane|collagen type VIII					0																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100700087	100700088	+	Intron	INS	-	A	A	rs145114286		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100700087_100700088insA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244			ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	103018000	103018000	+	IGR	DEL	T	-	-	rs67874551		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103018000delT								ZPLD1 (819315 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103170621	103170621	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103170621delT								ZPLD1 (971936 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103739772	103739773	+	IGR	INS	-	AAAA	AAAA	rs144129753		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103739772_103739773insAAAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103903226	103903233	+	IGR	DEL	GCACTCCA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103903226_103903233delGCACTCCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104631053	104631053	+	IGR	DEL	T	-	-	rs141472820		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104631053delT								None (None upstream) : ALCAM (454660 downstream)																																			---	---	---	---
CBLB	868	broad.mit.edu	37	3	105396195	105396195	+	Intron	DEL	A	-	-	rs76235246		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105396195delA	uc003dwc.2	-						CBLB_uc003dwa.2_Intron|CBLB_uc011bhi.1_Intron	NM_170662	NP_733762			Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9								Mis S		AML								---	---	---	---
Unknown	0	broad.mit.edu	37	3	106154523	106154526	+	IGR	DEL	AGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106154523_106154526delAGAA								CBLB (566257 upstream) : LOC100302640 (401134 downstream)																																			---	---	---	---
GUCA1C	9626	broad.mit.edu	37	3	108671714	108671714	+	Intron	DEL	T	-	-	rs3842574		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108671714delT	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450			guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	109246622	109246622	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109246622delT								FLJ25363 (32608 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110513578	110513579	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110513578_110513579insA								None (None upstream) : PVRL3 (277286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	112142312	112142312	+	IGR	DEL	G	-	-	rs139055529	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112142312delG								CD200 (60656 upstream) : BTLA (40503 downstream)																																			---	---	---	---
BTLA	151888	broad.mit.edu	37	3	112210973	112210973	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112210973delC	uc003dza.3	-						BTLA_uc003dzb.3_Intron	NM_181780	NP_861445			B and T lymphocyte associated isoform 1						T cell costimulation		receptor activity				0		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)																---	---	---	---
Unknown	0	broad.mit.edu	37	3	112892065	112892066	+	IGR	INS	-	GGAA	GGAA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112892065_112892066insGGAA								C3orf17 (153510 upstream) : BOC (38346 downstream)																																			---	---	---	---
ZBTB20	26137	broad.mit.edu	37	3	114276318	114276318	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114276318delA	uc003ebj.2	-						ZBTB20_uc010hqp.2_Intron|ZBTB20_uc003ebk.2_Intron|ZBTB20_uc003ebl.2_Intron|ZBTB20_uc003ebm.2_Intron|ZBTB20_uc003ebn.2_Intron	NM_015642	NP_056457			zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	115129665	115129672	+	IGR	DEL	TGTGTGTG	-	-	rs71744093		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115129665_115129672delTGTGTGTG								ZBTB20 (263538 upstream) : GAP43 (212479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116946060	116946061	+	IGR	INS	-	GT	GT	rs73148832		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116946060_116946061insGT								LOC285194 (510175 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117690908	117690910	+	IGR	DEL	GTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117690908_117690910delGTG								None (None upstream) : IGSF11 (928571 downstream)																																			---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118744314	118744315	+	Intron	INS	-	G	G	rs147944443	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118744314_118744315insG	uc003ebw.2	-						IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Intron|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_001015887	NP_001015887			immunoglobulin superfamily, member 11 isoform b						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	120106298	120106299	+	IGR	DEL	AA	-	-	rs71873289		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120106298_120106299delAA								LRRC58 (38112 upstream) : FSTL1 (6763 downstream)																																			---	---	---	---
EAF2	55840	broad.mit.edu	37	3	121582992	121582992	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121582992delT	uc003een.2	+						EAF2_uc003eeo.2_Intron	NM_018456	NP_060926			ELL associated factor 2						apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	protein binding				0				GBM - Glioblastoma multiforme(114;0.0972)														---	---	---	---
SLC12A8	84561	broad.mit.edu	37	3	124882442	124882443	+	Intron	INS	-	A	A	rs76490903		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124882442_124882443insA	uc003ehv.3	-						SLC12A8_uc003ehw.3_Intron|SLC12A8_uc010hrz.1_Intron	NM_024628	NP_078904			solute carrier family 12, member 8						potassium ion transport	integral to membrane	symporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125446528	125446528	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125446528delT								OSBPL11 (132147 upstream) : MIR548I1 (62719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125502724	125502724	+	IGR	DEL	C	-	-	rs60485712		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125502724delC								OSBPL11 (188343 upstream) : MIR548I1 (6523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	126418528	126418528	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126418528delT								TXNRD3IT1 (44583 upstream) : CHCHD6 (4590 downstream)																																			---	---	---	---
KBTBD12	166348	broad.mit.edu	37	3	127637555	127637555	+	Intron	DEL	A	-	-	rs74874378		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127637555delA	uc003ejy.3	+						KBTBD12_uc010hsq.2_Intron	NM_207335	NP_997218			kelch domain containing 6											ovary(1)	1																		---	---	---	---
KIAA1257	57501	broad.mit.edu	37	3	128686922	128686922	+	Intron	DEL	A	-	-	rs143470431		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128686922delA	uc003elh.1	-						KIAA1257_uc003elg.1_Intron					RecName: Full=Uncharacterized protein FLJ43738;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	128802092	128802092	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128802092delA								GP9 (20839 upstream) : RAB43 (4326 downstream)																																			---	---	---	---
IFT122	55764	broad.mit.edu	37	3	129232729	129232730	+	Intron	INS	-	AGGCG	AGGCG	rs138345439		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129232729_129232730insAGGCG	uc003emm.2	+						IFT122_uc003eml.2_Intron|IFT122_uc003emn.2_Intron|IFT122_uc003emo.2_Intron|IFT122_uc003emp.2_Intron|IFT122_uc010htc.2_Intron|IFT122_uc011bky.1_Intron|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_Intron|IFT122_uc011bla.1_Intron|IFT122_uc010hte.2_Intron|IFT122_uc003ems.2_Intron	NM_052989	NP_443715			WD repeat domain 10 isoform 2						camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2																		---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129585951	129585951	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129585951delA	uc003emz.3	-						TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
ATP2C1	27032	broad.mit.edu	37	3	130614412	130614413	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130614412_130614413insT	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron	NM_014382	NP_055197			calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)									Hailey-Hailey_disease				---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131869449	131869450	+	Intron	INS	-	G	G	rs71963280		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131869449_131869450insG	uc003eom.2	-							NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
ACPP	55	broad.mit.edu	37	3	132068579	132068579	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132068579delA	uc010htp.2	+						ACPP_uc003eon.3_Intron|ACPP_uc003eop.3_Intron	NM_001099	NP_001090			acid phosphatase, prostate short isoform							extracellular region|lysosomal membrane	5'-nucleotidase activity|acid phosphatase activity			ovary(1)	1																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133067519	133067520	+	Intron	INS	-	AG	AG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133067519_133067520insAG	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_Intron|TMEM108_uc003epk.2_Intron	NM_023943	NP_076432			transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
BFSP2	8419	broad.mit.edu	37	3	133147179	133147179	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133147179delG	uc003epn.1	+							NM_003571	NP_003562			phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0																		---	---	---	---
RAB6B	51560	broad.mit.edu	37	3	133602422	133602423	+	Intron	INS	-	A	A	rs142202445	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133602422_133602423insA	uc003epy.2	-						RAB6B_uc011blu.1_Intron	NM_016577	NP_057661			RAB6B, member RAS oncogene family						protein transport|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle|Golgi membrane	GTP binding|GTPase activity|protein binding			pancreas(1)	1																		---	---	---	---
SLCO2A1	6578	broad.mit.edu	37	3	133684610	133684611	+	Intron	INS	-	TGGGCCCAGGCAGCT	TGGGCCCAGGCAGCT	rs150954866	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133684610_133684611insTGGGCCCAGGCAGCT	uc003eqa.3	-						SLCO2A1_uc003eqb.3_Intron|SLCO2A1_uc011blv.1_Intron|SLCO2A1_uc010htw.1_Intron	NM_005630	NP_005621			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134311122	134311122	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134311122delA								CEP63 (17270 upstream) : KY (7645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	135105819	135105824	+	IGR	DEL	AAAAAA	-	-	rs72225860		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135105819_135105824delAAAAAA								EPHB1 (126514 upstream) : PPP2R3A (578743 downstream)																																			---	---	---	---
MSL2	55167	broad.mit.edu	37	3	135877330	135877330	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135877330delA	uc003eqx.1	-						MSL2_uc011bmb.1_Intron	NM_018133	NP_060603			ring finger protein 184 isoform 1						histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	136855811	136855811	+	IGR	DEL	A	-	-	rs78220860		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136855811delA								IL20RB (125891 upstream) : SOX14 (627768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	138645329	138645330	+	IGR	DEL	CA	-	-	rs111692398		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138645329_138645330delCA								PIK3CB (167144 upstream) : FOXL2 (17737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139199005	139199005	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139199005delT								RBP2 (3653 upstream) : RBP1 (37271 downstream)																																			---	---	---	---
NMNAT3	349565	broad.mit.edu	37	3	139296843	139296844	+	Intron	INS	-	G	G	rs149621754	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139296843_139296844insG	uc003etj.2	-						NMNAT3_uc003etk.2_Intron|NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	139474763	139474763	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139474763delT								NMNAT3 (77923 upstream) : CLSTN2 (179264 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	139510154	139510154	+	IGR	DEL	G	-	-	rs79198315		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139510154delG								NMNAT3 (113314 upstream) : CLSTN2 (143873 downstream)																																			---	---	---	---
XRN1	54464	broad.mit.edu	37	3	142162283	142162286	+	Intron	DEL	ATCA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142162283_142162286delATCA	uc003eus.2	-						XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron|XRN1_uc003euw.2_Intron|XRN1_uc011bnh.1_Intron	NM_019001	NP_061874			5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3																		---	---	---	---
TRPC1	7220	broad.mit.edu	37	3	142462309	142462310	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142462309_142462310insT	uc003evc.2	+						TRPC1_uc003evb.2_Intron	NM_003304	NP_003295			transient receptor potential cation channel,						axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	142896965	142896965	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142896965delC								CHST2 (55155 upstream) : SLC9A9 (87100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	143626961	143626962	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143626961_143626962delTT								SLC9A9 (59615 upstream) : C3orf58 (63678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145066365	145066365	+	IGR	DEL	C	-	-	rs35617678		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145066365delC								None (None upstream) : PLOD2 (720863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145115049	145115050	+	IGR	INS	-	CTC	CTC	rs150856982	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145115049_145115050insCTC								None (None upstream) : PLOD2 (672178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145135545	145135546	+	IGR	INS	-	T	T	rs142190484	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145135545_145135546insT								None (None upstream) : PLOD2 (651682 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147408467	147408471	+	IGR	DEL	TCCCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147408467_147408471delTCCCT								ZIC1 (273963 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148336715	148336716	+	IGR	INS	-	A	A	rs150001781		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148336715_148336716insA								None (None upstream) : AGTR1 (78942 downstream)																																			---	---	---	---
AGTR1	185	broad.mit.edu	37	3	148453363	148453363	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148453363delA	uc003ewg.2	+						AGTR1_uc003ewh.2_Intron|AGTR1_uc003ewi.2_Intron|AGTR1_uc003ewj.2_Intron|AGTR1_uc003ewk.2_Intron	NM_031850	NP_114038			angiotensin II receptor, type 1						calcium-mediated signaling|cell chemotaxis|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|kidney development|low-density lipoprotein particle remodeling|positive regulation of cellular protein metabolic process|positive regulation of cholesterol esterification|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of phospholipase A2 activity|positive regulation of reactive oxygen species metabolic process|regulation of cell growth|regulation of cell proliferation|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|Rho protein signal transduction		acetyltransferase activator activity|angiotensin type I receptor activity|angiotensin type II receptor activity|bradykinin receptor binding|protein heterodimerization activity				0			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Spironolactone(DB00421)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	149963012	149963013	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149963012_149963013delTG								PFN2 (274271 upstream) : TSC22D2 (163775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	150066461	150066462	+	IGR	DEL	GC	-	-	rs71990674		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150066461_150066462delGC								PFN2 (377720 upstream) : TSC22D2 (60326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153140023	153140023	+	IGR	DEL	T	-	-	rs138276372		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153140023delT								RAP2B (253762 upstream) : C3orf79 (62261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153360097	153360098	+	IGR	INS	-	AAGTT	AAGTT	rs143827553	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153360097_153360098insAAGTT								C3orf79 (139614 upstream) : SGEF (479051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153838757	153838759	+	Intron	DEL	ACC	-	-	rs150359298		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153838757_153838759delACC	uc003ezu.1	-						SGEF_uc011bog.1_5'Flank|SGEF_uc011boh.1_5'Flank					Homo sapiens cDNA clone IMAGE:4823793.																														---	---	---	---
GPR149	344758	broad.mit.edu	37	3	154149867	154149868	+	5'Flank	INS	-	AGAG	AGAG	rs139624912	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154149867_154149868insAGAG	uc003faa.2	-							NM_001038705	NP_001033794			G protein-coupled receptor 149							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	156442432	156442432	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156442432delA								TIPARP (17903 upstream) : PA2G4P4 (84628 downstream)																																			---	---	---	---
VEPH1	79674	broad.mit.edu	37	3	157173650	157173651	+	Intron	INS	-	AA	AA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157173650_157173651insAA	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897			ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	157319078	157319078	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157319078delA								C3orf55 (59 upstream) : SHOX2 (494723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	157633712	157633715	+	IGR	DEL	ACAC	-	-	rs66738130		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157633712_157633715delACAC								C3orf55 (314693 upstream) : SHOX2 (180086 downstream)																																			---	---	---	---
RSRC1	51319	broad.mit.edu	37	3	157946676	157946677	+	Intron	INS	-	T	T	rs149320397	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157946676_157946677insT	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709			arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	158500488	158500488	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158500488delT								RARRES1 (50213 upstream) : MFSD1 (19424 downstream)																																			---	---	---	---
TRIM59	286827	broad.mit.edu	37	3	160167841	160167841	+	5'Flank	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160167841delG	uc003fdm.2	-						IFT80_uc003fda.2_5'Flank	NM_173084	NP_775107			tripartite motif-containing 59							integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	162433479	162433480	+	IGR	INS	-	G	G	rs143576783	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162433479_162433480insG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	163728264	163728265	+	IGR	INS	-	AA	AA	rs112806960		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163728264_163728265insAA								None (None upstream) : MIR1263 (160994 downstream)																																			---	---	---	---
SLITRK3	22865	broad.mit.edu	37	3	164910769	164910769	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164910769delA	uc003fej.3	-						SLITRK3_uc003fek.2_Intron	NM_014926	NP_055741			slit and trk like 3 protein precursor							integral to membrane				ovary(6)|skin(3)|pancreas(1)	10															HNSCC(40;0.11)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165133200	165133200	+	IGR	DEL	C	-	-	rs57235786		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165133200delC								SLITRK3 (218731 upstream) : BCHE (357494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165973705	165973708	+	IGR	DEL	AGAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165973705_165973708delAGAG								BCHE (418452 upstream) : ZBBX (984373 downstream)																																			---	---	---	---
TNIK	23043	broad.mit.edu	37	3	171006597	171006597	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171006597delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	171197071	171197071	+	IGR	DEL	C	-	-	rs78675539		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171197071delC								TNIK (18874 upstream) : PLD1 (121549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	171278935	171278936	+	IGR	INS	-	T	T	rs141911739	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171278935_171278936insT								TNIK (100738 upstream) : PLD1 (39684 downstream)																																			---	---	---	---
SPATA16	83893	broad.mit.edu	37	3	172738096	172738097	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172738096_172738097insC	uc003fin.3	-							NM_031955	NP_114161			spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	173023411	173023412	+	IGR	INS	-	T	T	rs11426638		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173023411_173023412insT								SPATA16 (164379 upstream) : NLGN1 (92832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	178717361	178717361	+	IGR	DEL	C	-	-	rs11362575		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178717361delC								KCNMB2 (155145 upstream) : ZMAT3 (24166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	179248330	179248330	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179248330delA								GNB4 (78959 upstream) : ACTL6A (32378 downstream)																																			---	---	---	---
FXR1	8087	broad.mit.edu	37	3	180692624	180692625	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180692624_180692625insA	uc003fkq.2	+						FXR1_uc003fkp.2_Intron|FXR1_uc003fkr.2_Intron|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_Intron|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Intron	NM_005087	NP_005078			fragile X mental retardation-related protein 1						apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	181692690	181692690	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181692690delA	uc003fky.2	+											Homo sapiens cDNA clone IMAGE:5296886.																														---	---	---	---
MCCC1	56922	broad.mit.edu	37	3	182830284	182830284	+	Intron	DEL	T	-	-	rs144985519		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182830284delT	uc003flg.2	-											RecName: Full=Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial;          Short=MCCase subunit alpha;          EC=6.4.1.4; AltName: Full=3-methylcrotonyl-CoA carboxylase 1; AltName: Full=3-methylcrotonyl-CoA:carbon dioxide ligase subunit alpha; AltName: Full=3-methylcrotonyl-CoA carboxylase biotin-containing subunit; Flags: Precursor;						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---
MCF2L2	23101	broad.mit.edu	37	3	183027054	183027055	+	Intron	INS	-	T	T	rs113865609		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183027054_183027055insT	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc003flp.1_Intron	NM_015078	NP_055893			Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)															---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183697133	183697133	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183697133delA	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679			ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	184325382	184325382	+	IGR	DEL	T	-	-	rs66609461		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184325382delT								EPHB3 (25187 upstream) : MAGEF1 (102774 downstream)																																			---	---	---	---
VPS8	23355	broad.mit.edu	37	3	184542693	184542694	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184542693_184542694insTT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc003fpc.1_Intron	NM_015303	NP_056118			vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)															---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185957689	185957689	+	Intron	DEL	T	-	-	rs11293906		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185957689delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	186195568	186195569	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186195568_186195569insT	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	186534038	186534040	+	IGR	DEL	AAA	-	-	rs74727735		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186534038_186534040delAAA								RFC4 (9554 upstream) : ADIPOQ (26423 downstream)																																			---	---	---	---
RPL39L	116832	broad.mit.edu	37	3	186855610	186855610	+	Intron	DEL	A	-	-	rs112518388		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186855610delA	uc003fre.1	-						RPL39L_uc003frf.1_Intron	NM_052969	NP_443201			ribosomal protein L39-like protein						spermatogenesis|translation	cytosolic large ribosomal subunit	structural constituent of ribosome				0	all_cancers(143;2.61e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.87e-18)	GBM - Glioblastoma multiforme(93;0.0745)														---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	188945294	188945295	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188945294_188945295insT	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
IL1RAP	3556	broad.mit.edu	37	3	190317279	190317279	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190317279delT	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173			interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	191191912	191191913	+	IGR	INS	-	C	C	rs66746024		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191191912_191191913insC								PYDC2 (12669 upstream) : FGF12 (667771 downstream)																																			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192039285	192039285	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192039285delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360			fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193724785	193724785	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193724785delT								LOC100128023 (12758 upstream) : HES1 (129149 downstream)																																			---	---	---	---
ATP13A3	79572	broad.mit.edu	37	3	194138714	194138715	+	Intron	INS	-	AGGG	AGGG	rs59305126	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194138714_194138715insAGGG	uc003fty.3	-						ATP13A3_uc003ftx.3_Intron	NM_024524	NP_078800			ATPase type 13A3						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195331277	195331278	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195331277_195331278delTG								APOD (20201 upstream) : SDHAP2 (53632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195369820	195369820	+	IGR	DEL	G	-	-	rs71242206		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195369820delG								APOD (58744 upstream) : SDHAP2 (15090 downstream)																																			---	---	---	---
MUC20	200958	broad.mit.edu	37	3	195447642	195447642	+	5'Flank	DEL	G	-	-	rs11185521		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195447642delG	uc010hzo.2	+							NM_152673	NP_689886			mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195543990	195543990	+	IGR	DEL	C	-	-	rs63424961		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195543990delC								MUC4 (4842 upstream) : TNK2 (46246 downstream)																																			---	---	---	---
SDHAP1	255812	broad.mit.edu	37	3	195689455	195689456	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195689455_195689456insC	uc003fvx.3	-							NR_003264				Homo sapiens full length insert cDNA clone ZC24D06.												0																		---	---	---	---
SDHAP1	255812	broad.mit.edu	37	3	195714613	195714614	+	Intron	INS	-	A	A	rs139057401		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195714613_195714614insA	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	195736433	195736433	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195736433delT								SDHAP1 (19283 upstream) : TFRC (39723 downstream)																																			---	---	---	---
PCYT1A	5130	broad.mit.edu	37	3	195994994	195994994	+	Intron	DEL	T	-	-	rs112248235		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195994994delT	uc003fwg.2	-						PCYT1A_uc003fwh.2_Intron	NM_005017	NP_005008			choline phosphate cytidylyltransferase 1 alpha							cytosol|soluble fraction	choline-phosphate cytidylyltransferase activity				0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)													---	---	---	---
DLG1	1739	broad.mit.edu	37	3	196870134	196870135	+	Intron	INS	-	T	T	rs147407279	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196870134_196870135insT	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron|DLG1_uc010ian.2_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	27530	27530	+	IGR	DEL	T	-	-	rs113321029		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27530delT								None (None upstream) : ZNF595 (25697 downstream)																																			---	---	---	---
ZNF721	170960	broad.mit.edu	37	4	487973	487973	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:487973delT	uc003gag.2	-						ZNF721_uc010ibe.2_Intron|ZNF721_uc003gah.1_Intron	NM_133474	NP_597731			zinc finger protein 721							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	777779	777780	+	IGR	INS	-	T	T	rs71640355		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:777779_777780insT								PCGF3 (13354 upstream) : CPLX1 (966 downstream)																																			---	---	---	---
LETM1	3954	broad.mit.edu	37	4	1845779	1845779	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1845779delC	uc003gdv.2	-						LETM1_uc011bvg.1_Intron	NM_012318	NP_036450			leucine zipper-EF-hand containing transmembrane						cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)															---	---	---	---
POLN	353497	broad.mit.edu	37	4	2140668	2140668	+	Intron	DEL	T	-	-	rs112436211		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2140668delT	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524			DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
Unknown	0	broad.mit.edu	37	4	2787696	2787696	+	IGR	DEL	T	-	-	rs144948999		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2787696delT								TNIP2 (29593 upstream) : SH3BP2 (7054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3290936	3290937	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3290936_3290937insT								C4orf44 (25097 upstream) : RGS12 (3818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3581736	3581736	+	Intron	DEL	A	-	-	rs68187014		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3581736delA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3779609	3779612	+	IGR	DEL	TTCA	-	-	rs112488147		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3779609_3779612delTTCA								ADRA2C (9358 upstream) : LOC348926 (164058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3924992	3924995	+	IGR	DEL	TAGT	-	-	rs139802695		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3924992_3924995delTAGT								ADRA2C (154741 upstream) : LOC348926 (18675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	4564189	4564190	+	Intron	DEL	TG	-	-	rs71638568		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4564189_4564190delTG	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	4622019	4622020	+	Intron	INS	-	TG	TG	rs145190268	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4622019_4622020insTG	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																														---	---	---	---
STK32B	55351	broad.mit.edu	37	4	5192984	5192984	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5192984delT	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871			serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	6571530	6571532	+	IGR	DEL	AAG	-	-	rs58176017		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6571530_6571532delAAG								PPP2R2C (6203 upstream) : MAN2B2 (5370 downstream)																																			---	---	---	---
MAN2B2	23324	broad.mit.edu	37	4	6617835	6617835	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6617835delT	uc003gjf.1	+						MAN2B2_uc003gje.1_Intron|MAN2B2_uc011bwf.1_Intron	NM_015274	NP_056089			mannosidase, alpha, class 2B, member 2						mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	6630613	6630617	+	IGR	DEL	AGGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6630613_6630617delAGGAA								MAN2B2 (6425 upstream) : MRFAP1 (11201 downstream)																																			---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7526312	7526313	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7526312_7526313insT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7545140	7545143	+	Intron	DEL	ATCT	-	-	rs113154599		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7545140_7545143delATCT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7605030	7605031	+	Intron	DEL	AT	-	-	rs75415549		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7605030_7605031delAT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ABLIM2	84448	broad.mit.edu	37	4	8110930	8110931	+	Intron	DEL	TC	-	-	rs147127339		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8110930_8110931delTC	uc003gko.2	-						ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron|ABLIM2_uc011bwl.1_Intron	NM_001130084	NP_001123556			actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8513452	8513452	+	IGR	DEL	A	-	-	rs111403567		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8513452delA								C4orf23 (18194 upstream) : GPR78 (68839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	9579456	9579456	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9579456delG								MIR548I2 (21519 upstream) : DRD5 (203802 downstream)																																			---	---	---	---
DRD5	1816	broad.mit.edu	37	4	9781363	9781366	+	5'Flank	DEL	TCTC	-	-	rs145087136		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9781363_9781366delTCTC	uc003gmb.3	+							NM_000798	NP_000789			dopamine receptor D5						activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	11199903	11199904	+	IGR	DEL	AC	-	-	rs111718883		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11199903_11199904delAC								CLNK (513517 upstream) : MIR572 (170547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11979369	11979370	+	IGR	INS	-	TT	TT	rs10635240		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11979369_11979370insTT								HS3ST1 (548832 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13871564	13871565	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13871564_13871565delTG	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	14906643	14906644	+	IGR	INS	-	AG	AG	rs150267529	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14906643_14906644insAG								None (None upstream) : CPEB2 (98878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18761443	18761444	+	IGR	DEL	TG	-	-	rs34957760		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18761443_18761444delTG								LCORL (738058 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19775868	19775871	+	IGR	DEL	AAGG	-	-	rs34193568		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19775868_19775871delAAGG								None (None upstream) : SLIT2 (479364 downstream)																																			---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20292379	20292379	+	Intron	DEL	T	-	-	rs34853294		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20292379delT	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778			slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	20649565	20649565	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20649565delA								SLIT2 (28777 upstream) : PACRGL (48340 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20878195	20878195	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20878195delT	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21430947	21430947	+	Intron	DEL	T	-	-	rs144570578		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21430947delT	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	24757954	24757955	+	IGR	INS	-	C	C	rs148230306	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24757954_24757955insC								DHX15 (171770 upstream) : SOD3 (39130 downstream)																																			---	---	---	---
SEPSECS	51091	broad.mit.edu	37	4	25148096	25148097	+	Intron	INS	-	A	A	rs138753452	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25148096_25148097insA	uc003grg.2	-						SEPSECS_uc003gri.2_Intron|SEPSECS_uc003grh.2_Intron	NM_153825	NP_722547			Sep (O-phosphoserine) tRNA:Sec (selenocysteine)						selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	26014232	26014241	+	IGR	DEL	GTGTGTGTGT	-	-	rs36218128		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26014232_26014241delGTGTGTGTGT								C4orf52 (82732 upstream) : RBPJ (307091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26138580	26138581	+	IGR	INS	-	AG	AG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26138580_26138581insAG								C4orf52 (207080 upstream) : RBPJ (182751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26216343	26216344	+	IGR	INS	-	AGAA	AGAA	rs148895739	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26216343_26216344insAGAA								C4orf52 (284843 upstream) : RBPJ (104988 downstream)																																			---	---	---	---
TBC1D19	55296	broad.mit.edu	37	4	26733043	26733043	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26733043delC	uc003gsf.3	+						TBC1D19_uc010iew.2_Intron|TBC1D19_uc011bxu.1_Intron	NM_018317	NP_060787			TBC1 domain family, member 19							intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	28038654	28038654	+	IGR	DEL	G	-	-	rs35440631		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28038654delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30053951	30053952	+	IGR	INS	-	C	C	rs147473099	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30053951_30053952insC								None (None upstream) : PCDH7 (668085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30301437	30301438	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30301437_30301438delTG								None (None upstream) : PCDH7 (420599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31969811	31969811	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31969811delA								PCDH7 (821390 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32260910	32260910	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32260910delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33558454	33558454	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33558454delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33844613	33844613	+	IGR	DEL	T	-	-	rs111960267		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33844613delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	36264714	36264714	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36264714delT	uc003gss.2	+						uc010ifa.1_Intron					Homo sapiens cDNA clone IMAGE:4799398.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	36713900	36713900	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36713900delT								MIR1255B-1 (285850 upstream) : KIAA1239 (532790 downstream)																																			---	---	---	---
C4orf19	55286	broad.mit.edu	37	4	37482920	37482920	+	Intron	DEL	A	-	-	rs71841810		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37482920delA	uc003gsw.3	+							NM_001104629	NP_001098099			hypothetical protein LOC55286												0																		---	---	---	---
C4orf34	201895	broad.mit.edu	37	4	39615946	39615946	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39615946delT	uc003guo.2	-							NM_174921	NP_777581			hypothetical protein LOC201895							integral to membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	40644240	40644247	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40644240_40644247delACACACAC								RBM47 (11600 upstream) : NSUN7 (107667 downstream)																																			---	---	---	---
APBB2	323	broad.mit.edu	37	4	40854662	40854662	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40854662delT	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc003gvk.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	40874804	40874804	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40874804delA	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	41805178	41805178	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41805178delA								PHOX2B (54191 upstream) : TMEM33 (131959 downstream)																																			---	---	---	---
SLC30A9	10463	broad.mit.edu	37	4	42037516	42037517	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42037516_42037517insT	uc003gwl.2	+						SLC30A9_uc011byx.1_Intron	NM_006345	NP_006336			solute carrier family 30 (zinc transporter),						nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
BEND4	389206	broad.mit.edu	37	4	42151745	42151745	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42151745delA	uc003gwn.2	-						BEND4_uc003gwm.2_Intron|BEND4_uc011byy.1_Intron	NM_207406	NP_997289			BEN domain containing 4 isoform a												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	42175162	42175162	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42175162delT								BEND4 (20267 upstream) : SHISA3 (224694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	42731193	42731193	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42731193delT								ATP8A1 (72071 upstream) : GRXCR1 (164091 downstream)																																			---	---	---	---
GRXCR1	389207	broad.mit.edu	37	4	43017130	43017130	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43017130delA	uc003gwt.2	+							NM_001080476	NP_001073945			glutaredoxin, cysteine rich 1						cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	45854062	45854062	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45854062delT								None (None upstream) : GABRG1 (183727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45963469	45963469	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45963469delA								None (None upstream) : GABRG1 (74320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	46028924	46028925	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46028924_46028925insA								None (None upstream) : GABRG1 (8864 downstream)																																			---	---	---	---
CORIN	10699	broad.mit.edu	37	4	47784943	47784943	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47784943delT	uc003gxm.2	-						CORIN_uc011bzf.1_Intron|CORIN_uc011bzg.1_Intron|CORIN_uc011bzh.1_Intron|CORIN_uc011bzi.1_Intron|CORIN_uc003gxn.3_Intron	NM_006587	NP_006578			corin						peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48773794	48773795	+	Intron	INS	-	ATG	ATG	rs146565755	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48773794_48773795insATG	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gym.1_Intron|FRYL_uc003gyn.3_Intron	NM_015030	NP_055845			furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49242061	49242061	+	IGR	DEL	C	-	-	rs61467355		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49242061delC								CWH43 (177968 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49314797	49314798	+	IGR	INS	-	CTT	CTT	rs67463962		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49314797_49314798insCTT								CWH43 (250704 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53032417	53032418	+	IGR	DEL	AT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53032417_53032418delAT								SPATA18 (68960 upstream) : USP46 (424711 downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	53892247	53892249	+	Intron	DEL	AAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53892247_53892249delAAC	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	55338095	55338095	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55338095delT								PDGFRA (173684 upstream) : KIT (186000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56025303	56025304	+	IGR	INS	-	CA	CA	rs143026410	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56025303_56025304insCA								KDR (33541 upstream) : SRD5A3 (187105 downstream)																																			---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57163086	57163087	+	Intron	INS	-	TT	TT	rs5858372		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57163086_57163087insTT	uc003hbk.2	+						KIAA1211_uc010iha.2_Intron	NM_020722	NP_065773			hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	57719288	57719289	+	IGR	INS	-	A	A	rs72166790		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57719288_57719289insA								SPINK2 (31395 upstream) : REST (54753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59138545	59138545	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59138545delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60890348	60890348	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60890348delT								None (None upstream) : None (None downstream)																																			---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62814736	62814736	+	Intron	DEL	A	-	-	rs76714032		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62814736delA	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc003hct.2_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	65592165	65592166	+	IGR	INS	-	TCTTT	TCTTT	rs149552740	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65592165_65592166insTCTTT								TECRL (316987 upstream) : EPHA5 (593116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65961080	65961081	+	IGR	INS	-	A	A	rs148943239		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65961080_65961081insA								TECRL (685902 upstream) : EPHA5 (224201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	69331331	69331332	+	Intron	INS	-	T	T	rs34768803		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69331331_69331332insT	uc003hdz.3	+							NM_014058	NP_054777			transmembrane protease, serine 11E																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	69894362	69894362	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69894362delT								UGT2A3 (76853 upstream) : UGT2B7 (67831 downstream)																																			---	---	---	---
UGT2A1	10941	broad.mit.edu	37	4	70478253	70478256	+	Intron	DEL	AGAT	-	-	rs141676441		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70478253_70478256delAGAT	uc003hem.3	-						UGT2A1_uc011caq.1_Intron|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron|UGT2A1_uc010ihs.2_Intron	NM_006798	NP_006789			UDP glucuronosyltransferase 2 family,						detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	71210694	71210696	+	IGR	DEL	GGG	-	-	rs139784839		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71210694_71210696delGGG								C4orf35 (7862 upstream) : SMR3A (15797 downstream)																																			---	---	---	---
SLC4A4	8671	broad.mit.edu	37	4	72251564	72251564	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72251564delT	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc003hga.2_Intron|SLC4A4_uc003hgb.3_Intron	NM_001098484	NP_001091954			solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)															---	---	---	---
AFM	173	broad.mit.edu	37	4	74363023	74363023	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74363023delA	uc003hhb.2	+							NM_001133	NP_001124			afamin precursor						vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
G3BP2	9908	broad.mit.edu	37	4	76590831	76590840	+	Intron	DEL	ACACAAACAA	-	-	rs67912571		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76590831_76590840delACACAAACAA	uc003hir.2	-						G3BP2_uc003his.2_Intron|G3BP2_uc003hit.2_Intron	NM_012297	NP_036429			Ras-GTPase activating protein SH3 domain-binding						cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78905761	78905762	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78905761_78905762insA								MRPL1 (31817 upstream) : FRAS1 (72962 downstream)																																			---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79363295	79363295	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79363295delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc010ijj.1_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	82612133	82612135	+	IGR	DEL	CTT	-	-	rs142911750		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82612133_82612135delCTT								RASGEF1B (219072 upstream) : HNRNPD (662332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	82754360	82754361	+	IGR	DEL	TT	-	-	rs11341020		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82754360_82754361delTT								RASGEF1B (361299 upstream) : HNRNPD (520106 downstream)																																			---	---	---	---
SCD5	79966	broad.mit.edu	37	4	83590309	83590310	+	Intron	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83590309_83590310delGA	uc003hna.2	-						SCD5_uc003hnb.3_Intron	NM_001037582	NP_001032671			stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	90928921	90928921	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90928921delT								MMRN1 (53143 upstream) : FAM190A (119763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	98393547	98393547	+	IGR	DEL	T	-	-	rs116633888	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98393547delT								None (None upstream) : C4orf37 (86487 downstream)																																			---	---	---	---
MTTP	4547	broad.mit.edu	37	4	100488108	100488108	+	Intron	DEL	T	-	-	rs72137651		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100488108delT	uc003hvc.3	+						MTTP_uc011cej.1_Intron|RG9MTD2_uc003huz.3_5'Flank|RG9MTD2_uc003hva.3_5'Flank	NM_000253	NP_000244			microsomal triglyceride transfer protein large						lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)													---	---	---	---
EMCN	51705	broad.mit.edu	37	4	101369980	101369999	+	Intron	DEL	CCTCCCTCCCTCCCTCCCTC	-	-	rs12644581		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101369980_101369999delCCTCCCTCCCTCCCTCCCTC	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326			endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)														---	---	---	---
DKK2	27123	broad.mit.edu	37	4	108126124	108126125	+	Intron	INS	-	CA	CA	rs146599729	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108126124_108126125insCA	uc010ilw.1	-											Homo sapiens dickkopf-2 mRNA, complete cds.						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	108375660	108375661	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108375660_108375661insT								DKK2 (170814 upstream) : PAPSS1 (159162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	109101587	109101588	+	IGR	INS	-	AAG	AAG	rs145629689	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109101587_109101588insAAG								LEF1 (12009 upstream) : LOC285456 (357758 downstream)																																			---	---	---	---
CCDC109B	55013	broad.mit.edu	37	4	110556848	110556851	+	Intron	DEL	CTTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110556848_110556851delCTTC	uc011cfs.1	+						CCDC109B_uc010imf.2_Intron	NM_017918	NP_060388			coiled-coil domain containing 109B							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111155221	111155222	+	IGR	DEL	AT	-	-	rs57782018		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111155221_111155222delAT								ELOVL6 (35401 upstream) : ENPEP (242007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	112359959	112359959	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112359959delA								MIR297 (578156 upstream) : C4orf32 (706594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116081206	116081229	+	IGR	DEL	ACCCCCACACACACATATATACAC	-	-	rs5861205	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116081206_116081229delACCCCCACACACACATATATACAC								NDST4 (46174 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116687214	116687215	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116687214_116687215delTC								NDST4 (652182 upstream) : MIR1973 (533666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117752137	117752137	+	IGR	DEL	C	-	-	rs58860126	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117752137delC								MIR1973 (531213 upstream) : TRAM1L1 (252579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	125882030	125882030	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125882030delA								ANKRD50 (248143 upstream) : FAT4 (355537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127582925	127582925	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127582925delA								None (None upstream) : INTU (971195 downstream)																																			---	---	---	---
LARP1B	55132	broad.mit.edu	37	4	129061033	129061034	+	Intron	INS	-	TCTG	TCTG	rs139060229	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129061033_129061034insTCTG	uc003iga.2	+						LARP1B_uc003igc.2_Intron|LARP1B_uc003igb.1_Intron	NM_018078	NP_060548			La ribonucleoprotein domain family member 2								RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	129683555	129683556	+	IGR	INS	-	TG	TG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129683555_129683556insTG								PGRMC2 (474607 upstream) : PHF17 (47223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131633238	131633238	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131633238delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	134547678	134547678	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134547678delA								PCDH10 (434947 upstream) : PABPC4L (569813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135068904	135068905	+	IGR	INS	-	TTGT	TTGT	rs142818832	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135068904_135068905insTTGT								PCDH10 (956173 upstream) : PABPC4L (48586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135979396	135979397	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135979396_135979397insT								PABPC4L (856493 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136905690	136905691	+	IGR	INS	-	TT	TT	rs145740199	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136905690_136905691insTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	141718794	141718795	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141718794_141718795insT								TBC1D9 (41323 upstream) : RNF150 (67930 downstream)																																			---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143117628	143117629	+	Intron	INS	-	AG	AG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143117628_143117629insAG	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143361886	143361889	+	Intron	DEL	AAAT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143361886_143361889delAAAT	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc003iiz.2_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
GYPA	2993	broad.mit.edu	37	4	144979488	144979495	+	Intron	DEL	CTTCCTTT	-	-	rs149068280		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144979488_144979495delCTTCCTTT	uc003ijn.2	-											SubName: Full=Glycophorin MiX; Flags: Fragment;						interspecies interaction between organisms	membrane fraction	receptor activity			central_nervous_system(2)	2	all_hematologic(180;0.15)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	146249499	146249500	+	IGR	INS	-	AGGA	AGGA	rs71915350		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146249499_146249500insAGGA								OTUD4 (148667 upstream) : SMAD1 (153451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	147894555	147894556	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147894555_147894556delCA								TTC29 (27521 upstream) : MIR548G (371225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	149586998	149586998	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149586998delT								NR3C2 (223355 upstream) : None (None downstream)																																			---	---	---	---
DCLK2	166614	broad.mit.edu	37	4	151012920	151012929	+	Intron	DEL	TATGTGTGTG	-	-	rs62339910	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151012920_151012929delTATGTGTGTG	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350			doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)																	---	---	---	---
LRBA	987	broad.mit.edu	37	4	151726437	151726438	+	Intron	INS	-	AAGGA	AAGGA	rs56007287		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151726437_151726438insAAGGA	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	152277333	152277333	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152277333delG								PRSS48 (64730 upstream) : FAM160A1 (53065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	153476383	153476384	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153476383_153476384delTT								FBXW7 (20040 upstream) : TMEM154 (70887 downstream)																																			---	---	---	---
RNF175	285533	broad.mit.edu	37	4	154661318	154661319	+	Intron	INS	-	T	T	rs147266829	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154661318_154661319insT	uc003int.2	-						RNF175_uc003inu.1_Intron	NM_173662	NP_775933			ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)																---	---	---	---
GUCY1B3	2983	broad.mit.edu	37	4	156689609	156689610	+	Intron	DEL	TT	-	-	rs72216630		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156689609_156689610delTT	uc003ipc.2	+						GUCY1B3_uc011cio.1_Intron|GUCY1B3_uc011cip.1_Intron|GUCY1B3_uc003ipd.2_Intron|GUCY1B3_uc010iqf.2_Intron|GUCY1B3_uc010iqg.2_Intron|GUCY1B3_uc011ciq.1_Intron	NM_000857	NP_000848			guanylate cyclase 1, soluble, beta 3						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble|intracellular membrane-bounded organelle	GTP binding|guanylate cyclase activity|receptor activity				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	161006207	161006208	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs150294703	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161006207_161006208insTGTGTGTGTG								RAPGEF2 (724908 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161597851	161597852	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161597851_161597852delAC								None (None upstream) : FSTL5 (707199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163508130	163508130	+	IGR	DEL	T	-	-	rs62328877		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163508130delT								FSTL5 (422944 upstream) : NAF1 (539730 downstream)																																			---	---	---	---
KLHL2	11275	broad.mit.edu	37	4	166193181	166193181	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166193181delT	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177			kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)														---	---	---	---
KLHL2	11275	broad.mit.edu	37	4	166232962	166232971	+	Intron	DEL	TGTGTGTGTG	-	-	rs35059483		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166232962_166232971delTGTGTGTGTG	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177			kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	171155099	171155099	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171155099delA								AADAT (143727 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	174263395	174263395	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174263395delT								HMGB2 (7800 upstream) : SAP30 (28698 downstream)																																			---	---	---	---
WDR17	116966	broad.mit.edu	37	4	177030475	177030475	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177030475delA	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron	NM_170710	NP_733828			WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	178387187	178387188	+	Intron	INS	-	A	A	rs143338417		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178387187_178387188insA	uc003iux.1	+											Homo sapiens cDNA FLJ37626 fis, clone BRCOC2014748.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	179890090	179890091	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179890090_179890091delGT								LOC285501 (978187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180012742	180012743	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180012742_180012743delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	182120052	182120052	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182120052delC								None (None upstream) : MGC45800 (940107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	182499387	182499388	+	IGR	INS	-	TTTG	TTTG	rs144438230	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182499387_182499388insTTTG								None (None upstream) : MGC45800 (560771 downstream)																																			---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183392781	183392782	+	Intron	DEL	TG	-	-	rs71605064		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183392781_183392782delTG	uc003ivd.1	+							NM_001080477	NP_001073946			odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
WWC2	80014	broad.mit.edu	37	4	184218564	184218564	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184218564delT	uc010irx.2	+						WWC2_uc003ivk.3_Intron|WWC2_uc003ivl.3_Intron|WWC2_uc010iry.2_Intron|WWC2_uc003ivn.3_Intron|WWC2_uc010irz.2_Intron|WWC2_uc003ivo.3_Intron	NM_024949	NP_079225			WW and C2 domain containing 2											ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	185250368	185250368	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185250368delA								ENPP6 (111254 upstream) : IRF2 (58510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	186080534	186080535	+	IGR	INS	-	AAG	AAG	rs146395957	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186080534_186080535insAAG								SLC25A4 (12110 upstream) : KIAA1430 (288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188087573	188087573	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188087573delG								FAT1 (439723 upstream) : ZFP42 (829352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190546312	190546313	+	IGR	DEL	TT	-	-	rs137889406		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190546312_190546313delTT								None (None upstream) : FRG1 (315661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190573695	190573696	+	IGR	INS	-	A	A	rs146016729		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190573695_190573696insA								None (None upstream) : FRG1 (288278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190577427	190577427	+	IGR	DEL	G	-	-	rs66786338		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190577427delG								None (None upstream) : FRG1 (284547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190614727	190614727	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190614727delA								None (None upstream) : FRG1 (247247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	191033761	191033761	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191033761delA								LOC653545 (23585 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1042227	1042228	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1042227_1042228delGT								NKD2 (3302 upstream) : SLC12A7 (8263 downstream)																																			---	---	---	---
LPCAT1	79888	broad.mit.edu	37	5	1465232	1465235	+	Intron	DEL	CACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1465232_1465235delCACA	uc003jcm.2	-						LPCAT1_uc003jcl.2_Intron	NM_024830	NP_079106			lysophosphatidylcholine acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	2004442	2004442	+	IGR	DEL	C	-	-	rs77944586		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2004442delC								IRX4 (121562 upstream) : IRX2 (741839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2907506	2907538	+	IGR	DEL	CCACCTAAAGGTCAAGGTTGGACAGTGGGATCC	-	-	rs72372822	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2907506_2907538delCCACCTAAAGGTCAAGGTTGGACAGTGGGATCC								C5orf38 (151994 upstream) : IRX1 (688630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4266683	4266684	+	IGR	INS	-	T	T	rs150426527	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4266683_4266684insT								IRX1 (665167 upstream) : LOC340094 (767788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4455202	4455203	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4455202_4455203insT								IRX1 (853686 upstream) : LOC340094 (579269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5566207	5566207	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5566207delA								KIAA0947 (75870 upstream) : FLJ33360 (744347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5720621	5720622	+	IGR	INS	-	T	T	rs34684580		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5720621_5720622insT								KIAA0947 (230284 upstream) : FLJ33360 (589932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6201565	6201566	+	IGR	INS	-	AATGAATG	AATGAATG	rs141256915	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6201565_6201566insAATGAATG								KIAA0947 (711228 upstream) : FLJ33360 (108988 downstream)																																			---	---	---	---
PAPD7	11044	broad.mit.edu	37	5	6731655	6731656	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6731655_6731656insTT	uc003jdx.1	+							NM_006999	NP_008930			DNA polymerase sigma						cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1																		---	---	---	---
PAPD7	11044	broad.mit.edu	37	5	6740705	6740706	+	Intron	DEL	AT	-	-	rs147141960		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6740705_6740706delAT	uc003jdx.1	+						PAPD7_uc011cmn.1_Intron	NM_006999	NP_008930			DNA polymerase sigma						cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	7990042	7990043	+	IGR	DEL	CC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7990042_7990043delCC								MTRR (88809 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	12772367	12772367	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12772367delA	uc003jfb.1	+						uc010itv.1_Intron					Homo sapiens TAG1 mRNA, complete sequence.																														---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14348918	14348919	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14348918_14348919delTG	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	14980317	14980318	+	IGR	DEL	GG	-	-	rs150101890		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14980317_14980318delGG								ANKH (108430 upstream) : FBXL7 (519987 downstream)																																			---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15640641	15640642	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15640641_15640642insT	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	16655048	16655049	+	IGR	INS	-	T	T	rs146720138	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16655048_16655049insT								FAM134B (37930 upstream) : MYO10 (6968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	16977077	16977077	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16977077delA								MYO10 (40692 upstream) : LOC285696 (153060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17104543	17104544	+	IGR	INS	-	T	T	rs111851750		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17104543_17104544insT								MYO10 (168158 upstream) : LOC285696 (25593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18106500	18106501	+	IGR	DEL	TC	-	-	rs113585704		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18106500_18106501delTC								BASP1 (829565 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20102931	20102931	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20102931delA								CDH18 (114624 upstream) : None (None downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21529305	21529305	+	Intron	DEL	C	-	-	rs11477344		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21529305delC	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21566517	21566518	+	Intron	INS	-	AATG	AATG	rs140291614	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21566517_21566518insAATG	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21782797	21782797	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21782797delT	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22229970	22229971	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22229970_22229971delAC	uc003jgk.2	-							NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23824768	23824768	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23824768delA								PRDM9 (296064 upstream) : CDH10 (662442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26336352	26336352	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26336352delT								None (None upstream) : CDH9 (544357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28118776	28118776	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28118776delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29818819	29818820	+	IGR	INS	-	T	T	rs148347333	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29818819_29818820insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30829079	30829079	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30829079delT								None (None upstream) : CDH6 (364717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31133259	31133260	+	IGR	INS	-	A	A	rs11419146		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31133259_31133260insA								None (None upstream) : CDH6 (60536 downstream)																																			---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31498964	31498964	+	Intron	DEL	A	-	-	rs111545757		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31498964delA	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron|RNASEN_uc010iui.1_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31676676	31676676	+	Intron	DEL	T	-	-	rs35311263		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31676676delT	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31903117	31903117	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31903117delA	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
MTMR12	54545	broad.mit.edu	37	5	32236944	32236945	+	Intron	INS	-	A	A	rs111843533		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32236944_32236945insA	uc003jhq.2	-						MTMR12_uc010iuk.2_Intron|MTMR12_uc010iul.2_Intron	NM_001040446	NP_001035536			myotubularin related protein 12							cytoplasm	phosphatase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	34555667	34555668	+	IGR	INS	-	T	T	rs143749881	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34555667_34555668insT								C1QTNF3 (512350 upstream) : RAI14 (100765 downstream)																																			---	---	---	---
PRLR	5618	broad.mit.edu	37	5	35153820	35153821	+	Intron	DEL	AC	-	-	rs111779432		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35153820_35153821delAC	uc003jjm.2	-							NM_000949	NP_000940			prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	36777167	36777168	+	IGR	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36777167_36777168delAA								SLC1A3 (88733 upstream) : NIPBL (99693 downstream)																																			---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	36960530	36960530	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36960530delG	uc003jkl.3	+						NIPBL_uc003jkk.3_Intron|NIPBL_uc003jkm.1_5'Flank	NM_133433	NP_597677			delangin isoform A						brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	38060778	38060778	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38060778delT								GDNF (220996 upstream) : EGFLAM (197755 downstream)																																			---	---	---	---
EGFLAM	133584	broad.mit.edu	37	5	38290679	38290680	+	Intron	INS	-	A	A	rs111734871		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38290679_38290680insA	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616			EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)																	---	---	---	---
GHR	2690	broad.mit.edu	37	5	42575834	42575834	+	Intron	DEL	A	-	-	rs34968925		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42575834delA	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	44266223	44266223	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44266223delA								NNT (560556 upstream) : FGF10 (38874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49880953	49880954	+	IGR	DEL	GC	-	-	rs10454829	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49880953_49880954delGC								EMB (143719 upstream) : PARP8 (80779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52259721	52259721	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52259721delA								ITGA1 (10237 upstream) : ITGA2 (25435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52468201	52468205	+	IGR	DEL	TCCCC	-	-	rs71849855		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52468201_52468205delTCCCC								MOCS2 (62603 upstream) : FST (308390 downstream)																																			---	---	---	---
ANKRD55	79722	broad.mit.edu	37	5	55491975	55491977	+	Intron	DEL	TAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55491975_55491977delTAA	uc003jqu.2	-							NM_024669	NP_078945			ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	56309322	56309323	+	IGR	INS	-	AC	AC	rs5868036		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56309322_56309323insAC								MIER3 (41821 upstream) : GPBP1 (160452 downstream)																																			---	---	---	---
GPBP1	65056	broad.mit.edu	37	5	56487831	56487831	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56487831delT	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron	NM_022913	NP_075064			GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	56619022	56619022	+	IGR	DEL	T	-	-	rs34310088		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56619022delT								GPBP1 (59612 upstream) : ACTBL2 (156822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	57275901	57275902	+	IGR	INS	-	AC	AC	rs34889483		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57275901_57275902insAC								ACTBL2 (497265 upstream) : PLK2 (473910 downstream)																																			---	---	---	---
ELOVL7	79993	broad.mit.edu	37	5	60140665	60140665	+	5'Flank	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60140665delG	uc003jsi.3	-						ELOVL7_uc010iwk.2_5'Flank|ELOVL7_uc003jsj.3_5'Flank	NM_024930	NP_079206			elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)																---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	72954812	72954813	+	Intron	INS	-	CG	CG	rs138151989	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72954812_72954813insCG	uc003kcx.2	+							NM_001080479	NP_001073948			Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73004787	73004787	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73004787delC	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron	NM_001080479	NP_001073948			Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	75625540	75625541	+	IGR	INS	-	T	T	rs140683321	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75625540_75625541insT								SV2C (4124 upstream) : IQGAP2 (73608 downstream)																																			---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75805227	75805227	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75805227delT	uc003kek.2	+							NM_006633	NP_006624			IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)														---	---	---	---
AP3B1	8546	broad.mit.edu	37	5	77386492	77386492	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77386492delA	uc003kfj.2	-							NM_003664	NP_003655			adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)										Hermansky-Pudlak_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	5	77631362	77631362	+	IGR	DEL	A	-	-	rs113875814		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77631362delA								AP3B1 (40834 upstream) : SCAMP1 (24977 downstream)																																			---	---	---	---
ZFYVE16	9765	broad.mit.edu	37	5	79766758	79766759	+	Intron	INS	-	A	A	rs149537448	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79766758_79766759insA	uc003kgr.3	+						ZFYVE16_uc003kgq.3_Intron|ZFYVE16_uc003kgs.3_Intron|ZFYVE16_uc003kgt.3_Intron|ZFYVE16_uc003kgu.3_Intron	NM_001105251	NP_001098721			zinc finger, FYVE domain containing 16						BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)														---	---	---	---
ACOT12	134526	broad.mit.edu	37	5	80631971	80631972	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80631971_80631972insT	uc003khl.3	-						RNU5E_uc011cto.1_Intron	NM_130767	NP_570123			acyl-CoA thioesterase 12						acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)														---	---	---	---
SSBP2	23635	broad.mit.edu	37	5	80726541	80726542	+	Intron	DEL	TG	-	-	rs146545878		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80726541_80726542delTG	uc003kho.2	-						RNU5E_uc011cto.1_Intron|SSBP2_uc010jar.2_Intron|SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578			single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)														---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83255412	83255412	+	Intron	DEL	A	-	-	rs71605884		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83255412delA	uc003kio.1	-						EDIL3_uc003kip.1_Intron	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	88415492	88415493	+	IGR	INS	-	TC	TC	rs144203501	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88415492_88415493insTC								MEF2C (215623 upstream) : None (None downstream)																																			---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90085803	90085803	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90085803delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90156124	90156124	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90156124delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	91334876	91334876	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91334876delA								LOC100129716 (618345 upstream) : None (None downstream)																																			---	---	---	---
C5orf36	285600	broad.mit.edu	37	5	93643283	93643283	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93643283delT	uc011cuk.1	-						C5orf36_uc003kkn.2_Intron	NM_001145678	NP_001139150			hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94736139	94736140	+	Intron	INS	-	AT	AT	rs149085879	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94736139_94736140insAT	uc003kla.1	+						FAM81B_uc010jbe.1_Intron	NM_152548	NP_689761			hypothetical protein LOC153643											ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
GIN1	54826	broad.mit.edu	37	5	102426605	102426606	+	Intron	DEL	AC	-	-	rs72058777		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102426605_102426606delAC	uc003koa.1	-						GIN1_uc003kob.1_Intron|GIN1_uc003koc.1_Intron	NM_017676	NP_060146			zinc finger, H2C2 domain containing						DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	103497617	103497617	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103497617delA								NUDT12 (599127 upstream) : RAB9BP1 (937558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	103631335	103631335	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103631335delA								NUDT12 (732845 upstream) : RAB9BP1 (803840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104770759	104770760	+	IGR	INS	-	TA	TA	rs70993940		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104770759_104770760insTA								RAB9BP1 (334961 upstream) : None (None downstream)																																			---	---	---	---
EFNA5	1946	broad.mit.edu	37	5	106942240	106942247	+	Intron	DEL	ACACACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106942240_106942247delACACACAC	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953			ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
FER	2241	broad.mit.edu	37	5	108368076	108368077	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108368076_108368077insT	uc003kop.1	+						FER_uc011cvg.1_Intron	NM_005246	NP_005237			fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)														---	---	---	---
CAMK4	814	broad.mit.edu	37	5	110799936	110799936	+	Intron	DEL	T	-	-	rs75139287		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110799936delT	uc011cvj.1	+						CAMK4_uc003kpf.2_Intron|CAMK4_uc010jbv.2_Intron	NM_001744	NP_001735			calcium/calmodulin-dependent protein kinase IV						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
MCC	4163	broad.mit.edu	37	5	112637172	112637172	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112637172delA	uc003kql.3	-						MCC_uc003kqk.3_Intron	NM_001085377	NP_001078846			mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	112951965	112951965	+	IGR	DEL	T	-	-	rs78516249		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112951965delT								YTHDC2 (20986 upstream) : KCNN2 (746051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	114416469	114416469	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114416469delT								KCNN2 (584273 upstream) : TRIM36 (43998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	114702963	114702963	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114702963delT								CCDC112 (70505 upstream) : FEM1C (153645 downstream)																																			---	---	---	---
HSD17B4	3295	broad.mit.edu	37	5	118867259	118867260	+	Intron	DEL	GG	-	-	rs112037211		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118867259_118867260delGG	uc003ksj.2	+						HSD17B4_uc011cwg.1_Intron|HSD17B4_uc011cwh.1_Intron|HSD17B4_uc011cwi.1_Intron|HSD17B4_uc003ksk.3_Intron|HSD17B4_uc011cwj.1_Intron|HSD17B4_uc010jcn.1_Intron|HSD17B4_uc010jco.1_Intron	NM_000414	NP_000405			hydroxysteroid (17-beta) dehydrogenase 4						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	123606843	123606846	+	IGR	DEL	GAAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123606843_123606846delGAAG								CSNK1G3 (654381 upstream) : ZNF608 (365764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	124588718	124588718	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124588718delG								ZNF608 (504218 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	126039617	126039618	+	IGR	INS	-	C	C	rs145541228	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126039617_126039618insC								C5orf48 (67643 upstream) : LMNB1 (73215 downstream)																																			---	---	---	---
MARCH3	115123	broad.mit.edu	37	5	126207396	126207399	+	Intron	DEL	CTCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126207396_126207399delCTCT	uc003kuf.2	-							NM_178450	NP_848545			membrane-associated ring finger (C3HC4) 3						endocytosis	cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosome	ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.074)|OV - Ovarian serous cystadenocarcinoma(64;0.0793)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	126620390	126620392	+	IGR	DEL	CTT	-	-	rs5871245		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126620390_126620392delCTT								FLJ44606 (211218 upstream) : MEGF10 (6064 downstream)																																			---	---	---	---
ACSL6	23305	broad.mit.edu	37	5	131144754	131144755	+	Intron	INS	-	CAAA	CAAA	rs150210565	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131144754_131144755insCAAA	uc003kvv.1	-							NM_015256				acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
ACSL6	23305	broad.mit.edu	37	5	131283542	131283542	+	Intron	DEL	A	-	-	rs66577489		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131283542delA	uc003kvv.1	-							NM_015256				acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
AFF4	27125	broad.mit.edu	37	5	132257166	132257167	+	Intron	DEL	TT	-	-	rs142500965		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132257166_132257167delTT	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron	NM_014423	NP_055238			ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
HSPA4	3308	broad.mit.edu	37	5	132426534	132426534	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132426534delT	uc003kyj.2	+							NM_002154	NP_002145			heat shock 70kDa protein 4						cellular chaperone-mediated protein complex assembly|protein import into mitochondrial outer membrane|response to unfolded protein	cytoplasm|nucleus	ATP binding			lung(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132823957	132823958	+	Intron	INS	-	T	T	rs145276006	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132823957_132823958insT	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	133207672	133207679	+	IGR	DEL	AATGCAAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133207672_133207679delAATGCAAA								FSTL4 (259449 upstream) : C5orf15 (83520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133491651	133491651	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133491651delT								TCF7 (7732 upstream) : SKP1 (433 downstream)																																			---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136427890	136427890	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136427890delG	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
KDM3B	51780	broad.mit.edu	37	5	137689859	137689860	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137689859_137689860insT	uc003lcy.1	+							NM_016604	NP_057688			jumonji domain containing 1B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(3)|upper_aerodigestive_tract(2)|lung(2)|kidney(2)|central_nervous_system(1)|skin(1)	11																		---	---	---	---
NRG2	9542	broad.mit.edu	37	5	139361858	139361858	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139361858delC	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874			neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	139457208	139457209	+	IGR	INS	-	A	A	rs113497505		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139457208_139457209insA								NRG2 (34329 upstream) : PURA (36499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	139985717	139985718	+	IGR	INS	-	CCTT	CCTT	rs144844453	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139985717_139985718insCCTT								SLC35A4 (37034 upstream) : CD14 (25599 downstream)																																			---	---	---	---
PCDH1	5097	broad.mit.edu	37	5	141245443	141245446	+	Intron	DEL	GCAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141245443_141245446delGCAC	uc003llq.2	-						PCDH1_uc003llp.2_Intron|PCDH1_uc011dbf.1_Intron	NM_002587	NP_002578			protocadherin 1 isoform 1 precursor						cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	141810074	141810075	+	IGR	INS	-	GTTTGTTT	GTTTGTTT	rs143916974	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141810074_141810075insGTTTGTTT								SPRY4 (105454 upstream) : FGF1 (161669 downstream)																																			---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142212790	142212791	+	Intron	INS	-	TG	TG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142212790_142212791insTG	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142419183	142419184	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142419183_142419184insA	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146044080	146044081	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146044080_146044081insT	uc003loe.2	-						PPP2R2B_uc010jgm.2_Intron|PPP2R2B_uc003log.3_Intron|PPP2R2B_uc003lof.3_Intron|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
STK32A	202374	broad.mit.edu	37	5	146746634	146746635	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146746634_146746635insT	uc010jgn.1	+						STK32A_uc003lom.2_Intron|STK32A_uc011dbw.1_Intron	NM_001112724	NP_001106195			serine/threonine kinase 32A isoform 1								ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	148863229	148863229	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148863229delA								LOC728264 (50830 upstream) : CSNK1A1 (9720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	149106554	149106555	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149106554_149106555insT								ARHGEF37 (92027 upstream) : PPARGC1B (3309 downstream)																																			---	---	---	---
PPARGC1B	133522	broad.mit.edu	37	5	149133874	149133874	+	Intron	DEL	G	-	-	rs78753619		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149133874delG	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Intron|PPARGC1B_uc003lrd.2_Intron	NM_133263	NP_573570			peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	149725812	149725813	+	IGR	INS	-	TGTG	TGTG	rs146817304	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149725812_149725813insTGTG								ARSI (43287 upstream) : TCOF1 (11389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	150393291	150393291	+	IGR	DEL	A	-	-	rs71787924		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150393291delA								LOC134466 (67145 upstream) : GPX3 (6708 downstream)																																			---	---	---	---
GM2A	2760	broad.mit.edu	37	5	150735806	150735806	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150735806delA	uc011dcs.1	+							NM_000405				GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SPARC	6678	broad.mit.edu	37	5	151066145	151066146	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151066145_151066146insA	uc003lui.2	-						GM2A_uc011dcs.1_Intron|uc003luj.2_RNA	NM_003118	NP_003109			secreted protein, acidic, cysteine-rich						ossification|platelet activation|platelet degranulation|signal transduction	basement membrane|extracellular space|platelet alpha granule lumen	calcium ion binding|collagen binding			central_nervous_system(1)	1		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)	Becaplermin(DB00102)													---	---	---	---
SAP30L	79685	broad.mit.edu	37	5	153837160	153837160	+	3'UTR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153837160delG	uc003lvk.2	+	4					SAP30L_uc003lvm.3_RNA|SAP30L_uc011ddc.1_3'UTR|SAP30L_uc011ddd.1_3'UTR	NM_024632	NP_078908			SAP30-like isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|metal ion binding				0	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)															---	---	---	---
SGCD	6444	broad.mit.edu	37	5	155926050	155926050	+	Intron	DEL	T	-	-	rs75971559		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155926050delT	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681			delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
CYFIP2	26999	broad.mit.edu	37	5	156750834	156750835	+	Intron	INS	-	A	A	rs111716109		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156750834_156750835insA	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410			cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158315264	158315265	+	Intron	DEL	GT	-	-	rs151106797		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158315264_158315265delGT	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870			early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	5	161731879	161731879	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161731879delA								GABRG2 (149335 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164679516	164679517	+	IGR	INS	-	G	G	rs145563906	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164679516_164679517insG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165429898	165429903	+	IGR	DEL	AAAACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165429898_165429903delAAAACA								None (None upstream) : None (None downstream)																																			---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167784454	167784465	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs67198550		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167784454_167784465delTGTGTGTGTGTG	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	169990637	169990637	+	Intron	DEL	T	-	-	rs141440921		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169990637delT	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009			Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170699522	170699523	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170699522_170699523insA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	171007838	171007839	+	IGR	INS	-	GT	GT	rs145364895	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171007838_171007839insGT								FGF18 (123676 upstream) : FBXW11 (280717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171083240	171083240	+	IGR	DEL	T	-	-	rs149029997		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171083240delT								FGF18 (199078 upstream) : FBXW11 (205316 downstream)																																			---	---	---	---
STK10	6793	broad.mit.edu	37	5	171510172	171510173	+	Intron	INS	-	TGGA	TGGA	rs118190481	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171510172_171510173insTGGA	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
STK10	6793	broad.mit.edu	37	5	171576500	171576501	+	Intron	DEL	GT	-	-	rs145254227		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171576500_171576501delGT	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171623394	171623394	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171623394delT								STK10 (8048 upstream) : UBTD2 (13256 downstream)																																			---	---	---	---
NEURL1B	54492	broad.mit.edu	37	5	172114268	172114269	+	3'UTR	INS	-	GGGA	GGGA	rs150190348	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172114268_172114269insGGGA	uc003mbt.2	+	5						NM_001142651	NP_001136123			neuralized homolog 1B								ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	173710198	173710198	+	IGR	DEL	T	-	-	rs138762279		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173710198delT								HMP19 (174017 upstream) : MSX2 (441377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174961727	174961728	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174961727_174961728insA								SFXN1 (6106 upstream) : HRH2 (123312 downstream)																																	OREG0017071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	5	175350319	175350322	+	IGR	DEL	CTCT	-	-	rs111647998		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175350319_175350322delCTCT								CPLX2 (39296 upstream) : THOC3 (36214 downstream)																																			---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176490918	176490918	+	Intron	DEL	T	-	-	rs139234775		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176490918delT	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177885661	177885668	+	Intron	DEL	AAACAAAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177885661_177885668delAAACAAAC	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
GRM6	2916	broad.mit.edu	37	5	178422467	178422474	+	5'Flank	DEL	CTGTTTTC	-	-	rs77643251		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178422467_178422474delCTGTTTTC	uc003mjr.2	-							NM_000843	NP_000834			glutamate receptor, metabotropic 6 precursor						detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)														---	---	---	---
TBC1D9B	23061	broad.mit.edu	37	5	179329592	179329593	+	Intron	INS	-	G	G	rs139167480	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179329592_179329593insG	uc003mlh.2	-						TBC1D9B_uc003mli.2_Intron|TBC1D9B_uc003mlj.2_Intron	NM_198868	NP_942568			TBC1 domain family, member 9B (with GRAM domain)							integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	180249432	180249432	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180249432delA								MGAT1 (6891 upstream) : LOC729678 (7527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	363277	363278	+	IGR	INS	-	A	A	rs145896917	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:363277_363278insA								DUSP22 (11924 upstream) : IRF4 (28474 downstream)																																			---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4770375	4770375	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4770375delT	uc003mwi.2	+							NM_001143971	NP_001137443			chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	4961586	4961587	+	IGR	INS	-	AGG	AGG	rs149966106	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4961586_4961587insAGG								CDYL (5809 upstream) : RPP40 (33694 downstream)																																			---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5605004	5605004	+	Intron	DEL	T	-	-	rs113132643		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5605004delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	5791147	5791148	+	IGR	INS	-	A	A	rs56877238		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5791147_5791148insA								FARS2 (19331 upstream) : NRN1 (207087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7010430	7010431	+	IGR	INS	-	AAGAG	AAGAG	rs144348607	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7010430_7010431insAAGAG								LY86 (355214 upstream) : RREB1 (97757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8847733	8847734	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8847733_8847734delTG								HULC (193656 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9678730	9678730	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9678730delA								None (None upstream) : TFAP2A (718187 downstream)																																			---	---	---	---
C6orf52	347744	broad.mit.edu	37	6	10685480	10685481	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10685480_10685481insA	uc011dij.1	-						C6orf52_uc011dik.1_Intron|C6orf52_uc003mzf.3_Intron|C6orf52_uc011dil.1_Intron	NM_001145020	NP_001138492			hypothetical protein LOC347744												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	10713920	10713928	+	IGR	DEL	TTTGCCTTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10713920_10713928delTTTGCCTTG								PAK1IP1 (3952 upstream) : TMEM14C (9410 downstream)																																			---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	12935860	12935861	+	Intron	INS	-	GTGT	GTGT	rs139317479	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12935860_12935861insGTGT	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
TBC1D7	51256	broad.mit.edu	37	6	13291351	13291351	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13291351delA	uc003naj.2	-						TBC1D7_uc011dis.1_Intron|uc003nak.1_Intron	NM_016495	NP_057579			TBC1 domain family, member 7 isoform a						positive regulation of protein ubiquitination	cytoplasmic membrane-bounded vesicle	protein binding|Rab GTPase activator activity			ovary(1)	1	Breast(50;0.0296)|Ovarian(93;0.0339)	all_hematologic(90;0.135)	Epithelial(50;0.0784)|BRCA - Breast invasive adenocarcinoma(129;0.13)|all cancers(50;0.21)															---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16586275	16586276	+	Intron	DEL	CA	-	-	rs61649104	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16586275_16586276delCA	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	18127855	18127856	+	IGR	INS	-	A	A	rs67789318		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18127855_18127856insA								NHLRC1 (5004 upstream) : TPMT (690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19449056	19449057	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19449056_19449057insA								MIR548A1 (876945 upstream) : ID4 (388560 downstream)																																			---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	21180019	21180019	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21180019delC	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	21615726	21615727	+	IGR	DEL	AC	-	-	rs113802407		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21615726_21615727delAC								SOX4 (16879 upstream) : FLJ22536 (49276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	22594307	22594318	+	IGR	DEL	TCATCATCATCA	-	-	rs113094394		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22594307_22594318delTCATCATCATCA								HDGFL1 (23558 upstream) : None (None downstream)																																			---	---	---	---
CMAH	8418	broad.mit.edu	37	6	25084397	25084397	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25084397delC	uc003nes.3	-						CMAH_uc003ner.3_Intron					SubName: Full=CMP-N-acetylneuraminic acid hydroxylase;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	26626293	26626293	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26626293delA								ABT1 (26018 upstream) : ZNF322A (8319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26705234	26705251	+	IGR	DEL	ACACACACACACACACAC	-	-	rs71842313		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26705234_26705251delACACACACACACACACAC								ZNF322A (45271 upstream) : GUSBL1 (134015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26753655	26753655	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26753655delA								ZNF322A (93692 upstream) : GUSBL1 (85611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26801243	26801243	+	IGR	DEL	T	-	-	rs56340843		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26801243delT								ZNF322A (141280 upstream) : GUSBL1 (38023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28287954	28287955	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28287954_28287955insA								PGBD1 (17629 upstream) : ZNF323 (4562 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29835509	29835510	+	Intron	INS	-	T	T	rs138169780	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29835509_29835510insT	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
PPP1R10	5514	broad.mit.edu	37	6	30568235	30568235	+	3'UTR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30568235delA	uc003nqn.1	-	20					PPP1R10_uc010jsc.1_3'UTR	NM_002714	NP_002705			protein phosphatase 1, regulatory subunit 10						protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	31063598	31063601	+	IGR	DEL	AACT	-	-	rs3095306		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31063598_31063601delAACT								HCG22 (35945 upstream) : C6orf15 (15399 downstream)																																			---	---	---	---
POU5F1	5460	broad.mit.edu	37	6	31135723	31135724	+	Intron	DEL	CT	-	-	rs113468980		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31135723_31135724delCT	uc003nsv.2	-						POU5F1_uc003nsu.2_5'Flank|uc011dng.1_5'Flank	NM_002701	NP_002692			POU domain, class 5, transcription factor 1						anatomical structure morphogenesis|blastocyst development|BMP signaling pathway involved in heart induction|cardiac cell fate determination|cell fate commitment involved in formation of primary germ layers|mRNA transcription from RNA polymerase II promoter|negative regulation of gene silencing by miRNA|positive regulation of catenin import into nucleus|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|regulation of asymmetric cell division|regulation of heart induction by regulation of canonical Wnt receptor signaling pathway|regulation of methylation-dependent chromatin silencing|response to wounding|somatic stem cell maintenance|somatic stem cell maintenance	cytosol|nucleoplasm|transcription factor complex	miRNA binding|sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding		EWSR1/POU5F1(10)	skin(7)|salivary_gland(2)|bone(2)|lung(1)|ovary(1)	13								T	EWSR1	sarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	6	31535453	31535462	+	IGR	DEL	ACGCACGCAT	-	-	rs61045107		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31535453_31535462delACGCACGCAT								NFKBIL1 (7776 upstream) : LTA (4414 downstream)																																			---	---	---	---
AIF1	199	broad.mit.edu	37	6	31581916	31581917	+	5'Flank	DEL	AG	-	-	rs11358541		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31581916_31581917delAG	uc003nuy.2	+						AIF1_uc010jsy.2_5'Flank|AIF1_uc003nva.2_5'Flank	NM_001623	NP_001614			allograft inflammatory factor 1 isoform 3						actin filament bundle assembly|cell cycle arrest|inflammatory response|negative regulation of cell proliferation	nucleus|ruffle membrane	actin filament binding|calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32565069	32565069	+	IGR	DEL	T	-	-	rs66838403		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32565069delT								HLA-DRB1 (7507 upstream) : HLA-DQA1 (40114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32669305	32669305	+	IGR	DEL	T	-	-	rs71536145		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32669305delT								HLA-DQB1 (34839 upstream) : HLA-DQA2 (39858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32678096	32678097	+	IGR	INS	-	TTTG	TTTG	rs140631808	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32678096_32678097insTTTG								HLA-DQB1 (43630 upstream) : HLA-DQA2 (31066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33492844	33492847	+	IGR	DEL	AACA	-	-	rs113847651		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33492844_33492847delAACA								ZBTB9 (67526 upstream) : BAK1 (47477 downstream)																																			---	---	---	---
LEMD2	221496	broad.mit.edu	37	6	33747038	33747038	+	Intron	DEL	T	-	-	rs35812370		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33747038delT	uc011drm.1	-						LEMD2_uc010jvg.2_Intron|LEMD2_uc011drl.1_Intron|LEMD2_uc003ofe.2_Intron	NM_181336	NP_851853			LEM domain containing 2 isoform 1							integral to nuclear inner membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33974478	33974479	+	IGR	INS	-	TTCA	TTCA	rs142297458	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33974478_33974479insTTCA								MIR1275 (6650 upstream) : GRM4 (15150 downstream)																																			---	---	---	---
RPS10	6204	broad.mit.edu	37	6	34389797	34389797	+	Intron	DEL	A	-	-	rs34411335		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34389797delA	uc003ojm.2	-						RPS10_uc003ojn.2_Intron	NM_001014	NP_001005			ribosomal protein S10						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	34551211	34551212	+	IGR	INS	-	A	A	rs140360914	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34551211_34551212insA								SPDEF (27120 upstream) : C6orf106 (3854 downstream)																																			---	---	---	---
UHRF1BP1	54887	broad.mit.edu	37	6	34830610	34830611	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34830610_34830611insA	uc003oju.3	+						UHRF1BP1_uc010jvm.1_Intron|UHRF1BP1_uc010jvn.2_Intron|UHRF1BP1_uc010jvo.2_Intron	NM_017754	NP_060224			ICBP90 binding protein 1											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	35901103	35901104	+	IGR	INS	-	C	C	rs150309317	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35901103_35901104insC								SRPK1 (12147 upstream) : SLC26A8 (10191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	36205215	36205215	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36205215delG								BRPF3 (4649 upstream) : PNPLA1 (5730 downstream)																																			---	---	---	---
TBC1D22B	55633	broad.mit.edu	37	6	37299299	37299300	+	3'UTR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37299299_37299300insT	uc003onn.2	+	13					TBC1D22B_uc010jwt.2_RNA|TBC1D22B_uc003onp.2_3'UTR	NM_017772	NP_060242			TBC1 domain family, member 22B							intracellular	Rab GTPase activator activity				0			OV - Ovarian serous cystadenocarcinoma(102;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	37727608	37727608	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37727608delT								MDGA1 (61842 upstream) : ZFAND3 (59699 downstream)																																			---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38362437	38362437	+	Intron	DEL	G	-	-	rs35095110		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38362437delG	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39944670	39944670	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39944670delT								MOCS1 (42416 upstream) : TDRG1 (401493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40615698	40615713	+	IGR	DEL	TGTGTGTGTGTGTGTA	-	-	rs62394646	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40615698_40615713delTGTGTGTGTGTGTGTA								LRFN2 (60572 upstream) : UNC5CL (379059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40694804	40694805	+	IGR	DEL	AC	-	-	rs145109158		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40694804_40694805delAC								LRFN2 (139678 upstream) : UNC5CL (299967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40744059	40744059	+	IGR	DEL	G	-	-	rs74586630		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40744059delG								LRFN2 (188933 upstream) : UNC5CL (250713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	41761502	41761503	+	5'Flank	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41761502_41761503delAA	uc003orh.1	-											Homo sapiens cDNA FLJ13620 fis, clone PLACE1010947.																														---	---	---	---
CCND3	896	broad.mit.edu	37	6	41932202	41932203	+	Intron	DEL	GT	-	-	rs67771214		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41932202_41932203delGT	uc003orp.2	-						CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron	NM_001136017	NP_001129489			cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)					T	IGH@	MM								---	---	---	---
Unknown	0	broad.mit.edu	37	6	42065345	42065358	+	IGR	DEL	GGTCGGACCTGGCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42065345_42065358delGGTCGGACCTGGCT								TAF8 (10146 upstream) : C6orf132 (4627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	42695934	42695934	+	5'Flank	DEL	A	-	-	rs113558090		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42695934delA	uc011duv.1	-											DQ588041																														---	---	---	---
PTK7	5754	broad.mit.edu	37	6	43088795	43088796	+	Intron	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43088795_43088796delTT	uc003oub.1	+						PTK7_uc003ouc.1_Intron|PTK7_uc003oud.1_Intron|PTK7_uc003oue.1_Intron|PTK7_uc003ouf.1_Intron|PTK7_uc003oug.1_Intron|PTK7_uc011dve.1_Intron|PTK7_uc003oua.2_Intron	NM_002821	NP_002812			PTK7 protein tyrosine kinase 7 isoform a						actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)															---	---	---	---
POLH	5429	broad.mit.edu	37	6	43567895	43567896	+	Intron	INS	-	A	A	rs138043805		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43567895_43567896insA	uc003ovq.3	+						POLH_uc010jyu.2_Intron|POLH_uc011dvl.1_Intron|POLH_uc003ovr.3_Intron	NM_006502	NP_006493			DNA-directed DNA polymerase eta						DNA replication|DNA synthesis involved in DNA repair|regulation of DNA repair|response to UV-C	cytoplasm|nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			breast(2)	2	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)										DNA_polymerases_(catalytic_subunits)	Xeroderma_Pigmentosum				---	---	---	---
Unknown	0	broad.mit.edu	37	6	45650004	45650004	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45650004delT								RUNX2 (131186 upstream) : CLIC5 (216186 downstream)																																			---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	46050538	46050538	+	5'Flank	DEL	T	-	-	rs145992627		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46050538delT	uc003oxv.3	-							NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
OPN5	221391	broad.mit.edu	37	6	47780804	47780805	+	Intron	INS	-	AAC	AAC	rs148907607	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47780804_47780805insAAC	uc003ozc.2	+						OPN5_uc003ozd.2_Intron	NM_181744	NP_859528			opsin 5 isoform 1						phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1																		---	---	---	---
C6orf138	442213	broad.mit.edu	37	6	47927605	47927605	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47927605delA	uc011dwm.1	-						C6orf138_uc011dwn.1_Intron|C6orf138_uc003ozf.2_Intron	NM_001013732	NP_001013754			hypothetical protein LOC442213							integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1																		---	---	---	---
CENPQ	55166	broad.mit.edu	37	6	49456584	49456585	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49456584_49456585insT	uc003ozh.1	+							NM_018132	NP_060602			centromere protein Q						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2	Lung NSC(77;0.0128)																	---	---	---	---
CRISP3	10321	broad.mit.edu	37	6	49708289	49708292	+	Intron	DEL	TGTG	-	-	rs146951354		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49708289_49708292delTGTG	uc003ozs.2	-							NM_006061	NP_006052			cysteine-rich secretory protein 3 precursor						innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	50474309	50474312	+	Intron	DEL	TTTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50474309_50474312delTTTG	uc003pae.1	+											full-length cDNA clone CS0DD007YH13 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	50864684	50864687	+	IGR	DEL	CTTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50864684_50864687delCTTC								TFAP2B (49359 upstream) : PKHD1 (615458 downstream)																																			---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51666313	51666314	+	Intron	INS	-	T	T	rs140632625	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51666313_51666314insT	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	52055752	52055752	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52055752delT								IL17A (316 upstream) : IL17F (45732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52163976	52163976	+	IGR	DEL	T	-	-	rs35593834		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52163976delT								MCM3 (14394 upstream) : PAQR8 (62950 downstream)																																			---	---	---	---
EFHC1	114327	broad.mit.edu	37	6	52282887	52282887	+	5'Flank	DEL	T	-	-	rs35310353		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52282887delT	uc003pap.3	+						EFHC1_uc011dwv.1_5'Flank|EFHC1_uc011dww.1_5'Flank	NM_018100	NP_060570			EF-hand domain (C-terminal) containing 1							axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)																	---	---	---	---
ICK	22858	broad.mit.edu	37	6	52923721	52923721	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52923721delA	uc003pbh.2	-						ICK_uc003pbi.2_Intron|ICK_uc003pbj.2_Intron	NM_016513	NP_057597			intestinal cell kinase						intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)																	---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54202045	54202045	+	Intron	DEL	T	-	-	rs34286210		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54202045delT	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279			tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	55827421	55827422	+	IGR	INS	-	TCTCTC	TCTCTC	rs5742159		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55827421_55827422insTCTCTC								BMP5 (87046 upstream) : COL21A1 (93967 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57307327	57307328	+	Intron	INS	-	T	T	rs149715991	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57307327_57307328insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57325208	57325209	+	Intron	INS	-	T	T	rs139197745	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57325208_57325209insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57353602	57353602	+	Intron	DEL	A	-	-	rs68013861		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57353602delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57390726	57390728	+	Intron	DEL	TTG	-	-	rs34695317		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57390726_57390728delTTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57402197	57402197	+	Intron	DEL	T	-	-	rs68138830		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57402197delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57432462	57432463	+	Intron	INS	-	GTTTATTT	GTTTATTT	rs10654142		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432462_57432463insGTTTATTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57434316	57434317	+	Intron	INS	-	TGTT	TGTT	rs138331811		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57434316_57434317insTGTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57445087	57445089	+	Intron	DEL	AAT	-	-	rs5876621		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57445087_57445089delAAT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57504473	57504473	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57504473delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57517011	57517012	+	IGR	INS	-	TTAA	TTAA	rs138904532		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57517011_57517012insTTAA								PRIM2 (3636 upstream) : GUSBL2 (729147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57548982	57548982	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57548982delA								PRIM2 (35607 upstream) : GUSBL2 (697177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57593384	57593385	+	IGR	INS	-	A	A	rs149184524	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57593384_57593385insA								PRIM2 (80009 upstream) : GUSBL2 (652774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63679289	63679292	+	IGR	DEL	CACA	-	-	rs71781878		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63679289_63679292delCACA								KHDRBS2 (683189 upstream) : LGSN (306565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63820772	63820772	+	IGR	DEL	C	-	-	rs78277202		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63820772delC								KHDRBS2 (824672 upstream) : LGSN (165085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	64201346	64201348	+	IGR	DEL	AAG	-	-	rs144976057	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64201346_64201348delAAG								LGSN (171464 upstream) : PTP4A1 (30303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	64332671	64332671	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64332671delA								PTP4A1 (39183 upstream) : PHF3 (13054 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	65872804	65872805	+	Intron	INS	-	TG	TG	rs146458293	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65872804_65872805insTG	uc011dxu.1	-							NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	65989451	65989451	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65989451delT	uc011dxu.1	-							NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	68618755	68618755	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68618755delT								None (None upstream) : BAI3 (726877 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	71063194	71063194	+	IGR	DEL	T	-	-	rs36167257		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71063194delT								COL9A1 (50408 upstream) : FAM135A (59913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	72194398	72194399	+	IGR	INS	-	TCTATCTATCTA	TCTATCTATCTA	rs146114728	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72194398_72194399insTCTATCTATCTA								C6orf155 (63950 upstream) : RIMS1 (402251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	73130141	73130142	+	IGR	INS	-	C	C	rs148224959	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73130141_73130142insC								RIMS1 (17634 upstream) : KCNQ5 (201429 downstream)																																			---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73797732	73797733	+	Intron	INS	-	TC	TC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73797732_73797733insTC	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816			potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	77172976	77172977	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77172976_77172977insA								IMPG1 (390641 upstream) : HTR1B (998971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81381500	81381500	+	IGR	DEL	A	-	-	rs71680453		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81381500delA								BCKDHB (325513 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82511958	82511959	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82511958_82511959delTG								FAM46A (49530 upstream) : IBTK (367997 downstream)																																			---	---	---	---
ME1	4199	broad.mit.edu	37	6	83941137	83941137	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83941137delG	uc003pjy.2	-						ME1_uc011dzb.1_Intron|ME1_uc011dzc.1_Intron	NM_002395	NP_002386			cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	85171649	85171650	+	IGR	INS	-	T	T	rs150164187	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85171649_85171650insT								KIAA1009 (234314 upstream) : TBX18 (225431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85179831	85179832	+	IGR	INS	-	A	A	rs139253967	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85179831_85179832insA								KIAA1009 (242496 upstream) : TBX18 (217249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	88501492	88501492	+	Intron	DEL	T	-	-	rs11340721		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88501492delT	uc003pmm.2	+											Homo sapiens mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92750321	92750322	+	IGR	INS	-	TA	TA	rs10669512		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92750321_92750322insTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98088021	98088021	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98088021delT	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	98128539	98128540	+	Intron	DEL	TT	-	-	rs67010060		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98128539_98128540delTT	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	100300189	100300189	+	IGR	DEL	C	-	-	rs11322587		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100300189delC								PRDM13 (236735 upstream) : MCHR2 (67597 downstream)																																			---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	101184377	101184378	+	Intron	INS	-	A	A	rs74469888		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101184377_101184378insA	uc003pqk.2	-						ASCC3_uc011eai.1_Intron|ASCC3_uc003pql.2_Intron	NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	102789982	102789982	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102789982delG								GRIK2 (272025 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	106064418	106064418	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106064418delT								PREP (213449 upstream) : PRDM1 (469777 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	107239381	107239382	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107239381_107239382delTG								MIR587 (7286 upstream) : C6orf203 (110025 downstream)																																			---	---	---	---
RPF2	84154	broad.mit.edu	37	6	111327683	111327683	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111327683delC	uc003pun.2	+						RPF2_uc003puo.2_Intron	NM_032194	NP_115570			brix domain containing 1							nucleolus	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	114352746	114352747	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114352746_114352747delTG	uc003pwf.2	+											Homo sapiens, clone IMAGE:5770470, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	116146551	116146552	+	IGR	INS	-	GAAG	GAAG	rs71012306		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116146551_116146552insGAAG								None (None upstream) : FRK (116141 downstream)																																			---	---	---	---
FRK	2444	broad.mit.edu	37	6	116349001	116349001	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116349001delA	uc003pwi.1	-							NM_002031	NP_002022			fyn-related kinase						negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)														---	---	---	---
GOPC	57120	broad.mit.edu	37	6	117747603	117747604	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117747603_117747604delCT	uc003pxq.1	-						ROS1_uc003pxp.1_5'Flank|ROS1_uc011ebi.1_5'Flank	NM_001017408	NP_001017408			golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)				O	ROS1	glioblastoma								---	---	---	---
GOPC	57120	broad.mit.edu	37	6	117773910	117773911	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117773910_117773911insT	uc003pxq.1	-							NM_001017408	NP_001017408			golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)				O	ROS1	glioblastoma								---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118315365	118315366	+	Intron	INS	-	C	C	rs140654593	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118315365_118315366insC	uc003pxx.3	+							NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)														---	---	---	---
FAM184A	79632	broad.mit.edu	37	6	119458486	119458489	+	Intron	DEL	AGAG	-	-	rs71797128		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119458486_119458489delAGAG	uc003pyk.3	-						FAM184A_uc003pyl.3_Intron	NM_001100411	NP_001093881			hypothetical protein LOC79632 isoform 2											ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	120005944	120005944	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120005944delT								MAN1A1 (335018 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	120008653	120008653	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120008653delG								MAN1A1 (337727 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	120710206	120710207	+	IGR	INS	-	T	T	rs146195099	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120710206_120710207insT								None (None upstream) : C6orf170 (690420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	121279430	121279431	+	IGR	DEL	GT	-	-	rs67041363		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121279430_121279431delGT								None (None upstream) : C6orf170 (121196 downstream)																																			---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121491307	121491308	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121491307_121491308delAC	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron|C6orf170_uc010kej.1_Intron|C6orf170_uc003pyp.1_Intron	NM_152730	NP_689943			hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121652522	121652522	+	Intron	DEL	T	-	-	rs113304181		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121652522delT	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron	NM_152730	NP_689943			hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	123496699	123496699	+	IGR	DEL	G	-	-	rs67254066		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123496699delG								CLVS2 (111636 upstream) : TRDN (40784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	124062817	124062818	+	IGR	DEL	TG	-	-	rs73770247		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124062817_124062818delTG								TRDN (104875 upstream) : NKAIN2 (62251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	125680834	125680836	+	IGR	DEL	GAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125680834_125680836delGAA								HDDC2 (57552 upstream) : HEY2 (387944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	125912599	125912599	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125912599delT								HDDC2 (289317 upstream) : HEY2 (156181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	125994754	125994755	+	IGR	INS	-	AACA	AACA	rs143392219	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125994754_125994755insAACA								HDDC2 (371472 upstream) : HEY2 (74025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	127065528	127065529	+	Intron	DEL	AC	-	-	rs74565441		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127065528_127065529delAC	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129246962	129246963	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129246962_129246963insT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129567537	129567537	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129567537delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129740201	129740202	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129740201_129740202insT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	131840514	131840515	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131840514_131840515insT								AKAP7 (235841 upstream) : ARG1 (53850 downstream)																																			---	---	---	---
VNN2	8875	broad.mit.edu	37	6	133071815	133071815	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133071815delG	uc003qdt.2	-						VNN2_uc003qds.2_Intron|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Intron	NM_004665	NP_004656			vanin 2 isoform 1 precursor						cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	133126808	133126808	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133126808delT								C6orf192 (7061 upstream) : RPS12 (8900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133267074	133267076	+	IGR	DEL	AAC	-	-	rs113622111		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133267074_133267076delAAC								RPS12 (128372 upstream) : LOC285735 (142143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133482683	133482683	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133482683delA								LOC285735 (54973 upstream) : EYA4 (79053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	134426998	134426998	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134426998delA								SLC2A12 (53209 upstream) : SGK1 (63387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	135126300	135126301	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135126300_135126301insA								SGK1 (487104 upstream) : ALDH8A1 (112228 downstream)																																			---	---	---	---
ALDH8A1	64577	broad.mit.edu	37	6	135258155	135258156	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135258155_135258156delCA	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090			aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	135551811	135551811	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135551811delT								MYB (11498 upstream) : MIR548A2 (8487 downstream)																																			---	---	---	---
AHI1	54806	broad.mit.edu	37	6	135664086	135664086	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135664086delA	uc003qgi.2	-						AHI1_uc003qgf.2_Intron|AHI1_uc003qgg.2_Intron|AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron	NM_001134831	NP_001128303			Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)														---	---	---	---
C6orf217	100131814	broad.mit.edu	37	6	135843222	135843223	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135843222_135843223insT	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron|C6orf217_uc010kgo.2_Intron|C6orf217_uc003qgm.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0																		---	---	---	---
C6orf217	100131814	broad.mit.edu	37	6	135906161	135906161	+	Intron	DEL	C	-	-	rs67765113		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135906161delC	uc003qgn.2	+						C6orf217_uc003qgo.2_Intron|C6orf217_uc010kgo.2_Intron					Homo sapiens cDNA clone IMAGE:4795512.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	136119085	136119086	+	IGR	INS	-	CG	CG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136119085_136119086insCG								C6orf217 (81893 upstream) : PDE7B (53748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	136155335	136155335	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136155335delC								C6orf217 (118143 upstream) : PDE7B (17499 downstream)																																			---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136282414	136282419	+	Intron	DEL	TGTGTA	-	-	rs71800773		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136282414_136282419delTGTGTA	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	137942927	137942928	+	IGR	INS	-	T	T	rs113243389		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137942927_137942928insT								OLIG3 (127396 upstream) : TNFAIP3 (245653 downstream)																																			---	---	---	---
HEBP2	23593	broad.mit.edu	37	6	138731617	138731617	+	Intron	DEL	T	-	-	rs66799556		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138731617delT	uc003qhw.1	+							NM_014320	NP_055135			heme binding protein 2							mitochondrion					0	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)														---	---	---	---
NHSL1	57224	broad.mit.edu	37	6	138820271	138820272	+	Intron	INS	-	AC	AC	rs143185057	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138820271_138820272insAC	uc003qhx.2	-						NHSL1_uc011edp.1_Intron|NHSL1_uc003qhy.2_Intron	NM_020464	NP_065197			NHS-like 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	139026882	139026882	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139026882delT								NHSL1 (133214 upstream) : CCDC28A (67775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	139708891	139708892	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139708891_139708892delTT								CITED2 (13106 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	139728139	139728140	+	IGR	DEL	TG	-	-	rs66732735		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139728139_139728140delTG								CITED2 (32354 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140416786	140416786	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140416786delC								CITED2 (721001 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142046494	142046495	+	Intron	INS	-	TC	TC	rs144483776	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142046494_142046495insTC	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
AIG1	51390	broad.mit.edu	37	6	143569842	143569843	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143569842_143569843insA	uc003qjh.2	+						AIG1_uc003qjf.2_Intron|AIG1_uc003qji.2_Intron	NM_016108	NP_057192			androgen-induced 1							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144856927	144856927	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144856927delT	uc003qkt.2	+							NM_007124	NP_009055			utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147144325	147144325	+	IGR	DEL	A	-	-	rs67476588		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147144325delA								C6orf103 (7730 upstream) : STXBP5 (381183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	147925345	147925346	+	IGR	INS	-	T	T	rs68110943		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147925345_147925346insT								SAMD5 (34188 upstream) : SASH1 (738383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148138081	148138081	+	IGR	DEL	A	-	-	rs75536293		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148138081delA								SAMD5 (246924 upstream) : SASH1 (525648 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148425698	148425699	+	IGR	INS	-	A	A	rs143155428	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148425698_148425699insA								SAMD5 (534541 upstream) : SASH1 (238030 downstream)																																			---	---	---	---
SASH1	23328	broad.mit.edu	37	6	148688107	148688108	+	Intron	INS	-	T	T	rs67797233		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148688107_148688108insT	uc003qme.1	+							NM_015278	NP_056093			SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	149529033	149529034	+	IGR	INS	-	CT	CT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149529033_149529034insCT								UST (130908 upstream) : TAB2 (10725 downstream)																																			---	---	---	---
NUP43	348995	broad.mit.edu	37	6	150060135	150060135	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150060135delT	uc003qmz.2	-						NUP43_uc003qmx.3_5'Flank|NUP43_uc011eee.1_Intron|NUP43_uc011eef.1_Intron	NM_198887	NP_942590			nucleoporin 43kDa						carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			upper_aerodigestive_tract(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)														---	---	---	---
ULBP1	80329	broad.mit.edu	37	6	150293883	150293883	+	3'UTR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150293883delA	uc003qnp.2	+	5						NM_025218	NP_079494			UL16 binding protein 1 precursor						antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)														---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151420311	151420312	+	Intron	INS	-	A	A	rs72020168		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151420311_151420312insA	uc003qob.2	+						MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152628968	152628969	+	Intron	INS	-	TTGT	TTGT	rs146905714	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152628968_152628969insTTGT	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153212707	153212708	+	IGR	DEL	GT	-	-	rs66733032		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153212707_153212708delGT								VIP (131809 upstream) : FBXO5 (78952 downstream)																																			---	---	---	---
RGS17	26575	broad.mit.edu	37	6	153367440	153367444	+	Intron	DEL	AATAA	-	-	rs3048964		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153367440_153367444delAATAA	uc003qpm.2	-							NM_012419	NP_036551			regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)										Lung_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	6	153655504	153655505	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153655504_153655505delCA								RGS17 (203115 upstream) : OPRM1 (676131 downstream)																																			---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154513453	154513454	+	Intron	DEL	TG	-	-	rs67045637		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154513453_154513454delTG	uc003qpx.2	-						OPRM1_uc003qpt.1_Intron|IPCEF1_uc003qpv.2_Intron|IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
CNKSR3	154043	broad.mit.edu	37	6	154800352	154800353	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154800352_154800353delAA	uc003qpy.2	-							NM_173515	NP_775786			CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	154915550	154915551	+	IGR	INS	-	AA	AA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154915550_154915551insAA								CNKSR3 (83797 upstream) : RBM16 (138961 downstream)																																			---	---	---	---
RBM16	22828	broad.mit.edu	37	6	155118114	155118115	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155118114_155118115insA	uc003qqa.2	+						RBM16_uc011efj.1_Intron|RBM16_uc011efk.1_Intron|RBM16_uc003qpz.2_Intron|RBM16_uc010kji.2_Intron	NM_014892	NP_055707			RNA-binding motif protein 16						mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)														---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155512944	155512944	+	Intron	DEL	A	-	-	rs113522190		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155512944delA	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_Intron|TIAM2_uc003qqg.2_Intron	NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	156338340	156338340	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156338340delT								MIR1202 (70327 upstream) : ARID1B (760746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156898648	156898653	+	IGR	DEL	CTCTAC	-	-	rs79034883		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156898648_156898653delCTCTAC								MIR1202 (630635 upstream) : ARID1B (200433 downstream)																																			---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157134992	157134993	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157134992_157134993insT	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989			AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	157992809	157992809	+	Intron	DEL	T	-	-	rs66913060		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157992809delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjm.1_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
SYNJ2	8871	broad.mit.edu	37	6	158452652	158452653	+	Intron	INS	-	TC	TC	rs147202634	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158452652_158452653insTC	uc003qqx.1	+						SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc011efn.1_Intron|SYNJ2_uc010kjo.1_Intron	NM_003898	NP_003889			synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)														---	---	---	---
TULP4	56995	broad.mit.edu	37	6	158822079	158822081	+	Intron	DEL	TTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158822079_158822081delTTT	uc003qrf.2	+						TULP4_uc011efo.1_Intron|TULP4_uc003qrg.2_Intron	NM_020245	NP_064630			tubby like protein 4 isoform 1						intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)														---	---	---	---
SYTL3	94120	broad.mit.edu	37	6	159126356	159126356	+	Intron	DEL	A	-	-	rs72348358		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159126356delA	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991			synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)												OREG0017758	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	6	159339131	159339134	+	IGR	DEL	GTGT	-	-	rs68034929		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159339131_159339134delGTGT								OSTCL (60467 upstream) : RSPH3 (59134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	159519027	159519028	+	IGR	INS	-	TT	TT	rs112774875		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159519027_159519028insTT								TAGAP (52843 upstream) : FNDC1 (71401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	159576005	159576006	+	IGR	INS	-	A	A	rs138878683	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159576005_159576006insA								TAGAP (109821 upstream) : FNDC1 (14423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	161111184	161111185	+	IGR	INS	-	GCGC	GCGC	rs139420181	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161111184_161111185insGCGC								LPA (23777 upstream) : PLG (12089 downstream)																																			---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162982422	162982423	+	Intron	INS	-	A	A	rs150126059	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162982422_162982423insA	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	163020532	163020534	+	Intron	DEL	AAC	-	-	rs71927433		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163020532_163020534delAAC	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164375525	164375526	+	IGR	INS	-	AA	AA	rs71715757		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164375525_164375526insAA								QKI (380633 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165494220	165494221	+	IGR	INS	-	A	A	rs147599863	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165494220_165494221insA								None (None upstream) : C6orf118 (198934 downstream)																																			---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165945251	165945254	+	Intron	DEL	TTTA	-	-	rs67743848		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165945251_165945254delTTTA	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	166690495	166690496	+	IGR	DEL	AG	-	-	rs71703161		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166690495_166690496delAG								T (108364 upstream) : PRR18 (28672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168116391	168116391	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168116391delC								TCP10 (318393 upstream) : C6orf123 (68830 downstream)																																			---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168356083	168356083	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168356083delT	uc003qwd.2	+						MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090			myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	168919897	168919898	+	Intron	DEL	GA	-	-	rs147173363		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168919897_168919898delGA	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421			SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	169302134	169302134	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169302134delT								SMOC2 (233463 upstream) : THBS2 (313742 downstream)																																			---	---	---	---
THBS2	7058	broad.mit.edu	37	6	169643156	169643156	+	Intron	DEL	C	-	-	rs112849189		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169643156delC	uc003qwt.2	-							NM_003247	NP_003238			thrombospondin 2 precursor						cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170429347	170429352	+	IGR	DEL	ATCTGC	-	-	rs148359180		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170429347_170429352delATCTGC								C6orf208 (226378 upstream) : LOC154449 (134070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170529464	170529464	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170529464delG								C6orf208 (326495 upstream) : LOC154449 (33958 downstream)																																			---	---	---	---
PSMB1	5689	broad.mit.edu	37	6	170821866	170821867	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170821866_170821867delAC	uc003qxq.2	-							NM_002793				proteasome beta 1 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	340854	340855	+	IGR	INS	-	CA	CA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:340854_340855insCA								FAM20C (40143 upstream) : PDGFA (196044 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2022786	2022793	+	Intron	DEL	CGCGCACA	-	-	rs72080144	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2022786_2022793delCGCGCACA	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	3275333	3275335	+	IGR	DEL	TAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3275333_3275335delTAG								CARD11 (191754 upstream) : SDK1 (65745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	5305759	5305760	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5305759_5305760delGT								WIPI2 (32274 upstream) : SLC29A4 (16801 downstream)																																			---	---	---	---
FBXL18	80028	broad.mit.edu	37	7	5536110	5536111	+	Intron	INS	-	GGCTAAA	GGCTAAA	rs145335337	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5536110_5536111insGGCTAAA	uc003soo.2	-						FBXL18_uc003son.3_Intron|MIR589_hsa-mir-589|MI0003599_5'Flank	NM_024963	NP_079239			F-box and leucine-rich repeat protein 18											central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)														---	---	---	---
C7orf70	84792	broad.mit.edu	37	7	6371745	6371746	+	Intron	DEL	AA	-	-	rs112556297		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6371745_6371746delAA	uc003spu.2	-							NM_001037163	NP_001032240			hypothetical protein LOC84792							nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	7672774	7672775	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7672774_7672775insT								MIOS (25671 upstream) : RPA3 (3802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9346813	9346814	+	IGR	DEL	AC	-	-	rs145446486		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9346813_9346814delAC								NXPH1 (554221 upstream) : PER4 (327086 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14850003	14850005	+	Intron	DEL	ACA	-	-	rs35098567		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14850003_14850005delACA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	15157799	15157806	+	IGR	DEL	ACACACAC	-	-	rs67872061		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15157799_15157806delACACACAC								DGKB (215249 upstream) : TMEM195 (82137 downstream)																																			---	---	---	---
AHR	196	broad.mit.edu	37	7	17345771	17345771	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17345771delA	uc011jxz.1	+						AHR_uc003stt.3_Intron	NM_001621	NP_001612			aryl hydrocarbon receptor precursor						apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	19853194	19853197	+	IGR	DEL	AAAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19853194_19853197delAAAC								TMEM196 (39978 upstream) : MACC1 (321091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20634309	20634310	+	IGR	INS	-	ACAC	ACAC	rs117537998	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20634309_20634310insACAC								ITGB8 (178931 upstream) : ABCB5 (20935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22005371	22005372	+	IGR	DEL	GT	-	-	rs35438736		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22005371_22005372delGT								CDCA7L (19829 upstream) : RAPGEF5 (152537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22437412	22437412	+	IGR	DEL	A	-	-	rs78924440		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22437412delA								RAPGEF5 (40879 upstream) : MGC87042 (21654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	23323223	23323224	+	IGR	INS	-	TGTTT	TGTTT	rs142251910	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23323223_23323224insTGTTT								GPNMB (8495 upstream) : C7orf30 (15716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26028790	26028791	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26028790_26028791delTC								MIR148A (39184 upstream) : NFE2L3 (163056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26037000	26037003	+	IGR	DEL	TGAA	-	-	rs72240185		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26037000_26037003delTGAA								MIR148A (47394 upstream) : NFE2L3 (154844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26157908	26157909	+	IGR	INS	-	TTGT	TTGT	rs143871478	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26157908_26157909insTTGT								MIR148A (168302 upstream) : NFE2L3 (33938 downstream)																																			---	---	---	---
HOXA5	3202	broad.mit.edu	37	7	27185072	27185080	+	5'Flank	DEL	TTTTGTTTT	-	-	rs74624015		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27185072_27185080delTTTTGTTTT	uc003syn.1	-						uc003syp.1_5'Flank	NM_019102	NP_061975			homeobox A5						negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	27418866	27418866	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27418866delT								EVX1 (132674 upstream) : HIBADH (146197 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	27468722	27468722	+	IGR	DEL	A	-	-	rs35102985		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27468722delA								EVX1 (182530 upstream) : HIBADH (96341 downstream)																																			---	---	---	---
JAZF1	221895	broad.mit.edu	37	7	28039184	28039184	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28039184delC	uc003szn.2	-							NM_175061	NP_778231			JAZF zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131								T	SUZ12	endometrial stromal tumours								---	---	---	---
Unknown	0	broad.mit.edu	37	7	28302365	28302366	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28302365_28302366delCT								JAZF1 (81928 upstream) : LOC402644 (16476 downstream)																																			---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28456972	28456973	+	Intron	INS	-	T	T	rs11433698		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28456972_28456973insT	uc003szq.2	+						CREB5_uc003szo.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28769353	28769354	+	Intron	INS	-	AAT	AAT	rs151057917	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28769353_28769354insAAT	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	32413795	32413796	+	IGR	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32413795_32413796delAA								PDE1C (74854 upstream) : LSM5 (111149 downstream)																																			---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33247148	33247149	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33247148_33247149insT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc011kan.1_Intron|BBS9_uc011kao.1_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	40147789	40147789	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40147789delA								CDK13 (12644 upstream) : C7orf11 (24554 downstream)																																			---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40318286	40318288	+	Intron	DEL	CTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40318286_40318288delCTT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40472937	40472937	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40472937delT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40817051	40817052	+	Intron	INS	-	T	T	rs35350371		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40817051_40817052insT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41502636	41502636	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41502636delT								C7orf10 (602279 upstream) : INHBA (225967 downstream)																																			---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43286451	43286452	+	Intron	INS	-	A	A	rs147021433	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43286451_43286452insA	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
POLR2J4	84820	broad.mit.edu	37	7	44018547	44018554	+	Intron	DEL	TGAGTGAA	-	-	rs58670391	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44018547_44018554delTGAGTGAA	uc010kxw.2	-						POLR2J4_uc003tjc.2_Intron|POLR2J4_uc003tjd.2_Intron					SubName: Full=cDNA FLJ58900, weakly similar to Uroplakin-3B;												0																		---	---	---	---
CAMK2B	816	broad.mit.edu	37	7	44329194	44329194	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44329194delC	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2																		---	---	---	---
CAMK2B	816	broad.mit.edu	37	7	44364012	44364012	+	Intron	DEL	A	-	-	rs76285380		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44364012delA	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	49277013	49277014	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49277013_49277014delTG								CDC14C (309964 upstream) : VWC2 (536243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51646365	51646366	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51646365_51646366delTG								COBL (261850 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51674595	51674626	+	IGR	DEL	CCTTTATGAGTATTGACTCATTCCTATTAAAA	-	-	rs112875115	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51674595_51674626delCCTTTATGAGTATTGACTCATTCCTATTAAAA								COBL (290080 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52067288	52067288	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52067288delT								COBL (682773 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53225408	53225408	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53225408delA								POM121L12 (120791 upstream) : None (None downstream)																																			---	---	---	---
ZNF713	349075	broad.mit.edu	37	7	55988881	55988881	+	Intron	DEL	A	-	-	rs74508122		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55988881delA	uc003trc.1	+						ZNF713_uc003tra.1_Intron|MRPS17_uc003trb.2_Intron	NM_182633	NP_872439			zinc finger protein 713						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	56226098	56226101	+	IGR	DEL	TCAC	-	-	rs10590892		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56226098_56226101delTCAC								PSPH (42008 upstream) : DKFZp434L192 (337815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57606415	57606416	+	IGR	INS	-	T	T	rs142545843	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57606415_57606416insT								ZNF716 (73150 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57729468	57729469	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57729468_57729469delTG								ZNF716 (196203 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58031182	58031182	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58031182delC								ZNF716 (497917 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61747280	61747281	+	IGR	INS	-	GAAAT	GAAAT	rs76534560		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61747280_61747281insGAAAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61859652	61859653	+	IGR	INS	-	A	A	rs148197113	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61859652_61859653insA								None (None upstream) : LOC643955 (892019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62980774	62980775	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62980774_62980775insT								LOC100287704 (168623 upstream) : ZNF727 (525046 downstream)																																			---	---	---	---
ZNF273	10793	broad.mit.edu	37	7	64365799	64365800	+	Intron	DEL	TT	-	-	rs34374261		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64365799_64365800delTT	uc003tto.2	+						ZNF273_uc003ttl.2_Intron|ZNF273_uc003ttm.1_Intron|ZNF273_uc003ttn.2_Intron|ZNF273_uc003ttp.1_Intron	NM_021148	NP_066971			zinc finger protein 273						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	64808217	64808217	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64808217delA								INTS4L1 (113618 upstream) : ZNF92 (30551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64832103	64832103	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64832103delA								INTS4L1 (137504 upstream) : ZNF92 (6665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64963995	64963996	+	IGR	INS	-	T	T	rs145671706		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64963995_64963996insT								ZNF92 (97998 upstream) : INTS4L2 (148781 downstream)																																			---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66490354	66490354	+	Intron	DEL	A	-	-	rs71830151		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66490354delA	uc003tvn.2	+						TYW1_uc010lai.2_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	66888987	66888987	+	IGR	DEL	A	-	-	rs55848996	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66888987delA								STAG3L4 (102475 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68529936	68529936	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68529936delT								None (None upstream) : AUTS2 (533969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68659643	68659643	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68659643delT								None (None upstream) : AUTS2 (404262 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69412271	69412271	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69412271delC	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70107776	70107777	+	Intron	INS	-	GTAA	GTAA	rs140762359	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70107776_70107777insGTAA	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	70268355	70268358	+	IGR	DEL	AAAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70268355_70268358delAAAC								AUTS2 (10471 upstream) : WBSCR17 (329431 downstream)																																			---	---	---	---
GTF2IRD2P1	401375	broad.mit.edu	37	7	72667909	72667909	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72667909delT	uc003txs.1	-						FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0																		---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73346011	73346012	+	Intron	DEL	AT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73346011_73346012delAT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
EIF4H	7458	broad.mit.edu	37	7	73592875	73592876	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73592875_73592876insA	uc003uad.1	+						RFC2_uc011kfa.1_Intron|EIF4H_uc011kfg.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_Intron|EIF4H_uc003uaf.1_Intron	NM_022170	NP_071496			eukaryotic translation initiation factor 4H						interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0																		---	---	---	---
GTF2I	2969	broad.mit.edu	37	7	74082168	74082169	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74082168_74082169insT	uc003uau.2	+						GTF2I_uc003uat.2_Intron|GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron	NM_032999	NP_127492			general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75185123	75185124	+	Intron	INS	-	A	A	rs146728911	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75185123_75185124insA	uc003uds.1	-						HIP1_uc011kfz.1_Intron	NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75275404	75275405	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75275404_75275405insT	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75860063	75860066	+	Intron	DEL	TTAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75860063_75860066delTTAC	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	76018331	76018332	+	IGR	INS	-	A	A	rs35271628		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76018331_76018332insA								YWHAG (29989 upstream) : SRCRB4D (315 downstream)																																			---	---	---	---
LOC100132832	100132832	broad.mit.edu	37	7	76678775	76678775	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76678775delT	uc003ufy.2	+							NR_028058				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
CCDC146	57639	broad.mit.edu	37	7	76809593	76809594	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76809593_76809594delAC	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930			coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	79914073	79914074	+	IGR	DEL	TG	-	-	rs10567801		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79914073_79914074delTG								GNAI1 (65348 upstream) : CD36 (84817 downstream)																																			---	---	---	---
CD36	948	broad.mit.edu	37	7	80202335	80202336	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80202335_80202336delTG	uc003uhc.2	+							NM_001127444	NP_001120916			CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1																		---	---	---	---
SEMA3C	10512	broad.mit.edu	37	7	80534492	80534492	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80534492delT	uc003uhj.2	-						SEMA3C_uc011kgw.1_Intron|SEMA3C_uc011kgx.1_Intron	NM_006379	NP_006370			semaphorin 3C precursor						immune response|response to drug	membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	83951202	83951216	+	IGR	DEL	AAAAAAAAAAAAAAG	-	-	rs147109954	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83951202_83951216delAAAAAAAAAAAAAAG								SEMA3A (126985 upstream) : SEMA3D (673658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	83951216	83951216	+	IGR	DEL	G	-	-	rs71539322		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83951216delG								SEMA3A (126999 upstream) : SEMA3D (673658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84566695	84566695	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84566695delA								SEMA3A (742478 upstream) : SEMA3D (58179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85741645	85741645	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85741645delT								SEMA3D (925474 upstream) : GRM3 (531585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85795461	85795466	+	IGR	DEL	AAGAAC	-	-	rs58960096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85795461_85795466delAAGAAC								SEMA3D (979290 upstream) : GRM3 (477764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	88314342	88314342	+	IGR	DEL	A	-	-	rs141052205		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88314342delA								STEAP4 (378133 upstream) : ZNF804B (74411 downstream)																																			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88493406	88493407	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88493406_88493407insT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90300604	90300604	+	Intron	DEL	T	-	-	rs71974325		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90300604delT	uc003uky.2	+						CDK14_uc003ukt.1_Intron|CDK14_uc003ukv.1_Intron|CDK14_uc003uku.1_Intron|CDK14_uc003ukx.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90605561	90605561	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90605561delT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
ACN9	57001	broad.mit.edu	37	7	96754587	96754588	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96754587_96754588insT	uc003uoo.3	+							NM_020186	NP_064571			ACN9 homolog precursor						regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)																	---	---	---	---
ACN9	57001	broad.mit.edu	37	7	96764377	96764377	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96764377delT	uc003uoo.3	+							NM_020186	NP_064571			ACN9 homolog precursor						regulation of gluconeogenesis	mitochondrial intermembrane space					0	all_cancers(62;2.54e-08)|all_epithelial(64;2.24e-08)|Esophageal squamous(72;0.00507)|all_lung(186;0.154)|Lung NSC(181;0.159)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	97091884	97091885	+	IGR	INS	-	T	T	rs34882096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97091884_97091885insT								ACN9 (280811 upstream) : TAC1 (269386 downstream)																																			---	---	---	---
TECPR1	25851	broad.mit.edu	37	7	97879963	97879965	+	Intron	DEL	AAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97879963_97879965delAAC	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210			tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1																		---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	97946179	97946180	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97946179_97946180insT	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	98017805	98017806	+	Intron	INS	-	AAAAC	AAAAC	rs142448000	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98017805_98017806insAAAAC	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	99641108	99641110	+	IGR	DEL	TCC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99641108_99641110delTCC								ZKSCAN1 (5705 upstream) : ZSCAN21 (6307 downstream)																																			---	---	---	---
STAG3	10734	broad.mit.edu	37	7	99801910	99801910	+	Intron	DEL	T	-	-	rs143599714	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99801910delT	uc003utx.1	+						STAG3_uc011kjk.1_Intron|GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Intron	NM_012447	NP_036579			stromal antigen 3						chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100043306	100043306	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100043306delT								C7orf47 (9212 upstream) : C7orf61 (10932 downstream)																																			---	---	---	---
ZAN	7455	broad.mit.edu	37	7	100366706	100366707	+	Intron	INS	-	TTTTG	TTTTG	rs148527571	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100366706_100366707insTTTTG	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377			zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)															---	---	---	---
ZAN	7455	broad.mit.edu	37	7	100373941	100373948	+	Intron	DEL	AGGGAGGG	-	-	rs3991185		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100373941_100373948delAGGGAGGG	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kke.1_Intron	NM_003386	NP_003377			zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	100615790	100615791	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100615790_100615791insT								ACHE (121251 upstream) : MUC12 (32284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100982956	100982957	+	IGR	INS	-	T	T	rs142144062		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100982956_100982957insT								RABL5 (17863 upstream) : EMID2 (23165 downstream)																																			---	---	---	---
NAPEPLD	222236	broad.mit.edu	37	7	102789072	102789073	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102789072_102789073insT	uc003vbc.2	-						NAPEPLD_uc003vbd.2_Intron|NAPEPLD_uc011klj.1_Intron|NAPEPLD_uc003vbe.2_Intron|NAPEPLD_uc003vbf.2_Intron	NM_198990	NP_945341			N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103130776	103130776	+	Intron	DEL	C	-	-	rs35858697		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103130776delC	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
SRPK2	6733	broad.mit.edu	37	7	105004852	105004853	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105004852_105004853insT	uc003vcv.2	-						SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634			serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	105085000	105085001	+	IGR	INS	-	CCTC	CCTC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105085000_105085001insCCTC								SRPK2 (45202 upstream) : PUS7 (11961 downstream)																																			---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105370844	105370844	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105370844delA	uc003vde.2	-							NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
CDHR3	222256	broad.mit.edu	37	7	105533342	105533343	+	Intron	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105533342_105533343insG	uc003vdk.2	+											RecName: Full=Cadherin-like protein 28; Flags: Precursor;						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	105788105	105788106	+	IGR	INS	-	T	T	rs59669977		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105788105_105788106insT								SYPL1 (35048 upstream) : NAMPT (100628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	106035069	106035069	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106035069delA								NAMPT (109431 upstream) : FLJ36031 (264081 downstream)																																			---	---	---	---
COG5	10466	broad.mit.edu	37	7	106868032	106868032	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106868032delT	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	108100707	108100707	+	IGR	DEL	T	-	-	rs111995271		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108100707delT								NRCAM (3881 upstream) : PNPLA8 (11364 downstream)																																			---	---	---	---
PNPLA8	50640	broad.mit.edu	37	7	108118312	108118313	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108118312_108118313delAC	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538			patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	108850396	108850396	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108850396delT								C7orf66 (325759 upstream) : EIF3IP1 (748888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109701226	109701231	+	IGR	DEL	ACACAC	-	-	rs113595688		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109701226_109701231delACACAC								EIF3IP1 (100956 upstream) : IMMP2L (601879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	110018479	110018480	+	IGR	INS	-	TGTG	TGTG	rs150438020	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110018479_110018480insTGTG								EIF3IP1 (418209 upstream) : IMMP2L (284630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	111340005	111340005	+	IGR	DEL	T	-	-	rs72418810		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111340005delT								IMMP2L (137467 upstream) : DOCK4 (26160 downstream)																																			---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111737467	111737467	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111737467delT	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	112314577	112314578	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112314577_112314578delCT								C7orf53 (183642 upstream) : TMEM168 (91211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	113433031	113433031	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113433031delA								LOC401397 (674394 upstream) : PPP1R3A (83851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115441187	115441188	+	IGR	INS	-	GT	GT	rs138945853	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115441187_115441188insGT								MDFIC (781924 upstream) : TFEC (134014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	116914372	116914373	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116914372_116914373insT								ST7 (44299 upstream) : WNT2 (2315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119871675	119871676	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119871675_119871676delAG								None (None upstream) : KCND2 (42046 downstream)																																			---	---	---	---
C7orf58	79974	broad.mit.edu	37	7	120696585	120696585	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120696585delC	uc003vjq.3	+						C7orf58_uc003vjr.1_Intron|C7orf58_uc003vjs.3_Intron	NM_024913	NP_079189			hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	121507262	121507263	+	IGR	INS	-	AAAT	AAAT	rs138842591	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121507262_121507263insAAAT								FAM3C (470840 upstream) : PTPRZ1 (5896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124335862	124335877	+	IGR	DEL	GAAGGAAGGAAGGAAA	-	-	rs13247257		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124335862_124335877delGAAGGAAGGAAGGAAA								TMEM229A (662339 upstream) : GPR37 (50239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124375883	124375883	+	IGR	DEL	A	-	-	rs74535164		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124375883delA								TMEM229A (702360 upstream) : GPR37 (10233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	124453252	124453252	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124453252delA								GPR37 (47571 upstream) : POT1 (9189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125684823	125684823	+	IGR	DEL	T	-	-	rs66698161		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125684823delT								None (None upstream) : GRM8 (393829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127058571	127058573	+	IGR	DEL	CCA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127058571_127058573delCCA								ZNF800 (25804 upstream) : GCC1 (162110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128022208	128022209	+	IGR	INS	-	T	T	rs148927457	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128022208_128022209insT								PRRT4 (20469 upstream) : IMPDH1 (10122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128204628	128204629	+	IGR	INS	-	TG	TG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128204628_128204629insTG								METTL2B (61651 upstream) : FLJ45340 (76666 downstream)																																			---	---	---	---
FAM71F1	84691	broad.mit.edu	37	7	128351713	128351722	+	Intron	DEL	ACACACACAC	-	-	rs112902860		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128351713_128351722delACACACACAC	uc003vnn.1	+						FAM71F1_uc010llo.1_Intron|FAM71F1_uc011koq.1_Intron|FAM71F1_uc003vnm.1_Intron					SubName: Full=HCG2039358, isoform CRA_b; SubName: Full=cDNA FLJ35842 fis, clone TESTI2006735;											skin(1)	1																		---	---	---	---
FLNC	2318	broad.mit.edu	37	7	128484475	128484475	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128484475delG	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449			gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12																		---	---	---	---
KCP	375616	broad.mit.edu	37	7	128548213	128548216	+	Intron	DEL	AGAG	-	-	rs141841849		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128548213_128548216delAGAG	uc011kor.1	-						KCP_uc011kos.1_Intron	NM_001135914	NP_001129386			cysteine rich BMP regulator 2 isoform 1							extracellular region				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129202480	129202481	+	IGR	INS	-	ACAC	ACAC	rs66596811		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129202480_129202481insACAC								FAM40B (74243 upstream) : NRF1 (49074 downstream)																																			---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129258045	129258047	+	Intron	DEL	TGA	-	-	rs34001638		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129258045_129258047delTGA	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129646057	129646061	+	IGR	DEL	TGTTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129646057_129646061delTGTTT								UBE2H (53268 upstream) : ZC3HC1 (12066 downstream)																																			---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130799698	130799698	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130799698delA	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	131178115	131178115	+	3'UTR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131178115delA	uc011kpm.1	+	18					MKLN1_uc011kpl.1_3'UTR|MKLN1_uc003vqs.2_3'UTR|MKLN1_uc003vqu.2_3'UTR	NM_013255	NP_037387			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131438392	131438392	+	IGR	DEL	T	-	-	rs144638874		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131438392delT								PODXL (197016 upstream) : PLXNA4 (369700 downstream)																																			---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131813285	131813296	+	3'UTR	DEL	AAGGGGAAAGAG	-	-	rs111713453		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131813285_131813296delAAGGGGAAAGAG	uc003vra.3	-	32					PLXNA4_uc003vqz.3_3'UTR	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132153494	132153495	+	Intron	DEL	CA	-	-	rs113442670		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132153494_132153495delCA	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	132774060	132774061	+	IGR	INS	-	TG	TG	rs145015916	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132774060_132774061insTG								CHCHD3 (7232 upstream) : EXOC4 (163762 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133022392	133022394	+	Intron	DEL	TTT	-	-	rs146110116		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133022392_133022394delTTT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133420842	133420842	+	Intron	DEL	A	-	-	rs74370468		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133420842delA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	133791707	133791707	+	IGR	DEL	T	-	-	rs112805821		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133791707delT								EXOC4 (41196 upstream) : LRGUK (20398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	134177631	134177631	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134177631delT								AKR1B1 (33743 upstream) : AKR1B10 (34713 downstream)																																			---	---	---	---
SLC13A4	26266	broad.mit.edu	37	7	135405303	135405305	+	Intron	DEL	AAA	-	-	rs33993859		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135405303_135405305delAAA	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron|SLC13A4_uc003vtc.1_Intron	NM_012450	NP_036582			solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0																		---	---	---	---
PTN	5764	broad.mit.edu	37	7	136934019	136934020	+	Intron	INS	-	GT	GT	rs138129789	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136934019_136934020insGT	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
SVOPL	136306	broad.mit.edu	37	7	138303450	138303451	+	Intron	DEL	CG	-	-	rs111732264		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138303450_138303451delCG	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928			SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	138887423	138887423	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138887423delT								TTC26 (12873 upstream) : UBN2 (28808 downstream)																																			---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139858712	139858712	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139858712delA	uc003vvm.2	-							NM_030647	NP_085150			jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
DENND2A	27147	broad.mit.edu	37	7	140327638	140327638	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140327638delT	uc010lnk.2	-						DENND2A_uc003vvw.2_Intron|DENND2A_uc003vvx.2_Intron	NM_015689	NP_056504			DENN/MADD domain containing 2A											ovary(3)|breast(1)	4	Melanoma(164;0.00956)																	---	---	---	---
BRAF	673	broad.mit.edu	37	7	140536321	140536322	+	Intron	INS	-	T	T	rs139195175	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140536321_140536322insT	uc003vwc.3	-							NM_004333	NP_004324			B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	140751867	140751869	+	IGR	DEL	TCA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140751867_140751869delTCA								MRPS33 (37086 upstream) : AGK (499209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	141024541	141024542	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141024541_141024542delTG								MRPS33 (309760 upstream) : AGK (226536 downstream)																																			---	---	---	---
AGK	55750	broad.mit.edu	37	7	141350621	141350621	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141350621delC	uc003vwi.2	+						AGK_uc011krg.1_Intron	NM_018238	NP_060708			acylglycerol kinase precursor						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	142134027	142134028	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142134027_142134028delTG	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc010lnz.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	142928421	142928450	+	IGR	DEL	CACCACACACATTCACACACACACACACAC	-	-	rs13228076		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142928421_142928450delCACCACACACATTCACACACACACACACAC								TAS2R40 (8279 upstream) : GSTK1 (32072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	143684950	143684950	+	IGR	DEL	T	-	-	rs112977010		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143684950delT								OR2F1 (26842 upstream) : OR6B1 (16140 downstream)																																			---	---	---	---
OR2A9P	441295	broad.mit.edu	37	7	144051934	144051951	+	Intron	DEL	CAACAACAACAACAACAT	-	-	rs143911900		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144051934_144051951delCAACAACAACAACAACAT	uc003wec.1	-						ARHGEF5_uc003wek.2_5'Flank|ARHGEF5_uc003wel.2_5'Flank					SubName: Full=Seven transmembrane helix receptor;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	144799691	144799693	+	IGR	DEL	CAA	-	-	rs67563442		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144799691_144799693delCAA								TPK1 (266545 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	144886998	144886999	+	IGR	DEL	TC	-	-	rs71908207		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144886998_144886999delTC								TPK1 (353852 upstream) : CNTNAP2 (926454 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	145453547	145453547	+	IGR	DEL	T	-	-	rs61217437	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145453547delT								TPK1 (920401 upstream) : CNTNAP2 (359906 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	145907929	145907930	+	Intron	INS	-	T	T	rs113950285		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145907929_145907930insT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146507392	146507392	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146507392delT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
ZNF767	79970	broad.mit.edu	37	7	149320313	149320313	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149320313delA	uc003wfy.3	-						ZNF767_uc003wfx.2_Intron|ZNF767_uc011kuq.1_Intron	NR_027789				Homo sapiens cDNA FLJ12700 fis, clone NT2RP1000721.											central_nervous_system(1)	1	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)															---	---	---	---
NOS3	4846	broad.mit.edu	37	7	150708457	150708458	+	Intron	INS	-	T	T	rs140765096	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150708457_150708458insT	uc003wif.2	+						NOS3_uc011kuy.1_Intron	NM_000603	NP_000594			nitric oxide synthase 3 isoform 1						anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)													---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151855607	151855608	+	Intron	INS	-	TT	TT	rs77253307		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151855607_151855608insTT	uc003wla.2	-						MLL3_uc003wkz.2_Intron|MLL3_uc003wkx.2_5'Flank|MLL3_uc003wky.2_Intron	NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151972669	151972670	+	Intron	INS	-	AAA	AAA	rs142502858	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151972669_151972670insAAA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152029936	152029937	+	Intron	INS	-	AC	AC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152029936_152029937insAC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152177685	152177714	+	IGR	DEL	ATAACATAACATAACATAACATAACATAAC	-	-	rs72167655		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152177685_152177714delATAACATAACATAACATAACATAACATAAC								LOC100128822 (15057 upstream) : XRCC2 (165875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	152567503	152567504	+	IGR	INS	-	TGTT	TGTT	rs149152420	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152567503_152567504insTGTT								ACTR3B (15040 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	153093779	153093779	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153093779delA								ACTR3B (541316 upstream) : DPP6 (490640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	153286480	153286480	+	IGR	DEL	C	-	-	rs78784323		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153286480delC								ACTR3B (734017 upstream) : DPP6 (297939 downstream)																																			---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154021953	154021953	+	Intron	DEL	T	-	-	rs143944650		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154021953delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron|DPP6_uc010lqh.1_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154415248	154415249	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154415248_154415249delAC	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154674760	154674771	+	Intron	DEL	TGCTCACACATT	-	-	rs61723982		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154674760_154674771delTGCTCACACATT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	155138115	155138116	+	IGR	INS	-	T	T	rs147310794	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155138115_155138116insT								INSIG1 (36173 upstream) : EN2 (112708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155584730	155584730	+	IGR	DEL	A	-	-	rs62481272		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155584730delA								RBM33 (10551 upstream) : SHH (8006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155872450	155872451	+	IGR	INS	-	TGTG	TGTG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155872450_155872451insTGTG								SHH (267483 upstream) : C7orf4 (460734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156361476	156361477	+	IGR	INS	-	T	T	rs140712145	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156361476_156361477insT								C7orf4 (27681 upstream) : C7orf13 (69585 downstream)																																			---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156636530	156636530	+	Intron	DEL	A	-	-	rs11288663		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156636530delA	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157948438	157948446	+	Intron	DEL	CACCATCAC	-	-	rs149426760	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157948438_157948446delCACCATCAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158460902	158460902	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158460902delC	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_5'Flank	NM_017760	NP_060230			leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
DLGAP2	9228	broad.mit.edu	37	8	1646335	1646335	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1646335delC	uc003wpl.2	+						DLGAP2_uc003wpm.2_Intron	NM_004745	NP_004736			discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1699920	1699921	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1699920_1699921delAC								DLGAP2 (43280 upstream) : CLN8 (11949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2239381	2239382	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2239381_2239382insA								MYOM2 (146002 upstream) : CSMD1 (553494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2258306	2258307	+	IGR	INS	-	A	A	rs147520347	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2258306_2258307insA								MYOM2 (164927 upstream) : CSMD1 (534569 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2997871	2997872	+	Intron	INS	-	TC	TC	rs145618802	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2997871_2997872insTC	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3268886	3268889	+	Intron	DEL	TTTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3268886_3268889delTTTC	uc011kwk.1	-						CSMD1_uc011kwj.1_5'Flank	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3355374	3355374	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3355374delT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5581684	5581685	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5581684_5581685insA								CSMD1 (729356 upstream) : MCPH1 (682436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5648626	5648627	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5648626_5648627delGT								CSMD1 (796298 upstream) : MCPH1 (615494 downstream)																																			---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8650698	8650698	+	Intron	DEL	T	-	-	rs10103169	byFrequency;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8650698delT	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8716862	8716863	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8716862_8716863insA	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
TNKS	8658	broad.mit.edu	37	8	9501108	9501110	+	Intron	DEL	ACC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9501108_9501110delACC	uc003wss.2	+						TNKS_uc011kwv.1_Intron|TNKS_uc011kww.1_Intron	NM_003747	NP_003738			tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)														---	---	---	---
TNKS	8658	broad.mit.edu	37	8	9633906	9633906	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9633906delT	uc003wss.2	+						TNKS_uc011kww.1_Intron	NM_003747	NP_003738			tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	10376827	10376828	+	Intron	DEL	TT	-	-	rs146754465		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10376827_10376828delTT	uc010lru.2	-											Homo sapiens cDNA, FLJ97155.																														---	---	---	---
GATA4	2626	broad.mit.edu	37	8	11546033	11546034	+	Intron	INS	-	CA	CA	rs145128130	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11546033_11546034insCA	uc003wub.1	+						GATA4_uc011kxb.1_Intron	NM_002052	NP_002043			GATA binding protein 4						atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)														---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12408791	12408794	+	Intron	DEL	TTTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12408791_12408794delTTTG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12421675	12421676	+	Intron	INS	-	T	T	rs149035109	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12421675_12421676insT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12426141	12426141	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12426141delG	uc003wvy.3	-						uc003wvz.1_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12431520	12431520	+	Intron	DEL	A	-	-	rs113159264		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12431520delA	uc003wvy.3	-						uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16515574	16515575	+	IGR	INS	-	C	C	rs139301919	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16515574_16515575insC								MSR1 (465274 upstream) : FGF20 (334759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	16740469	16740470	+	IGR	DEL	CA	-	-	rs112768801		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16740469_16740470delCA								MSR1 (690169 upstream) : FGF20 (109864 downstream)																																			---	---	---	---
EFHA2	286097	broad.mit.edu	37	8	16918311	16918311	+	Intron	DEL	T	-	-	rs113788935		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16918311delT	uc003wxd.2	+							NM_181723	NP_859074			EF-hand domain family, member A2							integral to membrane	calcium ion binding			skin(1)	1				Colorectal(111;0.0686)|COAD - Colon adenocarcinoma(73;0.239)														---	---	---	---
SLC7A2	6542	broad.mit.edu	37	8	17405294	17405295	+	Intron	INS	-	GTGT	GTGT	rs148997201	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17405294_17405295insGTGT	uc011kyc.1	+						SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Intron|SLC7A2_uc011kyf.1_Intron	NM_001008539	NP_001008539			solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	17973549	17973550	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17973549_17973550insT								ASAH1 (31042 upstream) : NAT1 (54421 downstream)																																			---	---	---	---
NAT2	10	broad.mit.edu	37	8	18247706	18247707	+	5'Flank	INS	-	AG	AG	rs137970074	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18247706_18247707insAG	uc003wyw.1	+							NM_000015	NP_000006			N-acetyltransferase 2						xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity			ovary(1)|skin(1)	2				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)										Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	8	19982863	19982863	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19982863delG								LPL (158094 upstream) : SLC18A1 (19504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20256452	20256452	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20256452delA								LZTS1 (143649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21081128	21081129	+	IGR	INS	-	AAC	AAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21081128_21081129insAAC								LZTS1 (968325 upstream) : GFRA2 (468401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21151114	21151115	+	IGR	INS	-	T	T	rs112707880		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21151114_21151115insT								None (None upstream) : GFRA2 (398415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21229806	21229820	+	IGR	DEL	TCTGCCATCTGACAA	-	-	rs140363822		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21229806_21229820delTCTGCCATCTGACAA								None (None upstream) : GFRA2 (319710 downstream)																																			---	---	---	---
XPO7	23039	broad.mit.edu	37	8	21797929	21797929	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21797929delA	uc003xaa.3	+						XPO7_uc010lti.2_Intron|XPO7_uc010ltj.1_Intron	NM_015024	NP_055839			exportin 7 isoform b						mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)														---	---	---	---
BMP1	649	broad.mit.edu	37	8	22030734	22030736	+	Intron	DEL	GCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22030734_22030736delGCT	uc003xbg.2	+						BMP1_uc011kzb.1_Intron|BMP1_uc003xba.2_Intron|BMP1_uc003xbb.2_Intron|BMP1_uc003xbe.2_Intron|BMP1_uc003xbc.2_Intron|BMP1_uc003xbd.2_Intron|BMP1_uc003xbf.2_Intron|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_Intron|BMP1_uc003xbi.2_Intron	NM_006129	NP_006120			bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)														---	---	---	---
PPP3CC	5533	broad.mit.edu	37	8	22303785	22303785	+	Intron	DEL	C	-	-	rs36055419		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22303785delC	uc003xbs.2	+						PPP3CC_uc003xbr.1_Intron|PPP3CC_uc011kzi.1_Intron|PPP3CC_uc003xbt.2_Intron	NM_005605	NP_005596			protein phosphatase 3, catalytic subunit, gamma						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	cytosol	calmodulin binding|metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)														---	---	---	---
LOXL2	4017	broad.mit.edu	37	8	23259745	23259748	+	Intron	DEL	CACA	-	-	rs140194400		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23259745_23259748delCACA	uc003xdh.1	-						ENTPD4_uc011kzu.1_Intron	NM_002318	NP_002309			lysyl oxidase-like 2 precursor						aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)														---	---	---	---
SLC25A37	51312	broad.mit.edu	37	8	23396036	23396037	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23396036_23396037delGT	uc003xdo.2	+						SLC25A37_uc003xdn.1_Intron|SLC25A37_uc003xdp.2_Intron|SLC25A37_uc010ltz.2_Intron	NM_016612	NP_057696			solute carrier family 25, member 37						ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23468401	23468402	+	IGR	INS	-	A	A	rs9650404	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23468401_23468402insA								SLC25A37 (38340 upstream) : NKX3-1 (67805 downstream)																																			---	---	---	---
NKX3-1	4824	broad.mit.edu	37	8	23540897	23540898	+	5'Flank	INS	-	CT	CT	rs150663494	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23540897_23540898insCT	uc011kzx.1	-						NKX3-1_uc003xdv.1_5'Flank	NM_006167	NP_006158			NK3 homeobox 1						negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23934128	23934128	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23934128delT								STC1 (221808 upstream) : ADAM28 (217452 downstream)																																			---	---	---	---
ADAM7	8756	broad.mit.edu	37	8	24352226	24352226	+	Intron	DEL	A	-	-	rs35824095		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24352226delA	uc003xeb.2	+						ADAM7_uc003xec.2_Intron	NM_003817	NP_003808			a disintegrin and metalloproteinase domain 7						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	24598174	24598177	+	IGR	DEL	TGAA	-	-	rs112367983		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24598174_24598177delTGAA								ADAM7 (213693 upstream) : NEFM (173097 downstream)																																			---	---	---	---
NEFL	4747	broad.mit.edu	37	8	24816333	24816336	+	5'Flank	DEL	TTTC	-	-	rs66575263		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24816333_24816336delTTTC	uc003xee.2	-							NM_006158	NP_006149			neurofilament, light polypeptide 68kDa						anterograde axon cargo transport|axon transport of mitochondrion|neurofilament bundle assembly|retrograde axon cargo transport|synaptic transmission	cytosol|neurofilament	identical protein binding|protein C-terminus binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	24880945	24880945	+	IGR	DEL	A	-	-	rs76410235		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24880945delA								NEFL (66814 upstream) : DOCK5 (161342 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	26335988	26335989	+	IGR	INS	-	AC	AC	rs139634425	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26335988_26335989insAC								BNIP3L (65344 upstream) : PNMA2 (26207 downstream)																																			---	---	---	---
TRIM35	23087	broad.mit.edu	37	8	27145997	27145997	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27145997delG	uc003xfl.1	-						TRIM35_uc010lup.1_Intron	NM_171982	NP_741983			tripartite motif-containing 35 isoform 2						apoptosis|induction of apoptosis|negative regulation of mitotic cell cycle	cytoplasm|nucleus	zinc ion binding				0		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)														---	---	---	---
PBK	55872	broad.mit.edu	37	8	27676845	27676849	+	Intron	DEL	AACTT	-	-	rs10549827		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27676845_27676849delAACTT	uc003xgi.2	-						PBK_uc011lap.1_Intron	NM_018492	NP_060962			PDZ binding kinase						mitosis		ATP binding|protein binding|protein serine/threonine kinase activity				0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|KIRC - Kidney renal clear cell carcinoma(542;0.101)|Kidney(114;0.121)|Colorectal(74;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28113951	28113954	+	IGR	DEL	GGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28113951_28113954delGGAA								ELP3 (65284 upstream) : PNOC (60695 downstream)																																			---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	28985453	28985453	+	Intron	DEL	A	-	-	rs140665351	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28985453delA	uc003xhh.3	-						uc003xhi.1_Intron	NM_015254	NP_056069			kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	31387332	31387333	+	IGR	INS	-	ACACAC	ACACAC	rs62506843	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31387332_31387333insACACAC								WRN (356056 upstream) : NRG1 (109935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33062701	33062702	+	IGR	INS	-	T	T	rs5890715		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33062701_33062702insT								NRG1 (440143 upstream) : FUT10 (165644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34145923	34145923	+	IGR	DEL	A	-	-	rs34266120		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34145923delA								DUSP26 (688484 upstream) : UNC5D (947052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34459489	34459494	+	IGR	DEL	ACACAC	-	-	rs150742990		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34459489_34459494delACACAC								None (None upstream) : UNC5D (633481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34520291	34520292	+	IGR	INS	-	A	A	rs145769476	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34520291_34520292insA								None (None upstream) : UNC5D (572683 downstream)																																			---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35444802	35444803	+	Intron	DEL	AC	-	-	rs35992580		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35444802_35444803delAC	uc003xjr.1	+						UNC5D_uc003xjs.1_Intron	NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	37474931	37474932	+	IGR	INS	-	A	A	rs138525479		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37474931_37474932insA								KCNU1 (681290 upstream) : ZNF703 (78369 downstream)																																			---	---	---	---
GOT1L1	137362	broad.mit.edu	37	8	37798620	37798621	+	5'Flank	INS	-	T	T	rs71216641		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37798620_37798621insT	uc011lbj.1	-							NM_152413	NP_689626			glutamic-oxaloacetic transaminase 1-like 1						biosynthetic process|cellular amino acid metabolic process	cytoplasm	pyridoxal phosphate binding|transaminase activity			ovary(1)	1	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	38464046	38464047	+	IGR	INS	-	GGCATGTG	GGCATGTG	rs150922347	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38464046_38464047insGGCATGTG								RNF5P1 (5271 upstream) : TACC1 (121657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	38581903	38581903	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38581903delA								RNF5P1 (123128 upstream) : TACC1 (3801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	38750780	38750781	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38750780_38750781delAC								TACC1 (40235 upstream) : PLEKHA2 (7972 downstream)																																			---	---	---	---
CHRNB3	1142	broad.mit.edu	37	8	42550377	42550377	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42550377delT	uc003xpi.1	+							NM_000749	NP_000740			cholinergic receptor, nicotinic, beta						synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
POTEA	340441	broad.mit.edu	37	8	43162350	43162350	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43162350delT	uc003xpz.1	+						POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365			POTE ankyrin domain family, member A isoform 2											ovary(1)	1																		---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48689773	48689774	+	Intron	INS	-	T	T	rs13260489		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48689773_48689774insT	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835			protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
PRKDC	5591	broad.mit.edu	37	8	48783344	48783345	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48783344_48783345delAC	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835			protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)											NHEJ					---	---	---	---
EFCAB1	79645	broad.mit.edu	37	8	49642082	49642082	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49642082delA	uc003xqo.2	-						EFCAB1_uc003xqn.3_Intron|EFCAB1_uc011ldj.1_Intron|EFCAB1_uc010lxx.2_Intron|EFCAB1_uc011ldk.1_Intron	NM_024593	NP_078869			EF-hand calcium binding domain 1 isoform a								calcium ion binding				0		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	50324042	50324042	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50324042delT								C8orf22 (335401 upstream) : SNTG1 (498307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	53502591	53502591	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53502591delT								FAM150A (24570 upstream) : RB1CC1 (32428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	53734581	53734581	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53734581delT								RB1CC1 (107555 upstream) : NPBWR1 (117887 downstream)																																			---	---	---	---
TCEA1	6917	broad.mit.edu	37	8	54916308	54916308	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54916308delG	uc003xru.2	-						TCEA1_uc003xrv.2_Intron|TCEA1_uc011ldw.1_Intron|TCEA1_uc003xrw.1_Intron	NM_006756	NP_006747			transcription elongation factor A 1 isoform 1						positive regulation of viral transcription|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	nucleoplasm	DNA binding|translation elongation factor activity|zinc ion binding				0		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)					T	PLAG1	salivary adenoma								---	---	---	---
Unknown	0	broad.mit.edu	37	8	55121114	55121115	+	IGR	DEL	TT	-	-	rs35342201		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55121114_55121115delTT								MRPL15 (60040 upstream) : SOX17 (249380 downstream)																																			---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56331451	56331451	+	Intron	DEL	T	-	-	rs11302035		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56331451delT	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	58397460	58397461	+	IGR	INS	-	A	A	rs34768965		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58397460_58397461insA								C8orf71 (200172 upstream) : FAM110B (509652 downstream)																																			---	---	---	---
TOX	9760	broad.mit.edu	37	8	59766855	59766855	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59766855delA	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
TOX	9760	broad.mit.edu	37	8	59949727	59949727	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59949727delT	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
TOX	9760	broad.mit.edu	37	8	59953633	59953636	+	Intron	DEL	GTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59953633_59953636delGTGT	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	62024738	62024739	+	IGR	INS	-	ACAC	ACAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62024738_62024739insACAC								CHD7 (245275 upstream) : CLVS1 (175786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62038523	62038523	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62038523delT								CHD7 (259060 upstream) : CLVS1 (162002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62659453	62659454	+	IGR	DEL	AG	-	-	rs35122374		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62659453_62659454delAG								ASPH (32254 upstream) : NKAIN3 (502047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	63954712	63954712	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63954712delT								GGH (3102 upstream) : TTPA (18719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64132454	64132455	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64132454_64132455insT								YTHDF3 (7109 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64260526	64260529	+	IGR	DEL	CTTC	-	-	rs71817864		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64260526_64260529delCTTC								YTHDF3 (135181 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65923184	65923184	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65923184delA								CYP7B1 (211836 upstream) : ARMC1 (591888 downstream)																																			---	---	---	---
MTFR1	9650	broad.mit.edu	37	8	66599583	66599583	+	Intron	DEL	T	-	-	rs149661096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66599583delT	uc003xvm.2	+						MTFR1_uc011lep.1_Intron|MTFR1_uc003xvn.2_Intron|MTFR1_uc003xvo.1_Intron	NM_014637	NP_055452			mitochondrial fission regulator 1 isoform 1							mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	67457900	67457900	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67457900delC								C8orf46 (27143 upstream) : MYBL1 (16511 downstream)																																			---	---	---	---
CPA6	57094	broad.mit.edu	37	8	68436856	68436857	+	Intron	INS	-	TT	TT	rs55969800	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68436856_68436857insTT	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094			carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	70347045	70347045	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70347045delA								C8orf34 (615789 upstream) : SULF1 (31814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	73155789	73155789	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73155789delA	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	74260106	74260107	+	Intron	INS	-	T	T	rs139643931	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74260106_74260107insT	uc003xzk.1	-											Homo sapiens cDNA FLJ46349 fis, clone TESTI4047746.																														---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74355739	74355739	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74355739delG	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75102860	75102860	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75102860delA								LY96 (161555 upstream) : JPH1 (44081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75796985	75796985	+	IGR	DEL	T	-	-	rs59556630		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75796985delT								PI15 (29723 upstream) : CRISPLD1 (99858 downstream)																																			---	---	---	---
CRISPLD1	83690	broad.mit.edu	37	8	75903232	75903232	+	Intron	DEL	T	-	-	rs113323931		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75903232delT	uc003yan.2	+							NM_031461	NP_113649			cysteine-rich secretory protein LCCL domain							extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	76886739	76886740	+	IGR	INS	-	TTTG	TTTG	rs146644489	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76886739_76886740insTTTG								HNF4G (407680 upstream) : LOC100192378 (636375 downstream)																																			---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77665866	77665866	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77665866delT	uc003yav.2	+						ZFHX4_uc003yau.1_Intron|ZFHX4_uc003yaw.1_Intron	NM_024721	NP_078997			zinc finger homeodomain 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	79997781	79997781	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79997781delG								IL7 (280023 upstream) : STMN2 (525599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80193882	80193882	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80193882delC								IL7 (476124 upstream) : STMN2 (329498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81174833	81174833	+	IGR	DEL	T	-	-	rs35164028		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81174833delT								TPD52 (90997 upstream) : ZBTB10 (223021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81449822	81449823	+	IGR	INS	-	A	A	rs74469563		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81449822_81449823insA								ZBTB10 (15214 upstream) : ZNF704 (100946 downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85547590	85547591	+	Intron	INS	-	AAC	AAC	rs149525156	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85547590_85547591insAAC	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85628497	85628497	+	Intron	DEL	A	-	-	rs112805587		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85628497delA	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85670872	85670873	+	Intron	INS	-	CAGC	CAGC	rs149119094	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85670872_85670873insCAGC	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	87252229	87252230	+	IGR	DEL	AC	-	-	rs113361303		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87252229_87252230delAC								SLC7A13 (9620 upstream) : WWP1 (102764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	87483377	87483377	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87483377delT								WWP1 (3201 upstream) : FAM82B (1202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	89946377	89946378	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89946377_89946378insT								MMP16 (606660 upstream) : RIPK2 (823597 downstream)																																			---	---	---	---
DECR1	1666	broad.mit.edu	37	8	91034576	91034577	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91034576_91034577delTG	uc003yek.1	+						DECR1_uc011lgc.1_Intron|DECR1_uc011lgd.1_Intron	NM_001359	NP_001350			2,4-dienoyl CoA reductase 1 precursor						fatty acid beta-oxidation|protein homotetramerization	mitochondrial matrix|nucleus|plasma membrane	2,4-dienoyl-CoA reductase (NADPH) activity|NADPH binding|oxidoreductase activity, acting on NADH or NADPH				0			BRCA - Breast invasive adenocarcinoma(11;0.00953)															---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92222791	92222798	+	Intron	DEL	ACACACAC	-	-	rs62526738		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92222791_92222798delACACACAC	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|LRRC69_uc010mal.1_Intron|LRRC69_uc003yev.1_Intron|LRRC69_uc003yew.1_Intron	NM_052832	NP_439897			solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
SLC26A7	115111	broad.mit.edu	37	8	92226585	92226585	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92226585delG	uc003yex.2	+						SLC26A7_uc003yey.2_Intron|LRRC69_uc010mal.1_Intron|LRRC69_uc003yev.1_Intron|LRRC69_uc003yew.1_Intron	NM_052832	NP_439897			solute carrier family 26, member 7 isoform a							basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	92759182	92759183	+	IGR	INS	-	TG	TG	rs141782242	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92759182_92759183insTG								SLC26A7 (348802 upstream) : RUNX1T1 (211969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	95819498	95819498	+	IGR	DEL	T	-	-	rs5893301		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95819498delT								DPY19L4 (13422 upstream) : INTS8 (16036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	95831824	95831824	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95831824delT								DPY19L4 (25748 upstream) : INTS8 (3710 downstream)																																			---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97602852	97602852	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97602852delG	uc003yhv.1	+						SDC2_uc011lgu.1_Intron	NM_002998	NP_002989			syndecan 2 precursor							integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
NIPAL2	79815	broad.mit.edu	37	8	99280851	99280851	+	Intron	DEL	A	-	-	rs113001531		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99280851delA	uc003yil.1	-						NIPAL2_uc003yim.1_Intron	NM_024759	NP_079035			NIPA-like domain containing 2							integral to membrane					0																		---	---	---	---
STK3	6788	broad.mit.edu	37	8	99554682	99554682	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99554682delT	uc003yip.2	-						STK3_uc003yio.2_Intron	NM_006281	NP_006272			serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	101359262	101359265	+	IGR	DEL	TGTT	-	-	rs34605915		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101359262_101359265delTGTT								RNF19A (36935 upstream) : ANKRD46 (162722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	101518427	101518427	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101518427delA								RNF19A (196100 upstream) : ANKRD46 (3560 downstream)																																			---	---	---	---
RRM2B	50484	broad.mit.edu	37	8	103225978	103225979	+	Intron	INS	-	C	C	rs147612023	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103225978_103225979insC	uc003ykn.2	-						RRM2B_uc003yko.2_Intron|RRM2B_uc010mbv.1_Intron|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528			ribonucleotide reductase M2 B (TP53 inducible)						deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)										Direct_reversal_of_damage|Modulation_of_nucleotide_pools					---	---	---	---
Unknown	0	broad.mit.edu	37	8	103465016	103465016	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103465016delT								UBR5 (40521 upstream) : ODF1 (98832 downstream)																																			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	105020081	105020081	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105020081delT	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105621638	105621639	+	IGR	INS	-	T	T	rs141382492		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105621638_105621639insT								LRP12 (20418 upstream) : ZFPM2 (709508 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106546504	106546505	+	Intron	INS	-	TCCC	TCCC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106546504_106546505insTCCC	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	106883780	106883781	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106883780_106883781delAC								ZFPM2 (67015 upstream) : OXR1 (398692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	106898306	106898307	+	IGR	INS	-	A	A	rs147099864	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106898306_106898307insA								ZFPM2 (81541 upstream) : OXR1 (384166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108208085	108208086	+	IGR	INS	-	T	T	rs79624260		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108208085_108208086insT								ABRA (425613 upstream) : ANGPT1 (53625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108746788	108746789	+	IGR	INS	-	A	A	rs139539040	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108746788_108746789insA								ANGPT1 (236534 upstream) : RSPO2 (164756 downstream)																																			---	---	---	---
TTC35	9694	broad.mit.edu	37	8	109468577	109468577	+	Intron	DEL	G	-	-	rs59637017		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109468577delG	uc003ymw.1	+							NM_014673	NP_055488			tetratricopeptide repeat domain 35							endoplasmic reticulum|nucleus	binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.34e-10)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	109873713	109873714	+	IGR	INS	-	TG	TG	rs139802546	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109873713_109873714insTG								TMEM74 (73943 upstream) : TRHR (226025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110361051	110361051	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110361051delA								ENY2 (5141 upstream) : PKHD1L1 (13655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110717484	110717484	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110717484delG								SYBU (13464 upstream) : KCNV1 (261751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111491202	111491202	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111491202delT								KCNV1 (503126 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111632346	111632347	+	IGR	DEL	TG	-	-	rs150973904		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111632346_111632347delTG								KCNV1 (644270 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112149676	112149677	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112149676_112149677insT								None (None upstream) : None (None downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113433404	113433405	+	Intron	INS	-	T	T	rs142925405	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113433404_113433405insT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114533798	114533798	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114533798delG								CSMD3 (84556 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115036744	115036745	+	IGR	DEL	AC	-	-	rs5894186		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115036744_115036745delAC								CSMD3 (587502 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116358343	116358344	+	IGR	INS	-	A	A	rs118087787		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116358343_116358344insA								None (None upstream) : TRPS1 (62381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116401614	116401614	+	IGR	DEL	T	-	-	rs35934624		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116401614delT								None (None upstream) : TRPS1 (19111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118391285	118391285	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118391285delA								SLC30A8 (202333 upstream) : MED30 (141680 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	119110998	119110998	+	Intron	DEL	A	-	-	rs11365839		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119110998delA	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119249542	119249542	+	Intron	DEL	T	-	-	rs67070272		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119249542delT	uc010mda.1	-						SAMD12_uc010mdb.1_Intron	NM_001101676	NP_001095146			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
ENPP2	5168	broad.mit.edu	37	8	120612247	120612247	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120612247delA	uc003yot.1	-						ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181			autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	121128598	121128598	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121128598delT								DEPDC6 (65442 upstream) : COL14A1 (8754 downstream)																																			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121679986	121679987	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121679986_121679987insT	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301			basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	121876088	121876089	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs144550710	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121876088_121876089insTGTGTGTGTG								SNTB1 (51779 upstream) : HAS2 (749182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122351260	122351260	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122351260delG								SNTB1 (526951 upstream) : HAS2 (274011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122623079	122623083	+	IGR	DEL	TTTTG	-	-	rs111459338		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122623079_122623083delTTTTG								SNTB1 (798770 upstream) : HAS2 (2188 downstream)																																			---	---	---	---
HAS2	3037	broad.mit.edu	37	8	122652661	122652664	+	Intron	DEL	GTGT	-	-	rs35845896		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122652661_122652664delGTGT	uc003yph.2	-						HAS2AS_uc003ypi.1_Intron	NM_005328	NP_005319			hyaluronan synthase 2							integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	123233997	123233998	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123233997_123233998insT								HAS2AS (577064 upstream) : ZHX2 (559903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123540653	123540653	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123540653delT								HAS2AS (883720 upstream) : ZHX2 (253248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123587961	123587962	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123587961_123587962insA								HAS2AS (931028 upstream) : ZHX2 (205939 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125618413	125618413	+	Intron	DEL	T	-	-	rs4871514		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125618413delT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126508569	126508569	+	IGR	DEL	A	-	-	rs111820546		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126508569delA								TRIB1 (57927 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	126701220	126701221	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126701220_126701221delGT								TRIB1 (250578 upstream) : FAM84B (863466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128147098	128147099	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128147098_128147099insA								FAM84B (576632 upstream) : LOC727677 (154963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128226544	128226545	+	Intron	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128226544_128226545delGA	uc003ysa.1	-											Homo sapiens cDNA FLJ43320 fis, clone NT2RI2024935.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	128274051	128274051	+	IGR	DEL	C	-	-	rs34459425		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128274051delC								FAM84B (703585 upstream) : LOC727677 (28011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128337049	128337050	+	Intron	INS	-	AG	AG	rs148869318	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128337049_128337050insAG	uc003ysc.1	-						uc003ysd.1_Intron|LOC727677_uc003yse.1_Intron					Homo sapiens isolate DGPc1_8_exons1-2-3-4-6-8 unknown mRNA, alternatively spliced.																														---	---	---	---
PVT1	5820	broad.mit.edu	37	8	128923158	128923159	+	Intron	INS	-	GA	GA	rs150373603	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128923158_128923159insGA	uc010mdq.2	+						PVT1_uc003ysl.2_Intron|PVT1_uc010mdp.1_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
PVT1	5820	broad.mit.edu	37	8	129066564	129066565	+	Intron	INS	-	C	C	rs56873750		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129066564_129066565insC	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	129149635	129149635	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129149635delT								PVT1 (36137 upstream) : MIR1208 (12727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129189138	129189139	+	IGR	INS	-	T	T	rs35562823		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129189138_129189139insT								MIR1208 (26704 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129926999	129926999	+	IGR	DEL	T	-	-	rs35165762		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129926999delT								MIR1208 (764565 upstream) : GSDMC (833444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130220774	130220774	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130220774delT								None (None upstream) : GSDMC (539669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130746955	130746956	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130746955_130746956insT								None (None upstream) : GSDMC (13487 downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131144641	131144643	+	Intron	DEL	AAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131144641_131144643delAAC	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	131533394	131533394	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131533394delA								ASAP1 (119178 upstream) : ADCY8 (259154 downstream)																																			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131864976	131864976	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131864976delT	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131871147	131871160	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs142237701		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131871147_131871160delTGTGTGTGTGTGTG	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134860935	134860935	+	IGR	DEL	A	-	-	rs72177193		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134860935delA								ST3GAL1 (276752 upstream) : ZFAT (629098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135395256	135395257	+	IGR	INS	-	AC	AC	rs142254262	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135395256_135395257insAC								ST3GAL1 (811073 upstream) : ZFAT (94776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135898615	135898615	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135898615delA								MIR30D (81427 upstream) : LOC286094 (347759 downstream)																																	OREG0019009	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136522218	136522218	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136522218delT	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	136875919	136875920	+	IGR	DEL	GT	-	-	rs67890986		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136875919_136875920delGT								KHDRBS3 (216073 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136954247	136954247	+	IGR	DEL	A	-	-	rs34721937		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136954247delA								KHDRBS3 (294401 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138415229	138415230	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138415229_138415230insA								None (None upstream) : FAM135B (727038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138956553	138956553	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138956553delT								None (None upstream) : FAM135B (185715 downstream)																																			---	---	---	---
KCNK9	51305	broad.mit.edu	37	8	140709591	140709602	+	Intron	DEL	TGGATGGATGGA	-	-	rs111229425		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140709591_140709602delTGGATGGATGGA	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685			potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)															---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140920852	140920853	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140920852_140920853insA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141073074	141073091	+	Intron	DEL	AAGCCTCAGGAAACTTAC	-	-	rs66870981		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141073074_141073091delAAGCCTCAGGAAACTTAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141761178	141761178	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141761178delA	uc003yvu.2	-						PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141995053	141995053	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141995053delA	uc003yvu.2	-						PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
DENND3	22898	broad.mit.edu	37	8	142166890	142166891	+	Intron	INS	-	T	T	rs34035594		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142166890_142166891insT	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003yvz.1_5'Flank	NM_014957	NP_055772			DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142864353	142864356	+	IGR	DEL	CCAT	-	-	rs147307319		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142864353_142864356delCCAT								FLJ43860 (347023 upstream) : MIR1302-7 (3247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143067840	143067843	+	IGR	DEL	TGTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143067840_143067843delTGTG								MIR1302-7 (200166 upstream) : NCRNA00051 (211874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143873191	143873205	+	IGR	DEL	CATCCATCCATCCTC	-	-	rs57621851		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143873191_143873205delCATCCATCCATCCTC								LY6D (5183 upstream) : GML (43012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144389256	144389257	+	IGR	INS	-	GGCAGAGGATCCCACGTGGCAGAGAAGAGGGC	GGCAGAGGATCCCACGTGGCAGAGAAGAGGGC	rs11988080		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144389256_144389257insGGCAGAGGATCCCACGTGGCAGAGAAGAGGGC								ZNF696 (7138 upstream) : TOP1MT (2273 downstream)																																			---	---	---	---
RHPN1	114822	broad.mit.edu	37	8	144459311	144459312	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144459311_144459312delTG	uc003yyb.2	+							NM_052924	NP_443156			rhophilin 1						signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)															---	---	---	---
ZC3H3	23144	broad.mit.edu	37	8	144604786	144604786	+	Intron	DEL	C	-	-	rs77082065		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144604786delC	uc003yyd.2	-							NM_015117	NP_055932			zinc finger CCCH-type containing 3						mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)															---	---	---	---
COMMD5	28991	broad.mit.edu	37	8	146087776	146087776	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146087776delT	uc010mgf.2	-							NM_014066	NP_054785			COMM domain containing 5							nucleus	protein binding			ovary(1)	1	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)															---	---	---	---
ZNF16	7564	broad.mit.edu	37	8	146172390	146172391	+	Intron	DEL	CT	-	-	rs66905525		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146172390_146172391delCT	uc003zet.2	-						ZNF16_uc003zeu.2_Intron	NM_001029976	NP_001025147			zinc finger protein 16						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)														---	---	---	---
DMRT1	1761	broad.mit.edu	37	9	923477	923478	+	Intron	INS	-	GTGTT	GTGTT	rs149523575	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:923477_923478insGTGTT	uc003zgv.2	+							NM_021951	NP_068770			doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	2939684	2939686	+	IGR	DEL	AGG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2939684_2939686delAGG								KIAA0020 (95554 upstream) : RFX3 (284963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	3019636	3019645	+	IGR	DEL	TTTTTTTTTC	-	-	rs6150892		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3019636_3019645delTTTTTTTTTC								KIAA0020 (175506 upstream) : RFX3 (205004 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9702127	9702128	+	Intron	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9702127_9702128delAG	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14847398	14847399	+	Intron	INS	-	GAAGGAAGGAAGGAAG	GAAGGAAGGAAGGAAG	rs34089648		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14847398_14847399insGAAGGAAGGAAGGAAG	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
TTC39B	158219	broad.mit.edu	37	9	15275041	15275041	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15275041delT	uc003zlr.1	-						TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_Intron|TTC39B_uc010mig.1_5'Flank|TTC39B_uc011lms.1_Intron	NM_152574	NP_689787			tetratricopeptide repeat domain 39B								binding			ovary(1)	1																		---	---	---	---
C9orf93	203238	broad.mit.edu	37	9	15900510	15900510	+	Intron	DEL	A	-	-	rs143012427		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15900510delA	uc003zmd.2	+						C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron	NM_173550	NP_775821			hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)														---	---	---	---
BNC2	54796	broad.mit.edu	37	9	16733883	16733883	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16733883delA	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc003zmq.1_Intron|BNC2_uc003zmr.1_Intron|BNC2_uc003zmp.1_Intron|BNC2_uc010mij.1_Intron|BNC2_uc003zmu.1_Intron|BNC2_uc010mim.1_Intron|BNC2_uc010min.1_Intron	NM_017637	NP_060107			basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	16932978	16932978	+	IGR	DEL	A	-	-	rs112082859		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16932978delA								BNC2 (62192 upstream) : CNTLN (202060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	17539087	17539087	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17539087delC								CNTLN (35172 upstream) : SH3GL2 (39866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	19257354	19257354	+	IGR	DEL	A	-	-	rs72416705		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19257354delA								PLIN2 (129781 upstream) : DENND4C (33348 downstream)																																			---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20776850	20776851	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20776850_20776851insT	uc003zog.1	+							NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20887241	20887241	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20887241delT	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	23209384	23209385	+	IGR	DEL	AC	-	-	rs111636601		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23209384_23209385delAC								DMRTA1 (756912 upstream) : ELAVL2 (480720 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28189667	28189668	+	Intron	INS	-	AGGA	AGGA	rs71480398	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28189667_28189668insAGGA	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	31831798	31831799	+	IGR	INS	-	A	A	rs151299625	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31831798_31831799insA								None (None upstream) : ACO1 (552802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32727451	32727452	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32727451_32727452insT								TAF1L (91784 upstream) : TMEM215 (56045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32740725	32740725	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32740725delA								TAF1L (105058 upstream) : TMEM215 (42772 downstream)																																			---	---	---	---
UBAP2	55833	broad.mit.edu	37	9	33940059	33940061	+	Intron	DEL	AAG	-	-	rs147216266		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33940059_33940061delAAG	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron|UBAP2_uc003zts.2_Intron	NM_018449	NP_060919			ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35226351	35226352	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35226351_35226352delGT	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368			UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
PAX5	5079	broad.mit.edu	37	9	36890600	36890600	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36890600delT	uc003zzo.1	-						PAX5_uc011lpt.1_Intron|PAX5_uc011lpu.1_Intron|PAX5_uc011lpv.1_Intron|PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953			paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(20)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)				T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								---	---	---	---
PAX5	5079	broad.mit.edu	37	9	37033596	37033597	+	Intron	INS	-	AC	AC	rs143530662	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37033596_37033597insAC	uc003zzo.1	-						PAX5_uc011lpw.1_Intron|PAX5_uc011lpx.1_Intron|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Intron|PAX5_uc011lpz.1_Intron|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_Intron|PAX5_uc011lqb.1_Intron|PAX5_uc010mlo.1_Intron|PAX5_uc010mlp.1_Intron|PAX5_uc011lqc.1_Intron|PAX5_uc010mlr.1_Intron	NM_016734	NP_057953			paired box 5						cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(8)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)				T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	9	38538798	38538798	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38538798delA								IGFBPL1 (114354 upstream) : C9orf122 (82287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	43823712	43823712	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43823712delA	uc004acz.1	+											Homo sapiens cDNA FLJ30083 fis, clone BGGI12001097, weakly similar to Homo sapiens contactin associated protein (Caspr) mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	47209230	47209231	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:47209230_47209231insT								KGFLP1 (460845 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66529266	66529271	+	Intron	DEL	TAAGTT	-	-	rs147589571		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66529266_66529271delTAAGTT	uc010mnh.1	-						uc004aef.2_Intron					Homo sapiens cDNA FLJ20444 fis, clone KAT05128.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66797667	66797668	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66797667_66797668delTT								LOC442421 (294640 upstream) : AQP7P1 (456599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	67216679	67216679	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67216679delG								LOC442421 (713652 upstream) : AQP7P1 (37588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68390420	68390421	+	IGR	INS	-	T	T	rs145073692	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68390420_68390421insT								FAM27B (596231 upstream) : MIR1299 (611818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68408397	68408397	+	5'Flank	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68408397delC	uc004aew.1	+											Homo sapiens cDNA, FLJ98602.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	68694632	68694632	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68694632delG								FAM27B (900443 upstream) : MIR1299 (307607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68836179	68836180	+	IGR	INS	-	AAA	AAA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68836179_68836180insAAA								None (None upstream) : MIR1299 (166059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69509623	69509623	+	IGR	DEL	A	-	-	rs147013303		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69509623delA								ANKRD20A4 (84515 upstream) : LOC100133920 (141738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69540143	69540144	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69540143_69540144insT								ANKRD20A4 (115035 upstream) : LOC100133920 (111217 downstream)																																			---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73621436	73621439	+	Intron	DEL	AAAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73621436_73621439delAAAC	uc004aid.2	-						TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73920236	73920237	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73920236_73920237insT	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	74111090	74111091	+	IGR	INS	-	A	A	rs146492940		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74111090_74111091insA								TRPM3 (49270 upstream) : TMEM2 (187191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	74616671	74616672	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74616671_74616672delGT								C9orf85 (17281 upstream) : C9orf57 (49626 downstream)																																			---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77360379	77360380	+	Intron	DEL	GT	-	-	rs71861907		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77360379_77360380delGT	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Intron	NM_017662	NP_060132			transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77414486	77414489	+	Intron	DEL	ACAT	-	-	rs112113061		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77414486_77414489delACAT	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Intron	NM_017662	NP_060132			transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	81138877	81138877	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81138877delA								PSAT1 (193870 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83086974	83086975	+	IGR	DEL	AC	-	-	rs111417336		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83086974_83086975delAC								TLE4 (745317 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84476979	84476979	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84476979delG								TLE1 (173383 upstream) : FLJ43950 (51373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84581060	84581061	+	Intron	INS	-	T	T	rs113304302		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84581060_84581061insT	uc004ami.1	-											Homo sapiens cDNA FLJ40128 fis, clone TESTI2011407.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	86847005	86847005	+	IGR	DEL	T	-	-	rs11365156		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86847005delT								RMI1 (228023 upstream) : SLC28A3 (46087 downstream)																																			---	---	---	---
SLC28A3	64078	broad.mit.edu	37	9	86939565	86939565	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86939565delA	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron|SLC28A3_uc010mqb.2_Intron	NM_022127	NP_071410			concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4																		---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87566460	87566461	+	Intron	INS	-	TG	TG	rs139500640	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87566460_87566461insTG	uc004aoa.1	+						NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron	NM_001018064	NP_001018074			neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87609606	87609606	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87609606delT	uc004aoa.1	+						NTRK2_uc004anz.1_Intron	NM_001018064	NP_001018074			neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87828012	87828013	+	IGR	DEL	CA	-	-	rs71499843		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87828012_87828013delCA								NTRK2 (189507 upstream) : AGTPBP1 (333442 downstream)																																			---	---	---	---
AGTPBP1	23287	broad.mit.edu	37	9	88165107	88165108	+	Intron	INS	-	GA	GA	rs72089458		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88165107_88165108insGA	uc011ltd.1	-						AGTPBP1_uc004aod.3_Intron|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054			ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89212845	89212846	+	IGR	INS	-	C	C	rs149137860	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89212845_89212846insC								ZCCHC6 (243467 upstream) : GAS1 (346433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89849935	89849936	+	Intron	DEL	TA	-	-	rs111591940	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89849935_89849936delTA	uc004apb.1	-											Homo sapiens cDNA clone IMAGE:30346008.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	91601734	91601735	+	IGR	INS	-	AA	AA	rs150766267		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91601734_91601735insAA								LOC286238 (334659 upstream) : C9orf47 (4043 downstream)																																			---	---	---	---
SHC3	53358	broad.mit.edu	37	9	91674670	91674670	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91674670delG	uc004aqg.2	-							NM_016848	NP_058544			src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	91868143	91868144	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91868143_91868144delGT								SHC3 (74461 upstream) : CKS2 (57969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93457861	93457862	+	IGR	DEL	AA	-	-	rs144557027		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93457861_93457862delAA								DIRAS2 (52753 upstream) : SYK (106150 downstream)																																			---	---	---	---
AUH	549	broad.mit.edu	37	9	94111962	94111963	+	Intron	DEL	AC	-	-	rs113323477		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94111962_94111963delAC	uc004arf.3	-						AUH_uc004arg.3_Intron|AUH_uc011ltu.1_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94381231	94381232	+	Intron	INS	-	TTTG	TTTG	rs144767777	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94381231_94381232insTTTG	uc004ari.1	-							NM_004560	NP_004551			receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
WNK2	65268	broad.mit.edu	37	9	95988197	95988206	+	Intron	DEL	TGTTGTGTTG	-	-	rs147166290		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95988197_95988206delTGTTGTGTTG	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc010mrc.1_Intron	NM_006648	NP_006639			WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
WNK2	65268	broad.mit.edu	37	9	95989400	95989400	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95989400delT	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc010mrc.1_Intron	NM_006648	NP_006639			WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
HIATL1	84641	broad.mit.edu	37	9	97204970	97204971	+	Intron	INS	-	A	A	rs34304521		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97204970_97204971insA	uc004aur.2	+						HIATL1_uc011luh.1_Intron	NM_032558	NP_115947			hippocampus abundant transcript-like 1						transmembrane transport	integral to membrane|plasma membrane	protein binding|transporter activity			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)																---	---	---	---
C9orf3	84909	broad.mit.edu	37	9	97838522	97838522	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97838522delT	uc004ava.2	+						C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron|C9orf3_uc004avc.2_Intron|C9orf3_uc011luj.1_Intron|C9orf3_uc011luk.1_Intron|C9orf3_uc004avd.2_Intron	NM_032823	NP_116212			aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	98558636	98558637	+	IGR	DEL	CA	-	-	rs67874420		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98558636_98558637delCA								PTCH1 (279389 upstream) : C9orf130 (9735 downstream)																																			---	---	---	---
C9orf102	375748	broad.mit.edu	37	9	98694356	98694357	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98694356_98694357insT	uc004avt.3	+						C9orf102_uc010mrx.1_Intron|C9orf102_uc011lum.1_Intron|C9orf102_uc010mry.1_Intron|C9orf102_uc010mrz.2_Intron|C9orf102_uc004avu.2_Intron	NM_001010895	NP_001010895			RAD26L hypothetical protein						DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101468392	101468396	+	Intron	DEL	AAAAA	-	-	rs72297149		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101468392_101468396delAAAAA	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	104504463	104504464	+	IGR	INS	-	T	T	rs28758491	byFrequency	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104504463_104504464insT								GRIN3A (3601 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104678197	104678198	+	IGR	INS	-	A	A	rs146064043	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104678197_104678198insA								GRIN3A (177335 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	105668375	105668376	+	IGR	INS	-	A	A	rs79093777		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105668375_105668376insA								None (None upstream) : CYLC2 (89217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	105996247	105996247	+	Intron	DEL	T	-	-	rs72032689		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105996247delT	uc004bbt.2	-											Homo sapiens cDNA clone IMAGE:5266449.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	106467284	106467284	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106467284delT								CYLC2 (686514 upstream) : SMC2 (389257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	107080165	107080168	+	IGR	DEL	AGAT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107080165_107080168delAGAT								SMC2 (176472 upstream) : OR13F1 (186376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108417155	108417156	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108417155_108417156delTG								FKTN (13757 upstream) : TAL2 (7582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	109093274	109093275	+	Intron	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109093274_109093275delAG	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	110706816	110706816	+	IGR	DEL	C	-	-	rs28613492		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110706816delC								KLF4 (454769 upstream) : ACTL7B (910055 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111009963	111009964	+	IGR	INS	-	AAC	AAC	rs140274585	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111009963_111009964insAAC								KLF4 (757916 upstream) : ACTL7B (606907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111275072	111275073	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111275072_111275073insA								None (None upstream) : ACTL7B (341798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111507011	111507011	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111507011delA								None (None upstream) : ACTL7B (109860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111604548	111604548	+	IGR	DEL	A	-	-	rs66583483		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111604548delA								None (None upstream) : ACTL7B (12323 downstream)																																			---	---	---	---
MUSK	4593	broad.mit.edu	37	9	113552061	113552061	+	Intron	DEL	A	-	-	rs35732450		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113552061delA	uc004bey.2	+						MUSK_uc004bez.1_Intron	NM_005592	NP_005583			skeletal muscle receptor tyrosine kinase						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114803290	114803290	+	3'UTR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114803290delT	uc004bfu.2	-	17					SUSD1_uc010mui.2_3'UTR|SUSD1_uc010muj.2_3'UTR	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	115666227	115666228	+	IGR	INS	-	AGAG	AGAG	rs149767461	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115666227_115666228insAGAG								SLC46A2 (13034 upstream) : ZNF883 (93174 downstream)																																			---	---	---	---
DFNB31	25861	broad.mit.edu	37	9	117227097	117227108	+	Intron	DEL	ATGATGATGATG	-	-	rs10523063		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117227097_117227108delATGATGATGATG	uc004biz.3	-						DFNB31_uc004biy.3_Intron|DFNB31_uc004bja.3_Intron	NM_015404	NP_056219			CASK-interacting protein CIP98 isoform 1						inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	117511698	117511698	+	IGR	DEL	A	-	-	rs35115740		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117511698delA								C9orf91 (103002 upstream) : TNFSF15 (39915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	117663315	117663316	+	IGR	DEL	GT	-	-	rs113133989		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117663315_117663316delGT								TNFSF15 (94907 upstream) : TNFSF8 (1808 downstream)																																			---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119486243	119486244	+	Intron	INS	-	C	C	rs144809625	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119486243_119486244insC	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	125322725	125322725	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125322725delT								OR1N2 (6285 upstream) : OR1L8 (7102 downstream)																																			---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126157736	126157737	+	Intron	INS	-	CT	CT	rs140282595	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126157736_126157737insCT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc010mwh.1_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
RABEPK	10244	broad.mit.edu	37	9	127970819	127970820	+	Intron	INS	-	T	T	rs75487369		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127970819_127970820insT	uc004bpi.2	+						RABEPK_uc004bph.1_Intron|RABEPK_uc004bpj.2_Intron|RABEPK_uc004bpk.2_Intron|RABEPK_uc004bpl.1_Intron|RABEPK_uc004bpm.2_Intron	NM_005833	NP_005824			Rab9 effector protein with kelch motifs						receptor-mediated endocytosis|vesicle docking involved in exocytosis	endosome membrane|plasma membrane				ovary(1)	1																		---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128321452	128321452	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128321452delA	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
PBX3	5090	broad.mit.edu	37	9	128656245	128656246	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128656245_128656246insA	uc004bqb.2	+						PBX3_uc004bqc.2_Intron|PBX3_uc004bqd.2_Intron|PBX3_uc011lzw.1_Intron|PBX3_uc011lzx.1_Intron	NM_006195	NP_006186			pre-B-cell leukemia homeobox 3 isoform 1						anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
PBX3	5090	broad.mit.edu	37	9	128693592	128693592	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128693592delC	uc004bqb.2	+						PBX3_uc004bqc.2_Intron|PBX3_uc004bqd.2_Intron|PBX3_uc011lzw.1_Intron|PBX3_uc011lzx.1_Intron|PBX3_uc004bqe.2_Intron	NM_006195	NP_006186			pre-B-cell leukemia homeobox 3 isoform 1						anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128771657	128771657	+	IGR	DEL	G	-	-	rs5900680		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128771657delG								PBX3 (42004 upstream) : FAM125B (317471 downstream)																																			---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129694260	129694260	+	Intron	DEL	G	-	-	rs113935766		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129694260delG	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129743546	129743546	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129743546delG	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129842167	129842167	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129842167delG	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129911007	129911007	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129911007delC	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
LRSAM1	90678	broad.mit.edu	37	9	130215711	130215712	+	Intron	INS	-	T	T	rs139069232	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130215711_130215712insT	uc004brb.1	+						RPL12_uc004bqx.1_5'Flank|RPL12_uc004bqy.1_5'Flank|RPL12_uc004bqz.1_5'Flank|LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron	NM_001005373	NP_001005373			leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
FAM129B	64855	broad.mit.edu	37	9	130297316	130297317	+	Intron	INS	-	GAG	GAG	rs145528129	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130297316_130297317insGAG	uc004brh.2	-						FAM129B_uc004bri.2_Intron|FAM129B_uc004brj.3_Intron	NM_022833	NP_073744			hypothetical protein LOC64855 isoform 1								protein binding				0																		---	---	---	---
TOR2A	27433	broad.mit.edu	37	9	130498538	130498539	+	5'Flank	DEL	CA	-	-	rs145079558		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130498538_130498539delCA	uc004brs.3	-						TOR2A_uc004brt.3_5'Flank|TOR2A_uc004brw.3_5'Flank|TOR2A_uc011maj.1_5'Flank|TOR2A_uc004bru.3_5'Flank|TOR2A_uc004brv.3_5'Flank|TOR2A_uc004brx.1_5'Flank	NM_001085347	NP_001078816			torsin family 2, member A isoform a						chaperone mediated protein folding requiring cofactor	endoplasmic reticulum|extracellular region	ATP binding|nucleoside-triphosphatase activity				0																		---	---	---	---
ST6GALNAC6	30815	broad.mit.edu	37	9	130649241	130649242	+	Intron	INS	-	TT	TT	rs35918357		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130649241_130649242insTT	uc004bso.1	-						ST6GALNAC6_uc004bsn.1_Intron|ST6GALNAC6_uc011man.1_Intron|ST6GALNAC6_uc004bsp.1_Intron|ST6GALNAC6_uc004bsq.1_Intron|ST6GALNAC6_uc004bsr.2_Intron|ST6GALNAC6_uc010mxp.1_Intron	NM_013443	NP_038471			sialytransferase 7F						protein glycosylation	integral to Golgi membrane|plasma membrane					0																		---	---	---	---
FAM102A	399665	broad.mit.edu	37	9	130714093	130714094	+	Intron	INS	-	A	A	rs79950187		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130714093_130714094insA	uc004bsx.1	-						FAM102A_uc004bsw.1_5'Flank	NM_001035254	NP_001030331			early estrogen-induced gene 1 protein isoform a											ovary(1)	1																		---	---	---	---
FAM102A	399665	broad.mit.edu	37	9	130723269	130723269	+	Intron	DEL	C	-	-	rs77698586		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130723269delC	uc004bsx.1	-							NM_001035254	NP_001030331			early estrogen-induced gene 1 protein isoform a											ovary(1)	1																		---	---	---	---
FAM102A	399665	broad.mit.edu	37	9	130728815	130728816	+	Intron	DEL	AG	-	-	rs74987020		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130728815_130728816delAG	uc004bsx.1	-							NM_001035254	NP_001030331			early estrogen-induced gene 1 protein isoform a											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	130810352	130810353	+	IGR	INS	-	A	A	rs142526633		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130810352_130810353insA								FAM102A (67857 upstream) : NAIF1 (13160 downstream)																																			---	---	---	---
ENDOG	2021	broad.mit.edu	37	9	131578521	131578522	+	5'Flank	INS	-	AT	AT	rs141673774	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131578521_131578522insAT	uc004bwc.2	+							NM_004435	NP_004426			endonuclease G precursor							mitochondrion	endonuclease activity|metal ion binding|nucleic acid binding				0																		---	---	---	---
FAM73B	84895	broad.mit.edu	37	9	131818800	131818800	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131818800delT	uc004bxa.2	+						FAM73B_uc004bwy.2_Intron|FAM73B_uc004bwz.2_Intron|FAM73B_uc011mbn.1_Intron	NM_032809	NP_116198			hypothetical protein LOC84895							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	131967996	131967997	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131967996_131967997insT	uc010myu.1	+											Homo sapiens cDNA FLJ41803 fis, clone NHNPC2002749.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	132103091	132103092	+	5'Flank	DEL	TA	-	-	rs17441253		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132103091_132103092delTA	uc004bxu.2	+											Homo sapiens cDNA clone IMAGE:6277875, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	132194343	132194343	+	IGR	DEL	G	-	-	rs67048043		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132194343delG								C9orf106 (109461 upstream) : C9orf50 (180163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	133043381	133043382	+	IGR	INS	-	A	A	rs142691792		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133043381_133043382insA								NCS1 (43798 upstream) : ASS1 (276712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	133268543	133268544	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133268543_133268544delCT	uc004bzj.2	+											RecName: Full=Hemicentin-2.; Flags: Fragment;																														---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133899538	133899538	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133899538delT	uc004caa.1	+							NM_006059	NP_006050			laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133936487	133936487	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133936487delG	uc004caa.1	+	13	2322	c.2224delG	c.(2224-2226)GGCfs	p.G742fs		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	742	Laminin EGF-like 6.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	134202754	134202754	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134202754delT								PPAPDC3 (18105 upstream) : BAT2L1 (66846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134700752	134700752	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134700752delT								RAPGEF1 (85535 upstream) : MED27 (34747 downstream)																																			---	---	---	---
SARDH	1757	broad.mit.edu	37	9	136533610	136533610	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136533610delC	uc004cep.3	-						SARDH_uc004ceo.2_Intron|SARDH_uc011mdn.1_Intron|SARDH_uc011mdo.1_Intron|SARDH_uc004cen.2_Intron	NM_001134707	NP_001128179			sarcosine dehydrogenase precursor						glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137651215	137651216	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137651215_137651216delCA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137654715	137654716	+	Intron	DEL	GT	-	-	rs71990638		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137654715_137654716delGT	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138091197	138091197	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138091197delT								OLFM1 (78166 upstream) : KIAA0649 (280451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138117802	138117803	+	IGR	INS	-	CA	CA	rs150187885	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138117802_138117803insCA								OLFM1 (104771 upstream) : KIAA0649 (253845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138311648	138311649	+	IGR	INS	-	G	G	rs79140961		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138311648_138311649insG								OLFM1 (298617 upstream) : KIAA0649 (59999 downstream)																																			---	---	---	---
SEC16A	9919	broad.mit.edu	37	9	139365930	139365932	+	Intron	DEL	AAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139365930_139365932delAAA	uc004chx.2	-						SEC16A_uc004chv.3_Intron|SEC16A_uc004chw.2_Intron|SEC16A_uc010nbn.2_Intron	NM_014866	NP_055681			SEC16 homolog A						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	140168259	140168261	+	IGR	DEL	GAT	-	-	rs71387817		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140168259_140168261delGAT								COBRA1 (260 upstream) : C9orf167 (4019 downstream)																																			---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140563964	140563964	+	Intron	DEL	G	-	-	rs147186780	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140563964delG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
CACNA1B	774	broad.mit.edu	37	9	141001571	141001571	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141001571delA	uc004cog.2	+						CACNA1B_uc004coi.2_Intron|CACNA1B_uc004cok.1_Intron|CACNA1B_uc010ncp.1_Intron	NM_000718	NP_000709			calcium channel, voltage-dependent, N type,						membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	110285	110286	+	IGR	INS	-	C	C	rs146536708	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110285_110286insC								TUBB8 (14781 upstream) : ZMYND11 (70138 downstream)																																			---	---	---	---
IDI1	3422	broad.mit.edu	37	10	1099673	1099673	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1099673delT	uc001igc.2	-						WDR37_uc001ige.2_5'Flank	NM_004508	NP_004499			isopentenyl-diphosphate delta isomerase						carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2325687	2325687	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2325687delA								ADARB2 (545969 upstream) : PFKP (784065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2644324	2644325	+	IGR	INS	-	TCCT	TCCT	rs72517511		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2644324_2644325insTCCT								ADARB2 (864606 upstream) : PFKP (465427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2764513	2764513	+	IGR	DEL	A	-	-	rs72497492		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2764513delA								ADARB2 (984795 upstream) : PFKP (345239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3357105	3357106	+	IGR	INS	-	A	A	rs140602943		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3357105_3357106insA								PITRM1 (142102 upstream) : KLF6 (461083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3545901	3545901	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3545901delA	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	3731594	3731597	+	Intron	DEL	TATC	-	-	rs141235670		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3731594_3731597delTATC	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	3954912	3954913	+	IGR	DEL	AT	-	-	rs79730978		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3954912_3954913delAT								KLF6 (127439 upstream) : LOC100216001 (666531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4226333	4226333	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4226333delG								KLF6 (398860 upstream) : LOC100216001 (395111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4832577	4832578	+	IGR	DEL	AT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4832577_4832578delAT								LOC100216001 (112315 upstream) : AKR1E2 (35824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5353886	5353887	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5353886_5353887insA								AKR1C4 (92976 upstream) : UCN3 (53089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5539549	5539552	+	IGR	DEL	ACAG	-	-	rs139560010		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5539549_5539552delACAG								NET1 (39125 upstream) : CALML5 (1106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6820659	6820659	+	5'Flank	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6820659delG	uc001ijm.2	+											Homo sapiens cDNA FLJ36835 fis, clone ASTRO2010996.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	7507154	7507155	+	IGR	INS	-	A	A	rs147945644	by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7507154_7507155insA								SFMBT2 (53704 upstream) : ITIH5 (94481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	8189268	8189269	+	IGR	INS	-	T	T	rs138825539		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8189268_8189269insT								GATA3 (72106 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	8272504	8272504	+	IGR	DEL	C	-	-	rs76558434		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8272504delC								GATA3 (155342 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	8700018	8700019	+	IGR	INS	-	T	T	rs147962185	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8700018_8700019insT								GATA3 (582856 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	9523008	9523008	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9523008delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	9578008	9578009	+	IGR	INS	-	A	A	rs147676097	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9578008_9578009insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	9841883	9841883	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9841883delA								None (None upstream) : SFTA1P (984519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10280755	10280756	+	IGR	INS	-	A	A	rs148707372	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10280755_10280756insA								None (None upstream) : SFTA1P (545646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10428251	10428251	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10428251delA								None (None upstream) : SFTA1P (398151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	11419852	11419852	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11419852delG								CELF2 (41182 upstream) : USP6NL (82657 downstream)																																			---	---	---	---
USP6NL	9712	broad.mit.edu	37	10	11607931	11607931	+	Intron	DEL	A	-	-	rs34407002		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11607931delA	uc001ikt.3	-						USP6NL_uc001iku.3_Intron	NM_014688	NP_055503			USP6 N-terminal like isoform 1							intracellular	Rab GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	12324943	12324944	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12324943_12324944insT								CDC123 (32356 upstream) : CAMK1D (66639 downstream)																																			---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12616307	12616308	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12616307_12616308insT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
PRPF18	8559	broad.mit.edu	37	10	13653882	13653882	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13653882delT	uc001imp.2	+						PRPF18_uc001imq.2_Intron	NM_003675	NP_003666			PRP18 pre-mRNA processing factor 18 homolog						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	14850605	14850606	+	IGR	INS	-	TTCC	TTCC	rs150329422	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14850605_14850606insTTCC								FAM107B (33709 upstream) : CDNF (10645 downstream)																																			---	---	---	---
OLAH	55301	broad.mit.edu	37	10	15100919	15100920	+	Intron	INS	-	TCCTTCCC	TCCTTCCC	rs148417161	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15100919_15100920insTCCTTCCC	uc001inu.2	+						ACBD7_uc010qby.1_Intron|OLAH_uc001int.2_Intron	NM_001039702	NP_001034791			oleoyl-ACP hydrolase isoform 2						fatty acid biosynthetic process		myristoyl-[acyl-carrier-protein] hydrolase activity|oleoyl-[acyl-carrier-protein] hydrolase activity|palmitoyl-[acyl-carrier-protein] hydrolase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15238528	15238529	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15238528_15238529insT								NMT2 (27833 upstream) : FAM171A1 (15118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	16151915	16151916	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16151915_16151916insT								FAM188A (249396 upstream) : PTER (327051 downstream)																																			---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16999493	16999493	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16999493delA	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17162647	17162648	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17162647_17162648delTG	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
PTPLA	9200	broad.mit.edu	37	10	17635321	17635321	+	Intron	DEL	T	-	-	rs72111717		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17635321delT	uc001ipg.2	-							NM_014241	NP_055056			protein tyrosine phosphatase-like, member A						fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	18990898	18990899	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18990898_18990899delTG								ARL5B (23958 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19391603	19391604	+	IGR	INS	-	A	A	rs138082010	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19391603_19391604insA								ARL5B (424663 upstream) : PLXDC2 (713768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19448567	19448567	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19448567delA								ARL5B (481627 upstream) : PLXDC2 (656805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19810898	19810898	+	Intron	DEL	A	-	-	rs11320376		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19810898delA	uc010qcq.1	+											SubName: Full=cDNA FLJ60310;																														---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20258173	20258173	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20258173delC	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	20956773	20956774	+	IGR	INS	-	TG	TG	rs142768750		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20956773_20956774insTG								PLXDC2 (387658 upstream) : NEBL (112131 downstream)																																			---	---	---	---
PIP4K2A	5305	broad.mit.edu	37	10	23001842	23001843	+	Intron	INS	-	GT	GT	rs148696081	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23001842_23001843insGT	uc001irl.3	-							NM_005028	NP_005019			phosphatidylinositol-5-phosphate 4-kinase, type								1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23053063	23053064	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23053063_23053064insA								PIP4K2A (49560 upstream) : ARMC3 (163890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23824024	23824025	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23824024_23824025insA								OTUD1 (92716 upstream) : KIAA1217 (159650 downstream)																																			---	---	---	---
ENKUR	219670	broad.mit.edu	37	10	25324489	25324492	+	Intron	DEL	AAAA	-	-	rs78271651		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25324489_25324492delAAAA	uc001ish.1	-							NM_145010	NP_659447			enkurin							cilium|flagellum	calmodulin binding|SH3 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26015458	26015459	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26015458_26015459delCT	uc001isl.1	+											Homo sapiens cDNA FLJ41446 fis, clone BRSTN2003590.																														---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26467482	26467482	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26467482delA	uc001isn.2	+						MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129			myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---
GAD2	2572	broad.mit.edu	37	10	26544529	26544530	+	Intron	INS	-	GAAA	GAAA	rs150804707	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26544529_26544530insGAAA	uc001isp.2	+						GAD2_uc001isq.2_Intron	NM_001134366	NP_001127838			glutamate decarboxylase 2						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)													---	---	---	---
ABI1	10006	broad.mit.edu	37	10	27150037	27150038	+	5'Flank	INS	-	T	T	rs143785627	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27150037_27150038insT	uc001isx.2	-						ABI1_uc001ite.2_5'Flank|ABI1_uc010qdh.1_5'Flank|ABI1_uc010qdi.1_5'Flank|ABI1_uc001isy.2_5'Flank|ABI1_uc001ita.2_5'Flank|ABI1_uc001isz.2_5'Flank|ABI1_uc001itb.2_5'Flank|ABI1_uc001itc.2_5'Flank|ABI1_uc010qdj.1_5'Flank|ABI1_uc001itd.2_5'Flank|ABI1_uc010qdk.1_5'Flank	NM_005470	NP_005461			abl-interactor 1 isoform a						actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1																		---	---	---	---
MASTL	84930	broad.mit.edu	37	10	27472199	27472201	+	Intron	DEL	TTG	-	-	rs147321879		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27472199_27472201delTTG	uc001itm.2	+						MASTL_uc001itl.2_Intron|MASTL_uc009xkw.1_Intron|MASTL_uc009xkx.1_Intron	NM_032844	NP_116233			microtubule associated serine/threonine						cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27853440	27853441	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27853440_27853441delTG								RAB18 (24343 upstream) : MKX (108363 downstream)																																			---	---	---	---
MPP7	143098	broad.mit.edu	37	10	28553075	28553075	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28553075delA	uc001iua.1	-						MPP7_uc001iub.1_Intron|MPP7_uc009xla.2_Intron|MPP7_uc010qdv.1_Intron	NM_173496	NP_775767			palmitoylated membrane protein 7						establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29029168	29029171	+	IGR	DEL	CTCT	-	-	rs56300405		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29029168_29029171delCTCT								BAMBI (57300 upstream) : LYZL1 (548819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29080464	29080476	+	RNA	DEL	AAGGGCTGGCCCA	-	-	rs111776023		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29080464_29080476delAAGGGCTGGCCCA	uc001iuk.1	-	2		c.1599_1611delTGGGCCAGCCCTT								Homo sapiens mRNA; cDNA DKFZp434F083 (from clone DKFZp434F083).																														---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29968210	29968210	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29968210delC	uc001iuu.1	-						SVIL_uc009xld.1_Intron	NM_003174	NP_003165			supervillin isoform 1						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30618172	30618172	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30618172delA	uc001iva.3	-						MTPAP_uc001ivb.3_Intron	NM_018109	NP_060579			PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	31510153	31510153	+	IGR	DEL	A	-	-	rs66839146		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31510153delA								ZNF438 (189287 upstream) : LOC220930 (95305 downstream)																																			---	---	---	---
EPC1	80314	broad.mit.edu	37	10	32595786	32595789	+	Intron	DEL	ACAC	-	-	rs142650483		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32595786_32595789delACAC	uc001iwg.1	-						EPC1_uc001iwi.3_Intron|EPC1_uc009xlt.2_Intron|EPC1_uc001iwh.1_Intron	NM_025209	NP_079485			enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)																---	---	---	---
ITGB1	3688	broad.mit.edu	37	10	33224776	33224776	+	Intron	DEL	C	-	-	rs2245844	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33224776delC	uc001iws.3	-						ITGB1_uc001iwp.3_5'Flank|ITGB1_uc001iwq.3_5'Flank|ITGB1_uc001iwr.3_5'Flank|ITGB1_uc001iwt.3_Intron|ITGB1_uc001iwu.1_5'Flank	NM_133376	NP_596867			integrin beta 1 isoform 1A precursor						axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	33749838	33749839	+	IGR	INS	-	T	T	rs138257555	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33749838_33749839insT								NRP1 (125832 upstream) : PARD3 (650259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	33885004	33885007	+	IGR	DEL	CAAA	-	-	rs145951188		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33885004_33885007delCAAA								NRP1 (260998 upstream) : PARD3 (515091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	34012535	34012535	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34012535delA								NRP1 (388529 upstream) : PARD3 (387563 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34450173	34450174	+	Intron	INS	-	AA	AA	rs67454847		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34450173_34450174insAA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35211122	35211123	+	IGR	INS	-	AAGGAAGGAGGG	AAGGAAGGAGGG	rs71881477		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35211122_35211123insAAGGAAGGAGGG								PARD3 (107199 upstream) : CUL2 (87685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	35225473	35225474	+	IGR	INS	-	T	T	rs72102644		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35225473_35225474insT								PARD3 (121550 upstream) : CUL2 (73334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	35889818	35889823	+	IGR	DEL	CACACC	-	-	rs71523386	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35889818_35889823delCACACC								CCNY (28973 upstream) : GJD4 (4515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36532834	36532835	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36532834_36532835insA								FZD8 (602472 upstream) : ANKRD30A (881950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36912280	36912280	+	IGR	DEL	T	-	-	rs112426032		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36912280delT								FZD8 (981918 upstream) : ANKRD30A (502505 downstream)																																			---	---	---	---
ZNF37A	7587	broad.mit.edu	37	10	38396904	38396904	+	Intron	DEL	T	-	-	rs140746387		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38396904delT	uc001izk.2	+						ZNF37A_uc001izl.2_Intron|ZNF37A_uc001izm.2_Intron	NM_001007094	NP_001007095			zinc finger protein 37a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	38875908	38875908	+	IGR	DEL	A	-	-	rs111727033		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38875908delA								LOC399744 (134828 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42531484	42531487	+	IGR	DEL	ACAA	-	-	rs145373202		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42531484_42531487delACAA								None (None upstream) : LOC441666 (295828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42667291	42667292	+	IGR	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42667291_42667292insTT								None (None upstream) : LOC441666 (160023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45013121	45013122	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45013121_45013122insT								CXCL12 (132579 upstream) : TMEM72 (393642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45346465	45346466	+	Intron	INS	-	TG	TG	rs146967412	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45346465_45346466insTG	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																														---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47013463	47013464	+	Intron	INS	-	T	T	rs146598184		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47013463_47013464insT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47138264	47138266	+	Intron	DEL	ATA	-	-	rs148020302		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47138264_47138266delATA	uc001jed.3	-						uc001jef.2_Intron					Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
FRMPD2	143162	broad.mit.edu	37	10	49481574	49481574	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49481574delT	uc001jgi.2	-						FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081			FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)														---	---	---	---
ERCC6	2074	broad.mit.edu	37	10	50690586	50690587	+	Intron	DEL	TT	-	-	rs72140045		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50690586_50690587delTT	uc001jhs.3	-						ERCC6_uc010qgr.1_Intron|ERCC6_uc001jhr.3_Intron	NM_000124	NP_000115			excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16													Direct_reversal_of_damage|NER					---	---	---	---
C10orf53	282966	broad.mit.edu	37	10	50914158	50914158	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50914158delG	uc001jid.1	+							NM_182554	NP_872360			chromosome 10 open reading frame 53 isoform a												0		all_neural(218;0.107)																---	---	---	---
OGDHL	55753	broad.mit.edu	37	10	50965262	50965262	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50965262delA	uc001jie.2	-						OGDHL_uc009xog.2_Intron|OGDHL_uc010qgt.1_Intron|OGDHL_uc010qgu.1_Intron|OGDHL_uc009xoh.2_Intron	NM_018245	NP_060715			oxoglutarate dehydrogenase-like isoform a						glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	51804622	51804623	+	Intron	DEL	AA	-	-	rs144792131		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51804622_51804623delAA	uc001jiz.1	-											Homo sapiens cDNA FLJ31813 fis, clone NT2RI2009517.																														---	---	---	---
SGMS1	259230	broad.mit.edu	37	10	52164072	52164072	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52164072delT	uc001jje.2	-						SGMS1_uc010qhk.1_Intron|SGMS1_uc009xot.1_Intron|SGMS1_uc009xou.1_Intron	NM_147156	NP_671512			sphingomyelin synthase 1						apoptosis|cell growth|sphingomyelin biosynthetic process	endoplasmic reticulum|Golgi trans cisterna|integral to Golgi membrane|nucleus|plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			ovary(1)|kidney(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	52558715	52558715	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52558715delT								ASAH2B (44148 upstream) : A1CF (7612 downstream)																																			---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53130272	53130273	+	Intron	INS	-	TG	TG	rs139267724	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53130272_53130273insTG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53805603	53805603	+	Intron	DEL	C	-	-	rs35352643		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53805603delC	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc009xow.1_5'Flank	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54513163	54513163	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54513163delG								DKK1 (435747 upstream) : MBL2 (11978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55352196	55352197	+	IGR	INS	-	TTTT	TTTT	rs150126935	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55352196_55352197insTTTT								MBL2 (820736 upstream) : PCDH15 (210338 downstream)																																			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56781693	56781693	+	Intron	DEL	A	-	-	rs34500983		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56781693delA	uc001jjv.1	-							NM_001142770	NP_001136242			protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56864708	56864708	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56864708delT	uc001jjv.1	-							NM_001142770	NP_001136242			protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	57728557	57728567	+	IGR	DEL	ATGATAACATA	-	-	rs113317926		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57728557_57728567delATGATAACATA								PCDH15 (340855 upstream) : ZWINT (388632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58674098	58674099	+	IGR	INS	-	TG	TG	rs111366516		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58674098_58674099insTG								ZWINT (553064 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58691790	58691791	+	IGR	INS	-	AAG	AAG	rs140972016	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58691790_58691791insAAG								ZWINT (570756 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59248028	59248030	+	IGR	DEL	ACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59248028_59248030delACA								None (None upstream) : IPMK (707588 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60317104	60317105	+	Intron	INS	-	T	T	rs35079883		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60317104_60317105insT	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
ZNF365	22891	broad.mit.edu	37	10	64093379	64093380	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64093379_64093380delTG	uc001jly.3	+							NM_014951	NP_055766			zinc finger protein 365 isoform A											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)																	---	---	---	---
ZNF365	22891	broad.mit.edu	37	10	64141504	64141504	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64141504delT	uc001jmc.2	+						ZNF365_uc001jly.3_Intron|ZNF365_uc001jmb.3_Intron|ZNF365_uc001jlz.3_Intron|ZNF365_uc001jma.3_Intron	NM_199451	NP_955523			zinc finger protein 365 isoform C											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	65751386	65751386	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65751386delA								REEP3 (369415 upstream) : ANXA2P3 (833899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65838099	65838099	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65838099delT								REEP3 (456128 upstream) : ANXA2P3 (747186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66944306	66944306	+	IGR	DEL	C	-	-	rs113819173		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66944306delC								ANXA2P3 (357672 upstream) : CTNNA3 (735419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67264192	67264193	+	IGR	INS	-	T	T	rs36098068		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67264192_67264193insT								ANXA2P3 (677558 upstream) : CTNNA3 (415532 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	67917168	67917171	+	Intron	DEL	TAGG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67917168_67917171delTAGG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	70013992	70013992	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70013992delT								ATOH7 (22137 upstream) : PBLD (28425 downstream)																																			---	---	---	---
RUFY2	55680	broad.mit.edu	37	10	70167894	70167894	+	5'Flank	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70167894delC	uc001job.2	-						RUFY2_uc001jnz.1_5'Flank|RUFY2_uc001joc.2_5'Flank|RUFY2_uc010qiw.1_5'Flank|RUFY2_uc001jod.1_5'Flank|RUFY2_uc009xpv.1_5'Flank|RUFY2_uc001joe.1_5'Flank	NM_017987	NP_060457			RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1																		---	---	---	---
TET1	80312	broad.mit.edu	37	10	70323267	70323267	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70323267delT	uc001jok.3	+							NM_030625	NP_085128			CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9																		---	---	---	---
DDX50	79009	broad.mit.edu	37	10	70690413	70690414	+	Intron	INS	-	T	T	rs146583869	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70690413_70690414insT	uc001jou.2	+						DDX50_uc010qjc.1_Intron	NM_024045	NP_076950			nucleolar protein GU2							nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	70803323	70803323	+	IGR	DEL	A	-	-	rs34172627		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70803323delA								KIAA1279 (26589 upstream) : SRGN (44505 downstream)																																			---	---	---	---
HK1	3098	broad.mit.edu	37	10	71038556	71038556	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71038556delT	uc001jpj.3	+						HK1_uc009xqc.1_Intron|HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron	NM_033500	NP_277035			hexokinase 1 isoform HKI-td						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1																		---	---	---	---
HK1	3098	broad.mit.edu	37	10	71120795	71120796	+	Intron	INS	-	CTC	CTC	rs139562651	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71120795_71120796insCTC	uc001jpl.3	+						HK1_uc001jpg.3_Intron|HK1_uc001jph.3_Intron|HK1_uc001jpi.3_Intron|HK1_uc001jpj.3_Intron|HK1_uc001jpk.3_Intron|HK1_uc009xqd.2_Intron	NM_000188	NP_000179			hexokinase 1 isoform HKI						glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1																		---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73282684	73282685	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73282684_73282685insA	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	74026567	74026568	+	IGR	INS	-	T	T	rs34332323		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74026567_74026568insT								ANAPC16 (30951 upstream) : DDIT4 (7109 downstream)																																			---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74363823	74363824	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74363823_74363824delAC	uc001jtb.1	-							NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
FAM149B1	317662	broad.mit.edu	37	10	74956083	74956083	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74956083delT	uc009xqz.2	+						FAM149B1_uc010qkf.1_Intron|FAM149B1_uc001jtq.2_Intron	NM_173348	NP_775483			hypothetical protein LOC317662												0																		---	---	---	---
ADK	132	broad.mit.edu	37	10	76386505	76386505	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76386505delT	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron|ADK_uc001jwl.2_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78910965	78910968	+	Intron	DEL	TCTT	-	-	rs141758735		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78910965_78910968delTCTT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79156095	79156096	+	Intron	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79156095_79156096delAG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79259193	79259194	+	Intron	DEL	AT	-	-	rs147496756	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79259193_79259194delAT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	80327751	80327751	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80327751delA								RPS24 (511181 upstream) : LOC283050 (375333 downstream)																																			---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	80960592	80960597	+	Intron	DEL	CATGTG	-	-	rs71931679		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80960592_80960597delCATGTG	uc001kaf.2	+						ZMIZ1_uc001kae.2_Intron	NM_020338	NP_065071			retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	86742688	86742688	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86742688delC								FAM190B (464412 upstream) : GRID1 (616624 downstream)																																			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87847099	87847100	+	Intron	DEL	TG	-	-	rs111753818		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87847099_87847100delTG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	88007016	88007017	+	Intron	INS	-	GATG	GATG	rs144925178	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88007016_88007017insGATG	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88202817	88202817	+	Intron	DEL	C	-	-	rs66880052		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88202817delC	uc001kdo.2	-						WAPAL_uc009xsv.2_Intron|WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	91738925	91738926	+	IGR	INS	-	A	A	rs1071815		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91738925_91738926insA								KIF20B (204225 upstream) : HTR7 (761652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	91815636	91815638	+	IGR	DEL	GAG	-	-	rs137872970		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91815636_91815638delGAG								KIF20B (280936 upstream) : HTR7 (684940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	92080438	92080439	+	IGR	INS	-	T	T	rs143709774		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92080438_92080439insT								KIF20B (545738 upstream) : HTR7 (420139 downstream)																																			---	---	---	---
MARCH5	54708	broad.mit.edu	37	10	94078399	94078399	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94078399delA	uc001khx.1	+						MARCH5_uc010qno.1_Intron	NM_017824	NP_060294			membrane-associated ring finger (C3HC4) 5						cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	94155092	94155093	+	IGR	INS	-	A	A	rs151269588	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94155092_94155093insA								MARCH5 (41371 upstream) : IDE (58507 downstream)																																			---	---	---	---
KIF11	3832	broad.mit.edu	37	10	94385107	94385108	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94385107_94385108insT	uc001kic.2	+						KIF11_uc010qnq.1_Intron	NM_004523	NP_004514			kinesin family member 11						blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	94500579	94500580	+	IGR	INS	-	CT	CT	rs149448159	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94500579_94500580insCT								HHEX (45173 upstream) : EXOC6 (90355 downstream)																																			---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	95981057	95981058	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95981057_95981058delGT	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron	NM_016341	NP_057425			phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	97929864	97929864	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97929864delA								ZNF518A (6354 upstream) : BLNK (21599 downstream)																																			---	---	---	---
PI4K2A	55361	broad.mit.edu	37	10	99388296	99388296	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99388296delT	uc010qoy.1	+						MORN4_uc001kob.3_Intron|MORN4_uc001koc.3_Intron|MORN4_uc001kod.3_Intron|MORN4_uc001koe.2_Intron|MORN4_uc009xvv.1_Intron	NM_018425	NP_060895			phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	99821567	99821568	+	IGR	INS	-	GTGTGT	GTGTGT	rs139096109	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99821567_99821568insGTGTGT								CRTAC1 (30982 upstream) : C10orf28 (72813 downstream)																																			---	---	---	---
PYROXD2	84795	broad.mit.edu	37	10	100146303	100146304	+	Intron	INS	-	TTTT	TTTT	rs143596143	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100146303_100146304insTTTT	uc001kpc.2	-						PYROXD2_uc001kpb.2_Intron|PYROXD2_uc001kpd.2_Intron	NM_032709	NP_116098			pyridine nucleotide-disulphide oxidoreductase								oxidoreductase activity			central_nervous_system(1)	1																		---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100611149	100611149	+	Intron	DEL	A	-	-	rs67440730		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100611149delA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100927639	100927640	+	Intron	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100927639_100927640delTC	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
ABCC2	1244	broad.mit.edu	37	10	101574386	101574387	+	Intron	DEL	AT	-	-	rs34009725		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101574386_101574387delAT	uc001kqf.2	+							NM_000392	NP_000383			ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	104198239	104198239	+	IGR	DEL	G	-	-	rs111645317		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104198239delG								MIR146B (1898 upstream) : C10orf95 (11355 downstream)																																			---	---	---	---
GSTO2	119391	broad.mit.edu	37	10	106037052	106037053	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106037052_106037053insT	uc001kyb.2	+						GSTO2_uc010qqw.1_Intron|GSTO2_uc010qqx.1_Intron|GSTO2_uc001kyc.2_Intron|GSTO2_uc010qqy.1_Intron	NM_183239	NP_899062			glutathione S-transferase omega 2						water-soluble vitamin metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.178)		Epithelial(162;1.14e-09)|all cancers(201;3.89e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0155)	Glutathione(DB00143)													---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106850991	106850991	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106850991delT	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107038880	107038883	+	IGR	DEL	CCTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107038880_107038883delCCTC								SORCS3 (13887 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	107039022	107039023	+	IGR	INS	-	TCTT	TCTT	rs10628726	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107039022_107039023insTCTT								SORCS3 (14029 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	107602275	107602276	+	IGR	DEL	CC	-	-	rs76418484		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107602275_107602276delCC								SORCS3 (577282 upstream) : SORCS1 (731146 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108720169	108720170	+	Intron	INS	-	T	T	rs11461091		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108720169_108720170insT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	110601393	110601393	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110601393delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111615126	111615143	+	IGR	DEL	ACACACACACACACACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111615126_111615143delACACACACACACACACAC								None (None upstream) : XPNPEP1 (9381 downstream)																																			---	---	---	---
MXI1	4601	broad.mit.edu	37	10	111977255	111977255	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111977255delT	uc001kyy.2	+						MXI1_uc001kyz.2_Intron	NM_130439	NP_569157			MAX interactor 1 isoform b						cytoplasmic sequestering of transcription factor|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription corepressor activity				0		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
SHOC2	8036	broad.mit.edu	37	10	112716121	112716121	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112716121delC	uc001kzl.3	+						SHOC2_uc009xxx.2_Intron|SHOC2_uc010qrg.1_Intron	NM_007373	NP_031399			soc-2 suppressor of clear homolog						fibroblast growth factor receptor signaling pathway|positive regulation of Ras protein signal transduction|Ras protein signal transduction	nucleus|protein phosphatase type 1 complex	protein phosphatase binding|protein phosphatase regulator activity			ovary(1)|skin(1)	2				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	112986958	112986958	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112986958delG								ADRA2A (146298 upstream) : GPAM (922664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113269860	113269861	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113269860_113269861delAC								ADRA2A (429200 upstream) : GPAM (639761 downstream)																																			---	---	---	---
GUCY2GP	390003	broad.mit.edu	37	10	114082479	114082480	+	Intron	INS	-	A	A	rs75268453		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114082479_114082480insA	uc010qri.1	-							NR_028134				Homo sapiens guanylate cyclase 2G homolog (mouse) pseudogene (GUCY2G), non-coding RNA, 611.												0																		---	---	---	---
GUCY2GP	390003	broad.mit.edu	37	10	114111263	114111264	+	Intron	DEL	CT	-	-	rs146430076		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114111263_114111264delCT	uc010qri.1	-							NR_028134				Homo sapiens guanylate cyclase 2G homolog (mouse) pseudogene (GUCY2G), non-coding RNA, 611.												0																		---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114775823	114775823	+	Intron	DEL	T	-	-	rs67473436		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114775823delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	115211212	115211213	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115211212_115211213delTT								TCF7L2 (283778 upstream) : HABP2 (101565 downstream)																																			---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	116902208	116902209	+	Intron	INS	-	A	A	rs142822166	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116902208_116902209insA	uc001lcg.2	+						ATRNL1_uc001lce.2_Intron|ATRNL1_uc001lcf.2_Intron|ATRNL1_uc009xyq.2_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117612800	117612801	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117612800_117612801insA	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	118049474	118049475	+	IGR	DEL	TT	-	-	rs35375800	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118049474_118049475delTT								GFRA1 (16348 upstream) : C10orf96 (34465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	119548392	119548392	+	IGR	DEL	C	-	-	rs11316534		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119548392delC								EMX2 (239336 upstream) : RAB11FIP2 (216037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120189179	120189180	+	IGR	DEL	CA	-	-	rs147539494		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120189179_120189180delCA								C10orf84 (87340 upstream) : PRLHR (163736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120230495	120230496	+	IGR	INS	-	T	T	rs147502717		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120230495_120230496insT								C10orf84 (128656 upstream) : PRLHR (122420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122481808	122481827	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGT	-	-	rs72239074		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122481808_122481827delGTGTGTGTGTGTGTGTGTGT								PPAPDC1A (132441 upstream) : WDR11 (128868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122541417	122541417	+	Intron	DEL	T	-	-	rs71684575		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122541417delT	uc001lfa.1	-						uc001lfb.1_Intron					Homo sapiens cDNA FLJ37330 fis, clone BRAMY2019509.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	123022158	123022158	+	IGR	DEL	C	-	-	rs10712502		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123022158delC								WDR11 (353123 upstream) : FGFR2 (215687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123477113	123477114	+	IGR	INS	-	GT	GT	rs146420772	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123477113_123477114insGT								FGFR2 (119141 upstream) : ATE1 (25512 downstream)																																			---	---	---	---
FAM175B	23172	broad.mit.edu	37	10	126515661	126515661	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126515661delA	uc001lib.3	+							NM_032182	NP_115558			hypothetical protein LOC23172							BRISC complex	polyubiquitin binding				0																		---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127799050	127799050	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127799050delA	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
PTPRE	5791	broad.mit.edu	37	10	129833331	129833331	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129833331delC	uc001lkb.2	+						PTPRE_uc009yat.2_Intron|PTPRE_uc010qup.1_Intron|PTPRE_uc009yau.2_Intron|PTPRE_uc001lkc.1_Intron	NM_006504	NP_006495			protein tyrosine phosphatase, receptor type, E						negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	130933040	130933041	+	IGR	INS	-	CT	CT	rs138650205	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130933040_130933041insCT								None (None upstream) : MGMT (332413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	131247715	131247722	+	IGR	DEL	GAAGGAGT	-	-	rs28593127	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131247715_131247722delGAAGGAGT								None (None upstream) : MGMT (17732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132362641	132362642	+	IGR	INS	-	TGT	TGT	rs139226598	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132362641_132362642insTGT								GLRX3 (379857 upstream) : TCERG1L (528014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132588990	132588991	+	IGR	INS	-	AAAC	AAAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132588990_132588991insAAAC								GLRX3 (606206 upstream) : TCERG1L (301665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	179247	179247	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:179247delA	uc001lnz.2	-											Homo sapiens mRNA; cDNA DKFZp434B2016 (from clone DKFZp434B2016).																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	2199812	2199813	+	IGR	INS	-	GTGT	GTGT	rs139294492	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2199812_2199813insGTGT								TH (6777 upstream) : ASCL2 (89916 downstream)																																			---	---	---	---
C11orf36	283303	broad.mit.edu	37	11	3238092	3238093	+	5'Flank	INS	-	TCTTTCTT	TCTTTCTT	rs117112327		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3238092_3238093insTCTTTCTT	uc001lxo.2	+						C11orf36_uc001lxn.2_5'Flank	NR_027138				RecName: Full=Uncharacterized protein C11orf36;												0																		---	---	---	---
RRM1	6240	broad.mit.edu	37	11	4173216	4173217	+	Intron	INS	-	TG	TG	rs150943543	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4173216_4173217insTG	uc009yej.2	+							NM_001033				ribonucleoside-diphosphate reductase M1 chain						deoxyribonucleotide biosynthetic process|DNA replication|nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleoplasm|ribonucleoside-diphosphate reductase complex	ATP binding|ribonucleoside-diphosphate reductase activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)													---	---	---	---
TRIM5	85363	broad.mit.edu	37	11	5891820	5891821	+	Intron	DEL	CC	-	-	rs10838761		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5891820_5891821delCC	uc001mbq.1	-							NM_033093	NP_149084			tripartite motif protein TRIM5 isoform delta						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	7785424	7785425	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7785424_7785425insA								OVCH2 (57483 upstream) : OR5P2 (32096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	10941296	10941296	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10941296delA								ZBED5 (61676 upstream) : GALNTL4 (351125 downstream)																																			---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11635910	11635912	+	Intron	DEL	GAG	-	-	rs146302999		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11635910_11635912delGAG	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
DKK3	27122	broad.mit.edu	37	11	12024558	12024558	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12024558delA	uc001mju.2	-						DKK3_uc010rcf.1_Intron|DKK3_uc001mjv.2_Intron|DKK3_uc001mjw.2_Intron|DKK3_uc010rcg.1_Intron|DKK3_uc001mjx.2_Intron	NM_001018057	NP_001018067			dickkopf homolog 3 precursor						adrenal gland development|anatomical structure morphogenesis|negative regulation of aldosterone biosynthetic process|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cortisol biosynthetic process|negative regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	extracellular space				breast(1)	1				Epithelial(150;0.000502)														---	---	---	---
MICAL2	9645	broad.mit.edu	37	11	12166688	12166689	+	Intron	INS	-	T	T	rs146994246	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12166688_12166689insT	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mjy.2_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron	NM_014632	NP_055447			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	12620065	12620066	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12620065_12620066delGT								PARVA (68655 upstream) : TEAD1 (75903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13541508	13541508	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13541508delA								PTH (23941 upstream) : FAR1 (148698 downstream)																																			---	---	---	---
INSC	387755	broad.mit.edu	37	11	15170175	15170176	+	Intron	INS	-	ATGCC	ATGCC	rs138073791	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15170175_15170176insATGCC	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_5'Flank|INSC_uc010rcs.1_5'Flank|INSC_uc001mmb.2_5'Flank|INSC_uc001mmc.2_5'Flank	NM_001031853	NP_001027024			inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15306273	15306275	+	IGR	DEL	TTG	-	-	rs72436705		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15306273_15306275delTTG								INSC (37521 upstream) : SOX6 (681721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15906716	15906716	+	IGR	DEL	C	-	-	rs5789925		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15906716delC								INSC (637964 upstream) : SOX6 (81280 downstream)																																			---	---	---	---
SAA3P	6290	broad.mit.edu	37	11	18137744	18137745	+	5'Flank	DEL	CG	-	-	rs71047574		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18137744_18137745delCG	uc001mnt.2	-							NR_026576				Homo sapiens truncated serum amyloid A3 precursor (SAA3) mRNA, complete cds.												0																OREG0020820	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TSG101	7251	broad.mit.edu	37	11	18517551	18517551	+	Intron	DEL	A	-	-	rs77094178		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18517551delA	uc001mor.2	-							NM_006292	NP_006283			tumor susceptibility gene 101						cell division|cellular membrane organization|endosome transport|interspecies interaction between organisms|non-lytic virus budding|protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	early endosome|late endosome membrane|multivesicular body|nucleolus|plasma membrane	calcium-dependent protein binding|DNA binding|transcription corepressor activity|ubiquitin binding|ubiquitin protein ligase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	18819032	18819033	+	IGR	INS	-	TG	TG	rs148848611	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18819032_18819033insTG								PTPN5 (5643 upstream) : MRGPRX1 (136328 downstream)																																			---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21339066	21339067	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21339066_21339067delCT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21380265	21380266	+	Intron	INS	-	TTG	TTG	rs139358492	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21380265_21380266insTTG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	22506309	22506309	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22506309delT								SLC17A6 (105265 upstream) : FANCF (137770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24304123	24304123	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24304123delA								None (None upstream) : LUZP2 (214433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	25757334	25757334	+	IGR	DEL	T	-	-	rs11361304		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25757334delT								LUZP2 (653152 upstream) : ANO3 (453495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	27272520	27272522	+	IGR	DEL	AAA	-	-	rs72259989		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27272520_27272522delAAA								BBOX1 (123166 upstream) : CCDC34 (87539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	28478606	28478606	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28478606delT								METT5D1 (123552 upstream) : None (None downstream)																																			---	---	---	---
RCN1	5954	broad.mit.edu	37	11	31956926	31956926	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31956926delT	uc010rea.1	+							NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
RCN1	5954	broad.mit.edu	37	11	32075144	32075145	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32075144_32075145delAC	uc010rea.1	+							NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	32187733	32187733	+	IGR	DEL	A	-	-	rs66585096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32187733delA								RCN1 (60462 upstream) : WT1 (221592 downstream)																																			---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32629358	32629358	+	Intron	DEL	A	-	-	rs35497253		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32629358delA	uc001mtv.2	-							NM_001008391	NP_001008392			sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	33384437	33384440	+	IGR	DEL	TTCC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33384437_33384440delTTCC								HIPK3 (8498 upstream) : C11orf41 (179437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	33492765	33492765	+	IGR	DEL	T	-	-	rs113201118		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33492765delT								HIPK3 (116826 upstream) : C11orf41 (71112 downstream)																																			---	---	---	---
CD59	966	broad.mit.edu	37	11	33758782	33758787	+	5'Flank	DEL	ACACAC	-	-	rs71857868		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33758782_33758787delACACAC	uc001mut.3	-						CD59_uc009yka.2_5'Flank|CD59_uc001muu.3_5'Flank|CD59_uc001muv.3_5'Flank|CD59_uc001mux.3_5'Flank	NM_203330	NP_976075			CD59 antigen preproprotein						blood coagulation|cell surface receptor linked signaling pathway	anchored to external side of plasma membrane|extracellular region|membrane fraction					0																		---	---	---	---
EHF	26298	broad.mit.edu	37	11	34655737	34655738	+	Intron	INS	-	T	T	rs139951705	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34655737_34655738insT	uc001mvr.1	+						EHF_uc009yke.1_Intron|EHF_uc009ykf.1_Intron	NM_012153	NP_036285			ets homologous factor						cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	34759477	34759478	+	IGR	INS	-	T	T	rs138732863		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34759477_34759478insT								EHF (76396 upstream) : APIP (137236 downstream)																																			---	---	---	---
CD44	960	broad.mit.edu	37	11	35251769	35251770	+	3'UTR	INS	-	T	T	rs78387531		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35251769_35251770insT	uc001mvu.2	+	18					CD44_uc001mvv.2_3'UTR|CD44_uc001mvw.2_3'UTR|CD44_uc001mvx.2_3'UTR|CD44_uc001mvy.2_3'UTR|CD44_uc001mwc.3_3'UTR|CD44_uc010rer.1_3'UTR|CD44_uc009ykh.2_RNA	NM_000610	NP_000601			CD44 antigen isoform 1 precursor						cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)													---	---	---	---
PRR5L	79899	broad.mit.edu	37	11	36395998	36395999	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36395998_36395999insA	uc001mwo.3	+						PRR5L_uc001mwp.2_5'Flank|PRR5L_uc009ykk.2_5'Flank	NM_001160167	NP_001153639			protor-2 isoform a											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	38465321	38465322	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38465321_38465322delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39324137	39324138	+	IGR	DEL	TT	-	-	rs138957808		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39324137_39324138delTT								None (None upstream) : LRRC4C (811615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42130470	42130471	+	IGR	INS	-	GT	GT	rs142334826	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42130470_42130471insGT								LRRC4C (649147 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42827563	42827564	+	IGR	INS	-	A	A	rs144804769	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42827563_42827564insA								None (None upstream) : API5 (505941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42893377	42893377	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42893377delT								None (None upstream) : API5 (440128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42988705	42988705	+	IGR	DEL	A	-	-	rs66835671		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42988705delA								None (None upstream) : API5 (344800 downstream)																																			---	---	---	---
TTC17	55761	broad.mit.edu	37	11	43418507	43418508	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43418507_43418508insA	uc001mxi.2	+						TTC17_uc001mxh.2_Intron|TTC17_uc010rfj.1_Intron|TTC17_uc001mxj.2_Intron	NM_018259	NP_060729			tetratricopeptide repeat domain 17								binding			ovary(5)	5																		---	---	---	---
HSD17B12	51144	broad.mit.edu	37	11	43866531	43866532	+	Intron	INS	-	TTGT	TTGT	rs138855682	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43866531_43866532insTTGT	uc001mxq.3	+							NM_016142	NP_057226			hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0																		---	---	---	---
CD82	3732	broad.mit.edu	37	11	44618912	44618912	+	Intron	DEL	G	-	-	rs67661773		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44618912delG	uc001myc.2	+						CD82_uc001myd.2_Intron	NM_002231	NP_002222			CD82 antigen isoform 1							integral to plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
CD82	3732	broad.mit.edu	37	11	44635394	44635394	+	Intron	DEL	A	-	-	rs10709853		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44635394delA	uc001myc.2	+						CD82_uc001myd.2_Intron	NM_002231	NP_002222			CD82 antigen isoform 1							integral to plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	45609521	45609524	+	IGR	DEL	AGAA	-	-	rs11038557		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45609521_45609524delAGAA								SYT13 (301637 upstream) : CHST1 (60903 downstream)																																			---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46474811	46474812	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46474811_46474812insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron|hsa-mir-3160-1|MI0014189_5'Flank	NM_017749	NP_060219			activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
AMBRA1	55626	broad.mit.edu	37	11	46476423	46476424	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46476423_46476424insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron|hsa-mir-3160-1|MI0014189_5'Flank	NM_017749	NP_060219			activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)														---	---	---	---
ARHGAP1	392	broad.mit.edu	37	11	46714957	46714958	+	Intron	INS	-	T	T	rs112094408		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46714957_46714958insT	uc001ndd.2	-						ARHGAP1_uc009yle.1_Intron	NM_004308	NP_004299			Rho GTPase activating protein 1						Rho protein signal transduction	cytosol|intracellular membrane-bounded organelle	SH3 domain binding|SH3/SH2 adaptor activity			skin(1)	1		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)														---	---	---	---
SLC39A13	91252	broad.mit.edu	37	11	47378073	47378077	+	Intron	DEL	GCTCA	-	-	rs72460598		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47378073_47378077delGCTCA	uc001nfd.2	+						SPI1_uc001nfb.1_Intron|SPI1_uc001nfc.1_Intron					RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	48353007	48353010	+	IGR	DEL	AGTC	-	-	rs150547515		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48353007_48353010delAGTC								OR4C3 (5527 upstream) : OR4C45 (13892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48359344	48359345	+	IGR	INS	-	C	C	rs151275604	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48359344_48359345insC								OR4C3 (11864 upstream) : OR4C45 (7557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48936674	48936674	+	IGR	DEL	C	-	-	rs144885971	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48936674delC								OR4A47 (425402 upstream) : FOLH1 (231514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50382452	50382452	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50382452delA								LOC646813 (2649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50718038	50718039	+	IGR	DEL	AT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50718038_50718039delAT								LOC646813 (338235 upstream) : OR4A5 (693409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50723058	50723058	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50723058delA								LOC646813 (343255 upstream) : OR4A5 (688390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56195806	56195807	+	IGR	INS	-	A	A	rs71868672		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56195806_56195807insA								OR5R1 (10098 upstream) : OR5M9 (34140 downstream)																																			---	---	---	---
ZDHHC5	25921	broad.mit.edu	37	11	57454306	57454306	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57454306delT	uc001nkx.1	+						ZDHHC5_uc001nky.1_Intron|ZDHHC5_uc001nkz.1_Intron	NM_015457	NP_056272			zinc finger, DHHC domain containing 5							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1																		---	---	---	---
CD6	923	broad.mit.edu	37	11	60756170	60756171	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60756170_60756171insT	uc001nqq.2	+						CD6_uc009yni.2_Intron|CD6_uc009ynj.2_Intron|CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716			CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	60787933	60787934	+	IGR	INS	-	TG	TG	rs138602321	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60787933_60787934insTG								CD6 (87 upstream) : CD5 (81996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	60788383	60788384	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60788383_60788384delGT								CD6 (537 upstream) : CD5 (81546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	61239538	61239538	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61239538delA								SDHAF2 (25311 upstream) : C11orf66 (9054 downstream)																																			---	---	---	---
SYT7	9066	broad.mit.edu	37	11	61329550	61329551	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61329550_61329551delAC	uc001nrv.2	-						SYT7_uc009ynr.2_Intron	NM_004200	NP_004191			synaptotagmin VII							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4																		---	---	---	---
RAB3IL1	5866	broad.mit.edu	37	11	61689997	61689997	+	5'Flank	DEL	A	-	-	rs78012917		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61689997delA	uc001nsp.2	-											RecName: Full=Guanine nucleotide exchange factor for Rab3A; AltName: Full=Rab3A-interacting-like protein 1; AltName: Full=Rabin3-like 1;								protein binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
ASRGL1	80150	broad.mit.edu	37	11	62139425	62139426	+	Intron	INS	-	A	A	rs35892721		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62139425_62139426insA	uc001nte.3	+						ASRGL1_uc001ntf.3_Intron|ASRGL1_uc001ntg.3_Intron|ASRGL1_uc001nth.1_Intron	NM_025080	NP_079356			asparaginase-like 1						asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)													---	---	---	---
TUT1	64852	broad.mit.edu	37	11	62358283	62358284	+	Intron	INS	-	A	A	rs34251910		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62358283_62358284insA	uc001nto.2	-							NM_022830	NP_073741			terminal uridylyl transferase 1, U6						mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	62673842	62673843	+	IGR	DEL	AC	-	-	rs35842552		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62673842_62673843delAC								SLC3A2 (17490 upstream) : CHRM1 (2309 downstream)																																	OREG0021033	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	63566366	63566367	+	IGR	DEL	TT	-	-	rs112476778		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63566366_63566367delTT								C11orf95 (30253 upstream) : C11orf84 (14556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	64317588	64317589	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64317588_64317589delGT								RPS6KA4 (177902 upstream) : SLC22A11 (5509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	65238472	65238472	+	IGR	DEL	T	-	-	rs113070067		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65238472delT								MIR612 (26444 upstream) : MALAT1 (26761 downstream)																																			---	---	---	---
CHKA	1119	broad.mit.edu	37	11	67831875	67831875	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67831875delA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268			choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)													---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68309251	68309251	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68309251delG	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	68792914	68792916	+	IGR	DEL	AAC	-	-	rs10547178		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68792914_68792916delAAC								MRGPRF (12064 upstream) : TPCN2 (23434 downstream)																																			---	---	---	---
FGF19	9965	broad.mit.edu	37	11	69515534	69515535	+	Intron	INS	-	CCAGG	CCAGG	rs149065170	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69515534_69515535insCCAGG	uc001opf.2	-							NM_005117	NP_005108			fibroblast growth factor 19 precursor						fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of bile acid biosynthetic process|nervous system development|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import|positive regulation of JNK cascade	extracellular region	fibroblast growth factor receptor binding|growth factor activity			skin(1)	1	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;3.05e-56)|all cancers(3;2.69e-50)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)															---	---	---	---
NADSYN1	55191	broad.mit.edu	37	11	71199361	71199362	+	Intron	INS	-	GG	GG	rs141852645	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71199361_71199362insGG	uc001oqn.2	+						NADSYN1_uc001oqo.2_Intron|NADSYN1_uc001oqp.2_Intron	NM_018161	NP_060631			NAD synthetase 1						NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	71324566	71324566	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71324566delC								KRTAP5-11 (30645 upstream) : FAM86C (173991 downstream)																																			---	---	---	---
CLPB	81570	broad.mit.edu	37	11	72113139	72113139	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72113139delA	uc001osj.2	-						CLPB_uc010rqx.1_Intron|CLPB_uc010rqy.1_Intron|CLPB_uc001osk.2_Intron|CLPB_uc009ytg.2_Intron|CLPB_uc010rqz.1_Intron	NM_030813	NP_110440			caseinolytic peptidase B						cellular response to heat		ATP binding|nucleoside-triphosphatase activity|protein binding			pancreas(1)	1																		---	---	---	---
FCHSD2	9873	broad.mit.edu	37	11	72685853	72685853	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72685853delA	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639			FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)															---	---	---	---
RELT	84957	broad.mit.edu	37	11	73095225	73095226	+	Intron	INS	-	TC	TC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73095225_73095226insTC	uc001otv.2	+						RELT_uc001otw.2_Intron	NM_152222	NP_689408			RELT tumor necrosis factor receptor precursor							cytoplasm|integral to membrane|plasma membrane	binding|receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
MRPL48	51642	broad.mit.edu	37	11	73499518	73499518	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73499518delT	uc001ouh.3	+						MRPL48_uc009ytt.2_Intron|MRPL48_uc010rri.1_Intron|MRPL48_uc009ytu.2_Intron	NM_016055	NP_057139			mitochondrial ribosomal protein L48 precursor						translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0																		---	---	---	---
GDPD5	81544	broad.mit.edu	37	11	75200226	75200227	+	Intron	INS	-	A	A	rs144595500	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75200226_75200227insA	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001owq.3_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419			glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1																		---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77610331	77610331	+	Intron	DEL	G	-	-	rs112463272		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77610331delG	uc001oys.2	-						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron|INTS4_uc001oyt.2_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
GAB2	9846	broad.mit.edu	37	11	78112552	78112553	+	Intron	DEL	GT	-	-	rs11237483	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78112552_78112553delGT	uc001ozh.2	-							NM_080491	NP_536739			GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)															---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78686643	78686644	+	Intron	INS	-	CA	CA	rs10522468		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78686643_78686644insCA	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79899723	79899723	+	IGR	DEL	A	-	-	rs72350657		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79899723delA								ODZ4 (748028 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80027817	80027818	+	IGR	INS	-	AG	AG	rs142216727	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80027817_80027818insAG								ODZ4 (876122 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80069414	80069414	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80069414delG								ODZ4 (917719 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80381480	80381480	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80381480delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81540424	81540424	+	IGR	DEL	A	-	-	rs112384777		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81540424delA								None (None upstream) : FAM181B (902629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81823598	81823599	+	Intron	DEL	TG	-	-	rs146996733		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81823598_81823599delTG	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																														---	---	---	---
TMEM135	65084	broad.mit.edu	37	11	86752326	86752326	+	Intron	DEL	T	-	-	rs36088444		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86752326delT	uc001pch.2	+						TMEM135_uc010rtt.1_Intron|TMEM135_uc001pci.2_Intron|TMEM135_uc001pcg.1_Intron	NM_022918	NP_075069			transmembrane protein 135							integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	89496008	89496009	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89496008_89496009insT								TRIM77 (44970 upstream) : TRIM49 (34815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	89726627	89726627	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89726627delA								TRIM64 (19389 upstream) : UBTFL1 (92491 downstream)																																			---	---	---	---
CCDC67	159989	broad.mit.edu	37	11	93126253	93126254	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93126253_93126254insT	uc001pdq.2	+						CCDC67_uc001pdo.1_Intron|CCDC67_uc001pdp.2_Intron	NM_181645	NP_857596			coiled-coil domain containing 67											ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	94252080	94252080	+	IGR	DEL	T	-	-	rs141768923		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94252080delT								ANKRD49 (19340 upstream) : PIWIL4 (24926 downstream)																																			---	---	---	---
MTMR2	8898	broad.mit.edu	37	11	95632800	95632801	+	Intron	INS	-	A	A	rs10654504		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95632800_95632801insA	uc001pfu.2	-						MTMR2_uc001pfv.2_Intron|MTMR2_uc001pfs.2_Intron|MTMR2_uc001pft.2_Intron|MTMR2_uc010ruj.1_Intron	NM_016156	NP_057240			myotubularin-related protein 2 isoform 1							nucleus	inositol or phosphatidylinositol phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	97544145	97544146	+	IGR	INS	-	AC	AC	rs138692027	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97544145_97544146insAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98562417	98562417	+	IGR	DEL	T	-	-	rs113676297		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98562417delT								None (None upstream) : CNTN5 (329454 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	100517164	100517187	+	IGR	DEL	GAAGGAAGGAAAGAAGGAAGGAAA	-	-	rs12281290		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100517164_100517187delGAAGGAAGGAAAGAAGGAAGGAAA								CNTN5 (289692 upstream) : ARHGAP42 (41220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	101954747	101954748	+	IGR	INS	-	AA	AA	rs149305851	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101954747_101954748insAA								C11orf70 (603 upstream) : YAP1 (26462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	101969307	101969308	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101969307_101969308insA								C11orf70 (15163 upstream) : YAP1 (11902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	104297528	104297530	+	IGR	DEL	AAG	-	-	rs35289388		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104297528_104297530delAAG								PDGFD (262501 upstream) : CASP12 (458912 downstream)																																			---	---	---	---
CASP1	834	broad.mit.edu	37	11	104931538	104931538	+	Intron	DEL	G	-	-	rs5794376		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104931538delG	uc010rve.1	-						CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron	NM_033292	NP_150634			caspase 1 isoform alpha precursor						cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	105048270	105048271	+	IGR	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105048270_105048271delGA								CARD18 (38464 upstream) : GRIA4 (432529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107446642	107446643	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107446642_107446643insA								ALKBH8 (10181 upstream) : ELMOD1 (15174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107448407	107448407	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107448407delA								ALKBH8 (11946 upstream) : ELMOD1 (13410 downstream)																																			---	---	---	---
CUL5	8065	broad.mit.edu	37	11	107888573	107888573	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107888573delA	uc001pjv.2	+						CUL5_uc001pju.2_Intron	NM_003478	NP_003469			Vasopressin-activated calcium-mobilizing						cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	109722139	109722139	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109722139delC								C11orf87 (422301 upstream) : ZC3H12C (241787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	112205953	112205954	+	IGR	DEL	GC	-	-	rs35034944	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112205953_112205954delGC								PTS (65276 upstream) : NCAM1 (626041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113374948	113374949	+	IGR	INS	-	A	A	rs11346306		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113374948_113374949insA								DRD2 (28535 upstream) : TMPRSS5 (183320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113923457	113923457	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113923457delT								HTR3A (62425 upstream) : ZBTB16 (6974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114337462	114337462	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114337462delA								REXO2 (16464 upstream) : FAM55A (54976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114544108	114544109	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114544108_114544109insA								FAM55D (77624 upstream) : FAM55B (5091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114546066	114546066	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114546066delA								FAM55D (79582 upstream) : FAM55B (3134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	117914614	117914614	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117914614delT	uc001prx.1	-						uc001pry.1_Intron|uc001prz.1_Intron|uc009yzs.1_Intron|uc001psa.1_Intron					Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit26-03-15-R.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	118144715	118144716	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118144715_118144716insA								MPZL2 (9706 upstream) : CD3E (30579 downstream)																																			---	---	---	---
UPK2	7379	broad.mit.edu	37	11	118825225	118825225	+	5'Flank	DEL	A	-	-	rs74753126		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118825225delA	uc001puh.2	+							NM_006760	NP_006751			uroplakin 2 precursor						cellular membrane organization|epithelial cell differentiation|multicellular organismal development	integral to endoplasmic reticulum membrane|integral to plasma membrane				skin(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.122)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	119472753	119472753	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119472753delG								THY1 (178507 upstream) : PVRL1 (36055 downstream)																																			---	---	---	---
PVRL1	5818	broad.mit.edu	37	11	119554455	119554455	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119554455delT	uc001pwv.2	-						PVRL1_uc001pwu.1_Intron|PVRL1_uc001pww.2_Intron	NM_002855	NP_002846			poliovirus receptor-related 1 isoform 1						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)														---	---	---	---
POU2F3	25833	broad.mit.edu	37	11	120144735	120144735	+	Intron	DEL	A	-	-	rs5795222		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120144735delA	uc001pxc.2	+						POU2F3_uc010rzk.1_Intron|POU2F3_uc010rzl.1_Intron	NM_014352	NP_055167			POU transcription factor						negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	120363036	120363037	+	IGR	INS	-	A	A	rs139906598	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120363036_120363037insA								ARHGEF12 (2391 upstream) : GRIK4 (19431 downstream)																																			---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120824321	120824322	+	Intron	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120824321_120824322insG	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	121144374	121144393	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTC	-	-	rs57803831		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121144374_121144393delCTTCCTTCCTTCCTTCCTTC								TECTA (82861 upstream) : SC5DL (18995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122395344	122395344	+	IGR	DEL	C	-	-	rs5795335		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122395344delC								LOC399959 (156877 upstream) : UBASH3B (131054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	124136427	124136427	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124136427delA								OR8G2 (40117 upstream) : OR8D1 (43310 downstream)																																			---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125078681	125078682	+	Intron	DEL	AG	-	-	rs147497162		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125078681_125078682delAG	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	125554791	125554791	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125554791delA								ACRV1 (3849 upstream) : PATE1 (61397 downstream)																																			---	---	---	---
ST3GAL4	6484	broad.mit.edu	37	11	126229625	126229632	+	Intron	DEL	TCCCTCCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126229625_126229632delTCCCTCCT	uc001qds.2	+						ST3GAL4_uc001qdt.2_Intron|ST3GAL4_uc009zcc.2_Intron|ST3GAL4_uc009zcd.2_Intron|ST3GAL4_uc001qdu.2_Intron|ST3GAL4_uc001qdv.2_Intron	NM_006278	NP_006269			ST3 beta-galactoside alpha-2,3-sialyltransferase						post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126367006	126367007	+	Intron	DEL	TG	-	-	rs72306549		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126367006_126367007delTG	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127455875	127455875	+	IGR	DEL	A	-	-	rs143258070		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127455875delA								KIRREL3 (582520 upstream) : ETS1 (872781 downstream)																																			---	---	---	---
KCNJ5	3762	broad.mit.edu	37	11	128768042	128768042	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128768042delT	uc001qet.2	+						KCNJ5_uc009zck.2_Intron	NM_000890	NP_000881			potassium inwardly-rectifying channel J5						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	129455251	129455252	+	IGR	INS	-	T	T	rs111437942		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129455251_129455252insT								BARX2 (133078 upstream) : TMEM45B (230489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130423518	130423518	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130423518delT								ADAMTS15 (79803 upstream) : SNX19 (322249 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130561572	130561572	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130561572delC								ADAMTS15 (217857 upstream) : SNX19 (184195 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	132082852	132082853	+	Intron	INS	-	A	A	rs5795759		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132082852_132082853insA	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron|NTM_uc001qgr.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132897386	132897387	+	Intron	DEL	TG	-	-	rs77873729		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132897386_132897387delTG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
GLB1L2	89944	broad.mit.edu	37	11	134231219	134231219	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134231219delA	uc001qhp.2	+						GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351			galactosidase, beta 1-like 2 precursor						carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)														---	---	---	---
FGF23	8074	broad.mit.edu	37	12	4485695	4485696	+	Intron	INS	-	T	T	rs140174060	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4485695_4485696insT	uc001qmq.1	-							NM_020638	NP_065689			fibroblast growth factor 23 precursor						cell differentiation|insulin receptor signaling pathway|negative regulation of bone mineralization|negative regulation of hormone secretion|negative regulation of osteoblast differentiation|positive regulation of vitamin D 24-hydroxylase activity|regulation of phosphate transport|vitamin D catabolic process	extracellular space	growth factor activity			ovary(2)|breast(1)|skin(1)	4			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)															---	---	---	---
C12orf4	57102	broad.mit.edu	37	12	4601578	4601578	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4601578delA	uc001qms.2	-						C12orf4_uc001qmt.2_Intron	NM_020374	NP_065107			hypothetical protein LOC57102												0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)														---	---	---	---
C12orf4	57102	broad.mit.edu	37	12	4639391	4639391	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4639391delA	uc001qms.2	-						C12orf4_uc001qmt.2_Intron	NM_020374	NP_065107			hypothetical protein LOC57102												0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	4907774	4907775	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4907774_4907775delAC								GALNT8 (25882 upstream) : KCNA6 (10567 downstream)																																			---	---	---	---
GAPDH	2597	broad.mit.edu	37	12	6642557	6642558	+	5'Flank	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6642557_6642558insA	uc001qop.1	+						GAPDH_uc009zep.1_5'Flank|GAPDH_uc001qoq.1_5'Flank|GAPDH_uc001qor.1_5'Flank|GAPDH_uc001qos.1_5'Flank|GAPDH_uc001qot.1_5'Flank|GAPDH_uc001qou.1_5'Flank|GAPDH_uc001qov.1_5'Flank	NM_002046	NP_002037			glyceraldehyde-3-phosphate dehydrogenase						gluconeogenesis|glycolysis|neuron apoptosis|peptidyl-cysteine S-trans-nitrosylation|protein stabilization	cytosol|membrane|nucleus|perinuclear region of cytoplasm	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|peptidyl-cysteine S-nitrosylase activity|protein binding				0					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	9387519	9387519	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9387519delT								PZP (26553 upstream) : MIR1244 (4544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	16966744	16966755	+	IGR	DEL	TTCCTTCCTTCC	-	-	rs34075706		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16966744_16966755delTTCCTTCCTTCC								LMO3 (203986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	21878540	21878543	+	IGR	DEL	TATT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21878540_21878543delTATT								LDHB (67764 upstream) : KCNJ8 (39347 downstream)																																			---	---	---	---
BCAT1	586	broad.mit.edu	37	12	24977202	24977203	+	Intron	INS	-	TCCCTCCC	TCCCTCCC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24977202_24977203insTCCCTCCC	uc001rgd.3	-						BCAT1_uc001rgc.2_Intron|BCAT1_uc010six.1_Intron|BCAT1_uc010siy.1_Intron|BCAT1_uc001rge.3_Intron	NM_005504	NP_005495			branched chain aminotransferase 1, cytosolic						branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	25822225	25822225	+	IGR	DEL	A	-	-	rs72419823		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25822225delA								IFLTD1 (20737 upstream) : RASSF8 (289744 downstream)																																			---	---	---	---
SSPN	8082	broad.mit.edu	37	12	26373181	26373183	+	Intron	DEL	AAA	-	-	rs72370226		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26373181_26373183delAAA	uc001rhe.2	+						SSPN_uc001rhd.2_Intron|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077			sarcospan isoform 1						cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)																	---	---	---	---
SSPN	8082	broad.mit.edu	37	12	26375194	26375194	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26375194delA	uc001rhe.2	+						SSPN_uc001rhd.2_Intron|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077			sarcospan isoform 1						cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27304944	27304945	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27304944_27304945insT								C12orf71 (69489 upstream) : STK38L (92133 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	28928180	28928181	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28928180_28928181insT								CCDC91 (225082 upstream) : FAR2 (374051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	29016544	29016547	+	IGR	DEL	CCTT	-	-	rs113125236		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29016544_29016547delCCTT								CCDC91 (313446 upstream) : FAR2 (285685 downstream)																																			---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29819161	29819162	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29819161_29819162insT	uc001rjb.2	-						TMTC1_uc001rja.2_Intron|TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057			transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30232892	30232892	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30232892delC								TMTC1 (295200 upstream) : IPO8 (549031 downstream)																																			---	---	---	---
IPO8	10526	broad.mit.edu	37	12	30804498	30804499	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30804498_30804499delTG	uc001rjd.2	-						IPO8_uc001rje.1_Intron|IPO8_uc010sjt.1_Intron	NM_006390	NP_006381			importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30938520	30938520	+	IGR	DEL	A	-	-	rs34653818		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30938520delA								CAPRIN2 (31072 upstream) : TSPAN11 (140842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32242397	32242398	+	IGR	INS	-	A	A	rs147240147	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32242397_32242398insA								C12orf35 (96366 upstream) : BICD1 (17787 downstream)																																			---	---	---	---
BICD1	636	broad.mit.edu	37	12	32500586	32500586	+	Intron	DEL	G	-	-	rs76421004		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32500586delG	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
DNM1L	10059	broad.mit.edu	37	12	32849318	32849319	+	Intron	DEL	AC	-	-	rs112335727		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32849318_32849319delAC	uc001rld.2	+						DNM1L_uc010skf.1_Intron|DNM1L_uc010skg.1_Intron|DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192			dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	33777938	33777939	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33777938_33777939delGT								SYT10 (185184 upstream) : ALG10 (397277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34108150	34108150	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34108150delA								SYT10 (515396 upstream) : ALG10 (67066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34185653	34185653	+	IGR	DEL	T	-	-	rs67353257		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34185653delT								ALG10 (4419 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37877083	37877084	+	IGR	INS	-	A	A	rs76079002		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37877083_37877084insA								None (None upstream) : ALG10B (833473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37882444	37882445	+	IGR	INS	-	T	T	rs4123919		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37882444_37882445insT								None (None upstream) : ALG10B (828112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37954958	37954959	+	IGR	INS	-	A	A	rs111480869		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37954958_37954959insA								None (None upstream) : ALG10B (755598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38004009	38004010	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38004009_38004010delCT								None (None upstream) : ALG10B (706547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38052004	38052004	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38052004delC								None (None upstream) : ALG10B (658553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	39577177	39577178	+	IGR	INS	-	T	T	rs140136597	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39577177_39577178insT								CPNE8 (277757 upstream) : KIF21A (109853 downstream)																																			---	---	---	---
ABCD2	225	broad.mit.edu	37	12	40008355	40008355	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40008355delT	uc001rmb.2	-							NM_005164	NP_005155			ATP-binding cassette, sub-family D, member 2						fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
SLC2A13	114134	broad.mit.edu	37	12	40335931	40335931	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40335931delA	uc010skm.1	-							NM_052885	NP_443117			solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)													HNSCC(50;0.14)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	40920873	40920873	+	Intron	DEL	T	-	-	rs111826232		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40920873delT	uc001rmj.1	+											Homo sapiens mRNA; cDNA DKFZp686N11246 (from clone DKFZp686N11246).																														---	---	---	---
CNTN1	1272	broad.mit.edu	37	12	41404668	41404668	+	Intron	DEL	T	-	-	rs35933164		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41404668delT	uc001rmm.1	+						CNTN1_uc001rmn.1_Intron	NM_001843	NP_001834			contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	41495558	41495558	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41495558delG								CNTN1 (31464 upstream) : PDZRN4 (87229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	42005574	42005574	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42005574delG								PDZRN4 (37190 upstream) : GXYLT1 (470076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43510213	43510213	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43510213delT								PRICKLE1 (526641 upstream) : ADAMTS20 (237800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43971066	43971067	+	IGR	DEL	GT	-	-	rs35178671		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43971066_43971067delGT								ADAMTS20 (25342 upstream) : PUS7L (151347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	44185266	44185266	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44185266delA								IRAK4 (1920 upstream) : TWF1 (2262 downstream)																																			---	---	---	---
TMEM117	84216	broad.mit.edu	37	12	44553174	44553174	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44553174delC	uc001rod.2	+						TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Intron	NM_032256	NP_115632			transmembrane protein 117							endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	44830927	44830927	+	IGR	DEL	A	-	-	rs77324519		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44830927delA								TMEM117 (47387 upstream) : NELL2 (71131 downstream)																																			---	---	---	---
PFKM	5213	broad.mit.edu	37	12	48536299	48536300	+	Intron	INS	-	T	T	rs74089121		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48536299_48536300insT	uc001rrc.2	+						PFKM_uc001rra.1_Intron|PFKM_uc001rrb.1_Intron|PFKM_uc001rrd.2_Intron|PFKM_uc001rre.1_Intron|PFKM_uc001rrg.1_Intron	NM_000289	NP_000280			phosphofructokinase, muscle						fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4																		---	---	---	---
ASB8	140461	broad.mit.edu	37	12	48550770	48550770	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48550770delA	uc001rrh.2	-						ASB8_uc010slr.1_Intron	NM_024095	NP_077000			ankyrin repeat and SOCS box-containing 8						intracellular signal transduction	cytoplasm|nucleus				kidney(1)	1																		---	---	---	---
TUBA1B	10376	broad.mit.edu	37	12	49567704	49567704	+	Intron	DEL	T	-	-	rs5798096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49567704delT	uc001rto.2	-							NM_006082	NP_006073			tubulin, alpha, ubiquitous						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
TUBA1C	84790	broad.mit.edu	37	12	49635775	49635775	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49635775delT	uc010smh.1	+						TUBA1C_uc001rts.2_Intron	NM_032704	NP_116093			tubulin alpha 6						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	50174856	50174857	+	IGR	INS	-	CCTTC	CCTTC	rs145606245	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50174856_50174857insCCTTC								TMBIM6 (16139 upstream) : NCKAP5L (10072 downstream)																																			---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50607834	50607835	+	Intron	INS	-	ACAT	ACAT	rs142450989	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50607834_50607835insACAT	uc001rwj.3	-						LIMA1_uc001rwh.3_Intron|LIMA1_uc001rwi.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
LARP4	113251	broad.mit.edu	37	12	50826134	50826134	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50826134delA	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc001rwm.2_Intron|LARP4_uc001rwn.2_Intron	NM_052879	NP_443111			c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
TMPRSS12	283471	broad.mit.edu	37	12	51251572	51251574	+	Intron	DEL	TTG	-	-	rs112819225		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51251572_51251574delTTG	uc001rwx.3	+						TMPRSS12_uc001rwy.2_Intron	NM_182559	NP_872365			transmembrane protease, serine 12 precursor						proteolysis	integral to membrane	serine-type endopeptidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	53541775	53541776	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53541775_53541776insT								SOAT2 (23453 upstream) : CSAD (9672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54144309	54144310	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54144309_54144310delGT								CALCOCO1 (23002 upstream) : HOXC13 (188266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54282976	54282977	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54282976_54282977insC								CALCOCO1 (161669 upstream) : HOXC13 (49599 downstream)																																			---	---	---	---
GPR84	53831	broad.mit.edu	37	12	54760781	54760785	+	5'Flank	DEL	AAAAC	-	-	rs111401288		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54760781_54760785delAAAAC	uc001sfu.2	-							NM_020370	NP_065103			G protein-coupled receptor 84							integral to membrane|plasma membrane	G-protein coupled receptor activity			breast(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	55981641	55981642	+	IGR	INS	-	TA	TA	rs4529917	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55981641_55981642insTA								OR6C4 (35703 upstream) : OR10P1 (49034 downstream)																																			---	---	---	---
TIMELESS	8914	broad.mit.edu	37	12	56822988	56822988	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56822988delT	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911			timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	56911372	56911372	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56911372delT								GLS2 (29191 upstream) : RBMS2 (4237 downstream)																																			---	---	---	---
LRP1	4035	broad.mit.edu	37	12	57571731	57571731	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57571731delT	uc001snd.2	+							NM_002332	NP_002323			low density lipoprotein-related protein 1						aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)													---	---	---	---
INHBC	3626	broad.mit.edu	37	12	57842489	57842489	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57842489delA	uc001snv.1	+							NM_005538	NP_005529			inhibin beta C chain preproprotein						growth	extracellular region	growth factor activity|hormone activity|transforming growth factor beta receptor binding				0																		---	---	---	---
MARS	4141	broad.mit.edu	37	12	57898948	57898948	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57898948delT	uc001sog.2	+						MARS_uc001sof.1_Intron|MARS_uc010srp.1_Intron|MARS_uc010srq.1_Intron	NM_004990	NP_004981			methionyl-tRNA synthetase						methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	58779258	58779259	+	IGR	INS	-	GCAC	GCAC	rs138147615	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58779258_58779259insGCAC								XRCC6BP1 (428207 upstream) : LRIG3 (486679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59007175	59007176	+	Intron	INS	-	TTT	TTT	rs150007087	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59007175_59007176insTTT	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	59568184	59568185	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59568184_59568185insT								LRIG3 (253922 upstream) : SLC16A7 (421663 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62126515	62126516	+	Intron	DEL	TG	-	-	rs6581423	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62126515_62126516delTG	uc001sqw.2	-						FAM19A2_uc001sqv.2_Intron|FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62452407	62452408	+	Intron	DEL	CT	-	-	rs57250351	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62452407_62452408delCT	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	62853436	62853436	+	IGR	DEL	T	-	-	rs35718438		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62853436delT								USP15 (53538 upstream) : MON2 (7161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63345600	63345601	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63345600_63345601insA								PPM1H (16685 upstream) : AVPR1A (194615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63628063	63628064	+	IGR	DEL	TA	-	-	rs56857644		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63628063_63628064delTA								AVPR1A (81473 upstream) : DPY19L2 (324629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63784555	63784560	+	IGR	DEL	GTGTGT	-	-	rs139419295		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63784555_63784560delGTGTGT								AVPR1A (237965 upstream) : DPY19L2 (168133 downstream)																																			---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64796186	64796186	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64796186delT	uc001ssb.2	+						XPOT_uc009zqm.1_5'Flank	NM_007235	NP_009166			tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	65870051	65870051	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65870051delC								MSRB3 (9371 upstream) : RPSAP52 (281752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	66387141	66387142	+	IGR	INS	-	T	T	rs141932183	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66387141_66387142insT								HMGA2 (27073 upstream) : LLPH (129708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	66478845	66478846	+	IGR	INS	-	CAAA	CAAA	rs145440759	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66478845_66478846insCAAA								HMGA2 (118777 upstream) : LLPH (38004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	67878645	67878645	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67878645delT								CAND1 (170257 upstream) : DYRK2 (163867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68984518	68984518	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68984518delT								MDM1 (258357 upstream) : RAP1B (20134 downstream)																																			---	---	---	---
CPM	1368	broad.mit.edu	37	12	69270698	69270701	+	Intron	DEL	GTGA	-	-	rs2904507		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69270698_69270701delGTGA	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079			carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)															---	---	---	---
YEATS4	8089	broad.mit.edu	37	12	69759837	69759837	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69759837delT	uc001sux.2	+							NM_006530	NP_006521			glioma-amplified sequence-41						histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	69807640	69807644	+	IGR	DEL	AAAAG	-	-	rs66489818		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69807640_69807644delAAAAG								YEATS4 (23065 upstream) : FRS2 (56485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	70371317	70371317	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70371317delG								RAB3IP (154335 upstream) : CNOT2 (265460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	72441648	72441649	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72441648_72441649delTG								TPH2 (15427 upstream) : LOC283392 (214679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74620116	74620117	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74620116_74620117insT	uc009zrx.1	-						uc001sxc.2_Intron					Homo sapiens cDNA clone IMAGE:3926153, partial cds.																														---	---	---	---
OSBPL8	114882	broad.mit.edu	37	12	76919322	76919323	+	Intron	INS	-	AAC	AAC	rs143058968	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76919322_76919323insAAC	uc001sye.1	-						OSBPL8_uc001syf.1_Intron|OSBPL8_uc001syg.1_Intron	NM_020841	NP_065892			oxysterol-binding protein-like protein 8 isoform						lipid transport		lipid binding			ovary(1)	1																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78224950	78224957	+	5'Flank	DEL	AGAGAGAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224950_78224957delAGAGAGAG	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
PPP1R12A	4659	broad.mit.edu	37	12	80273626	80273627	+	Intron	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80273626_80273627insG	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001szc.2_Intron	NM_002480	NP_002471			protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
LIN7A	8825	broad.mit.edu	37	12	81243204	81243204	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81243204delA	uc001szj.1	-						LIN7A_uc001szk.1_Intron	NM_004664	NP_004655			lin-7 homolog A						exocytosis|protein complex assembly|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	L27 domain binding			ovary(1)|skin(1)	2																		---	---	---	---
PPFIA2	8499	broad.mit.edu	37	12	81655693	81655693	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81655693delT	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010suf.1_Intron|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616			PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	84038348	84038349	+	IGR	INS	-	GT	GT	rs144912799	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84038348_84038349insGT								TMTC2 (510285 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	84075422	84075422	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84075422delT								TMTC2 (547359 upstream) : None (None downstream)																																			---	---	---	---
POC1B	282809	broad.mit.edu	37	12	89865159	89865159	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89865159delT	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron|POC1B_uc009zsp.2_Intron|POC1B_uc009zsq.2_Intron	NM_172240	NP_758440			WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1																		---	---	---	---
POC1B	282809	broad.mit.edu	37	12	89911410	89911410	+	Intron	DEL	A	-	-	rs113256657		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89911410delA	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron	NM_172240	NP_758440			WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	93665203	93665203	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93665203delG								EEA1 (342096 upstream) : NUDT4 (106498 downstream)																																			---	---	---	---
CCDC38	120935	broad.mit.edu	37	12	96310088	96310089	+	Intron	INS	-	T	T	rs138396860	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96310088_96310089insT	uc001tek.1	-							NM_182496	NP_872302			coiled-coil domain containing 38											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	96831303	96831303	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96831303delT								CDK17 (37080 upstream) : C12orf63 (210450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	97291799	97291800	+	IGR	DEL	GC	-	-	rs58836913		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97291799_97291800delGC								C12orf63 (132751 upstream) : NEDD1 (9201 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99255737	99255737	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99255737delT	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc010sve.1_Intron|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Intron|ANKS1B_uc010svf.1_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron|ANKS1B_uc001tgm.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100092737	100092738	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100092737_100092738delTG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
UHRF1BP1L	23074	broad.mit.edu	37	12	100499640	100499641	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100499640_100499641insA	uc001tgq.2	-						UHRF1BP1L_uc001tgr.2_Intron	NM_015054	NP_055869			UHRF1 (ICBP90) binding protein 1-like isoform a											ovary(2)	2																		---	---	---	---
SYCP3	50511	broad.mit.edu	37	12	102130487	102130492	+	Intron	DEL	TGTGTG	-	-	rs34377603		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102130487_102130492delTGTGTG	uc001tiq.2	-						SYCP3_uc001tir.2_Intron|SYCP3_uc001tis.2_Intron	NM_153694	NP_710161			synaptonemal complex protein 3						cell division|male meiosis I|spermatogenesis, exchange of chromosomal proteins	nucleus	DNA binding				0																		---	---	---	---
GNPTAB	79158	broad.mit.edu	37	12	102177665	102177666	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102177665_102177666insT	uc001tit.2	-						GNPTAB_uc001tiu.1_Intron|GNPTAB_uc001tiv.3_Intron	NM_024312	NP_077288			N-acetylglucosamine-1-phosphate transferase						cell differentiation	Golgi membrane|integral to membrane|nucleus	metal ion binding|transcription factor binding|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity			ovary(1)|skin(1)	2																		---	---	---	---
NT5DC3	51559	broad.mit.edu	37	12	104234156	104234160	+	Intron	DEL	CTCAT	-	-	rs139287401	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104234156_104234160delCTCAT	uc010swe.1	-							NM_001031701	NP_001026871			5'-nucleotidase domain containing 3								hydrolase activity|metal ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TXNRD1	7296	broad.mit.edu	37	12	104611812	104611812	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104611812delT	uc010swk.1	+						TXNRD1_uc001tkm.1_Intron	NM_001093771	NP_001087240			thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	106309991	106309991	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106309991delC								C12orf75 (544696 upstream) : NUAK1 (147134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	107590100	107590119	+	IGR	DEL	TCTATCTATCTATCTATCTA	-	-	rs113937723		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107590100_107590119delTCTATCTATCTATCTATCTA								CRY1 (102502 upstream) : BTBD11 (122078 downstream)																																			---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107858727	107858728	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107858727_107858728delAC	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	111186951	111186951	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111186951delT								PPP1CC (6194 upstream) : CCDC63 (97860 downstream)																																			---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111490494	111490495	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111490494_111490495delTG	uc001tsa.1	+							NM_015267	NP_056082			cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111508198	111508213	+	Intron	DEL	TTCCTTCCTTCCTTCC	-	-	rs55667059		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111508198_111508213delTTCCTTCCTTCCTTCC	uc001tsa.1	+							NM_015267	NP_056082			cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
SH2B3	10019	broad.mit.edu	37	12	111841491	111841493	+	5'Flank	DEL	TTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111841491_111841493delTTT	uc001tse.2	+							NM_005475	NP_005466			SH2B adaptor protein 3						blood coagulation	cytosol	signal transducer activity			ovary(1)	1																		---	---	---	---
ATXN2	6311	broad.mit.edu	37	12	112028699	112028699	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112028699delT	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964			ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114080407	114080407	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114080407delT								LHX5 (170530 upstream) : RBM19 (174136 downstream)																																			---	---	---	---
RBM19	9904	broad.mit.edu	37	12	114366223	114366224	+	Intron	DEL	AC	-	-	rs71443065		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114366223_114366224delAC	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171			RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	115139579	115139579	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115139579delC								TBX3 (17610 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116196538	116196538	+	IGR	DEL	T	-	-	rs67957003		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116196538delT								None (None upstream) : MED13L (199845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116810925	116810925	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116810925delT								MED13L (95934 upstream) : NCRNA00173 (160302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	117019979	117019979	+	IGR	DEL	T	-	-	rs34961747		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117019979delT								MAP1LC3B2 (5554 upstream) : C12orf49 (133617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	118584739	118584740	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118584739_118584740insA								PEBP1 (1349 upstream) : TAOK3 (2867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	118928912	118928913	+	IGR	INS	-	T	T	rs138294326	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118928912_118928913insT								SUDS3 (73073 upstream) : SRRM4 (490483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	119122703	119122704	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119122703_119122704delAG								SUDS3 (266864 upstream) : SRRM4 (296692 downstream)																																			---	---	---	---
SRRM4	84530	broad.mit.edu	37	12	119429404	119429405	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119429404_119429405delAC	uc001txa.1	+							NM_194286	NP_919262			KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2																		---	---	---	---
SRRM4	84530	broad.mit.edu	37	12	119557975	119557976	+	Intron	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119557975_119557976delTC	uc001txa.1	+							NM_194286	NP_919262			KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2																		---	---	---	---
SRRM4	84530	broad.mit.edu	37	12	119567769	119567772	+	Intron	DEL	GATG	-	-	rs10549675		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119567769_119567772delGATG	uc001txa.1	+							NM_194286	NP_919262			KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2																		---	---	---	---
SRRM4	84530	broad.mit.edu	37	12	119581083	119581083	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119581083delA	uc001txa.1	+							NM_194286	NP_919262			KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	120410368	120410368	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120410368delA								CIT (95276 upstream) : CCDC64 (17280 downstream)																																			---	---	---	---
ANAPC5	51433	broad.mit.edu	37	12	121791238	121791239	+	5'Flank	INS	-	TTTTGTTTTG	TTTTGTTTTG	rs146846306	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121791238_121791239insTTTTGTTTTG	uc001uag.2	-						ANAPC5_uc001uah.2_Intron	NM_016237	NP_057321			anaphase-promoting complex subunit 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	122126100	122126100	+	IGR	DEL	T	-	-	rs34328366		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122126100delT								MORN3 (15563 upstream) : TMEM120B (24558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	122630769	122630769	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122630769delT								MLXIP (1804 upstream) : LRRC43 (21497 downstream)																																			---	---	---	---
ZCCHC8	55596	broad.mit.edu	37	12	122982537	122982538	+	Intron	INS	-	AAACAA	AAACAA	rs150507572	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122982537_122982538insAAACAA	uc001ucn.2	-						ZCCHC8_uc009zxp.2_Intron|ZCCHC8_uc009zxq.2_Intron	NM_017612	NP_060082			zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)														---	---	---	---
RSRC2	65117	broad.mit.edu	37	12	123003936	123003941	+	Intron	DEL	TTAAGT	-	-	rs67040035		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123003936_123003941delTTAAGT	uc001ucr.2	-						RSRC2_uc001uco.2_Intron|RSRC2_uc001ucp.2_Intron|RSRC2_uc001ucq.2_Intron|RSRC2_uc001ucs.2_Intron|RSRC2_uc001uct.2_Intron|RSRC2_uc001ucu.2_Intron	NM_023012	NP_075388			arginine/serine-rich coiled-coil 2 isoform a											ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)														---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123030498	123030498	+	Intron	DEL	A	-	-	rs68098547		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123030498delA	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
GPR81	27198	broad.mit.edu	37	12	123196183	123196184	+	Intron	INS	-	T	T	rs62969561		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123196183_123196184insT	uc001ucw.1	-							NM_032554				G protein-coupled receptor 81						response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)														---	---	---	---
SETD8	387893	broad.mit.edu	37	12	123890034	123890034	+	Intron	DEL	C	-	-	rs34477554		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123890034delC	uc001uew.2	+						SETD8_uc001uex.2_Intron	NM_020382	NP_065115			SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	124662019	124662022	+	IGR	DEL	GTGG	-	-	rs72250195		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124662019_124662022delGTGG								ZNF664 (162052 upstream) : FAM101A (111688 downstream)																																			---	---	---	---
AACS	65985	broad.mit.edu	37	12	125547463	125547464	+	5'Flank	DEL	GT	-	-	rs34222505		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125547463_125547464delGT	uc001uhc.2	+						AACS_uc009zyg.2_5'Flank|AACS_uc001uhd.2_5'Flank	NM_023928	NP_076417			acetoacetyl-CoA synthetase						fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)														---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126010441	126010441	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126010441delT	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	127933157	127933157	+	IGR	DEL	A	-	-	rs34723458		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127933157delA								LOC100128554 (975827 upstream) : TMEM132C (966134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128466217	128466218	+	IGR	DEL	AA	-	-	rs141369955		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128466217_128466218delAA								None (None upstream) : TMEM132C (433073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129516478	129516479	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129516478_129516479insA								GLT1D1 (46969 upstream) : TMEM132D (39792 downstream)																																			---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131607234	131607235	+	Intron	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131607234_131607235delTT	uc001uit.3	+						GPR133_uc010tbm.1_Intron|GPR133_uc009zyo.2_Intron|GPR133_uc009zyp.2_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131880191	131880199	+	IGR	DEL	TGATGATGA	-	-	rs150166007		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131880191_131880199delTGATGATGA								LOC116437 (182716 upstream) : SFRS8 (315436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131993724	131993725	+	IGR	INS	-	CTC	CTC	rs112239866		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131993724_131993725insCTC								LOC116437 (296249 upstream) : SFRS8 (201910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132116074	132116081	+	IGR	DEL	ATGGATGG	-	-	rs72500899		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132116074_132116081delATGGATGG								LOC116437 (418599 upstream) : SFRS8 (79554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133040998	133040999	+	IGR	INS	-	CATCAC	CATCAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133040998_133040999insCATCAC								GALNT9 (135093 upstream) : FBRSL1 (26158 downstream)																																			---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19651281	19651282	+	Intron	INS	-	T	T	rs138485383	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19651281_19651282insT	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
MPHOSPH8	54737	broad.mit.edu	37	13	20234096	20234099	+	Intron	DEL	TTTT	-	-	rs34817892		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20234096_20234099delTTTT	uc001umh.2	+						MPHOSPH8_uc001umg.2_Intron	NM_017520	NP_059990			M-phase phosphoprotein 8						cell cycle	cytoplasm|nucleus					0		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	21816984	21816984	+	IGR	DEL	T	-	-	rs112717607		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21816984delT								MRP63 (63766 upstream) : ZDHHC20 (133526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22320365	22320366	+	IGR	INS	-	TT	TT	rs141546368		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22320365_22320366insTT								FGF9 (41725 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22936043	22936043	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22936043delT								FGF9 (657403 upstream) : SGCG (819017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23458964	23458964	+	IGR	DEL	T	-	-	rs58208166		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23458964delT								None (None upstream) : SGCG (296096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23507699	23507704	+	IGR	DEL	CACAAC	-	-	rs111682687	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23507699_23507704delCACAAC								None (None upstream) : SGCG (247356 downstream)																																			---	---	---	---
SGCG	6445	broad.mit.edu	37	13	23775305	23775305	+	Intron	DEL	A	-	-	rs66716392		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23775305delA	uc001uom.2	+						SGCG_uc009zzv.2_Intron|SGCG_uc009zzw.2_Intron	NM_000231	NP_000222			gamma sarcoglycan						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)														---	---	---	---
MIPEP	4285	broad.mit.edu	37	13	24349249	24349256	+	Intron	DEL	TGTGTGTG	-	-	rs9578641		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24349249_24349256delTGTGTGTG	uc001uox.3	-							NM_005932	NP_005923			mitochondrial intermediate peptidase precursor						protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24660205	24660206	+	Intron	INS	-	GAGTA	GAGTA	rs147254503	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24660205_24660206insGAGTA	uc001upd.1	+						C1QTNF9_uc001upe.2_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	24958714	24958715	+	IGR	INS	-	GC	GC	rs139855556	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24958714_24958715insGC								C1QTNF9 (62049 upstream) : PARP4 (36360 downstream)																																			---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26499635	26499635	+	Intron	DEL	T	-	-	rs80350005		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26499635delT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27279554	27279554	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27279554delA								WASF3 (16474 upstream) : GPR12 (49787 downstream)																																			---	---	---	---
LNX2	222484	broad.mit.edu	37	13	28157662	28157663	+	Intron	INS	-	GG	GG	rs141274395	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28157662_28157663insGG	uc001url.3	-						LNX2_uc001urm.1_Intron	NM_153371	NP_699202			ligand of numb-protein X 2								zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	28247242	28247242	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28247242delG								POLR1D (5695 upstream) : GSX1 (119538 downstream)																																			---	---	---	---
FLT1	2321	broad.mit.edu	37	13	29050267	29050268	+	Intron	DEL	CA	-	-	rs71769502		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29050267_29050268delCA	uc001usb.3	-						FLT1_uc010aar.1_Intron|FLT1_uc001usc.3_Intron|FLT1_uc010tdp.1_Intron|FLT1_uc001usd.2_Intron	NM_002019	NP_002010			fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)													---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29757390	29757391	+	Intron	INS	-	GA	GA	rs139424564	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29757390_29757391insGA	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
SLC7A1	6541	broad.mit.edu	37	13	30108942	30108944	+	Intron	DEL	AAA	-	-	rs146337116	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30108942_30108944delAAA	uc001uso.2	-							NM_003045	NP_003036			solute carrier family 7 (cationic amino acid						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	30896738	30896739	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30896738_30896739insT								KATNAL1 (15154 upstream) : LOC100188949 (17670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	32289985	32289988	+	IGR	DEL	CTAA	-	-	rs3046979		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32289985_32289988delCTAA								B3GALTL (383576 upstream) : RXFP2 (23691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	37799727	37799727	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37799727delT								CSNK1A1L (119926 upstream) : POSTN (336993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38576829	38576830	+	IGR	INS	-	T	T	rs139246585	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38576829_38576830insT								TRPC4 (132890 upstream) : UFM1 (347112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39517687	39517687	+	IGR	DEL	G	-	-	rs35689953		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39517687delG								FREM2 (56422 upstream) : STOML3 (22376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39649970	39649970	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39649970delA								NHLRC3 (25728 upstream) : LHFP (267060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	40583508	40583508	+	IGR	DEL	T	-	-	rs34951098		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40583508delT								COG6 (217706 upstream) : LOC646982 (337765 downstream)																																			---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41068750	41068751	+	Intron	DEL	AG	-	-	rs2721065		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41068750_41068751delAG	uc010acc.1	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
MRPS31	10240	broad.mit.edu	37	13	41303867	41303867	+	Intron	DEL	T	-	-	rs72358841		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41303867delT	uc001uxm.3	-						MIR320D-1_hsa-mir-320d-1|MI0008190_5'Flank	NM_005830	NP_005821			mitochondrial ribosomal protein S31 precursor							mitochondrion|ribosome	protein domain specific binding				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42021170	42021170	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42021170delA								OR7E37P (15030 upstream) : C13orf15 (10372 downstream)																																			---	---	---	---
KIAA0564	23078	broad.mit.edu	37	13	42522090	42522090	+	Intron	DEL	C	-	-	rs7997953		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42522090delC	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873			hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42639026	42639026	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42639026delA	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42961760	42961779	+	IGR	DEL	ACACACACACACACACACAC	-	-	rs67251506		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42961760_42961779delACACACACACACACACACAC								AKAP11 (64358 upstream) : TNFSF11 (175093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	43013845	43013846	+	IGR	INS	-	TGTGTG	TGTGTG	rs113166999		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43013845_43013846insTGTGTG								AKAP11 (116443 upstream) : TNFSF11 (123026 downstream)																																			---	---	---	---
COG3	83548	broad.mit.edu	37	13	46098956	46098956	+	Intron	DEL	T	-	-	rs34702079		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46098956delT	uc001vak.2	+						COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	NM_031431	NP_113619			component of golgi transport complex 3						ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46835767	46835769	+	Intron	DEL	CAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46835767_46835769delCAA	uc001vbc.2	+											RecName: Full=Leucine-rich repeat-containing protein 63;																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46882936	46882939	+	IGR	DEL	GACG	-	-	rs35721842		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46882936_46882939delGACG								LCP1 (126477 upstream) : C13orf18 (33200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	47058522	47058522	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47058522delA								C13orf18 (46197 upstream) : LRCH1 (68774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	47532282	47532282	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47532282delT								HTR2A (61232 upstream) : SUCLA2 (984510 downstream)																																			---	---	---	---
SUCLA2	8803	broad.mit.edu	37	13	48602498	48602499	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48602498_48602499insT	uc010tgd.1	-							NM_003850	NP_003841			succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	50208992	50208993	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50208992_50208993insT								ARL11 (1261 upstream) : EBPL (25818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	50519955	50519955	+	IGR	DEL	A	-	-	rs112084450		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50519955delA								C13orf1 (9330 upstream) : DLEU2 (36733 downstream)																																			---	---	---	---
DLEU2	8847	broad.mit.edu	37	13	50667180	50667181	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50667180_50667181insT	uc001vdn.1	-						DLEU2_uc001vdo.1_Intron|DLEU1_uc010adl.1_Intron|DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|DLEU1_uc001vec.2_Intron|DLEU1_uc001ved.2_Intron	NR_002612				Homo sapiens BCMS-upstream neighbor (BCMSUN) mRNA, partial sequence.												0																		---	---	---	---
FAM124A	220108	broad.mit.edu	37	13	51829885	51829886	+	Intron	INS	-	T	T	rs142274857		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51829885_51829886insT	uc001vfg.1	+						FAM124A_uc001vff.1_Intron	NM_145019	NP_659456			hypothetical protein LOC220108											central_nervous_system(1)	1		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	53396734	53396734	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53396734delA								MIR759 (12459 upstream) : PCDH8 (21377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57048769	57048769	+	IGR	DEL	T	-	-	rs147726553		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57048769delT								None (None upstream) : PRR20C (666283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58359445	58359446	+	IGR	INS	-	T	T	rs144443651	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58359445_58359446insT								PCDH17 (56380 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59767981	59767981	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59767981delT								None (None upstream) : DIAPH3 (471744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	60161890	60161891	+	IGR	INS	-	A	A	rs146542025	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60161890_60161891insA								None (None upstream) : DIAPH3 (77834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62749918	62749921	+	IGR	DEL	GTGT	-	-	rs34219398		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62749918_62749921delGTGT								PCDH20 (747839 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63344656	63344657	+	IGR	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63344656_63344657delTC								None (None upstream) : OR7E156P (966911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64559693	64559694	+	IGR	DEL	TG	-	-	rs144187891		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64559693_64559694delTG								OR7E156P (242992 upstream) : None (None downstream)																																			---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67587854	67587855	+	Intron	DEL	AC	-	-	rs146056006	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67587854_67587855delAC	uc001vik.2	-						PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	68654194	68654195	+	IGR	DEL	CA	-	-	rs12869762		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68654194_68654195delCA								PCDH9 (849726 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69043031	69043032	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69043031_69043032delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69073069	69073078	+	IGR	DEL	TGTGTGTGTG	-	-	rs34496885		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69073069_69073078delTGTGTGTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69191463	69191486	+	IGR	DEL	TGGGAGACACCTCCCAGCAAGGGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69191463_69191486delTGGGAGACACCTCCCAGCAAGGGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69322290	69322292	+	IGR	DEL	AAA	-	-	rs146661144		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69322290_69322292delAAA								None (None upstream) : KLHL1 (952434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69894964	69894965	+	IGR	INS	-	TGTG	TGTG	rs71196243		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69894964_69894965insTGTG								None (None upstream) : KLHL1 (379761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70727147	70727156	+	IGR	DEL	TGTGTGTGTG	-	-	rs66574752		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70727147_70727156delTGTGTGTGTG								ATXN8OS (13262 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71598501	71598503	+	IGR	DEL	GAA	-	-	rs34002447		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71598501_71598503delGAA								ATXN8OS (884616 upstream) : DACH1 (413595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73594875	73594876	+	IGR	INS	-	G	G	rs138037490	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73594875_73594876insG								PIBF1 (4286 upstream) : KLF5 (34238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75275013	75275014	+	IGR	INS	-	TTTT	TTTT	rs72442966		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75275013_75275014insTTTT								KLF12 (566619 upstream) : LOC647288 (536876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77554890	77554890	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77554890delA								BTF3L1 (51667 upstream) : CLN5 (11169 downstream)																																	OREG0022450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	13	78078033	78078033	+	IGR	DEL	C	-	-	rs5804908		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78078033delC								MYCBP2 (176856 upstream) : SCEL (31776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78463888	78463890	+	Intron	DEL	TTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78463888_78463890delTTC	uc001vkn.1	+											Homo sapiens cDNA clone IMAGE:5266257.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78755494	78755495	+	Intron	INS	-	ACACACAC	ACACACAC	rs145985214	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78755494_78755495insACACACAC	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78770530	78770531	+	Intron	INS	-	T	T	rs146399027	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78770530_78770531insT	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79153711	79153711	+	RNA	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79153711delA	uc001vks.2	+	3		c.1415delA			uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80039403	80039404	+	IGR	DEL	AT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80039403_80039404delAT								RBM26 (59480 upstream) : NDFIP2 (15855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80703529	80703530	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80703529_80703530insA								NDFIP2 (573324 upstream) : SPRY2 (206584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80732589	80732590	+	IGR	INS	-	A	A	rs33968357		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80732589_80732590insA								NDFIP2 (602384 upstream) : SPRY2 (177524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81016507	81016508	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81016507_81016508insC								SPRY2 (101421 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81429073	81429074	+	IGR	INS	-	TG	TG	rs139249474	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81429073_81429074insTG								SPRY2 (513987 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	82024461	82024461	+	IGR	DEL	G	-	-	rs35026660		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82024461delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	82243507	82243507	+	IGR	DEL	G	-	-	rs140491428	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82243507delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86241498	86241499	+	IGR	INS	-	T	T	rs140813053	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86241498_86241499insT								None (None upstream) : SLITRK6 (125423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88618773	88618774	+	IGR	INS	-	T	T	rs72140282		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88618773_88618774insT								SLITRK5 (286905 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89326470	89326471	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89326470_89326471delGT								SLITRK5 (994602 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89379757	89379758	+	IGR	INS	-	T	T	rs56015110		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89379757_89379758insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90336522	90336523	+	IGR	INS	-	GTGT	GTGT	rs66951933		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90336522_90336523insGTGT								None (None upstream) : MIR622 (546913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90815859	90815860	+	IGR	DEL	AC	-	-	rs34965074		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90815859_90815860delAC								None (None upstream) : MIR622 (67576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91732355	91732355	+	IGR	DEL	C	-	-	rs11299934		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91732355delC								LOC144776 (153504 upstream) : MIR17HG (267719 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92456035	92456036	+	Intron	INS	-	ACAC	ACAC	rs2026970	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92456035_92456036insACAC	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93332410	93332410	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93332410delC	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	93721065	93721066	+	IGR	INS	-	T	T	rs35116577		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93721065_93721066insT								GPC5 (201580 upstream) : GPC6 (158012 downstream)																																			---	---	---	---
GPC6	10082	broad.mit.edu	37	13	93983857	93983858	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93983857_93983858insT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94607497	94607504	+	Intron	DEL	CACACACA	-	-	rs71667982		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94607497_94607504delCACACACA	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
DCT	1638	broad.mit.edu	37	13	95126513	95126513	+	Intron	DEL	A	-	-	rs3837536		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95126513delA	uc001vlv.3	-						DCT_uc010afh.2_Intron	NM_001922	NP_001913			dopachrome tautomerase isoform 1						epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)														---	---	---	---
ABCC4	10257	broad.mit.edu	37	13	95848800	95848801	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95848800_95848801insA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron|ABCC4_uc001vmf.2_Intron|ABCC4_uc010afl.1_Intron|ABCC4_uc010afm.1_Intron	NM_005845	NP_005836			ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)													---	---	---	---
DNAJC3	5611	broad.mit.edu	37	13	96330983	96330983	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96330983delT	uc001vmq.2	+						DNAJC3_uc001vmp.2_Intron|DNAJC3_uc001vmr.2_Intron|uc001vmo.3_5'Flank	NM_006260	NP_006251			DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	96733103	96733106	+	IGR	DEL	TGTC	-	-	rs9525121		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96733103_96733106delTGTC								UGGT2 (27367 upstream) : HS6ST3 (9987 downstream)																																			---	---	---	---
OXGR1	27199	broad.mit.edu	37	13	97647280	97647281	+	5'Flank	INS	-	GAG	GAG	rs150979228	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97647280_97647281insGAG	uc001vmx.1	-						OXGR1_uc010afr.1_5'Flank	NM_080818	NP_543008			oxoglutarate (alpha-ketoglutarate) receptor 1							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	98509726	98509728	+	IGR	DEL	ATC	-	-	rs77277758		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98509726_98509728delATC								RAP2A (389475 upstream) : IPO5 (96201 downstream)																																			---	---	---	---
CLYBL	171425	broad.mit.edu	37	13	100278122	100278123	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100278122_100278123insT	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
PCCA	5095	broad.mit.edu	37	13	100892623	100892624	+	Intron	INS	-	T	T	rs35401040		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100892623_100892624insT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102550376	102550377	+	Intron	INS	-	T	T	rs143317521	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102550376_102550377insT	uc001vpe.2	-						FGF14_uc001vpf.2_Intron	NM_004115	NP_004106			fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102745705	102745705	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102745705delT	uc001vpf.2	-							NM_175929	NP_787125			fibroblast growth factor 14 isoform 1B						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	103181244	103181244	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103181244delT								FGF14 (127120 upstream) : TPP2 (68042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	103954456	103954457	+	IGR	INS	-	AGAA	AGAA	rs139212496	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103954456_103954457insAGAA								SLC10A2 (235260 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104790381	104790382	+	IGR	INS	-	GT	GT	rs139305255	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104790381_104790382insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105647505	105647505	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105647505delT								None (None upstream) : DAOA (470711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106373312	106373313	+	Intron	INS	-	TGTG	TGTG	rs138465100	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106373312_106373313insTGTG	uc001vqf.1	+											Homo sapiens cDNA FLJ25324 fis, clone TST00330.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	106688746	106688747	+	IGR	INS	-	CAAAA	CAAAA	rs144771093	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106688746_106688747insCAAAA								DAOA (545364 upstream) : EFNB2 (453351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107055757	107055758	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107055757_107055758delCA								DAOA (912375 upstream) : EFNB2 (86340 downstream)																																			---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108108212	108108212	+	Intron	DEL	T	-	-	rs34303743		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108108212delT	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	108734897	108734898	+	IGR	INS	-	C	C	rs117526686	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108734897_108734898insC								FAM155A (215437 upstream) : LIG4 (124896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	109151315	109151315	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109151315delG								TNFSF13B (191951 upstream) : MYO16 (97185 downstream)																																			---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109427959	109427968	+	Intron	DEL	TTTTCTGAGG	-	-	rs71938096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109427959_109427968delTTTTCTGAGG	uc001vqt.1	+						MYO16_uc010agk.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	110351890	110351890	+	IGR	DEL	A	-	-	rs34900957		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110351890delA								MYO16 (491535 upstream) : IRS2 (54296 downstream)																																			---	---	---	---
RAB20	55647	broad.mit.edu	37	13	111201820	111201821	+	Intron	DEL	TA	-	-	rs71812542		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111201820_111201821delTA	uc001vqy.2	-							NM_017817	NP_060287			RAB20, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	111640524	111640525	+	IGR	INS	-	AG	AG	rs149091168	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111640524_111640525insAG								ANKRD10 (73108 upstream) : ARHGEF7 (127099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112594392	112594393	+	IGR	DEL	AC	-	-	rs72324358		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112594392_112594393delAC								C13orf16 (597799 upstream) : SOX1 (127520 downstream)																																			---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113411396	113411396	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113411396delT	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|uc001vsk.2_5'Flank|uc001vsl.1_5'Flank	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	114025755	114025755	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114025755delC								GRTP1 (7292 upstream) : ADPRHL1 (50505 downstream)																																			---	---	---	---
RASA3	22821	broad.mit.edu	37	13	114793716	114793717	+	Intron	INS	-	G	G	rs148971537	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114793716_114793717insG	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron|RASA3_uc010aha.1_Intron	NM_007368	NP_031394			RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	19067417	19067417	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19067417delC								None (None upstream) : OR11H12 (310177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19590187	19590188	+	IGR	INS	-	A	A	rs78339255	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19590187_19590188insA								POTEG (5245 upstream) : P704P (393766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19818287	19818287	+	IGR	DEL	C	-	-	rs111887361		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19818287delC								POTEG (233345 upstream) : P704P (165667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20356879	20356880	+	IGR	INS	-	T	T	rs149189824		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20356879_20356880insT								OR4K2 (11508 upstream) : OR4K5 (31886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20422437	20422441	+	IGR	DEL	TGATA	-	-	rs146384510		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20422437_20422441delTGATA								OR4K1 (17676 upstream) : OR4K15 (21237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	21264637	21264638	+	IGR	INS	-	AG	AG	rs72669444	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21264637_21264638insAG								RNASE6 (14013 upstream) : RNASE1 (4878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	21308428	21308428	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21308428delT								RNASE1 (37392 upstream) : RNASE3 (51134 downstream)																																			---	---	---	---
JUB	84962	broad.mit.edu	37	14	23445057	23445057	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23445057delA	uc001whz.2	-						JUB_uc001why.2_Intron	NM_032876	NP_116265			ajuba isoform 1						cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding				0	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0122)														---	---	---	---
ACIN1	22985	broad.mit.edu	37	14	23563314	23563327	+	Intron	DEL	CACACAAACACACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23563314_23563327delCACACAAACACACA	uc001wit.3	-						ACIN1_uc010akg.2_Intron|ACIN1_uc010tnj.1_Intron|C14orf119_uc001wiu.2_5'Flank	NM_014977	NP_055792			apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)														---	---	---	---
PPP1R3E	90673	broad.mit.edu	37	14	23768869	23768869	+	Intron	DEL	G	-	-	rs148962748		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23768869delG	uc001wjc.2	-						HOMEZ_uc001wjb.2_5'Flank					Homo sapiens mRNA for FLJ00089 protein, partial cds.												0																		---	---	---	---
IL25	64806	broad.mit.edu	37	14	23839080	23839080	+	5'Flank	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23839080delG	uc001wjr.2	+						IL25_uc001wjq.2_5'Flank	NM_022789	NP_073626			interleukin 25 isoform 1 precursor						inflammatory response	extracellular space|membrane	cytokine activity|interleukin-17E receptor binding			ovary(1)	1	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)														---	---	---	---
AP4S1	11154	broad.mit.edu	37	14	31546945	31546946	+	Intron	INS	-	T	T	rs72386557		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31546945_31546946insT	uc001wqy.3	+						AP4S1_uc001wqw.3_Intron|AP4S1_uc001wqx.3_Intron|AP4S1_uc010amh.2_Intron|AP4S1_uc001wqz.3_Intron	NM_001128126	NP_001121598			adaptor-related protein complex 4, sigma 1							coated pit|Golgi apparatus	protein transporter activity				0	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.221)	GBM - Glioblastoma multiforme(265;0.00553)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34459244	34459245	+	IGR	DEL	GA	-	-	rs111327050	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34459244_34459245delGA								EGLN3 (38957 upstream) : C14orf147 (442900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34689667	34689668	+	IGR	INS	-	TG	TG	rs142618484	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34689667_34689668insTG								EGLN3 (269380 upstream) : C14orf147 (212477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	36478767	36478768	+	IGR	INS	-	TG	TG	rs140295525	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36478767_36478768insTG								BRMS1L (137599 upstream) : MBIP (288996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	37092470	37092471	+	IGR	INS	-	AT	AT	rs145642213	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37092470_37092471insAT								NKX2-8 (40684 upstream) : PAX9 (34311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39119867	39119868	+	IGR	INS	-	TGACCA	TGACCA	rs139333210	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39119867_39119868insTGACCA								CLEC14A (394293 upstream) : SEC23A (381255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39197887	39197890	+	IGR	DEL	TGTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39197887_39197890delTGTG								CLEC14A (472313 upstream) : SEC23A (303233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	41516298	41516298	+	IGR	DEL	A	-	-	rs112876238		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41516298delA								None (None upstream) : LRFN5 (560466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43190103	43190103	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43190103delC								LRFN5 (816353 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	45956297	45956298	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45956297_45956298insC								C14orf106 (233692 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46042998	46042999	+	IGR	INS	-	A	A	rs145474745	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46042998_46042999insA								C14orf106 (320393 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	50354262	50354262	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50354262delA								SDCCAG1 (34723 upstream) : ARF6 (5474 downstream)																																			---	---	---	---
ATL1	51062	broad.mit.edu	37	14	51049309	51049309	+	Intron	DEL	T	-	-	rs111544118		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51049309delT	uc001wyf.3	+						ATL1_uc001wyd.3_Intron|ATL1_uc001wye.3_Intron	NM_015915	NP_056999			atlastin GTPase 1 isoform a						axonogenesis|cell death|endoplasmic reticulum organization|protein homooligomerization	axon|endoplasmic reticulum membrane|Golgi cis cisterna|Golgi membrane|integral to membrane|microsome	GTP binding|GTPase activity|identical protein binding			skin(3)|central_nervous_system(1)	4																		---	---	---	---
C14orf166	51637	broad.mit.edu	37	14	52469712	52469715	+	Intron	DEL	TCAA	-	-	rs1693191	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52469712_52469715delTCAA	uc010aod.2	+						C14orf166_uc001wzm.3_Intron|C14orf166_uc001wzn.3_Intron	NM_016039	NP_057123			homeobox prox 1							microtubule organizing center|nucleus|perinuclear region of cytoplasm|tRNA-splicing ligase complex	identical protein binding				0	Breast(41;0.0639)|all_epithelial(31;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	52799208	52799208	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52799208delA								PTGER2 (3888 upstream) : TXNDC16 (98101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	55030942	55030943	+	IGR	INS	-	T	T	rs10138558	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55030942_55030943insT								CGRRF1 (25610 upstream) : SAMD4A (3694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56307971	56307972	+	IGR	INS	-	T	T	rs66843682		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56307971_56307972insT								C14orf34 (44579 upstream) : PELI2 (277121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57312536	57312536	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57312536delT	uc001xcr.1	+											Homo sapiens cDNA clone IMAGE:5492202, partial cds.																														---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58683428	58683428	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58683428delT	uc010tro.1	-						ACTR10_uc001xdf.2_Intron|ACTR10_uc001xdg.2_Intron|ACTR10_uc001xdh.2_Intron|ACTR10_uc010trp.1_Intron|ACTR10_uc010apc.2_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	59123418	59123418	+	IGR	DEL	A	-	-	rs113472311		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59123418delA								DACT1 (8382 upstream) : DAAM1 (531981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	62044966	62044971	+	Intron	DEL	CATCAT	-	-	rs68036425		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62044966_62044971delCATCAT	uc001xfp.2	+											Homo sapiens cDNA: FLJ22447 fis, clone HRC09479.																														---	---	---	---
SYT16	83851	broad.mit.edu	37	14	62506745	62506745	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62506745delT	uc001xfu.1	+						SYT16_uc010tsd.1_Intron	NM_031914	NP_114120			synaptotagmin XIV-like											central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)														---	---	---	---
RHOJ	57381	broad.mit.edu	37	14	63683674	63683674	+	Intron	DEL	A	-	-	rs75984455		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63683674delA	uc001xgb.1	+							NM_020663	NP_065714			ras homolog gene family, member J precursor						actin cytoskeleton organization|regulation of cell shape|regulation of small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)														---	---	---	---
FNTB	2342	broad.mit.edu	37	14	65395444	65395444	+	Intron	DEL	A	-	-	rs11331213		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65395444delA	uc010tsl.1	+						CHURC1_uc010tsj.1_Intron|CHURC1_uc010tsk.1_Intron|FNTB_uc010tsm.1_Intron|CHURC1_uc001xhv.1_Intron|CHURC1_uc001xhw.1_Intron	NM_002028	NP_002019			farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)														---	---	---	---
MPP5	64398	broad.mit.edu	37	14	67738776	67738777	+	Intron	INS	-	AA	AA	rs35689121		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67738776_67738777insAA	uc001xjc.2	+						MPP5_uc001xjd.2_Intron|MPP5_uc001xjb.1_Intron	NM_022474	NP_071919			membrane protein, palmitoylated 5						tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)														---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68978515	68978515	+	Intron	DEL	G	-	-	rs35605174		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68978515delG	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	69047089	69047091	+	Intron	DEL	GCT	-	-	rs149278527		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69047089_69047091delGCT	uc001xkf.1	+						RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	69064954	69064955	+	Intron	INS	-	TCAT	TCAT	rs149422899	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69064954_69064955insTCAT	uc010aqs.1	+						RAD51L1_uc001xkg.1_Intron	NM_133510	NP_598194			RAD51-like 1 isoform 2						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
GALNTL1	57452	broad.mit.edu	37	14	69782411	69782411	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69782411delT	uc010aqu.1	+						GALNTL1_uc001xla.1_Intron|GALNTL1_uc001xlb.1_Intron	NM_020692	NP_065743			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)														---	---	---	---
KIAA0247	9766	broad.mit.edu	37	14	70118100	70118101	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70118100_70118101insA	uc001xlk.2	+						KIAA0247_uc010aqz.2_Intron	NM_014734	NP_055549			hypothetical protein LOC9766 precursor							integral to membrane				ovary(3)	3				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72442185	72442185	+	Intron	DEL	T	-	-	rs111540663		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72442185delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72884188	72884189	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72884188_72884189insT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73270889	73270902	+	Intron	DEL	ACACACACACACAC	-	-	rs72445781		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73270889_73270902delACACACACACACAC	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
ZNF410	57862	broad.mit.edu	37	14	74379753	74379753	+	Intron	DEL	T	-	-	rs112532996		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74379753delT	uc001xoz.1	+						ZNF410_uc001xoy.1_Intron|ZNF410_uc010tuf.1_Intron|ZNF410_uc010tug.1_Intron|ZNF410_uc010tuh.1_Intron|ZNF410_uc010tui.1_Intron|ZNF410_uc010arz.1_Intron|ZNF410_uc001xpa.1_Intron|ZNF410_uc001xpb.1_Intron|ZNF410_uc001xpc.1_Intron|ZNF410_uc010tuj.1_Intron	NM_021188	NP_067011			zinc finger protein 410						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	75226081	75226082	+	IGR	INS	-	T	T	rs147286296		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75226081_75226082insT								FCF1 (22584 upstream) : YLPM1 (3987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	77078328	77078329	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77078328_77078329delAG								ESRRB (110150 upstream) : VASH1 (149906 downstream)																																			---	---	---	---
SPTLC2	9517	broad.mit.edu	37	14	78078168	78078169	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78078168_78078169insA	uc001xub.2	-							NM_004863	NP_004854			serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	81118516	81118516	+	Intron	DEL	C	-	-	rs34322712		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81118516delC	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659			hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82137720	82137721	+	IGR	DEL	TG	-	-	rs113878137		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82137720_82137721delTG								SEL1L (137515 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82673173	82673174	+	IGR	DEL	TG	-	-	rs141485946		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82673173_82673174delTG								SEL1L (672968 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83203621	83203621	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83203621delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84643858	84643859	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84643858_84643859insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84980708	84980715	+	IGR	DEL	TGTGAAGT	-	-	rs76303280		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84980708_84980715delTGTGAAGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84986129	84986132	+	IGR	DEL	TCTC	-	-	rs112054966		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84986129_84986132delTCTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86099977	86099978	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86099977_86099978insA								FLRT2 (5708 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	89444209	89444210	+	IGR	INS	-	A	A	rs147813983	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89444209_89444210insA								TTC8 (99875 upstream) : FOXN3 (178307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90855053	90855053	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90855053delG								C14orf102 (56774 upstream) : CALM1 (8320 downstream)																																			---	---	---	---
RPS6KA5	9252	broad.mit.edu	37	14	91459825	91459827	+	Intron	DEL	AAC	-	-	rs112673622		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91459825_91459827delAAC	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746			ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)														---	---	---	---
RPS6KA5	9252	broad.mit.edu	37	14	91465570	91465571	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91465570_91465571insC	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746			ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)														---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92329227	92329229	+	Intron	DEL	AAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92329227_92329229delAAC	uc001xzv.3	-							NM_001128596	NP_001122068			tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
RIN3	79890	broad.mit.edu	37	14	93020451	93020451	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93020451delG	uc001yap.2	+						RIN3_uc010auk.2_Intron	NM_024832	NP_079108			Ras and Rab interactor 3						endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)																---	---	---	---
PRIMA1	145270	broad.mit.edu	37	14	94253368	94253369	+	Intron	INS	-	G	G	rs148581244	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94253368_94253369insG	uc001ybw.1	-						PRIMA1_uc001ybx.1_Intron	NM_178013	NP_821092			proline rich membrane anchor 1 precursor						neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)														---	---	---	---
SERPINA6	866	broad.mit.edu	37	14	94790434	94790434	+	5'Flank	DEL	T	-	-	rs35257320		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94790434delT	uc001ycv.2	-						SERPINA6_uc010auv.2_5'Flank	NM_001756	NP_001747			corticosteroid binding globulin precursor						regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	95404219	95404220	+	IGR	INS	-	CA	CA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95404219_95404220insCA								GSC (167720 upstream) : DICER1 (148345 downstream)																																			---	---	---	---
DICER1	23405	broad.mit.edu	37	14	95556508	95556509	+	3'UTR	INS	-	A	A	rs140314161		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95556508_95556509insA	uc001ydw.2	-	28					DICER1_uc010avh.1_3'UTR|DICER1_uc001ydv.2_3'UTR|DICER1_uc001ydx.2_3'UTR	NM_030621	NP_085124			dicer1						negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)				Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				---	---	---	---
C14orf132	56967	broad.mit.edu	37	14	96531371	96531374	+	Intron	DEL	CATA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96531371_96531374delCATA	uc001yff.3	+							NR_023938				Homo sapiens clone 25027 mRNA sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	97581884	97581885	+	IGR	INS	-	T	T	rs150124073	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97581884_97581885insT								VRK1 (233934 upstream) : C14orf64 (810062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98331707	98331707	+	IGR	DEL	A	-	-	rs35004485		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98331707delA								VRK1 (983757 upstream) : C14orf64 (60240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98473504	98473506	+	IGR	DEL	TTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98473504_98473506delTTG								C14orf64 (29043 upstream) : C14orf177 (704444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98639979	98639980	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98639979_98639980insA								C14orf64 (195518 upstream) : C14orf177 (537970 downstream)																																			---	---	---	---
EVL	51466	broad.mit.edu	37	14	100492581	100492581	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100492581delA	uc001ygt.2	+						EVL_uc001ygv.2_Intron	NM_016337	NP_057421			Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)																---	---	---	---
DLK1	8788	broad.mit.edu	37	14	101201434	101201436	+	3'UTR	DEL	AAT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101201434_101201436delAAT	uc001yhs.3	+	5					DLK1_uc001yhu.3_3'UTR	NM_003836	NP_003827			delta-like 1 homolog precursor						multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)																---	---	---	---
MEG3	55384	broad.mit.edu	37	14	101311732	101311734	+	Intron	DEL	CCT	-	-	rs10549236		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101311732_101311734delCCT	uc001yid.1	+						MEG3_uc001yhy.2_Intron|MEG3_uc010txb.1_Intron|MEG3_uc010txc.1_Intron|MEG3_uc001yib.2_Intron|MEG3_uc010txd.1_Intron|MEG3_uc010txe.1_Intron|MEG3_uc001yic.2_Intron|MEG3_uc010txf.1_Intron|MEG3_uc010avz.1_Intron|MEG3_uc001yhw.2_Intron|MEG3_uc001yie.2_Intron|MEG3_uc001yhx.2_Intron|MEG3_uc010txg.1_Intron|MEG3_uc001yhz.2_Intron|MEG3_uc001yia.2_Intron|MEG3_uc010txh.1_Intron|MEG3_uc001yhv.2_Intron					SubName: Full=HCG25025, isoform CRA_b; SubName: Full=Full-length cDNA clone CS0DI033YL14 of Placenta of Homo sapiens (human);												0																		---	---	---	---
MIR544	664613	broad.mit.edu	37	14	101514903	101514904	+	5'Flank	INS	-	GT	GT	rs148277017	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101514903_101514904insGT	hsa-mir-544|MI0003515	+						MIR655_hsa-mir-655|MI0003677_5'Flank																	0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	101758482	101758483	+	IGR	INS	-	TG	TG	rs141323100	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101758482_101758483insTG								MIR656 (225344 upstream) : DIO3OS (260077 downstream)																																			---	---	---	---
HSP90AA1	3320	broad.mit.edu	37	14	102603242	102603243	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102603242_102603243insA	uc001ykv.3	-						WDR20_uc001yky.1_5'Flank|WDR20_uc001yla.2_5'Flank|WDR20_uc001ykz.2_5'Flank|WDR20_uc001ylb.2_5'Flank|WDR20_uc010txu.1_5'Flank|WDR20_uc001ylc.2_5'Flank|WDR20_uc001yld.2_5'Flank|WDR20_uc001yle.2_5'Flank	NM_001017963	NP_001017963			heat shock 90kDa protein 1, alpha isoform 1						axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	103025272	103025272	+	IGR	DEL	T	-	-	rs35020678		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103025272delT								ANKRD9 (49144 upstream) : RCOR1 (33961 downstream)																																			---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103086819	103086825	+	Intron	DEL	ACTTGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103086819_103086825delACTTGAA	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106283183	106283184	+	Intron	INS	-	T	T	rs113130851		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106283183_106283184insT	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20472742	20472742	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20472742delA								None (None upstream) : GOLGA6L6 (264352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	23451219	23451220	+	IGR	INS	-	C	C	rs148828208		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23451219_23451220insC								GOLGA8E (2796 upstream) : MKRN3 (359234 downstream)																																			---	---	---	---
PWRN2	791115	broad.mit.edu	37	15	24411003	24411004	+	RNA	DEL	AA	-	-	rs148691390		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24411003_24411004delAA	uc010uad.1	-	1		c.4050_4051delTT			PWRN2_uc001ywl.2_RNA	NR_026647				Homo sapiens Prader-Willi region non-protein coding RNA 2 (PWRN2), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	24906071	24906073	+	IGR	DEL	GAA	-	-	rs35744916		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24906071_24906073delGAA								PWRN1 (73147 upstream) : C15orf2 (14468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24986935	24986935	+	IGR	DEL	T	-	-	rs66794453		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24986935delT								C15orf2 (58343 upstream) : SNRPN (81859 downstream)																																			---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27387928	27387928	+	Intron	DEL	T	-	-	rs11366858		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27387928delT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	29992273	29992273	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29992273delG								FAM189A1 (129346 upstream) : TJP1 (86 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	30465283	30465284	+	IGR	INS	-	GT	GT	rs143772220		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30465283_30465284insGT								FAM7A3 (41337 upstream) : DKFZP434L187 (22955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	34869402	34869403	+	IGR	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34869402_34869403delAA								GOLGA8B (41180 upstream) : GJD2 (175276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36302404	36302405	+	IGR	INS	-	T	T	rs112535113		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36302404_36302405insT								ATPBD4 (464000 upstream) : C15orf41 (569407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36507372	36507375	+	IGR	DEL	TGTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36507372_36507375delTGTG								ATPBD4 (668968 upstream) : C15orf41 (364437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36533959	36533959	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36533959delC								ATPBD4 (695555 upstream) : C15orf41 (337853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	39800658	39800659	+	IGR	INS	-	CA	CA	rs147152883	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39800658_39800659insCA								C15orf54 (253610 upstream) : THBS1 (72621 downstream)																																			---	---	---	---
EIF2AK4	440275	broad.mit.edu	37	15	40285425	40285428	+	Intron	DEL	CCAT	-	-	rs112677914	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40285425_40285428delCCAT	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron	NM_001013703	NP_001013725			eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	40866892	40866892	+	IGR	DEL	A	-	-	rs78117528		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40866892delA								RPUSD2 (231 upstream) : CASC5 (19555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	41267179	41267180	+	IGR	INS	-	T	T	rs68055125		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41267179_41267180insT								CHAC1 (18462 upstream) : INO80 (3901 downstream)																																			---	---	---	---
TTBK2	146057	broad.mit.edu	37	15	43082899	43082900	+	Intron	INS	-	TTTG	TTTG	rs148521209	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43082899_43082900insTTTG	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771			tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)														---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44885953	44885953	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44885953delT	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zty.1_Intron	NM_025137	NP_079413			spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
TRIM69	140691	broad.mit.edu	37	15	45026910	45026912	+	Intron	DEL	TGG	-	-	rs35277259		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45026910_45026912delTGG	uc001zuf.2	+						TRIM69_uc001zui.1_5'Flank|TRIM69_uc010bdy.1_5'Flank|TRIM69_uc001zug.1_5'Flank|TRIM69_uc001zuh.1_5'Flank	NM_182985	NP_892030			tripartite motif-containing 69 isoform a						apoptosis	nuclear speck	zinc ion binding				0		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	46692827	46692827	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46692827delA								SQRDL (709349 upstream) : SEMA6D (783576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	47243856	47243856	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47243856delA								None (None upstream) : SEMA6D (232547 downstream)																																			---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49167390	49167393	+	Intron	DEL	CTAT	-	-	rs146563368		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49167390_49167393delCTAT	uc001zxb.1	-						SHC4_uc010uey.1_Intron|SHC4_uc010uez.1_Intron|EID1_uc001zxc.1_5'Flank	NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
C15orf33	196951	broad.mit.edu	37	15	49648436	49648437	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49648436_49648437delAA	uc001zxl.2	-							NM_152647	NP_689860			hypothetical protein LOC196951											ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)														---	---	---	---
ATP8B4	79895	broad.mit.edu	37	15	50246272	50246272	+	Intron	DEL	T	-	-	rs34828291		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50246272delT	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113			ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)														---	---	---	---
SPPL2A	84888	broad.mit.edu	37	15	51028164	51028166	+	Intron	DEL	AAG	-	-	rs112151392		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51028164_51028166delAAG	uc001zyv.2	-							NM_032802	NP_116191			signal peptide peptidase-like 2A							integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)														---	---	---	---
TNFAIP8L3	388121	broad.mit.edu	37	15	51359803	51359803	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51359803delC	uc001zyy.2	-							NM_207381	NP_997264			tumor necrosis factor, alpha-induced protein												0				all cancers(107;0.000389)|GBM - Glioblastoma multiforme(94;0.00338)														---	---	---	---
SCG3	29106	broad.mit.edu	37	15	52008058	52008059	+	Intron	INS	-	T	T	rs113164979		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52008058_52008059insT	uc002abh.2	+						SCG3_uc010ufz.1_Intron	NM_013243	NP_037375			secretogranin III isoform 1 precursor						platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)														---	---	---	---
LEO1	123169	broad.mit.edu	37	15	52232758	52232759	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52232758_52232759delAA	uc002abo.2	-						LEO1_uc010bfd.2_Intron	NM_138792	NP_620147			Leo1, Paf1/RNA polymerase II complex component,						histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding				0				all cancers(107;0.00264)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	52295385	52295385	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52295385delA								LEO1 (31427 upstream) : MAPK6 (16026 downstream)																																			---	---	---	---
GNB5	10681	broad.mit.edu	37	15	52459868	52459869	+	Intron	INS	-	A	A	rs35907647		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52459868_52459869insA	uc002abt.1	-						GNB5_uc002abr.1_Intron|GNB5_uc002abs.1_Intron|GNB5_uc002abu.3_Intron	NM_016194	NP_057278			guanine nucleotide-binding protein, beta-5							heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	53411351	53411351	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53411351delC								ONECUT1 (329142 upstream) : WDR72 (394587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	53622044	53622047	+	IGR	DEL	TTCT	-	-	rs71867976		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53622044_53622047delTTCT								ONECUT1 (539835 upstream) : WDR72 (183891 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54606270	54606271	+	Intron	INS	-	A	A	rs34870835		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54606270_54606271insA	uc002ack.2	+						UNC13C_uc002acl.2_Intron	NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54762510	54762534	+	Intron	DEL	AGAATATGTATTAGTTCTTCTTGAA	-	-	rs71105812		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54762510_54762534delAGAATATGTATTAGTTCTTCTTGAA	uc002ack.2	+							NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	55400406	55400409	+	IGR	DEL	AAAG	-	-	rs36107718		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55400406_55400409delAAAG								UNC13C (479601 upstream) : RSL24D1 (73112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	56310591	56310592	+	IGR	INS	-	T	T	rs74369188		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56310591_56310592insT								NEDD4 (24756 upstream) : RFX7 (68887 downstream)																																			---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58322987	58322987	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58322987delA	uc002aex.2	-						ALDH1A2_uc002aey.2_Intron|ALDH1A2_uc010ugv.1_Intron|ALDH1A2_uc010ugw.1_Intron	NM_003888	NP_003879			aldehyde dehydrogenase 1A2 isoform 1						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	60290017	60290017	+	IGR	DEL	C	-	-	rs34243666		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60290017delC								BNIP2 (308375 upstream) : FOXB1 (6404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	61803510	61803510	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61803510delA								RORA (282008 upstream) : VPS13C (341082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62410146	62410146	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62410146delA								C2CD4A (47037 upstream) : C2CD4B (45591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62764084	62764085	+	IGR	INS	-	A	A	rs148722528	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62764084_62764085insA								C2CD4B (306602 upstream) : MGC15885 (165286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62898846	62898846	+	IGR	DEL	C	-	-	rs115162156	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62898846delC								C2CD4B (441364 upstream) : MGC15885 (30525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63146756	63146757	+	IGR	INS	-	TGTCCTCA	TGTCCTCA	rs149811850	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63146756_63146757insTGTCCTCA								TLN2 (9929 upstream) : TPM1 (188081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	64132879	64132895	+	IGR	DEL	AGTGGTTAAATTTGGAT	-	-	rs112569714		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64132879_64132895delAGTGGTTAAATTTGGAT								HERC1 (6732 upstream) : MIR422A (30234 downstream)																																			---	---	---	---
SNX1	6642	broad.mit.edu	37	15	64421447	64421447	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64421447delA	uc002amv.2	+						SNX1_uc010bgv.2_Intron|SNX1_uc010uio.1_Intron|SNX1_uc002amw.2_Intron|SNX1_uc002amx.2_Intron|SNX1_uc002amy.2_Intron|SNX1_uc010bgw.2_Intron	NM_003099	NP_003090			sorting nexin 1 isoform a						cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity				0																		---	---	---	---
ANKDD1A	348094	broad.mit.edu	37	15	65244012	65244014	+	Intron	DEL	TTC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65244012_65244014delTTC	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362			ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	65533478	65533478	+	IGR	DEL	T	-	-	rs34888317		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65533478delT								CILP (29638 upstream) : PARP16 (16956 downstream)																																			---	---	---	---
SMAD6	4091	broad.mit.edu	37	15	67042966	67042967	+	Intron	INS	-	G	G	rs146206381	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67042966_67042967insG	uc002aqf.2	+						SMAD6_uc010bhx.2_Intron|SMAD6_uc002aqg.2_Intron	NM_005585	NP_005576			SMAD family member 6 isoform 1						BMP signaling pathway|immune response|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of caspase activity|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of SMAD protein complex assembly|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of S phase of mitotic cell cycle|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	cytosol|transcription factor complex	co-SMAD binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I activin receptor binding|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			skin(1)	1																		---	---	---	---
SMAD3	4088	broad.mit.edu	37	15	67378226	67378239	+	Intron	DEL	ACACACACACACAT	-	-	rs142888234	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67378226_67378239delACACACACACACAT	uc002aqj.2	+							NM_005902	NP_005893			mothers against decapentaplegic homolog 3						activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)														---	---	---	---
MAP2K5	5607	broad.mit.edu	37	15	68048854	68048865	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs72342086		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68048854_68048865delTGTGTGTGTGTG	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143			mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	69132012	69132013	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69132012_69132013delAG								ANP32A (18751 upstream) : NOX5 (90851 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71688292	71688293	+	Intron	DEL	AA	-	-	rs58433075		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71688292_71688293delAA	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71739457	71739457	+	Intron	DEL	G	-	-	rs60840015		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71739457delG	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	72679139	72679139	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72679139delT								C15orf34 (8010 upstream) : TMEM202 (11529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	72886246	72886247	+	IGR	DEL	AA	-	-	rs78097185		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72886246_72886247delAA								MIR630 (6592 upstream) : GOLGA6B (60791 downstream)																																			---	---	---	---
CCDC33	80125	broad.mit.edu	37	15	74597291	74597291	+	Intron	DEL	T	-	-	rs5813756		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74597291delT	uc002axo.2	+						CCDC33_uc002axp.2_Intron	NM_025055	NP_079331			coiled-coil domain containing 33 isoform 1								protein binding			ovary(3)|skin(2)	5																		---	---	---	---
SCAMP5	192683	broad.mit.edu	37	15	75287197	75287198	+	5'Flank	INS	-	CT	CT	rs145239631	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75287197_75287198insCT	uc002azk.1	+						SCAMP5_uc002azl.1_5'Flank|SCAMP5_uc002azm.1_5'Flank|SCAMP5_uc002azn.1_5'Flank|SCAMP5_uc010uly.1_5'Flank|uc010bki.1_5'Flank	NM_138967	NP_620417			secretory carrier membrane protein 5						exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1																		---	---	---	---
CSPG4	1464	broad.mit.edu	37	15	76006041	76006041	+	5'Flank	DEL	G	-	-	rs71440260		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76006041delG	uc002baw.2	-							NM_001897	NP_001888			chondroitin sulfate proteoglycan 4 precursor						angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3																		---	---	---	---
SCAPER	49855	broad.mit.edu	37	15	77180015	77180015	+	Intron	DEL	A	-	-	rs6495222	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77180015delA	uc002bbz.1	-						SCAPER_uc002bca.1_Intron|SCAPER_uc002bcb.1_Intron|SCAPER_uc002bcc.1_Intron	NM_020843	NP_065894			S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	77821263	77821263	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77821263delT								HMG20A (43320 upstream) : LINGO1 (84106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	77877117	77877118	+	IGR	INS	-	G	G	rs143804198	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77877117_77877118insG								HMG20A (99174 upstream) : LINGO1 (28251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	79477728	79477731	+	IGR	DEL	CTTG	-	-	rs146430112		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79477728_79477731delCTTG								RASGRF1 (94513 upstream) : MIR184 (24399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80899237	80899238	+	IGR	INS	-	A	A	rs147747354	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80899237_80899238insA								ARNT2 (8965 upstream) : FAM108C1 (88414 downstream)																																			---	---	---	---
IL16	3603	broad.mit.edu	37	15	81514025	81514025	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81514025delA	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366			interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	82044288	82044289	+	IGR	INS	-	A	A	rs139414597	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82044288_82044289insA								TMC3 (377870 upstream) : MEX3B (289839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	84290733	84290734	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84290733_84290734delAC								SH3GL3 (3242 upstream) : ADAMTSL3 (32104 downstream)																																			---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84419314	84419315	+	Intron	INS	-	T	T	rs141203940	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84419314_84419315insT	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	86508278	86508278	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86508278delT								KLHL25 (170089 upstream) : AGBL1 (176964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	87685451	87685451	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87685451delG								AGBL1 (113168 upstream) : NCRNA00052 (434709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	87706758	87706758	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87706758delG								AGBL1 (134475 upstream) : NCRNA00052 (413402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88243800	88243801	+	IGR	INS	-	A	A	rs111406100		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88243800_88243801insA								NCRNA00052 (120883 upstream) : NTRK3 (176187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88285628	88285629	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88285628_88285629insT								NCRNA00052 (162711 upstream) : NTRK3 (134359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88840823	88840823	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88840823delT								NTRK3 (41162 upstream) : MRPL46 (161885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	89211863	89211868	+	IGR	DEL	GAGAGT	-	-	rs112594727		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89211863_89211868delGAGAGT								ISG20 (12984 upstream) : ACAN (134806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	89319739	89319739	+	IGR	DEL	A	-	-	rs35461272		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89319739delA								ISG20 (120860 upstream) : ACAN (26935 downstream)																																			---	---	---	---
ABHD2	11057	broad.mit.edu	37	15	89708009	89708009	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89708009delA	uc002bnj.2	+						ABHD2_uc002bnk.2_Intron	NM_007011	NP_008942			alpha/beta hydrolase domain containing protein							integral to membrane	carboxylesterase activity			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)																	---	---	---	---
Unknown	0	broad.mit.edu	37	15	90525420	90525420	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90525420delT								AP3S2 (69198 upstream) : ZNF710 (19332 downstream)																																			---	---	---	---
CIB1	10519	broad.mit.edu	37	15	90776161	90776162	+	Intron	INS	-	A	A	rs35084096		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90776161_90776162insA	uc002bpb.3	-						C15orf58_uc002bpc.2_5'Flank	NM_006384	NP_006375			calcium and integrin binding 1						apoptosis|cell adhesion|double-strand break repair	apical plasma membrane|endoplasmic reticulum|filopodium|nucleoplasm	calcium ion binding|protein binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)															---	---	---	---
IQGAP1	8826	broad.mit.edu	37	15	90959207	90959208	+	Intron	INS	-	T	T	rs144478124	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90959207_90959208insT	uc002bpl.1	+							NM_003870	NP_003861			IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)															---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91095784	91095784	+	Intron	DEL	C	-	-	rs34051702		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91095784delC	uc002bpp.2	+						CRTC3_uc002bpn.2_Intron|CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91144720	91144721	+	Intron	INS	-	A	A	rs146733628	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91144720_91144721insA	uc002bpp.2	+						CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
BLM	641	broad.mit.edu	37	15	91268730	91268730	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91268730delT	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron	NM_000057	NP_000048			Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)					Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				---	---	---	---
PRC1	9055	broad.mit.edu	37	15	91523763	91523764	+	Intron	INS	-	G	G	rs28584391		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91523763_91523764insG	uc002bqm.2	-						PRC1_uc002bqn.2_Intron|PRC1_uc002bqo.2_Intron|PRC1_uc010uqs.1_Intron	NM_003981	NP_003972			protein regulator of cytokinesis 1 isoform 1						cytokinesis|mitotic spindle elongation	cytoplasm|nucleus|spindle microtubule|spindle pole	protein binding			ovary(1)|skin(1)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)																	---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92432238	92432239	+	Intron	INS	-	A	A	rs35585843		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92432238_92432239insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93296570	93296572	+	IGR	DEL	AAG	-	-	rs72167694		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93296570_93296572delAAG								FAM174B (19266 upstream) : CHD2 (132861 downstream)																																			---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93478245	93478246	+	Intron	INS	-	T	T	rs112532540		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93478245_93478246insT	uc002bsp.2	+						CHD2_uc002bsm.1_Intron|CHD2_uc002bsn.2_Intron|CHD2_uc002bso.1_Intron|CHD2_uc010urb.1_Intron	NM_001271	NP_001262			chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	94174793	94174794	+	IGR	INS	-	T	T	rs140737753	by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94174793_94174794insT								RGMA (542360 upstream) : MCTP2 (600007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94453282	94453283	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94453282_94453283insC	uc002btf.1	+											Homo sapiens cDNA clone IMAGE:4827883.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	97098038	97098046	+	IGR	DEL	CTTCTTCTT	-	-	rs144874829	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97098038_97098046delCTTCTTCTT								NR2F2 (214548 upstream) : SPATA8 (228633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99565186	99565187	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99565186_99565187delTG								PGPEP1L (14162 upstream) : SYNM (80099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99569531	99569532	+	IGR	INS	-	T	T	rs72213947		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99569531_99569532insT								PGPEP1L (18507 upstream) : SYNM (75754 downstream)																																			---	---	---	---
LRRC28	123355	broad.mit.edu	37	15	99813434	99813434	+	Intron	DEL	T	-	-	rs12901501	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99813434delT	uc002bva.1	+						LRRC28_uc010urs.1_Intron|LRRC28_uc002bvb.1_Intron|LRRC28_uc010urt.1_Intron|LRRC28_uc002bvc.1_Intron|LRRC28_uc010uru.1_Intron|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199			leucine rich repeat containing 28												0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)															---	---	---	---
SOLH	6650	broad.mit.edu	37	16	583517	583517	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:583517delC	uc002chi.2	+						SOLH_uc002chg.2_Intron|SOLH_uc002chh.1_Intron	NM_005632	NP_005623			small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	896645	896646	+	IGR	INS	-	A	A	rs147320240	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:896645_896646insA								PRR25 (32785 upstream) : LMF1 (6989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	1379983	1379983	+	IGR	DEL	A	-	-	rs112358162		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1379983delA								UBE2I (4593 upstream) : BAIAP3 (3663 downstream)																																			---	---	---	---
MAPK8IP3	23162	broad.mit.edu	37	16	1787776	1787777	+	Intron	INS	-	GT	GT	rs144825749	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1787776_1787777insGT	uc002cmk.2	+						MAPK8IP3_uc002cmi.1_Intron|MAPK8IP3_uc002cmj.1_Intron|MAPK8IP3_uc002cml.2_Intron|MAPK8IP3_uc010uvl.1_Intron	NM_015133	NP_055948			mitogen-activated protein kinase 8 interacting						vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
TBL3	10607	broad.mit.edu	37	16	2020551	2020552	+	5'Flank	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2020551_2020552delTG	uc002cnu.1	+						TBL3_uc002cnv.1_5'Flank	NM_006453	NP_006444			transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0																		---	---	---	---
ZNF598	90850	broad.mit.edu	37	16	2056029	2056029	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2056029delG	uc002cof.1	-							NM_178167	NP_835461			zinc finger protein 598							intracellular	zinc ion binding			lung(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	3157687	3157688	+	IGR	DEL	TT	-	-	rs112243505		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3157687_3157688delTT								ZSCAN10 (8394 upstream) : MGC3771 (2773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	5451743	5451744	+	Intron	DEL	TC	-	-	rs117299705	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5451743_5451744delTC	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6133015	6133016	+	Intron	INS	-	TTTT	TTTT	rs145543773	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6133015_6133016insTTTT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7460195	7460195	+	Intron	DEL	C	-	-	rs58383302		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7460195delC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	8403359	8403360	+	IGR	DEL	AA	-	-	rs139468499		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8403359_8403360delAA								A2BP1 (640019 upstream) : TMEM114 (216143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8495149	8495149	+	IGR	DEL	A	-	-	rs148019702		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8495149delA								A2BP1 (731809 upstream) : TMEM114 (124354 downstream)																																			---	---	---	---
ABAT	18	broad.mit.edu	37	16	8865152	8865153	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8865152_8865153insA	uc002czc.3	+						ABAT_uc002czd.3_Intron|ABAT_uc010buh.2_Intron|ABAT_uc010bui.2_Intron	NM_020686	NP_065737			4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	9320170	9320171	+	IGR	INS	-	CCCTC	CCCTC	rs141382584	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9320170_9320171insCCCTC								C16orf72 (106625 upstream) : GRIN2A (527096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9492568	9492569	+	IGR	INS	-	T	T	rs151066965	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9492568_9492569insT								C16orf72 (279023 upstream) : GRIN2A (354698 downstream)																																			---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10069640	10069641	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10069640_10069641insA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879			N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10203203	10203203	+	Intron	DEL	A	-	-	rs71402430		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10203203delA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879			N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10896099	10896104	+	Intron	DEL	GTGTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10896099_10896104delGTGTGT	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
CLEC16A	23274	broad.mit.edu	37	16	11157135	11157135	+	Intron	DEL	T	-	-	rs141636676		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11157135delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041			C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C16orf75	116028	broad.mit.edu	37	16	11340940	11340941	+	5'Flank	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11340940_11340941delTT	uc002daq.1	+											Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0								T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
C16orf75	116028	broad.mit.edu	37	16	11440112	11440113	+	Intron	INS	-	TT	TT	rs71406236		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11440112_11440113insTT	uc002daw.1	+						C16orf75_uc002daq.1_Intron	NM_152308	NP_689521			RecQ-mediated genome instability protein 2						DNA replication	nucleus	DNA binding				0								T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
Unknown	0	broad.mit.edu	37	16	11539278	11539278	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11539278delA	uc002dax.1	-											Homo sapiens cDNA FLJ44575 fis, clone UTERU3018154.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	11754789	11754790	+	IGR	INS	-	TT	TT	rs71406268		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11754789_11754790insTT								LITAF (73467 upstream) : SNN (7511 downstream)																																			---	---	---	---
TXNDC11	51061	broad.mit.edu	37	16	11793565	11793566	+	Intron	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11793565_11793566insG	uc010buu.1	-						TXNDC11_uc002dbg.1_Intron	NM_015914	NP_056998			thioredoxin domain containing 11						cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
SNX29	92017	broad.mit.edu	37	16	12484033	12484034	+	Intron	INS	-	TA	TA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12484033_12484034insTA	uc002dby.3	+							NM_001080530	NP_001073999			sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	12996707	12996708	+	Intron	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12996707_12996708delGT	uc010uyy.1	+						SHISA9_uc002dcd.2_Intron	NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	13021431	13021432	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13021431_13021432insT	uc010uyy.1	+							NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	14161078	14161078	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14161078delT								ERCC4 (114873 upstream) : MKL2 (4118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	16243229	16243229	+	IGR	DEL	T	-	-	rs34900521		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16243229delT								ABCC1 (6301 upstream) : ABCC6 (194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17727049	17727050	+	IGR	INS	-	A	A	rs139328873	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17727049_17727050insA								XYLT1 (162311 upstream) : NOMO2 (784133 downstream)																																			---	---	---	---
TMC5	79838	broad.mit.edu	37	16	19459220	19459221	+	Intron	INS	-	TAAG	TAAG	rs146697443	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19459220_19459221insTAAG	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron	NM_001105248	NP_001098718			transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20205245	20205245	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20205245delG								GPR139 (120145 upstream) : GP2 (116567 downstream)																																			---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22258606	22258607	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22258606_22258607insA	uc002dki.2	+						EEF2K_uc002dkh.2_Intron	NM_013302	NP_037434			elongation factor-2 kinase						insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22744490	22744490	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22744490delT								LOC653786 (156304 upstream) : HS3ST2 (81370 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23207706	23207707	+	Intron	INS	-	G	G	rs148490091	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23207706_23207707insG	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	23833901	23833901	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23833901delT								CHP2 (63645 upstream) : PRKCB (13399 downstream)																																			---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24813291	24813292	+	Intron	DEL	AG	-	-	rs72165127		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24813291_24813292delAG	uc002dmm.2	+						TNRC6A_uc010bxs.2_Intron|TNRC6A_uc002dmn.2_Intron|TNRC6A_uc002dmo.2_Intron|TNRC6A_uc002dmp.2_5'Flank|TNRC6A_uc002dmq.2_5'Flank	NM_014494	NP_055309			trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
ARHGAP17	55114	broad.mit.edu	37	16	24948026	24948027	+	Intron	INS	-	A	A	rs72226804		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24948026_24948027insA	uc002dnb.2	-						ARHGAP17_uc002dmy.2_5'UTR|ARHGAP17_uc002dmz.2_Intron|ARHGAP17_uc002dna.2_Intron|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	NM_001006634	NP_001006635			nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)														---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25951523	25951523	+	Intron	DEL	T	-	-	rs149339477		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25951523delT	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	29235317	29235317	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29235317delA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29664549	29664549	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29664549delA	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
CDIPT	10423	broad.mit.edu	37	16	29873059	29873060	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29873059_29873060insT	uc002dum.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CDIPT_uc002duk.2_5'Flank|CDIPT_uc002dul.2_Intron|CDIPT_uc002dun.2_Intron|LOC440356_uc010veb.1_5'Flank|LOC440356_uc002duo.2_5'Flank	NM_006319	NP_006310			CDP-diacylglycerol-inositol							endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity|phosphatidylinositol transporter activity				0																		---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	30028600	30028600	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30028600delA	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
ORAI3	93129	broad.mit.edu	37	16	30965550	30965550	+	3'UTR	DEL	T	-	-	rs72307923		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30965550delT	uc002eac.2	+	2						NM_152288	NP_689501			ORAI calcium release-activated calcium modulator							integral to membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31251927	31251927	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31251927delT								TRIM72 (15417 upstream) : ITGAM (19361 downstream)																																			---	---	---	---
ITGAM	3684	broad.mit.edu	37	16	31339950	31339950	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31339950delG	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623			integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31602214	31602214	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31602214delA								CSDAP1 (21369 upstream) : KIAA0664P3 (109720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32180411	32180412	+	IGR	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32180411_32180412delAA								HERC2P4 (16537 upstream) : TP53TG3B (504429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32460828	32460831	+	IGR	DEL	TGAG	-	-	rs112878812		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32460828_32460831delTGAG								HERC2P4 (296954 upstream) : TP53TG3B (224010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32496184	32496184	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32496184delC								HERC2P4 (332310 upstream) : TP53TG3B (188657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32518493	32518493	+	IGR	DEL	G	-	-	rs76677034		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32518493delG								HERC2P4 (354619 upstream) : TP53TG3B (166348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32529520	32529521	+	IGR	INS	-	T	T	rs141832229		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32529520_32529521insT								HERC2P4 (365646 upstream) : TP53TG3B (155320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32536718	32536719	+	IGR	INS	-	GT	GT	rs146380532		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32536718_32536719insGT								HERC2P4 (372844 upstream) : TP53TG3B (148122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32551717	32551718	+	IGR	INS	-	CTTTCTGA	CTTTCTGA	rs112894721		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32551717_32551718insCTTTCTGA								HERC2P4 (387843 upstream) : TP53TG3B (133123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33081858	33081859	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33081858_33081859insT								SLC6A10P (185395 upstream) : MIR1826 (883649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33239144	33239144	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33239144delT								SLC6A10P (342681 upstream) : MIR1826 (726364 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33421473	33421474	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33421473_33421474delCT								SLC6A10P (525010 upstream) : MIR1826 (544034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33479160	33479161	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33479160_33479161delTT								SLC6A10P (582697 upstream) : MIR1826 (486347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33524516	33524517	+	IGR	INS	-	A	A	rs35636961		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33524516_33524517insA								SLC6A10P (628053 upstream) : MIR1826 (440991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33541320	33541322	+	IGR	DEL	ATG	-	-	rs111394426		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33541320_33541322delATG								SLC6A10P (644857 upstream) : MIR1826 (424186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33547462	33547462	+	IGR	DEL	T	-	-	rs74393040		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33547462delT								SLC6A10P (650999 upstream) : MIR1826 (418046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33575211	33575212	+	IGR	INS	-	A	A	rs111559895		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33575211_33575212insA								SLC6A10P (678748 upstream) : MIR1826 (390296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33577234	33577236	+	IGR	DEL	TGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33577234_33577236delTGT								SLC6A10P (680771 upstream) : MIR1826 (388272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33735746	33735746	+	IGR	DEL	G	-	-	rs112928315		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33735746delG								SLC6A10P (839283 upstream) : MIR1826 (229762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33921970	33921970	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33921970delC								None (None upstream) : MIR1826 (43538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951692	33951693	+	IGR	INS	-	ATTC	ATTC	rs74922113	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951692_33951693insATTC								None (None upstream) : MIR1826 (13815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33957996	33957997	+	IGR	INS	-	TG	TG	rs151338913		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33957996_33957997insTG								None (None upstream) : MIR1826 (7511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33967631	33967631	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33967631delA								MIR1826 (2039 upstream) : UBE2MP1 (436171 downstream)																																			---	---	---	---
NETO2	81831	broad.mit.edu	37	16	47168246	47168246	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47168246delT	uc002eer.1	-						NETO2_uc002ees.1_Intron	NM_018092	NP_060562			neuropilin- and tolloid-like protein 2							integral to membrane	receptor activity				0		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)													HNSCC(25;0.065)			---	---	---	---
N4BP1	9683	broad.mit.edu	37	16	48635393	48635393	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48635393delA	uc002efp.2	-							NM_153029	NP_694574			Nedd4 binding protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	48958142	48958142	+	IGR	DEL	A	-	-	rs5816610		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48958142delA								N4BP1 (314022 upstream) : CBLN1 (354069 downstream)																																			---	---	---	---
PAPD5	64282	broad.mit.edu	37	16	50226144	50226144	+	Intron	DEL	A	-	-	rs35218799		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50226144delA	uc010vgo.1	+						PAPD5_uc010cbi.2_Intron|PAPD5_uc002efz.2_Intron|PAPD5_uc002ega.2_Intron	NM_001040284	NP_001035374			PAP associated domain containing 5 isoform a						cell division|DNA replication|histone mRNA catabolic process|mitosis	cytoplasm|nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding				0		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	51462070	51462070	+	IGR	DEL	C	-	-	rs142525402	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51462070delC								SALL1 (276887 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52601450	52601451	+	Intron	INS	-	T	T	rs11372822		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52601450_52601451insT	uc002egx.2	-											Homo sapiens cDNA clone IMAGE:5172237.																														---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53124843	53124844	+	Intron	INS	-	GCAGGGATAAGTCTC	GCAGGGATAAGTCTC	rs146314431	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53124843_53124844insGCAGGGATAAGTCTC	uc002egy.2	+							NM_025134	NP_079410			chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)																---	---	---	---
GNAO1	2775	broad.mit.edu	37	16	56307960	56307960	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56307960delC	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073			guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	58419338	58419339	+	IGR	DEL	AC	-	-	rs67229001		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58419338_58419339delAC								PRSS54 (90387 upstream) : GINS3 (6959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58470375	58470375	+	IGR	DEL	A	-	-	rs34669496		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58470375delA								GINS3 (30328 upstream) : NDRG4 (27174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59478521	59478522	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59478521_59478522delTT								GOT2 (710275 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	61323161	61323161	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61323161delT								None (None upstream) : CDH8 (364074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63024470	63024471	+	IGR	INS	-	TATG	TATG	rs139459993	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63024470_63024471insTATG								CDH8 (954434 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65185094	65185094	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65185094delT								CDH11 (29175 upstream) : LOC283867 (133308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65662684	65662685	+	IGR	DEL	AG	-	-	rs56361104		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65662684_65662685delAG								LOC283867 (52481 upstream) : CDH5 (737840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65744409	65744409	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65744409delG								LOC283867 (134206 upstream) : CDH5 (656116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66899780	66899784	+	IGR	DEL	AAACA	-	-	rs112569130		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66899780_66899784delAAACA								CA7 (11733 upstream) : PDP2 (14652 downstream)																																			---	---	---	---
CBFB	865	broad.mit.edu	37	16	67108290	67108290	+	Intron	DEL	T	-	-	rs34186310		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67108290delT	uc002era.2	+						CBFB_uc002erb.2_Intron|CBFB_uc010vja.1_Intron	NM_001755	NP_001746			core-binding factor, beta subunit isoform 2						transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)				T	MYH11	AML								---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69050301	69050302	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69050301_69050302insA	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69917055	69917056	+	Intron	INS	-	A	A	rs111625113		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69917055_69917056insA	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945			WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																		---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69947103	69947104	+	Intron	INS	-	T	T	rs143001899	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69947103_69947104insT	uc002exu.1	+						WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945			WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																		---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	73011770	73011771	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73011770_73011771insT	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	73787834	73787834	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73787834delT								HTA (660164 upstream) : PSMD7 (542847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	73905594	73905594	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73905594delC								HTA (777924 upstream) : PSMD7 (425087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74366138	74366139	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74366138_74366139insA								PSMD7 (25954 upstream) : LOC283922 (165 downstream)																																			---	---	---	---
LOC283922	283922	broad.mit.edu	37	16	74396937	74396938	+	Intron	INS	-	A	A	rs144737590	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74396937_74396938insA	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0																		---	---	---	---
LOC283922	283922	broad.mit.edu	37	16	74404069	74404070	+	5'Flank	INS	-	A	A	rs72232722		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74404069_74404070insA	uc002fcr.2	-						LOC283922_uc010vms.1_5'Flank					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	76041094	76041094	+	IGR	DEL	C	-	-	rs76934669		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76041094delC								TERF2IP (349766 upstream) : CNTNAP4 (270082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77271017	77271018	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77271017_77271018insT								SYCE1L (24041 upstream) : ADAMTS18 (45008 downstream)																																			---	---	---	---
VAT1L	57687	broad.mit.edu	37	16	77878757	77878758	+	Intron	INS	-	TA	TA	rs144040525	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77878757_77878758insTA	uc002ffg.1	+							NM_020927	NP_065978			vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	80547946	80547946	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80547946delG								MAF (913324 upstream) : DYNLRB2 (26908 downstream)																																			---	---	---	---
GAN	8139	broad.mit.edu	37	16	81358634	81358650	+	Intron	DEL	CAGGGATGGCTCCCAGG	-	-	rs141928001	by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81358634_81358650delCAGGGATGGCTCCCAGG	uc002fgo.2	+							NM_022041	NP_071324			gigaxonin						cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)																---	---	---	---
SDR42E1	93517	broad.mit.edu	37	16	82035760	82035760	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82035760delA	uc002fgu.2	-							NM_145168	NP_660151			short chain dehydrogenase/reductase family 42E,						steroid biosynthetic process	integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding				0																		---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83353818	83353819	+	Intron	INS	-	T	T	rs113647238		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83353818_83353819insT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
MBTPS1	8720	broad.mit.edu	37	16	84133381	84133381	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84133381delA	uc002fhi.2	-							NM_003791	NP_003782			membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	84388650	84388651	+	IGR	INS	-	ATGG	ATGG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84388650_84388651insATGG								WFDC1 (25204 upstream) : ATP2C2 (13482 downstream)																																			---	---	---	---
ATP2C2	9914	broad.mit.edu	37	16	84478816	84478817	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84478816_84478817insT	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron|ATP2C2_uc002fhy.2_Intron|ATP2C2_uc002fhz.2_Intron	NM_014861	NP_055676			ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
KIAA1609	57707	broad.mit.edu	37	16	84535944	84535945	+	Intron	INS	-	A	A	rs145153845	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84535944_84535945insA	uc002fib.2	-						KIAA1609_uc010vod.1_Intron|KIAA1609_uc002fic.2_Intron	NM_020947	NP_065998			hypothetical protein LOC57707								protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	85186906	85186908	+	IGR	DEL	AAC	-	-	rs10533116		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85186906_85186908delAAC								FAM92B (40792 upstream) : KIAA0182 (458121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86154419	86154420	+	IGR	INS	-	CC	CC	rs59055658		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86154419_86154420insCC								IRF8 (198210 upstream) : LOC732275 (211036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88180692	88180692	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88180692delC								BANP (69769 upstream) : ZNF469 (313187 downstream)																																			---	---	---	---
GALNS	2588	broad.mit.edu	37	16	88899858	88899859	+	Intron	INS	-	C	C	rs71387667		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88899858_88899859insC	uc002fly.3	-						GALNS_uc010cid.2_Intron|GALNS_uc002flz.3_Intron	NM_000512	NP_000503			galactosamine (N-acetyl)-6-sulfate sulfatase							lysosome	metal ion binding|N-acetylgalactosamine-4-sulfatase activity|N-acetylgalactosamine-6-sulfatase activity			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0496)	Hyaluronidase(DB00070)													---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89382364	89382364	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89382364delA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|ANKRD11_uc002fnf.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	89568680	89568681	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89568680_89568681insA								ANKRD11 (11711 upstream) : SPG7 (6124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	89669583	89669584	+	IGR	INS	-	TGCATGTGTGTGCA	TGCATGTGTGTGCA	rs149366615	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89669583_89669584insTGCATGTGTGTGCA								CPNE7 (5930 upstream) : DPEP1 (10132 downstream)																																			---	---	---	---
AFG3L1	172	broad.mit.edu	37	16	90041061	90041061	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90041061delA	uc002fps.1	+						AFG3L1_uc002fpt.1_Intron|AFG3L1_uc002fpu.1_Intron|AFG3L1_uc002fpv.1_Intron|AFG3L1_uc002fpw.1_Intron|AFG3L1_uc002fpx.1_Intron|CENPBD1_uc002fpr.2_5'Flank					Homo sapiens AFG3L1 isoform 1 mRNA, partial sequence.												0																		---	---	---	---
AFG3L1	172	broad.mit.edu	37	16	90064002	90064003	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90064002_90064003insT	uc002fpx.1	+						AFG3L1_uc002fqb.1_Intron|AFG3L1_uc002fqd.1_5'Flank	NR_003228				Homo sapiens AFG3L1 isoform 1 mRNA, partial sequence.												0																		---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	171374	171394	+	Intron	DEL	GGCCCAGGTGGCAACAGAGAC	-	-	rs34171819	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:171374_171394delGGCCCAGGTGGCAACAGAGAC	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
SMYD4	114826	broad.mit.edu	37	17	1730648	1730648	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1730648delA	uc002ftm.3	-						RPA1_uc002fto.2_5'Flank	NM_052928	NP_443160			SET and MYND domain containing 4								zinc ion binding			skin(3)|kidney(2)	5																		---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2731714	2731715	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2731714_2731715insA	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900			RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
ZZEF1	23140	broad.mit.edu	37	17	4019404	4019404	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4019404delA	uc002fxe.2	-						ZZEF1_uc002fxk.1_Intron	NM_015113	NP_055928			zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
MINK1	50488	broad.mit.edu	37	17	4759733	4759733	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4759733delT	uc010vsl.1	+						MINK1_uc010vsk.1_Intron|MINK1_uc010vsm.1_Intron|MINK1_uc010vsn.1_Intron|MINK1_uc010vso.1_Intron	NM_153827	NP_722549			misshapen-like kinase 1 isoform 3						JNK cascade	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
NTN1	9423	broad.mit.edu	37	17	9108245	9108246	+	Intron	INS	-	T	T	rs148063994		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9108245_9108246insT	uc002glw.3	+							NM_004822	NP_004813			netrin 1 precursor						apoptosis|axon guidance		protein binding				0																		---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10547483	10547486	+	Intron	DEL	AAAC	-	-	rs147605554		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10547483_10547486delAAAC	uc002gmq.1	-							NM_002470	NP_002461			myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	10942872	10942873	+	IGR	INS	-	TT	TT	rs138544607	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10942872_10942873insTT								PIRT (201454 upstream) : SHISA6 (201867 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11754411	11754412	+	Intron	INS	-	TTG	TTG	rs139397279	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11754411_11754412insTTG	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12217467	12217468	+	IGR	INS	-	T	T	rs71367400		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12217467_12217468insT								MAP2K4 (170417 upstream) : MYOCD (351739 downstream)																																			---	---	---	---
COX10	1352	broad.mit.edu	37	17	13997871	13997871	+	Intron	DEL	T	-	-	rs71352450		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13997871delT	uc002gof.3	+						COX10_uc010vvs.1_Intron|COX10_uc010vvt.1_Intron	NM_001303	NP_001294			heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	15750880	15750880	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15750880delT								MEIS3P1 (57863 upstream) : ADORA2B (97351 downstream)																																			---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16066763	16066768	+	Intron	DEL	AACTAC	-	-	rs77358577		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16066763_16066768delAACTAC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16072291	16072293	+	Intron	DEL	AAC	-	-	rs72271646		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16072291_16072293delAAC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	18850643	18850643	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18850643delG								PRPSAP2 (16063 upstream) : SLC5A10 (3346 downstream)																																			---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19697506	19697508	+	Intron	DEL	AAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19697506_19697508delAAG	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082			unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	20871772	20871773	+	Intron	INS	-	AA	AA	rs138265619	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20871772_20871773insAA	uc002gyk.1	+											Homo sapiens hypothetical protein LOC339260, mRNA (cDNA clone IMAGE:5168338), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21011042	21011043	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21011042_21011043delAG								USP22 (63969 upstream) : DHRS7B (19215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21231493	21231494	+	IGR	INS	-	TCTC	TCTC	rs138596924		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21231493_21231494insTCTC								MAP2K3 (12944 upstream) : KCNJ12 (48205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21244376	21244377	+	IGR	INS	-	T	T	rs150487512		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21244376_21244377insT								MAP2K3 (25827 upstream) : KCNJ12 (35322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21248150	21248151	+	IGR	INS	-	C	C	rs142379650		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21248150_21248151insC								MAP2K3 (29601 upstream) : KCNJ12 (31548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21333424	21333424	+	IGR	DEL	C	-	-	rs111937714		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21333424delC								KCNJ12 (10245 upstream) : C17orf51 (98148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21520057	21520058	+	IGR	INS	-	ATGG	ATGG	rs142565682	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21520057_21520058insATGG								C17orf51 (42326 upstream) : FAM27L (305312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22206703	22206704	+	IGR	DEL	TT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22206703_22206704delTT								FLJ36000 (293633 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25278196	25278197	+	IGR	INS	-	AT	AT	rs62050990		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25278196_25278197insAT								None (None upstream) : WSB1 (342909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25282538	25282539	+	IGR	INS	-	T	T	rs147809021	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25282538_25282539insT								None (None upstream) : WSB1 (338567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25298267	25298267	+	IGR	DEL	T	-	-	rs143814491		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25298267delT								None (None upstream) : WSB1 (322839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25698056	25698056	+	IGR	DEL	T	-	-	rs113364749		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25698056delT								WSB1 (57411 upstream) : KSR1 (100980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	27542670	27542673	+	IGR	DEL	ACAC	-	-	rs148246642		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27542670_27542673delACAC								MYO18A (35263 upstream) : CRYBA1 (31202 downstream)																																			---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27820158	27820159	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27820158_27820159insA	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron|TAOK1_uc002heb.1_Intron	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
SSH2	85464	broad.mit.edu	37	17	27967617	27967618	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27967617_27967618insA	uc002heo.1	-						SSH2_uc010wbh.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	28625482	28625483	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28625482_28625483insC								BLMH (6408 upstream) : TMIGD1 (17883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	28643350	28643351	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28643350_28643351insT								BLMH (24276 upstream) : TMIGD1 (15 downstream)																																			---	---	---	---
TBC1D29	26083	broad.mit.edu	37	17	28885450	28885451	+	5'Flank	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28885450_28885451insT	uc002hfh.2	+						uc002hfg.1_5'Flank|TBC1D29_uc002hfi.2_5'Flank	NM_015594	NP_056409			TBC1 domain family, member 29							intracellular	Rab GTPase activator activity				0		Myeloproliferative disorder(56;0.0255)																---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31945250	31945250	+	Intron	DEL	T	-	-	rs10707605		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31945250delT	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32460320	32460321	+	Intron	INS	-	A	A	rs34964894	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32460320_32460321insA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	33130483	33130484	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33130483_33130484insT								TMEM132E (164147 upstream) : CCT6B (124456 downstream)																																			---	---	---	---
FNDC8	54752	broad.mit.edu	37	17	33449007	33449007	+	Intron	DEL	T	-	-	rs67915235		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33449007delT	uc002hix.2	+						RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank|RAD51L3_uc002hiw.1_5'Flank|RAD51L3_uc002hiv.1_5'Flank|RAD51L3_uc010ctl.1_5'Flank|RAD51L3_uc010ctm.1_5'Flank	NM_017559	NP_060029			fibronectin type III domain containing 8											ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)														---	---	---	---
FNDC8	54752	broad.mit.edu	37	17	33449716	33449716	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33449716delT	uc002hix.2	+						RFFL_uc002hiq.2_5'Flank|RAD51L3_uc002hir.2_5'Flank|RAD51L3_uc010wcd.1_5'Flank|RAD51L3_uc002his.2_5'Flank|RAD51L3_uc010ctk.2_5'Flank|RAD51L3_uc010wce.1_5'Flank|RAD51L3_uc002hit.2_5'Flank|RAD51L3_uc002hiu.2_5'Flank|RAD51L3_uc010wcf.1_5'Flank	NM_017559	NP_060029			fibronectin type III domain containing 8											ovary(2)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)														---	---	---	---
TAF15	8148	broad.mit.edu	37	17	34140122	34140133	+	Intron	DEL	AAAAAAAAAAAA	-	-	rs72511544		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34140122_34140133delAAAAAAAAAAAA	uc002hkd.2	+						TAF15_uc010ctw.1_Intron|TAF15_uc002hkc.2_Intron	NM_139215	NP_631961			TBP-associated factor 15 isoform 1						positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		TAF15/NR4A3(33)	bone(33)|lung(1)|skin(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)				T	TEC|CHN1|ZNF384	extraskeletal myxoid chondrosarcomas|ALL								---	---	---	---
ZNHIT3	9326	broad.mit.edu	37	17	34843937	34843938	+	Intron	INS	-	A	A	rs144904847		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34843937_34843938insA	uc002hms.1	+						ZNHIT3_uc010cus.1_Intron|ZNHIT3_uc002hmt.1_Intron|ZNHIT3_uc010cut.1_Intron	NM_004773	NP_004764			thyroid hormone receptor interactor 3						regulation of transcription, DNA-dependent	intracellular	metal ion binding|thyroid hormone receptor binding				0		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0188)														---	---	---	---
MYO19	80179	broad.mit.edu	37	17	34855111	34855111	+	Intron	DEL	T	-	-	rs111268012		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34855111delT	uc010wcy.1	-						MYO19_uc002hmw.2_Intron|MYO19_uc010cuu.2_Intron|ZNHIT3_uc010cut.1_RNA	NM_001163735	NP_001157207			myosin XIX isoform 2							mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	35094956	35094959	+	IGR	DEL	GGAA	-	-	rs7501604		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35094956_35094959delGGAA								MRM1 (129550 upstream) : LHX1 (199540 downstream)																																			---	---	---	---
ACACA	31	broad.mit.edu	37	17	35618390	35618391	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35618390_35618391insA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuz.2_Intron	NM_198836	NP_942133			acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
LOC284100	284100	broad.mit.edu	37	17	36209162	36209162	+	Intron	DEL	A	-	-	rs34301475		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36209162delA	uc002hom.1	-						LOC284100_uc002hon.1_Intron					Homo sapiens cDNA FLJ37577 fis, clone BRCOC2003513, moderately similar to 14-3-3 protein epsilon (14-3-3E).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	36280166	36280167	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36280166_36280167delAC								LOC284100 (35803 upstream) : TBC1D3 (3793 downstream)																																			---	---	---	---
TBC1D3	729873	broad.mit.edu	37	17	36364148	36364149	+	Intron	INS	-	A	A	rs71234838		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36364148_36364149insA	uc010wdn.1	-											Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
ARHGAP23	57636	broad.mit.edu	37	17	36634659	36634659	+	Intron	DEL	T	-	-	rs112208218		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36634659delT	uc010wdp.1	+						ARHGAP23_uc002hqc.2_Intron	NM_020876	NP_065927			Rho GTPase activating protein 23						signal transduction	intracellular	GTPase activator activity			lung(1)	1																		---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37878982	37878983	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37878982_37878983insT	uc002hso.2	+						ERBB2_uc002hsm.2_Intron|ERBB2_uc010cwa.2_Intron|ERBB2_uc002hsp.2_Intron|ERBB2_uc010cwb.2_Intron|ERBB2_uc010wek.1_Intron	NM_004448	NP_004439			erbB-2 isoform a						cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			---	---	---	---
MSL1	339287	broad.mit.edu	37	17	38287585	38287585	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38287585delA	uc002hub.2	+						MSL1_uc002hua.3_Intron|MSL1_uc002hud.2_5'UTR	NM_001012241	NP_001012241			hampin						histone H4-K16 acetylation	MSL complex					0																		---	---	---	---
WIPF2	147179	broad.mit.edu	37	17	38405705	38405705	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38405705delT	uc002hug.1	+						WIPF2_uc010cwv.1_Intron|WIPF2_uc002huh.1_Intron|WIPF2_uc010cww.1_Intron|WIPF2_uc002hui.1_Intron|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Intron	NM_133264	NP_573571			WIRE protein							cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3															HNSCC(43;0.11)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	38766306	38766307	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38766306_38766307insA								CCR7 (44582 upstream) : SMARCE1 (17669 downstream)																																			---	---	---	---
KRT39	390792	broad.mit.edu	37	17	39122309	39122310	+	Intron	INS	-	G	G	rs72032534		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39122309_39122310insG	uc002hvo.1	-						KRT39_uc010wfm.1_Intron	NM_213656	NP_998821			type I hair keratin KA35							intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)																---	---	---	---
HAP1	9001	broad.mit.edu	37	17	39886121	39886121	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39886121delA	uc002hxm.1	-						JUP_uc010wfs.1_Intron|HAP1_uc002hxn.1_Intron|HAP1_uc002hxo.1_Intron|HAP1_uc002hxp.1_Intron	NM_177977	NP_817084			huntingtin-associated protein 1 isoform 2						brain development|protein localization|synaptic transmission	actin cytoskeleton	protein binding			ovary(2)	2		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)															---	---	---	---
TTC25	83538	broad.mit.edu	37	17	40104924	40104924	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40104924delT	uc002hyj.3	+						TTC25_uc010cxt.2_Intron	NM_031421	NP_113609			tetratricopeptide repeat domain 25							cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)																---	---	---	---
CNP	1267	broad.mit.edu	37	17	40118440	40118440	+	5'Flank	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40118440delA	uc002hyl.1	+						CNP_uc002hyk.1_5'Flank|CNP_uc010wfz.1_5'Flank|CNP_uc002hym.1_5'Flank|CNP_uc010wga.1_5'Flank	NM_033133	NP_149124			2',3'-cyclic nucleotide 3' phosphodiesterase						cell killing|cyclic nucleotide catabolic process|RNA metabolic process|synaptic transmission	extracellular space|melanosome	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity|ATP binding|protein binding				0		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)														---	---	---	---
G6PC	2538	broad.mit.edu	37	17	41053722	41053722	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41053722delA	uc002icb.1	+						LOC388387_uc002ibz.2_5'Flank|LOC388387_uc002iby.2_5'Flank|LOC388387_uc002ica.2_5'Flank|LOC388387_uc010whe.1_5'Flank|G6PC_uc010whf.1_Intron	NM_000151	NP_000142			glucose-6-phosphatase, catalytic subunit						gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)										Glycogen_Storage_Disease_type_Ia				---	---	---	---
G6PC	2538	broad.mit.edu	37	17	41064655	41064656	+	3'UTR	INS	-	T	T	rs36092308		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41064655_41064656insT	uc002icb.1	+	5					G6PC_uc010whf.1_3'UTR	NM_000151	NP_000142			glucose-6-phosphatase, catalytic subunit						gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)										Glycogen_Storage_Disease_type_Ia				---	---	---	---
Unknown	0	broad.mit.edu	37	17	41715844	41715844	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41715844delT								ETV4 (92082 upstream) : MEOX1 (1923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41807750	41807750	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41807750delG								MEOX1 (68488 upstream) : SOST (23349 downstream)																																			---	---	---	---
LSM12	124801	broad.mit.edu	37	17	42120916	42120917	+	Intron	INS	-	T	T	rs141092270		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42120916_42120917insT	uc002iev.2	-						LSM12_uc010wit.1_Intron|LSM12_uc002iew.1_Intron	NM_152344	NP_689557			LSM12 homolog								protein binding				0		Breast(137;0.0313)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.115)														---	---	---	---
C17orf53	78995	broad.mit.edu	37	17	42236016	42236017	+	Intron	INS	-	T	T	rs67575522		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42236016_42236017insT	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_Intron	NM_024032	NP_076937			hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
UBTF	7343	broad.mit.edu	37	17	42301236	42301236	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42301236delT	uc010czt.2	-						UBTF_uc002igd.2_5'Flank	NM_014233	NP_055048			upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	43050014	43050015	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43050014_43050015insT								C1QL1 (4370 upstream) : DCAKD (50691 downstream)																																			---	---	---	---
C17orf46	124783	broad.mit.edu	37	17	43338641	43338642	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43338641_43338642delAA	uc002iis.1	-						LOC100133991_uc010dah.2_Intron|C17orf46_uc010wjk.1_Intron|LOC100133991_uc002iit.3_5'Flank|LOC100133991_uc010dai.2_5'Flank	NM_152343	NP_689556			hypothetical protein LOC124783											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	43659542	43659543	+	IGR	INS	-	C	C	rs145769624	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43659542_43659543insC								LRRC37A4 (64026 upstream) : LOC644172 (17948 downstream)																																			---	---	---	---
MAPT	4137	broad.mit.edu	37	17	44033096	44033096	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44033096delT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	45303222	45303223	+	IGR	DEL	TT	-	-	rs78230975		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45303222_45303223delTT								MYL4 (2178 upstream) : ITGB3 (27985 downstream)																																			---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46431300	46431301	+	Intron	INS	-	GAA	GAA	rs144881825	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46431300_46431301insGAA	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
UBE2Z	65264	broad.mit.edu	37	17	46992447	46992447	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46992447delT	uc002ioi.2	+							NM_023079	NP_075567			ubiquitin-conjugating enzyme E2Z						apoptosis	cytoplasm|nucleus	ATP binding|ubiquitin-protein ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	47765335	47765335	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47765335delA								SPOP (9810 upstream) : SLC35B1 (13355 downstream)																																			---	---	---	---
LUC7L3	51747	broad.mit.edu	37	17	48826250	48826250	+	Intron	DEL	A	-	-	rs71353662		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48826250delA	uc002isr.2	+						LUC7L3_uc010wmw.1_Intron|LUC7L3_uc002isq.2_Intron|LUC7L3_uc002iss.2_Intron	NM_006107	NP_006098			LUC7-like 3						apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0																		---	---	---	---
MBTD1	54799	broad.mit.edu	37	17	49308096	49308097	+	Intron	INS	-	GAT	GAT	rs10642031		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49308096_49308097insGAT	uc002itr.3	-						MBTD1_uc002itq.3_Intron	NM_017643	NP_060113			mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	51118540	51118540	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51118540delT								CA10 (881163 upstream) : KIF2B (781699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51694363	51694364	+	IGR	DEL	TA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51694363_51694364delTA								None (None upstream) : KIF2B (205875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52393717	52393724	+	IGR	DEL	AAGTGGAT	-	-	rs71359898		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52393717_52393724delAAGTGGAT								KIF2B (491144 upstream) : TOM1L1 (584328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52461879	52461881	+	IGR	DEL	AGC	-	-	rs77758249		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52461879_52461881delAGC								KIF2B (559306 upstream) : TOM1L1 (516171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52808748	52808749	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52808748_52808749delAC								KIF2B (906175 upstream) : TOM1L1 (169303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52924353	52924356	+	IGR	DEL	TGTG	-	-	rs71361725		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52924353_52924356delTGTG								None (None upstream) : TOM1L1 (53696 downstream)																																			---	---	---	---
HLF	3131	broad.mit.edu	37	17	53367452	53367452	+	Intron	DEL	G	-	-	rs66571613		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53367452delG	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_Intron|HLF_uc010wni.1_Intron	NM_002126	NP_002117			hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2								T	TCF3	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	17	53650878	53650880	+	IGR	DEL	GTT	-	-	rs148021724		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53650878_53650880delGTT								MMD (151537 upstream) : TMEM100 (146110 downstream)																																			---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54484148	54484148	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54484148delG	uc002iun.1	+							NM_153228	NP_694960			ankyrin-repeat and fibronectin type III domain											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	55231810	55231811	+	IGR	DEL	TA	-	-	rs71923328		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55231810_55231811delTA								AKAP1 (33101 upstream) : MSI2 (101401 downstream)																																			---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56634636	56634637	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56634636_56634637insT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59196236	59196236	+	Intron	DEL	T	-	-	rs112846146		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59196236delT	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59890618	59890618	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59890618delA	uc002izk.1	-							NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
INTS2	57508	broad.mit.edu	37	17	59960713	59960713	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59960713delA	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799			integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
INTS2	57508	broad.mit.edu	37	17	59992235	59992235	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59992235delA	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799			integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	61017466	61017466	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61017466delA								MARCH10 (131761 upstream) : MIR633 (4110 downstream)																																			---	---	---	---
ACE	1636	broad.mit.edu	37	17	61552658	61552658	+	5'Flank	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61552658delC	uc002jau.1	+						ACE_uc010wph.1_5'Flank|ACE_uc010wpi.1_5'Flank|ACE_uc010ddu.1_5'Flank	NM_000789	NP_000780			angiotensin I converting enzyme 1 isoform 1						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)													---	---	---	---
MAP3K3	4215	broad.mit.edu	37	17	61748620	61748621	+	Intron	INS	-	T	T	rs146809792		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61748620_61748621insT	uc002jbg.2	+						MAP3K3_uc002jbe.2_Intron|MAP3K3_uc002jbf.2_Intron|MAP3K3_uc002jbh.2_Intron|MAP3K3_uc010wpo.1_Intron|MAP3K3_uc010wpp.1_Intron	NM_002401	NP_002392			mitogen-activated protein kinase kinase kinase 3						MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6																		---	---	---	---
LRRC37A3	374819	broad.mit.edu	37	17	62917345	62917346	+	5'Flank	INS	-	AACACTCT	AACACTCT	rs150548483	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62917345_62917346insAACACTCT	uc002jey.2	-						LRRC37A3_uc010wqg.1_5'Flank	NM_199340	NP_955372			leucine rich repeat containing 37, member A3							integral to membrane					0																		---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	64057013	64057013	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64057013delA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CACNG4	27092	broad.mit.edu	37	17	65013615	65013617	+	Intron	DEL	GTT	-	-	rs66670619		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65013615_65013617delGTT	uc002jft.1	+							NM_014405	NP_055220			voltage-dependent calcium channel gamma-4						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	66823627	66823627	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66823627delT								FAM20A (226532 upstream) : ABCA8 (39806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69080617	69080617	+	IGR	DEL	G	-	-	rs34315044		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69080617delG								KCNJ2 (904436 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69915781	69915786	+	IGR	DEL	ATAGAG	-	-	rs140357049		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69915781_69915786delATAGAG								None (None upstream) : SOX9 (201375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70058208	70058208	+	IGR	DEL	G	-	-	rs11296807		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70058208delG								None (None upstream) : SOX9 (58953 downstream)																																			---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70823163	70823163	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70823163delC	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
DNAI2	64446	broad.mit.edu	37	17	72270424	72270433	+	5'UTR	DEL	AGCCGCGACC	-	-	rs5822035		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72270424_72270433delAGCCGCGACC	uc002jkf.2	+	1					DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	NM_023036	NP_075462			dynein, axonemal, intermediate polypeptide 2						cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	17	72416922	72416923	+	IGR	INS	-	C	C	rs146694299	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72416922_72416923insC								GPR142 (48161 upstream) : GPRC5C (10744 downstream)																																			---	---	---	---
KIAA0195	9772	broad.mit.edu	37	17	73460679	73460691	+	Intron	DEL	CTTTCTTTCCTTC	-	-	rs60125234		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73460679_73460691delCTTTCTTTCCTTC	uc002jnz.3	+							NM_014738	NP_055553			hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	74836314	74836315	+	IGR	INS	-	C	C	rs146734538	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74836314_74836315insC								MFSD11 (60978 upstream) : MGAT5B (28483 downstream)																																			---	---	---	---
MGAT5B	146664	broad.mit.edu	37	17	74910727	74910727	+	Intron	DEL	T	-	-	rs138452587		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74910727delT	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193			N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3																		---	---	---	---
SEC14L1	6397	broad.mit.edu	37	17	75194286	75194286	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75194286delT	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron	NM_003003	NP_002994			SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	75258526	75258526	+	IGR	DEL	A	-	-	rs72013561		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75258526delA								SEC14L1 (45347 upstream) : SEPT9 (18966 downstream)																																			---	---	---	---
CYTH1	9267	broad.mit.edu	37	17	76780981	76780981	+	5'Flank	DEL	T	-	-	rs113887674		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76780981delT	uc002jvw.2	-							NM_017456	NP_059430			cytohesin 1 isoform 2						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	80298122	80298123	+	IGR	INS	-	C	C	rs149575290	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80298122_80298123insC								SECTM1 (6201 upstream) : TEX19 (19001 downstream)																																			---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80510411	80510411	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80510411delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80977618	80977618	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80977618delT	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	488873	488883	+	Intron	DEL	AAAAAAAAGAA	-	-	rs139773745	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:488873_488883delAAAAAAAAGAA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
CETN1	1068	broad.mit.edu	37	18	581202	581203	+	3'UTR	INS	-	A	A	rs150936936	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:581202_581203insA	uc002kko.1	+	1						NM_004066	NP_004057			centrin 1						cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
CLUL1	27098	broad.mit.edu	37	18	605568	605569	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:605568_605569insA	uc002kkp.2	+						CLUL1_uc010wys.1_Intron	NM_014410	NP_055225			clusterin-like 1 (retinal) precursor						cell death	extracellular region				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	1080564	1080564	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1080564delT								ADCYAP1 (168393 upstream) : C18orf2 (173826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1952284	1952285	+	IGR	INS	-	TCTT	TCTT	rs148761758	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1952284_1952285insTCTT								C18orf2 (545103 upstream) : METTL4 (585240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2404884	2404884	+	IGR	DEL	T	-	-	rs35281708		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2404884delT								C18orf2 (997703 upstream) : METTL4 (132641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3288860	3288861	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3288860_3288861insT								MYL12B (10580 upstream) : TGIF1 (123211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3343886	3343886	+	IGR	DEL	T	-	-	rs111743145		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3343886delT								MYL12B (65606 upstream) : TGIF1 (68186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3485374	3485374	+	IGR	DEL	T	-	-	rs11431491		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3485374delT								TGIF1 (26970 upstream) : DLGAP1 (13463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3490044	3490045	+	IGR	INS	-	GAAGAG	GAAGAG	rs453406	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3490044_3490045insGAAGAG								TGIF1 (31640 upstream) : DLGAP1 (8792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	4715287	4715288	+	IGR	INS	-	G	G	rs148565585	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4715287_4715288insG								DLGAP1 (260021 upstream) : LOC642597 (428384 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5000863	5000864	+	IGR	INS	-	CACA	CACA	rs146907743	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5000863_5000864insCACA								DLGAP1 (545597 upstream) : LOC642597 (142808 downstream)																																			---	---	---	---
EPB41L3	23136	broad.mit.edu	37	18	5524617	5524617	+	Intron	DEL	G	-	-	rs11367428		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5524617delG	uc002kmt.1	-						EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc010dks.1_Intron|EPB41L3_uc002kmv.1_Intron	NM_012307	NP_036439			erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	6474832	6474832	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6474832delT								L3MBTL4 (59922 upstream) : ARHGAP28 (313661 downstream)																																			---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6788457	6788458	+	5'Flank	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6788457_6788458insT	uc002knc.2	+							NM_030672	NP_109597			Rho GTPase activating protein 28 isoform b						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	8584885	8584885	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8584885delA								PTPRM (178027 upstream) : RAB12 (24550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10569798	10569799	+	IGR	INS	-	TTTTAT	TTTTAT	rs144693245	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10569798_10569799insTTTTAT								NAPG (17036 upstream) : FAM38B (101061 downstream)																																			---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10788502	10788503	+	Intron	INS	-	G	G	rs139844882	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10788502_10788503insG	uc002kou.1	-											RecName: Full=Transmembrane protein C18orf30;							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11798377	11798379	+	Intron	DEL	ATG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11798377_11798379delATG	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron	NM_001142339	NP_001135811			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	11923418	11923419	+	IGR	INS	-	GGGG	GGGG	rs140366551	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11923418_11923419insGGGG								MPPE1 (14777 upstream) : IMPA2 (57638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	12113244	12113244	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12113244delA	uc002kqs.2	+											RecName: Full=UPF0634 protein E;																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	12211819	12211820	+	IGR	INS	-	T	T	rs57317945		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12211819_12211820insT								IMPA2 (180943 upstream) : CIDEA (42498 downstream)																																			---	---	---	---
SLMO1	10650	broad.mit.edu	37	18	12410693	12410694	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12410693_12410694insT	uc002kra.2	+						SLMO1_uc010wzu.1_Intron	NM_001142405	NP_001135877			slowmo homolog 1 isoform 1												0																		---	---	---	---
SPIRE1	56907	broad.mit.edu	37	18	12473307	12473308	+	Intron	INS	-	A	A	rs71371262		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12473307_12473308insA	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098			spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0																		---	---	---	---
CXADRP3	440224	broad.mit.edu	37	18	14489289	14489291	+	Intron	DEL	GTG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14489289_14489291delGTG	uc010xai.1	-							NR_024076				Homo sapiens cDNA clone IMAGE:30390722, containing frame-shift errors.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	14665204	14665205	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14665204_14665205delTG								POTEC (121605 upstream) : ANKRD30B (83034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14724829	14724830	+	IGR	INS	-	TTT	TTT	rs146636772	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14724829_14724830insTTT								POTEC (181230 upstream) : ANKRD30B (23409 downstream)																																			---	---	---	---
GREB1L	80000	broad.mit.edu	37	18	18979524	18979524	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18979524delT	uc010xam.1	+						GREB1L_uc002ktf.1_Intron|GREB1L_uc010dlp.1_Intron	NM_001142966	NP_001136438			growth regulation by estrogen in breast							integral to membrane					0																		---	---	---	---
ABHD3	171586	broad.mit.edu	37	18	19243425	19243425	+	Intron	DEL	A	-	-	rs2850582		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19243425delA	uc002ktl.2	-						ABHD3_uc002ktm.2_Intron|ABHD3_uc010xao.1_Intron|ABHD3_uc002ktk.2_Intron	NM_138340	NP_612213			alpha/beta hydrolase domain containing protein							integral to membrane	carboxylesterase activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	19605789	19605790	+	IGR	INS	-	T	T	rs141844798	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19605789_19605790insT								MIB1 (154879 upstream) : GATA6 (143626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20669997	20669999	+	IGR	DEL	AAA	-	-	rs71843895		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20669997_20669999delAAA								RBBP8 (63552 upstream) : CABLES1 (44529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	22078858	22078858	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22078858delG								HRH4 (18938 upstream) : ZNF521 (563030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	22134816	22134817	+	IGR	INS	-	T	T	rs34486770		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22134816_22134817insT								HRH4 (74896 upstream) : ZNF521 (507071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	22569631	22569634	+	IGR	DEL	AAAG	-	-	rs71985402		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22569631_22569634delAAAG								HRH4 (509711 upstream) : ZNF521 (72254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	23361622	23361622	+	IGR	DEL	A	-	-	rs948362		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23361622delA								ZNF521 (429408 upstream) : SS18 (234597 downstream)																																			---	---	---	---
PSMA8	143471	broad.mit.edu	37	18	23759261	23759261	+	Intron	DEL	T	-	-	rs36120364		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23759261delT	uc002kvq.2	+						PSMA8_uc002kvo.2_Intron|PSMA8_uc002kvp.2_Intron|PSMA8_uc002kvr.2_Intron	NM_144662	NP_653263			proteasome alpha 8 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	threonine-type endopeptidase activity			skin(1)	1	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)															---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24159009	24159010	+	Intron	INS	-	T	T	rs113083472		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24159009_24159010insT	uc010xbk.1	-							NM_198991	NP_945342			potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	26485010	26485011	+	IGR	INS	-	CTTC	CTTC	rs149654454	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26485010_26485011insCTTC								CDH2 (727565 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	26662488	26662488	+	IGR	DEL	T	-	-	rs68118255		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26662488delT								CDH2 (905043 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27526267	27526268	+	IGR	INS	-	T	T	rs112300073		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27526267_27526268insT								None (None upstream) : MIR302F (352608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27546998	27546998	+	IGR	DEL	G	-	-	rs11296475		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27546998delG								None (None upstream) : MIR302F (331878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	28007544	28007545	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28007544_28007545delCT								MIR302F (128618 upstream) : DSC3 (562508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	28521443	28521444	+	IGR	INS	-	AATA	AATA	rs143359922	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28521443_28521444insAATA								MIR302F (642517 upstream) : DSC3 (48609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	30461655	30461656	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30461655_30461656delCT								KLHL14 (108681 upstream) : C18orf34 (55710 downstream)																																			---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31680005	31680005	+	Intron	DEL	T	-	-	rs34923263		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31680005delT	uc010dmi.2	-						NOL4_uc002kxr.3_Intron|NOL4_uc010xbt.1_Intron|NOL4_uc010dmh.2_Intron|NOL4_uc010xbu.1_Intron|NOL4_uc002kxt.3_Intron|NOL4_uc010xbw.1_Intron	NM_003787	NP_003778			nucleolar protein 4							nucleolus	RNA binding			ovary(3)	3																		---	---	---	---
NOL4	8715	broad.mit.edu	37	18	31734617	31734617	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31734617delT	uc010dmi.2	-						NOL4_uc002kxr.3_Intron|NOL4_uc010xbt.1_Intron|NOL4_uc010dmh.2_Intron|NOL4_uc010xbu.1_Intron|NOL4_uc002kxt.3_Intron	NM_003787	NP_003778			nucleolar protein 4							nucleolus	RNA binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	31821479	31821479	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31821479delT								NOL4 (18033 upstream) : DTNA (251775 downstream)																																			---	---	---	---
MAPRE2	10982	broad.mit.edu	37	18	32625408	32625409	+	Intron	INS	-	A	A	rs1240795		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32625408_32625409insA	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083			microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1																		---	---	---	---
INO80C	125476	broad.mit.edu	37	18	33057762	33057762	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33057762delG	uc002kyy.3	-						INO80C_uc002kyw.1_Intron|INO80C_uc002kyx.3_Intron|INO80C_uc010dmt.2_Intron	NM_194281	NP_919257			Ies6-similar protein isoform 2						DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|MLL1 complex					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	35394403	35394404	+	IGR	DEL	GT	-	-	rs1786964	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35394403_35394404delGT								CELF4 (248403 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38536602	38536629	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGTGTGTGTGT	-	-	rs72494708		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38536602_38536629delGTGTGTGTGTGTGTGTGTGTGTGTGTGT								None (None upstream) : KC6 (523609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	42030718	42030718	+	Intron	DEL	T	-	-	rs34951283		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42030718delT	uc002lax.3	-											Homo sapiens cDNA clone IMAGE:5265929.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	42041438	42041438	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42041438delG	uc002lax.3	-											Homo sapiens cDNA clone IMAGE:5265929.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	42243631	42243643	+	IGR	DEL	CTTCAGCAGTAGG	-	-	rs6146296		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42243631_42243643delCTTCAGCAGTAGG								None (None upstream) : SETBP1 (16495 downstream)																																			---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	42781516	42781517	+	Intron	INS	-	GT	GT	rs145583802	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42781516_42781517insGT	uc002lbb.2	+							NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	45510759	45510760	+	IGR	INS	-	C	C	rs149047879	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45510759_45510760insC								SMAD2 (53244 upstream) : ZBTB7C (42988 downstream)																																			---	---	---	---
SMAD7	4092	broad.mit.edu	37	18	46470208	46470209	+	Intron	INS	-	C	C	rs148556809	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46470208_46470209insC	uc002ldg.2	-						SMAD7_uc002ldf.2_5'Flank|SMAD7_uc010xde.1_Intron	NM_005904	NP_005895			SMAD family member 7						adherens junction assembly|artery morphogenesis|BMP signaling pathway|cellular protein complex localization|negative regulation of BMP signaling pathway|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of pathway-restricted SMAD protein phosphorylation|negative regulation of peptidyl-serine phosphorylation|negative regulation of peptidyl-threonine phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of ubiquitin-protein ligase activity|pathway-restricted SMAD protein phosphorylation|positive regulation of anti-apoptosis|positive regulation of cell-cell adhesion|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein stabilization|regulation of activin receptor signaling pathway|response to laminar fluid shear stress|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	centrosome|cytosol|nucleolus|plasma membrane|transcription factor complex	activin binding|beta-catenin binding|I-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor, inhibitory cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding				0	Colorectal(1;0.0518)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	47308659	47308659	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47308659delC								LIPG (189383 upstream) : ACAA2 (1216 downstream)																																			---	---	---	---
MRO	83876	broad.mit.edu	37	18	48340649	48340649	+	Intron	DEL	C	-	-	rs2586773	byFrequency;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48340649delC	uc002lew.3	-						MRO_uc010xdn.1_Intron|MRO_uc010dpa.2_Intron|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Intron	NM_031939	NP_114145			maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	48677678	48677693	+	IGR	DEL	GGCAGGCACTGGAGAA	-	-	rs72471296		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48677678_48677693delGGCAGGCACTGGAGAA								SMAD4 (66269 upstream) : MEX3C (23229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	52853452	52853453	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52853452_52853453insT								CCDC68 (226713 upstream) : TCF4 (36109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	55197993	55197994	+	IGR	INS	-	CT	CT	rs147221164	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55197993_55197994insCT								ONECUT2 (39464 upstream) : FECH (14080 downstream)																																			---	---	---	---
MALT1	10892	broad.mit.edu	37	18	56359674	56359681	+	Intron	DEL	CTCCCTCC	-	-	rs62094984		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56359674_56359681delCTCCCTCC	uc002lhm.1	+						MALT1_uc002lhn.1_Intron	NM_006785	NP_006776			mucosa associated lymphoid tissue lymphoma						activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4								T	BIRC3	MALT								---	---	---	---
ZNF532	55205	broad.mit.edu	37	18	56532859	56532859	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56532859delC	uc002lho.2	+						ZNF532_uc002lhp.2_Intron|ZNF532_uc010xeg.1_Intron|ZNF532_uc002lhr.2_Intron|ZNF532_uc002lhs.2_Intron	NM_018181	NP_060651			zinc finger protein 532						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	57853289	57853292	+	IGR	DEL	AGAG	-	-	rs71905865		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57853289_57853292delAGAG								PMAIP1 (281751 upstream) : MC4R (185272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61272923	61272924	+	IGR	DEL	CA	-	-	rs113585124		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61272923_61272924delCA								SERPINB13 (6491 upstream) : SERPINB4 (31571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	62646173	62646174	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62646173_62646174delCA								C18orf20 (829913 upstream) : CDH7 (771314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	67063843	67063846	+	IGR	DEL	AACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67063843_67063846delAACA								CCDC102B (341417 upstream) : DOK6 (4445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	68689839	68689840	+	IGR	INS	-	A	A	rs141717051	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68689839_68689840insA								SOCS6 (692405 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70787558	70787558	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70787558delT								NETO1 (252748 upstream) : FBXO15 (953030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71237576	71237577	+	IGR	INS	-	T	T	rs144179933	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71237576_71237577insT								NETO1 (702766 upstream) : FBXO15 (503011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71694547	71694548	+	IGR	INS	-	G	G	rs142251326	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71694547_71694548insG								None (None upstream) : FBXO15 (46040 downstream)																																			---	---	---	---
CNDP2	55748	broad.mit.edu	37	18	72178942	72178943	+	Intron	INS	-	A	A	rs35283725		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72178942_72178943insA	uc002llm.1	+						CNDP2_uc002lln.1_Intron|CNDP2_uc010dqs.2_Intron	NM_018235	NP_060705			CNDP dipeptidase 2							cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)														---	---	---	---
ZNF407	55628	broad.mit.edu	37	18	72574877	72574878	+	Intron	INS	-	T	T	rs34268986		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72574877_72574878insT	uc002llw.2	+						ZNF407_uc010dqu.1_Intron	NM_017757	NP_060227			zinc finger protein 407 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	73945124	73945124	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73945124delG								C18orf62 (805535 upstream) : ZNF516 (126495 downstream)																																			---	---	---	---
MBP	4155	broad.mit.edu	37	18	74702114	74702114	+	Intron	DEL	T	-	-	rs74182679		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74702114delT	uc010xfd.1	-						MBP_uc002lml.2_Intron|MBP_uc002lmn.2_Intron|MBP_uc002lmp.2_Intron|MBP_uc010xfe.1_Intron|MBP_uc010dqz.2_5'Flank	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
MBP	4155	broad.mit.edu	37	18	74730704	74730705	+	Intron	INS	-	CATC	CATC	rs141460752	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74730704_74730705insCATC	uc010xfd.1	-						MBP_uc002lml.2_5'Flank|MBP_uc002lmn.2_5'Flank|MBP_uc002lmp.2_5'Flank|MBP_uc010xfe.1_5'Flank|MBP_uc002lmr.2_Intron	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	76061011	76061012	+	IGR	INS	-	AGTACACA	AGTACACA	rs149039617	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76061011_76061012insAGTACACA								None (None upstream) : SALL3 (679263 downstream)																																			---	---	---	---
CTDP1	9150	broad.mit.edu	37	18	77474223	77474223	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77474223delT	uc002lnh.1	+						CTDP1_uc002lni.1_Intron|CTDP1_uc010drd.1_Intron	NM_004715	NP_004706			CTD (carboxy-terminal domain, RNA polymerase II,						positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	77855491	77855491	+	IGR	DEL	A	-	-	rs112504067		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77855491delA								C18orf22 (1703 upstream) : ADNP2 (11424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	251753	251753	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:251753delA								FLJ45445 (49544 upstream) : PPAP2C (29293 downstream)																																			---	---	---	---
GZMM	3004	broad.mit.edu	37	19	544961	544963	+	Intron	DEL	ACC	-	-	rs59558746		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:544961_544963delACC	uc002low.1	+							NM_005317	NP_005308			granzyme M precursor						apoptosis|cytolysis|innate immune response|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	786448	786452	+	IGR	DEL	AGAAA	-	-	rs72039153		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:786448_786452delAGAAA								C19orf21 (22130 upstream) : PTBP1 (10940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	2266324	2266325	+	IGR	DEL	AA	-	-	rs74455147		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2266324_2266325delAA								JSRP1 (9908 upstream) : OAZ1 (3195 downstream)																																			---	---	---	---
NFIC	4782	broad.mit.edu	37	19	3362408	3362409	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3362408_3362409delTG	uc002lxo.2	+						NFIC_uc010xhh.1_Intron	NM_205843	NP_995315			nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)														---	---	---	---
ZFR2	23217	broad.mit.edu	37	19	3820879	3820879	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3820879delG	uc002lyw.2	-							NM_015174	NP_055989			zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)														---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5086657	5086657	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5086657delC	uc002mbq.3	+						KDM4B_uc010xil.1_Intron|KDM4B_uc010xim.1_Intron|KDM4B_uc002mbr.3_Intron	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	5517536	5517537	+	IGR	INS	-	CTCTCT	CTCTCT	rs148249362	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5517536_5517537insCTCTCT								ZNRF4 (60670 upstream) : PLAC2 (40643 downstream)																																			---	---	---	---
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958			scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)														---	---	---	---
LONP1	9361	broad.mit.edu	37	19	5697774	5697779	+	Intron	DEL	TGTCTC	-	-	rs58653252		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5697774_5697779delTGTCTC	uc002mcx.2	-						LONP1_uc002mcy.2_Intron|LONP1_uc010duh.2_Intron|LONP1_uc010dui.2_Intron|LONP1_uc002mcz.2_Intron	NM_004793	NP_004784			mitochondrial lon peptidase 1 precursor						cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding				0																		---	---	---	---
GTF2F1	2962	broad.mit.edu	37	19	6395570	6395571	+	5'Flank	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6395570_6395571insT	uc002meq.2	-						uc010dur.1_5'Flank	NM_002096	NP_002087			general transcription factor IIF, polypeptide 1,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|response to virus|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cell junction|transcription factor TFIIF complex	catalytic activity|DNA binding|phosphatase activator activity|transcription coactivator activity|transcription factor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	6727252	6727254	+	IGR	DEL	ACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6727252_6727254delACA								C3 (6590 upstream) : GPR108 (2673 downstream)																																			---	---	---	---
INSR	3643	broad.mit.edu	37	19	7153106	7153109	+	Intron	DEL	ACAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153106_7153109delACAC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
INSR	3643	broad.mit.edu	37	19	7207912	7207913	+	Intron	INS	-	AAGGAAGGAAGGAAGGAAGG	AAGGAAGGAAGGAAGGAAGG	rs139141232	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7207912_7207913insAAGGAAGGAAGGAAGGAAGG	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
PCP2	126006	broad.mit.edu	37	19	7697886	7697887	+	Intron	DEL	GA	-	-	rs78473084		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7697886_7697887delGA	uc002mgz.2	-							NM_174895	NP_777555			Purkinje cell protein 2						signal transduction		GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8582137	8582138	+	IGR	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8582137_8582138delCT								ZNF414 (3089 upstream) : MYO1F (3861 downstream)																																			---	---	---	---
MYO1F	4542	broad.mit.edu	37	19	8635029	8635029	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8635029delT	uc002mkg.2	-						MYO1F_uc002mkh.2_Intron|MYO1F_uc010xkf.1_Intron	NM_012335	NP_036467			myosin IF							unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8885073	8885074	+	IGR	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8885073_8885074insTT								OR2Z1 (42739 upstream) : ZNF558 (35308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13795732	13795732	+	IGR	DEL	A	-	-	rs113522963		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13795732delA								CACNA1A (178458 upstream) : CCDC130 (46842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14473444	14473447	+	IGR	DEL	GGAA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14473444_14473447delGGAA								LPHN1 (156447 upstream) : CD97 (18766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14726570	14726570	+	IGR	DEL	A	-	-	rs79381928		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14726570delA								CLEC17A (4619 upstream) : EMR3 (3482 downstream)																																			---	---	---	---
EMR2	30817	broad.mit.edu	37	19	14846071	14846072	+	3'UTR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14846071_14846072insT	uc002mzp.1	-	21					EMR2_uc010dzs.1_3'UTR|EMR2_uc010xnw.1_3'UTR|EMR2_uc002mzo.1_3'UTR|EMR2_uc002mzq.1_3'UTR|EMR2_uc002mzr.1_3'UTR|EMR2_uc002mzs.1_3'UTR|EMR2_uc002mzt.1_3'UTR|EMR2_uc002mzu.1_3'UTR	NM_013447	NP_038475			egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	16291734	16291734	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16291734delT								CIB3 (7448 upstream) : FAM32A (4501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	16426862	16426863	+	IGR	DEL	AC	-	-	rs3082752		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16426862_16426863delAC								AP1M1 (80706 upstream) : KLF2 (8788 downstream)																																			---	---	---	---
EPS15L1	58513	broad.mit.edu	37	19	16493434	16493437	+	Intron	DEL	TTTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16493434_16493437delTTTT	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron	NM_021235	NP_067058			epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5																OREG0025333	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SLC35E1	79939	broad.mit.edu	37	19	16680177	16680178	+	Intron	INS	-	ACA	ACA	rs139237976	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16680177_16680178insACA	uc010xph.1	-						MED26_uc002nee.2_Intron|SLC35E1_uc002nem.1_Intron	NM_024881	NP_079157			solute carrier family 35, member E1						transport	integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
NWD1	284434	broad.mit.edu	37	19	16893673	16893676	+	Intron	DEL	TTCT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16893673_16893676delTTCT	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron					RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7																		---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17117342	17117342	+	Intron	DEL	A	-	-	rs112672091		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17117342delA	uc002nfb.2	-							NM_015692	NP_056507			C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
MYO9B	4650	broad.mit.edu	37	19	17210934	17210934	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17210934delA	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_5'Flank	NM_004145	NP_004136			myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1																		---	---	---	---
MYO9B	4650	broad.mit.edu	37	19	17319703	17319732	+	Intron	DEL	CTGAGTCCCTCTGGTACTGGCCACTCCGGG	-	-	rs59084139	by1000genomes;by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17319703_17319732delCTGAGTCCCTCTGGTACTGGCCACTCCGGG	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron|MYO9B_uc002nfm.1_Intron	NM_004145	NP_004136			myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1																		---	---	---	---
USE1	55850	broad.mit.edu	37	19	17324949	17324949	+	5'Flank	DEL	T	-	-	rs71334686		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17324949delT	uc002nfo.2	+						USE1_uc002nfn.2_5'Flank|USE1_uc010eal.1_5'Flank	NM_018467	NP_060937			unconventional SNARE in the ER 1 homolog						lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0																		---	---	---	---
KCNN1	3780	broad.mit.edu	37	19	18074535	18074535	+	Intron	DEL	T	-	-	rs147435448		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18074535delT	uc002nht.2	+						KCNN1_uc010xqa.1_Intron	NM_002248	NP_002239			potassium intermediate/small conductance						synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0																		---	---	---	---
PDE4C	5143	broad.mit.edu	37	19	18337415	18337416	+	Intron	INS	-	T	T	rs34009293		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18337415_18337416insT	uc010xqc.1	-						PDE4C_uc002nik.3_Intron|PDE4C_uc002nil.3_Intron|PDE4C_uc010ebk.2_5'Flank|PDE4C_uc002nii.3_5'Flank|PDE4C_uc010ebl.2_Intron|PDE4C_uc010xqd.1_5'Flank|PDE4C_uc002nim.1_Intron	NM_001098819	NP_001092289			phosphodiesterase 4C isoform PDE4C-2						signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	18552131	18552132	+	IGR	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18552131_18552132insC								ISYNA1 (3188 upstream) : ELL (1343 downstream)																																			---	---	---	---
CRTC1	23373	broad.mit.edu	37	19	18841770	18841777	+	Intron	DEL	TCCCTCCT	-	-	rs71876806		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18841770_18841777delTCCCTCCT	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron	NM_015321	NP_056136			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519																		---	---	---	---
GATAD2A	54815	broad.mit.edu	37	19	19533525	19533526	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19533525_19533526insT	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron	NM_017660	NP_060130			GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20442506	20442507	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20442506_20442507insT								LOC284441 (72003 upstream) : ZNF826 (8571 downstream)																																			---	---	---	---
ZNF257	113835	broad.mit.edu	37	19	22268493	22268496	+	Intron	DEL	CACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22268493_22268496delCACA	uc010ecx.2	+						ZNF257_uc010ecy.2_Intron	NM_033468	NP_258429			zinc finger protein 257						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF91	7644	broad.mit.edu	37	19	23561804	23561805	+	Intron	INS	-	G	G	rs144522008	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23561804_23561805insG	uc002nre.2	-						ZNF91_uc010xrj.1_Intron	NM_003430	NP_003421			zinc finger protein 91							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	24023868	24023869	+	IGR	INS	-	T	T	rs139762491	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24023868_24023869insT								RPSAP58 (12951 upstream) : ZNF254 (192378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24557484	24557485	+	IGR	INS	-	A	A	rs141837543	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24557484_24557485insA								LOC100101266 (211235 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27865507	27865507	+	IGR	DEL	C	-	-	rs71224979		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27865507delC								None (None upstream) : LOC148189 (415895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27871042	27871042	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27871042delT								None (None upstream) : LOC148189 (410360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28444856	28444856	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28444856delT								LOC148189 (160008 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28604791	28604792	+	IGR	INS	-	AAGG	AAGG	rs71942704		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28604791_28604792insAAGG								LOC148189 (319943 upstream) : LOC148145 (851248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28897069	28897080	+	IGR	DEL	CACACACACAGG	-	-	rs71169747	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28897069_28897080delCACACACACAGG								LOC148189 (612221 upstream) : LOC148145 (558960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29008454	29008454	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29008454delA	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29100811	29100811	+	Intron	DEL	A	-	-	rs35179564		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29100811delA	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29405731	29405731	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29405731delT								None (None upstream) : LOC148145 (50309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29751588	29751589	+	IGR	INS	-	C	C	rs145310676	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29751588_29751589insC								UQCRFS1 (47452 upstream) : VSTM2B (265902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29895789	29895789	+	Intron	DEL	G	-	-	rs34933041		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29895789delG	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	30175225	30175226	+	IGR	INS	-	T	T	rs111943544		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30175225_30175226insT								PLEKHF1 (8849 upstream) : C19orf12 (14569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30252594	30252594	+	IGR	DEL	A	-	-	rs72427177		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30252594delA								C19orf12 (46142 upstream) : CCNE1 (50307 downstream)																																			---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30899755	30899780	+	Intron	DEL	ATCCATCCTCCATCCATCGATCTTCT	-	-	rs145652389		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30899755_30899780delATCCATCCTCCATCCATCGATCTTCT	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532			zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	31339439	31339440	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31339439_31339440delTG								ZNF536 (290474 upstream) : DKFZp566F0947 (301343 downstream)																																			---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31798508	31798508	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31798508delC	uc002nsy.3	-							NM_020856	NP_065907			zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	32252955	32252955	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32252955delT								TSHZ3 (412765 upstream) : ZNF507 (583559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33204953	33204953	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33204953delT								NUDT19 (252 upstream) : TDRD12 (5726 downstream)																																			---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33482543	33482544	+	Intron	INS	-	A	A	rs148574152	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33482543_33482544insA	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	33745424	33745425	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33745424_33745425insA								SLC7A10 (28668 upstream) : CEBPA (45417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33843301	33843301	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33843301delT								LOC80054 (47339 upstream) : CEBPG (21308 downstream)																																			---	---	---	---
PEPD	5184	broad.mit.edu	37	19	33913329	33913330	+	Intron	INS	-	CTAT	CTAT	rs149802080	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33913329_33913330insCTAT	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron	NM_000285	NP_000276			prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)																	---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34176272	34176273	+	Intron	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34176272_34176273insG	uc002nus.3	+						CHST8_uc002nut.3_Intron|CHST8_uc002nuu.2_Intron	NM_001127895	NP_001121367			carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34433890	34433890	+	IGR	DEL	T	-	-	rs80309786		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34433890delT								KCTD15 (127225 upstream) : LSM14A (229462 downstream)																																			---	---	---	---
LSM14A	26065	broad.mit.edu	37	19	34693031	34693032	+	Intron	INS	-	T	T	rs113903997		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34693031_34693032insT	uc002nvb.3	+						LSM14A_uc002nva.3_Intron|LSM14A_uc010xru.1_Intron	NM_001114093	NP_001107565			LSM14 homolog A isoform a						cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
KIAA0355	9710	broad.mit.edu	37	19	34843875	34843882	+	3'UTR	DEL	GCCTGCCT	-	-	rs74177140		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34843875_34843882delGCCTGCCT	uc002nvd.3	+	14						NM_014686	NP_055501			hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---
GPI	2821	broad.mit.edu	37	19	34889618	34889618	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34889618delT	uc002nvg.1	+						GPI_uc002nvf.2_Intron|GPI_uc010xrv.1_Intron|GPI_uc010xrw.1_Intron|GPI_uc010edl.1_Intron|GPI_uc002nvi.1_Intron	NM_000175	NP_000166			glucose phosphate isomerase						angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)																	---	---	---	---
PDCD2L	84306	broad.mit.edu	37	19	34902068	34902068	+	Intron	DEL	T	-	-	rs12974424		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34902068delT	uc002nvj.2	+							NM_032346	NP_115722			programmed cell death 2-like							cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)															---	---	---	---
PDCD2L	84306	broad.mit.edu	37	19	34902149	34902149	+	Intron	DEL	T	-	-	rs150050153		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34902149delT	uc002nvj.2	+							NM_032346	NP_115722			programmed cell death 2-like							cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38412244	38412245	+	Intron	DEL	TT	-	-	rs79587241		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38412244_38412245delTT	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38661611	38661612	+	Intron	DEL	AC	-	-	rs35105393		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38661611_38661612delAC	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	39748308	39748308	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39748308delC								IL28B (12662 upstream) : IL28A (10849 downstream)																																			---	---	---	---
LOC400696	400696	broad.mit.edu	37	19	40169393	40169393	+	5'Flank	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40169393delG	uc010xve.1	+						LOC400696_uc010xvf.1_5'Flank	NM_207646	NP_997529			hypothetical protein LOC400696												0																		---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41007148	41007149	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41007148_41007149insA	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron	NM_020971	NP_066022			spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
CYP2F1	1572	broad.mit.edu	37	19	41658957	41658957	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41658957delA	uc010xvw.1	+											SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	42100176	42100176	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42100176delC								CEACAM21 (6980 upstream) : CEACAM4 (25168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42107427	42107428	+	IGR	INS	-	CA	CA	rs71928647		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107427_42107428insCA								CEACAM21 (14231 upstream) : CEACAM4 (17916 downstream)																																			---	---	---	---
IRGC	56269	broad.mit.edu	37	19	44220521	44220522	+	Intron	INS	-	T	T	rs28674603		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44220521_44220522insT	uc002oxh.2	+							NM_019612	NP_062558			immunity-related GTPase family, cinema							membrane	GTP binding|hydrolase activity, acting on acid anhydrides			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(69;0.0435)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44269152	44269153	+	IGR	DEL	GT	-	-	rs72375856		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44269152_44269153delGT								C19orf61 (10010 upstream) : KCNN4 (1534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	45196632	45196633	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45196632_45196633insA								CEACAM19 (9007 upstream) : CEACAM16 (5725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	45270073	45270073	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45270073delA								BCL3 (6773 upstream) : CBLC (11053 downstream)																																			---	---	---	---
SFRS16	11129	broad.mit.edu	37	19	45565044	45565046	+	Intron	DEL	ATC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45565044_45565046delATC	uc002pak.2	+						SFRS16_uc002pal.2_Intron|SFRS16_uc010xxh.1_Intron|SFRS16_uc002pam.2_Intron|SFRS16_uc002pan.1_Intron	NM_007056	NP_008987			splicing factor, arginine/serine-rich 16						mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)														---	---	---	---
SNRPD2	6633	broad.mit.edu	37	19	46193747	46193751	+	Intron	DEL	AAACA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46193747_46193751delAAACA	uc002pcw.2	-						SNRPD2_uc002pcv.2_Intron|QPCTL_uc010xxr.1_5'Flank|QPCTL_uc010ekn.2_5'Flank	NM_004597	NP_004588			small nuclear ribonucleoprotein D2 isoform 1						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	46439624	46439624	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46439624delT								NANOS2 (21588 upstream) : NOVA2 (3147 downstream)																																			---	---	---	---
IGFL2	147920	broad.mit.edu	37	19	46652434	46652437	+	Intron	DEL	TCTC	-	-	rs143439832	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46652434_46652437delTCTC	uc010xxv.1	+						IGFL2_uc002peb.2_Intron	NM_001135113	NP_001128585			IGF-like family member 2 isoform b							extracellular region	protein binding				0		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)														---	---	---	---
PPP5C	5536	broad.mit.edu	37	19	46852548	46852548	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46852548delA	uc002pem.2	+						PPP5C_uc010xya.1_Intron|PPP5C_uc002pen.2_Intron	NM_006247	NP_006238			protein phosphatase 5, catalytic subunit						mitosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein dephosphorylation|transcription, DNA-dependent	Golgi apparatus|nucleus	metal ion binding|protein binding|protein serine/threonine phosphatase activity|signal transducer activity			lung(1)|pancreas(1)	2		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	46920623	46920624	+	IGR	INS	-	A	A	rs3063399		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46920623_46920624insA								CCDC8 (3704 upstream) : PNMAL1 (49125 downstream)																																			---	---	---	---
CARD8	22900	broad.mit.edu	37	19	48724265	48724266	+	Intron	INS	-	AAAG	AAAG	rs150900973	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48724265_48724266insAAAG	uc002pie.3	-						CARD8_uc002pii.3_Intron|CARD8_uc002pid.1_5'Flank|CARD8_uc010xzi.1_Intron|CARD8_uc010els.2_Intron|CARD8_uc010xzj.1_Intron|CARD8_uc010xzk.1_Intron|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_Intron|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Intron	NM_014959	NP_055774			caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)														---	---	---	---
RCN3	57333	broad.mit.edu	37	19	50043418	50043419	+	Intron	INS	-	TG	TG	rs142600017	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50043418_50043419insTG	uc002poj.2	+							NM_020650	NP_065701			reticulocalbin 3, EF-hand calcium binding domain							endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)														---	---	---	---
ZNF473	25888	broad.mit.edu	37	19	50535300	50535300	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50535300delC	uc002prn.2	+						ZNF473_uc002prm.2_Intron|ZNF473_uc010ybo.1_Intron	NM_001006656	NP_001006657			zinc finger protein 473						histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)														---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50888784	50888786	+	Intron	DEL	TTT	-	-	rs3058975		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50888784_50888786delTTT	uc002psb.3	+						POLD1_uc002psc.3_Intron|POLD1_uc010enx.2_Intron	NM_002691	NP_002682			DNA-directed DNA polymerase delta 1						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
Unknown	0	broad.mit.edu	37	19	51091057	51091058	+	IGR	INS	-	T	T	rs145938853	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51091057_51091058insT								LRRC4B (19755 upstream) : SNAR-F (17162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	51115486	51115487	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51115486_51115487insT								SNAR-F (7144 upstream) : SYT3 (9749 downstream)																																			---	---	---	---
KLK4	9622	broad.mit.edu	37	19	51415629	51415645	+	5'Flank	DEL	AGGAGGGCAGGGCGGGT	-	-	rs72497525		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51415629_51415645delAGGAGGGCAGGGCGGGT	uc002pua.1	-						KLK4_uc002pty.1_5'Flank|KLK4_uc002ptz.1_5'Flank|KLK4_uc002pub.1_5'Flank|KLK4_uc002puc.1_5'Flank|KLK4_uc010eoi.1_5'Flank	NM_004917	NP_004908			kallikrein-related peptidase 4 preproprotein						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)														---	---	---	---
IGLON5	402665	broad.mit.edu	37	19	51822559	51822560	+	Intron	DEL	GT	-	-	rs35370241		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51822559_51822560delGT	uc002pwc.2	+							NM_001101372	NP_001094842			IgLON family member 5 precursor							extracellular region					0																		---	---	---	---
CEACAM18	729767	broad.mit.edu	37	19	51977977	51977978	+	5'Flank	INS	-	G	G	rs139782373	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51977977_51977978insG	uc002pwv.1	+							NM_001080405	NP_001073874			carcinoembryonic antigen-related cell adhesion							integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)														---	---	---	---
ZNF534	147658	broad.mit.edu	37	19	52937999	52937999	+	Intron	DEL	G	-	-	rs2434458		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52937999delG	uc002pzk.2	+						ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_Intron|ZNF534_uc002pzl.2_Intron	NM_001143939	NP_001137411			zinc finger protein 534 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF578	147660	broad.mit.edu	37	19	52979360	52979361	+	Intron	INS	-	AA	AA	rs35835289	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52979360_52979361insAA	uc002pzp.3	+							NM_001099694	NP_001093164			zinc finger protein 578						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)														---	---	---	---
ZNF320	162967	broad.mit.edu	37	19	53390265	53390266	+	Intron	DEL	AA	-	-	rs142988176	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53390265_53390266delAA	uc002qag.2	-						ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Intron|ZNF320_uc002qai.2_Intron	NM_207333	NP_997216			zinc finger protein 320						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)														---	---	---	---
ZNF677	342926	broad.mit.edu	37	19	53745998	53745998	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53745998delC	uc002qbf.1	-						ZNF677_uc002qbg.1_Intron|ZNF677_uc002qbh.2_Intron	NM_182609	NP_872415			zinc finger protein 677						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54165811	54165812	+	IGR	INS	-	C	C	rs149559575	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54165811_54165812insC								DPRX (25548 upstream) : MIR512-1 (4121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	54272643	54272644	+	IGR	INS	-	T	T	rs113932567		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54272643_54272644insT								MIR519A2 (6959 upstream) : MIR371 (18285 downstream)																																			---	---	---	---
CACNG7	59284	broad.mit.edu	37	19	54431328	54431329	+	Intron	DEL	GA	-	-	rs10607723		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54431328_54431329delGA	uc002qcr.1	+						CACNG7_uc010era.1_Intron	NM_031896	NP_114102			voltage-dependent calcium channel gamma-7						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(1)	1	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)														---	---	---	---
CACNG8	59283	broad.mit.edu	37	19	54483312	54483317	+	Intron	DEL	GTGTGT	-	-	rs71949256		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483312_54483317delGTGTGT	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101			voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54810542	54810543	+	IGR	INS	-	CTTCCTT	CTTCCTT	rs140755834	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54810542_54810543insCTTCCTT								LILRA6 (6304 upstream) : LILRA5 (7811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	54829599	54829600	+	IGR	INS	-	CAC	CAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54829599_54829600insCAC								LILRA5 (5190 upstream) : LILRA4 (15093 downstream)																																			---	---	---	---
LAIR2	3904	broad.mit.edu	37	19	55009513	55009513	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55009513delT	uc002qga.1	+						LAIR2_uc002qgb.1_Intron					Homo sapiens leukocyte-associated Ig-like receptor-2 (LAIR-2) mRNA, complete cds.							extracellular region	receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)														---	---	---	---
RDH13	112724	broad.mit.edu	37	19	55561157	55561158	+	Intron	INS	-	AA	AA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55561157_55561158insAA	uc002qio.3	-						RDH13_uc002qip.2_Intron|RDH13_uc010esr.1_Intron	NM_001145971	NP_001139443			retinol dehydrogenase 13 isoform 1								binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	55727567	55727568	+	IGR	INS	-	T	T	rs142898172		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55727567_55727568insT								PTPRH (6693 upstream) : TMEM86B (10545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	55978043	55978044	+	IGR	INS	-	GT	GT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55978043_55978044insGT								ISOC2 (4994 upstream) : ZNF628 (9655 downstream)																																			---	---	---	---
NLRP13	126204	broad.mit.edu	37	19	56418333	56418333	+	Intron	DEL	T	-	-	rs11310557		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56418333delT	uc010ygg.1	-							NM_176810	NP_789780			NACHT, leucine rich repeat and PYD containing								ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)														---	---	---	---
ZNF551	90233	broad.mit.edu	37	19	58191938	58191939	+	5'Flank	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58191938_58191939delAA	uc002qpw.3	+						ZNF551_uc002qpv.3_5'Flank|ZNF776_uc002qpx.2_5'Flank	NM_138347	NP_612356			zinc finger protein 551						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
ZNF587	84914	broad.mit.edu	37	19	58298032	58298033	+	Intron	INS	-	C	C	rs145283189	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58298032_58298033insC	uc002qqb.2	+						ZNF586_uc002qqf.1_Intron	NM_032828	NP_116217			zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	241827	241830	+	IGR	DEL	TTTG	-	-	rs66982341		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:241827_241830delTTTG								DEFB132 (93 upstream) : C20orf96 (9694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1000443	1000446	+	IGR	DEL	TTCA	-	-	rs112800484		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1000443_1000446delTTCA								RSPO4 (17539 upstream) : PSMF1 (93460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1485423	1485424	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1485423_1485424delGT								SIRPB2 (13190 upstream) : SIRPD (29475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1660494	1660494	+	IGR	DEL	T	-	-	rs5839914		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1660494delT								SIRPG (22069 upstream) : SIRPA (214319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1845188	1845189	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1845188_1845189insA								SIRPG (206763 upstream) : SIRPA (29624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	2441617	2441618	+	IGR	INS	-	A	A	rs11481830		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2441617_2441618insA								TGM6 (28218 upstream) : SNRPB (663 downstream)																																			---	---	---	---
IDH3B	3420	broad.mit.edu	37	20	2643791	2643791	+	Intron	DEL	A	-	-	rs11476625		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2643791delA	uc002wgp.2	-						IDH3B_uc002wgq.2_Intron|IDH3B_uc002wgr.2_Intron|IDH3B_uc010zpz.1_Intron	NM_006899	NP_008830			isocitrate dehydrogenase 3, beta subunit isoform						isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	2757300	2757301	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2757300_2757301insT								EBF4 (16547 upstream) : CPXM1 (17415 downstream)																																			---	---	---	---
PTPRA	5786	broad.mit.edu	37	20	2881923	2881924	+	Intron	DEL	TC	-	-	rs1161235	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2881923_2881924delTC	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron					SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
C20orf194	25943	broad.mit.edu	37	20	3338276	3338277	+	Intron	INS	-	CTTAT	CTTAT	rs143771600	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3338276_3338277insCTTAT	uc002wii.2	-						C20orf194_uc002wik.2_Intron|C20orf194_uc010gay.1_Intron	NM_001009984	NP_001009984			hypothetical protein LOC25943												0																		---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3623961	3623961	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3623961delA	uc002wim.2	+							NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
RNF24	11237	broad.mit.edu	37	20	3981294	3981295	+	Intron	INS	-	CA	CA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3981294_3981295insCA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150			ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	4075258	4075258	+	IGR	DEL	A	-	-	rs67468700		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4075258delA								RNF24 (79042 upstream) : SMOX (54192 downstream)																																			---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4910202	4910202	+	Intron	DEL	G	-	-	rs112062770		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4910202delG	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron	NM_005116	NP_005107			solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5033406	5033407	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5033406_5033407delTG								SLC23A2 (42467 upstream) : C20orf30 (15723 downstream)																																			---	---	---	---
C20orf30	29058	broad.mit.edu	37	20	5062881	5062890	+	Intron	DEL	TCTCTCTCTC	-	-	rs148541954		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5062881_5062890delTCTCTCTCTC	uc010gbi.2	-							NM_014145	NP_054864			hypothetical protein LOC29058 isoform 2							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5518456	5518457	+	IGR	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5518456_5518457insG								LOC149837 (33214 upstream) : GPCPD1 (6624 downstream)																																			---	---	---	---
FERMT1	55612	broad.mit.edu	37	20	6104901	6104902	+	5'Flank	DEL	AA	-	-	rs2326720		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6104901_6104902delAA	uc002wmr.2	-						FERMT1_uc010gbt.2_5'Flank|FERMT1_uc002wms.2_5'Flank	NM_017671	NP_060141			kindlin-1						cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	6213692	6213695	+	IGR	DEL	TTCC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6213692_6213695delTTCC								FERMT1 (109501 upstream) : BMP2 (535050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6482639	6482640	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6482639_6482640insA								FERMT1 (378448 upstream) : BMP2 (266105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7117108	7117111	+	IGR	DEL	AAAG	-	-	rs71182171		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7117108_7117111delAAAG								BMP2 (356198 upstream) : HAO1 (746520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7268436	7268437	+	IGR	INS	-	CTGTCTGTCTGT	CTGTCTGTCTGT	rs148293957	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7268436_7268437insCTGTCTGTCTGT								BMP2 (507526 upstream) : HAO1 (595194 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8105892	8105892	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8105892delA	uc010zrb.1	+							NM_182734	NP_877398			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8446018	8446018	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8446018delT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8602727	8602728	+	Intron	INS	-	CC	CC	rs138549954	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8602727_8602728insCC	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8761722	8761723	+	Intron	INS	-	T	T	rs147813908	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8761722_8761723insT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB4	5332	broad.mit.edu	37	20	9321400	9321401	+	Intron	INS	-	A	A	rs144413383	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9321400_9321401insA	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949			phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	11015357	11015357	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11015357delA								JAG1 (360663 upstream) : BTBD3 (856120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12180977	12180977	+	IGR	DEL	C	-	-	rs112498959		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12180977delC								BTBD3 (273735 upstream) : SPTLC3 (808650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12234127	12234127	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12234127delT								BTBD3 (326885 upstream) : SPTLC3 (755500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12495850	12495851	+	IGR	INS	-	TTG	TTG	rs145094645	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12495850_12495851insTTG								BTBD3 (588608 upstream) : SPTLC3 (493776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12854079	12854080	+	IGR	DEL	GG	-	-	rs142894918	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12854079_12854080delGG								BTBD3 (946837 upstream) : SPTLC3 (135547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16239829	16239829	+	IGR	DEL	C	-	-	rs11477262		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16239829delC								MACROD2 (205990 upstream) : KIF16B (12920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16794483	16794483	+	IGR	DEL	T	-	-	rs138741333		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16794483delT								OTOR (61675 upstream) : PCSK2 (412269 downstream)																																			---	---	---	---
PCSK2	5126	broad.mit.edu	37	20	17226278	17226279	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17226278_17226279insT	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585			proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
DSTN	11034	broad.mit.edu	37	20	17581230	17581232	+	Intron	DEL	TAG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17581230_17581232delTAG	uc002wpr.2	+						DSTN_uc002wpq.2_Intron|DSTN_uc010gck.2_Intron	NM_006870	NP_006861			destrin isoform a						actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2																		---	---	---	---
C20orf12	55184	broad.mit.edu	37	20	18408248	18408249	+	Intron	INS	-	GG	GG			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18408248_18408249insGG	uc010zsa.1	-						C20orf12_uc002wqp.3_Intron|C20orf12_uc002wqr.3_Intron|C20orf12_uc002wqs.3_Intron|C20orf12_uc002wqq.3_Intron|C20orf12_uc002wqu.1_Intron|C20orf12_uc010gct.1_Intron	NM_001099407	NP_001092877			hypothetical protein LOC55184							intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	21589456	21589457	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21589456_21589457delAC								NKX2-2 (94792 upstream) : PAX1 (96840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22581345	22581346	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22581345_22581346insA								FOXA2 (15244 upstream) : SSTR4 (434711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22677149	22677168	+	IGR	DEL	CTCTCTGTGGCCCTCTGTGT	-	-	rs55932416	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22677149_22677168delCTCTCTGTGGCCCTCTGTGT								FOXA2 (111048 upstream) : SSTR4 (338889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23257687	23257688	+	IGR	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23257687_23257688delCA								CD93 (190710 upstream) : NXT1 (73685 downstream)																																			---	---	---	---
NAPB	63908	broad.mit.edu	37	20	23383461	23383462	+	Intron	INS	-	CACA	CACA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23383461_23383462insCACA	uc002wta.2	-						NAPB_uc002wtc.2_Intron|NAPB_uc002wtb.2_Intron|NAPB_uc002wtd.3_Intron|NAPB_uc010zst.1_Intron	NM_022080	NP_071363			N-ethylmaleimide-sensitive factor attachment						intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	24001961	24001962	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24001961_24001962delAC								GGTLC1 (32545 upstream) : TMEM90B (447873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24078853	24078856	+	IGR	DEL	TTTT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24078853_24078856delTTTT								GGTLC1 (109437 upstream) : TMEM90B (370979 downstream)																																			---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24554440	24554440	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24554440delC	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24635529	24635529	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24635529delA	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
ABHD12	26090	broad.mit.edu	37	20	25279726	25279727	+	Intron	INS	-	TG	TG	rs10668658		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25279726_25279727insTG	uc002wuq.2	-						ABHD12_uc002wur.2_Intron	NM_015600	NP_056415			abhydrolase domain containing 12 isoform b							integral to membrane	acylglycerol lipase activity			skin(1)	1																		---	---	---	---
GINS1	9837	broad.mit.edu	37	20	25408505	25408506	+	Intron	INS	-	T	T	rs11429312		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25408505_25408506insT	uc002wuv.1	+						GINS1_uc010zte.1_Intron	NM_021067	NP_066545			GINS complex subunit 1						DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	cytoplasm|nucleoplasm				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
NINL	22981	broad.mit.edu	37	20	25527488	25527489	+	Intron	INS	-	A	A	rs139240046	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25527488_25527489insA	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron	NM_025176	NP_079452			ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25846777	25846777	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25846777delC	uc002wvd.1	-						FAM182B_uc002wve.2_5'Flank					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25863383	25863384	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25863383_25863384delTG								FAM182B (14597 upstream) : LOC100134868 (127051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25957219	25957220	+	IGR	INS	-	GT	GT	rs138669329	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25957219_25957220insGT								FAM182B (108433 upstream) : LOC100134868 (33215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26083662	26083662	+	IGR	DEL	A	-	-	rs113870800		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26083662delA								FAM182A (16110 upstream) : C20orf191 (391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26145293	26145293	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26145293delT								C20orf191 (50616 upstream) : MIR663 (43529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26252664	26252667	+	IGR	DEL	AAGA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26252664_26252667delAAGA								MIR663 (63750 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29462348	29462349	+	IGR	INS	-	AA	AA	rs140899401	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29462348_29462349insAA								None (None upstream) : FRG1B (149530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29467912	29467912	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29467912delT								None (None upstream) : FRG1B (143967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29498078	29498078	+	IGR	DEL	T	-	-	rs112193141		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29498078delT								None (None upstream) : FRG1B (113801 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29618862	29618863	+	Intron	DEL	CT	-	-	rs112384226		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29618862_29618863delCT	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29650715	29650715	+	Intron	DEL	T	-	-	rs111649645		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29650715delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
DEFB118	117285	broad.mit.edu	37	20	29954505	29954506	+	5'Flank	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29954505_29954506insT	uc002wvr.2	+							NM_054112	NP_473453			beta-defensin 118 precursor						cell-matrix adhesion|defense response to bacterium|innate immune response|spermatogenesis	extracellular region				ovary(3)|pancreas(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30392937	30392939	+	IGR	DEL	TGC	-	-	rs148974069		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30392937_30392939delTGC								TPX2 (3334 upstream) : MYLK2 (14239 downstream)																																			---	---	---	---
C20orf160	140706	broad.mit.edu	37	20	30608351	30608352	+	Intron	INS	-	C	C	rs146165722	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30608351_30608352insC	uc002wxf.2	+						C20orf160_uc002wxg.2_5'Flank	NM_080625	NP_542192			hypothetical protein LOC140706											central_nervous_system(3)|ovary(1)	4																		---	---	---	---
DNMT3B	1789	broad.mit.edu	37	20	31355999	31355999	+	Intron	DEL	T	-	-	rs67694350		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31355999delT	uc002wyc.2	+						DNMT3B_uc010ztx.1_Intron|DNMT3B_uc010zty.1_Intron|DNMT3B_uc002wyd.2_Intron|DNMT3B_uc002wye.2_Intron|DNMT3B_uc010gee.2_Intron|DNMT3B_uc010gef.2_Intron|DNMT3B_uc010ztz.1_Intron|DNMT3B_uc010zua.1_Intron	NM_006892	NP_008823			DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5																		---	---	---	---
C20orf70	140683	broad.mit.edu	37	20	31767238	31767238	+	Intron	DEL	A	-	-	rs77930653		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31767238delA	uc002wyo.1	+							NM_080574	NP_542141			chromosome 20 open reading frame 70 precursor							extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	31863203	31863212	+	IGR	DEL	GTGTGTGTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31863203_31863212delGTGTGTGTGT								PLUNC (32089 upstream) : C20orf114 (7729 downstream)																																			---	---	---	---
CBFA2T2	9139	broad.mit.edu	37	20	32214183	32214184	+	Intron	DEL	TC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32214183_32214184delTC	uc002wzg.1	+						CBFA2T2_uc010zug.1_Intron|CBFA2T2_uc002wze.1_Intron|CBFA2T2_uc002wzf.1_Intron|CBFA2T2_uc002wzh.1_Intron|CBFA2T2_uc002wzi.1_Intron|CBFA2T2_uc002wzj.1_Intron	NM_005093	NP_005084			core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2																		---	---	---	---
RALY	22913	broad.mit.edu	37	20	32632134	32632134	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32632134delT	uc002xab.2	+						RALY_uc010zui.1_Intron|RALY_uc002xac.2_Intron|RALY_uc002xad.2_Intron|RALY_uc002xae.1_Intron	NM_016732	NP_057951			RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33010378	33010378	+	Intron	DEL	T	-	-	rs11479074		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33010378delT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
MMP24	10893	broad.mit.edu	37	20	33833612	33833613	+	Intron	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33833612_33833613delAA	uc002xbu.2	+						EDEM2_uc010zuv.1_Intron	NM_006690	NP_006681			matrix metalloproteinase 24 preproprotein						proteolysis	integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00252)															---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34374911	34374911	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34374911delT	uc002xek.1	+						PHF20_uc002xei.1_Intron|PHF20_uc010gfo.1_Intron|PHF20_uc002xej.1_Intron|PHF20_uc002xeh.2_Intron	NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	35163808	35163809	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35163808_35163809insA	uc002xfk.3	-											Homo sapiens, clone IMAGE:5165100, mRNA.																														---	---	---	---
C20orf118	140711	broad.mit.edu	37	20	35518312	35518313	+	Intron	INS	-	TG	TG	rs145364344	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35518312_35518313insTG	uc002xgg.1	+							NM_080628	NP_542195			hypothetical protein LOC140711												0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36270728	36270743	+	IGR	DEL	ATGCATCCCTTCATTT	-	-	rs3057735		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36270728_36270743delATGCATCCCTTCATTT								BLCAP (114425 upstream) : CTNNBL1 (51691 downstream)																																			---	---	---	---
VSTM2L	128434	broad.mit.edu	37	20	36550240	36550241	+	Intron	INS	-	TTTT	TTTT	rs72056490		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36550240_36550241insTTTT	uc002xhk.3	+							NM_080607	NP_542174			V-set and transmembrane domain containing 2 like											ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36749600	36749601	+	IGR	INS	-	AAA	AAA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36749600_36749601insAAA								RPRD1B (28836 upstream) : TGM2 (7265 downstream)																																			---	---	---	---
BPI	671	broad.mit.edu	37	20	36944238	36944238	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36944238delT	uc002xib.2	+							NM_001725	NP_001716			bactericidal/permeability-increasing protein						defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	37295980	37295981	+	IGR	INS	-	A	A	rs3064387		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37295980_37295981insA								ADIG (78876 upstream) : SLC32A1 (57124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37337965	37337966	+	IGR	INS	-	AAC	AAC	rs139039505	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37337965_37337966insAAC								ADIG (120861 upstream) : SLC32A1 (15139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39066346	39066346	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39066346delA								None (None upstream) : MAFB (248173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39641100	39641103	+	Intron	DEL	CACA	-	-	rs66805472		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39641100_39641103delCACA	uc002xjj.2	+						uc002xjk.2_Intron					Homo sapiens cDNA FLJ10978 fis, clone PLACE1001484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	40279910	40279910	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40279910delG								CHD6 (32777 upstream) : PTPRT (421483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	40395459	40395460	+	IGR	INS	-	AATAAT	AATAAT	rs140527823	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40395459_40395460insAATAAT								CHD6 (148326 upstream) : PTPRT (305933 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	40947903	40947903	+	Intron	DEL	T	-	-	rs71752567		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40947903delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	41899549	41899550	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41899549_41899550insA								PTPRT (80992 upstream) : SFRS6 (186954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42070461	42070462	+	IGR	INS	-	T	T	rs141221652	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42070461_42070462insT								PTPRT (251904 upstream) : SFRS6 (16042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42120052	42120053	+	IGR	INS	-	T	T	rs75409304		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42120052_42120053insT								SFRS6 (27810 upstream) : L3MBTL (16297 downstream)																																			---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42134595	42134595	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42134595delT	uc010zwh.1	+							NM_015478	NP_056293			l(3)mbt-like isoform I						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
IFT52	51098	broad.mit.edu	37	20	42243172	42243172	+	Intron	DEL	T	-	-	rs111989807		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42243172delT	uc002xkw.2	+						IFT52_uc010zwi.1_Intron|IFT52_uc002xky.2_Intron|IFT52_uc002xkx.2_Intron|IFT52_uc010ggn.2_Intron|IFT52_uc002xkz.2_Intron	NM_016004	NP_057088			intraflagellar transport 52 homolog							intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	42533142	42533152	+	IGR	DEL	TAACGTGCAAG	-	-	rs71337835		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42533142_42533152delTAACGTGCAAG								GTSF1L (177500 upstream) : TOX2 (10340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42538103	42538104	+	IGR	DEL	TA	-	-	rs11473896		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42538103_42538104delTA								GTSF1L (182461 upstream) : TOX2 (5388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42859009	42859009	+	IGR	DEL	A	-	-	rs77785005		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42859009delA								C20orf111 (19578 upstream) : GDAP1L1 (16899 downstream)																																			---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	42986493	42986496	+	Intron	DEL	ACAA	-	-	rs149218987		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42986493_42986496delACAA	uc002xlv.2	+						HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron	NM_175914	NP_787110			hepatocyte nuclear factor 4 alpha isoform d						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	43500456	43500457	+	IGR	INS	-	CG	CG	rs7509173		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43500456_43500457insCG								RIMS4 (61544 upstream) : YWHAB (13887 downstream)																																			---	---	---	---
SYS1-DBNDD2	767557	broad.mit.edu	37	20	44012301	44012302	+	Intron	INS	-	TT	TT			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44012301_44012302insTT	uc002xnx.2	+							NM_001048225	NP_001041690			SCF apoptosis response protein 1 isoform a												0																		---	---	---	---
WFDC9	259240	broad.mit.edu	37	20	44258875	44258877	+	Intron	DEL	TTG	-	-	rs75601807		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44258875_44258877delTTG	uc002xoy.2	-						WFDC10A_uc002xoz.2_Intron	NM_147198	NP_671731			protease inhibitor WAP9 precursor							extracellular region					0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	44360155	44360156	+	IGR	INS	-	T	T	rs139835857	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44360155_44360156insT								SPINT4 (5820 upstream) : WFDC3 (42691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	44624610	44624621	+	IGR	DEL	CTTTCTTTCTTT	-	-	rs77880402		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44624610_44624621delCTTTCTTTCTTT								ZNF335 (23777 upstream) : MMP9 (12926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	44764050	44764051	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44764050_44764051insT								CD40 (5666 upstream) : CDH22 (38325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	45457619	45457620	+	IGR	INS	-	GAAA	GAAA	rs139526672	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45457619_45457620insGAAA								SLC2A10 (92636 upstream) : EYA2 (65643 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45527034	45527035	+	Intron	DEL	AC	-	-	rs151121446		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45527034_45527035delAC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45539871	45539872	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45539871_45539872delTG	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45694971	45694971	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45694971delA	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	45832527	45832528	+	IGR	INS	-	T	T	rs35719121		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45832527_45832528insT								EYA2 (15037 upstream) : ZMYND8 (5853 downstream)																																			---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46136354	46136355	+	Intron	INS	-	TTG	TTG	rs141339561	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46136354_46136355insTTG	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045			nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
SULF2	55959	broad.mit.edu	37	20	46338499	46338500	+	Intron	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46338499_46338500delTG	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010ghv.1_Intron	NM_018837	NP_061325			sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	46465595	46465595	+	IGR	DEL	T	-	-	rs74178780		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46465595delT								SULF2 (50235 upstream) : LOC284749 (523059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46907292	46907294	+	IGR	DEL	CAA	-	-	rs142360415	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46907292_46907294delCAA								SULF2 (491932 upstream) : LOC284749 (81360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46981904	46981914	+	IGR	DEL	ATGAGCTCTAA	-	-	rs147631051		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46981904_46981914delATGAGCTCTAA								SULF2 (566544 upstream) : LOC284749 (6740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47030998	47030999	+	IGR	INS	-	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47030998_47030999insG								LOC284749 (31617 upstream) : PREX1 (209794 downstream)																																			---	---	---	---
STAU1	6780	broad.mit.edu	37	20	47731847	47731847	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47731847delT	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347			staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48234951	48234952	+	IGR	INS	-	TT	TT	rs33949967		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48234951_48234952insTT								PTGIS (50244 upstream) : B4GALT5 (14533 downstream)																																			---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48704638	48704638	+	Intron	DEL	A	-	-	rs11302479		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48704638delA	uc002xvf.2	-						UBE2V1_uc002xvb.2_Intron|UBE2V1_uc002xva.2_Intron|UBE2V1_uc002xvc.2_Intron|UBE2V1_uc002xvd.2_Intron|UBE2V1_uc002xve.2_Intron	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48779258	48779259	+	IGR	DEL	AC	-	-	rs148288078		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48779258_48779259delAC								TMEM189-UBE2V1 (8923 upstream) : CEBPB (28117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48798714	48798714	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48798714delT								TMEM189-UBE2V1 (28379 upstream) : CEBPB (8662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49069903	49069904	+	IGR	INS	-	CA	CA	rs139250206	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49069903_49069904insCA								CEBPB (260691 upstream) : PTPN1 (56987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49102586	49102587	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49102586_49102587insT								CEBPB (293374 upstream) : PTPN1 (24304 downstream)																																			---	---	---	---
FAM65C	140876	broad.mit.edu	37	20	49297785	49297785	+	Intron	DEL	G	-	-	rs74175516		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49297785delG	uc010zyt.1	-						FAM65C_uc010zyu.1_Intron	NM_080829	NP_543019			hypothetical protein LOC140876											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	49312967	49312967	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49312967delA								FAM65C (5051 upstream) : PARD6B (35114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49324291	49324295	+	IGR	DEL	GATAA	-	-	rs142372150		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49324291_49324295delGATAA								FAM65C (16375 upstream) : PARD6B (23786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49402307	49402307	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49402307delC								PARD6B (32030 upstream) : BCAS4 (9160 downstream)																																			---	---	---	---
ADNP	23394	broad.mit.edu	37	20	49536681	49536682	+	Intron	DEL	GT	-	-	rs72017800		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49536681_49536682delGT	uc002xvt.1	-						ADNP_uc002xvu.1_Intron	NM_015339	NP_056154			activity-dependent neuroprotector							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	49582901	49582901	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49582901delT								MOCS3 (5081 upstream) : KCNG1 (37293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49770139	49770140	+	IGR	DEL	TG	-	-	rs72324077		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49770139_49770140delTG								KCNG1 (130464 upstream) : NFATC2 (237626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49886716	49886717	+	IGR	DEL	TG	-	-	rs11468209		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49886716_49886717delTG								KCNG1 (247041 upstream) : NFATC2 (121049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49932585	49932585	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49932585delA								KCNG1 (292910 upstream) : NFATC2 (75181 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50043015	50043015	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50043015delA	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50326841	50326842	+	Intron	INS	-	A	A	rs151235908	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50326841_50326842insA	uc002xwg.1	-						ATP9A_uc010gih.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50572596	50572597	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50572596_50572597insT								SALL4 (153548 upstream) : ZFP64 (127954 downstream)																																			---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50734502	50734502	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50734502delT	uc002xwk.2	-							NM_199427	NP_955459			zinc finger protein 64 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50991114	50991114	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50991114delT								ZFP64 (182590 upstream) : TSHZ2 (597763 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51922515	51922515	+	Intron	DEL	A	-	-	rs72135385		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51922515delA	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52178785	52178786	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52178785_52178786insA								TSHZ2 (74820 upstream) : ZNF217 (4826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52531830	52531831	+	IGR	INS	-	AG	AG	rs146966906	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52531830_52531831insAG								SUMO1P1 (39582 upstream) : BCAS1 (28248 downstream)																																			---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52624259	52624260	+	Intron	INS	-	T	T	rs143712456	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52624259_52624260insT	uc002xws.2	-						BCAS1_uc010zzb.1_Intron|BCAS1_uc010gim.2_Intron|BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52766960	52766960	+	IGR	DEL	C	-	-	rs11477913		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52766960delC								BCAS1 (79656 upstream) : CYP24A1 (3028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53047078	53047079	+	IGR	DEL	AA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53047078_53047079delAA								PFDN4 (210587 upstream) : DOK5 (45178 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53203971	53203973	+	Intron	DEL	AAC	-	-	rs140509081		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53203971_53203973delAAC	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53904881	53904882	+	IGR	INS	-	T	T	rs111553793		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53904881_53904882insT								DOK5 (637172 upstream) : CBLN4 (667615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54086204	54086206	+	IGR	DEL	ATT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54086204_54086206delATT								DOK5 (818495 upstream) : CBLN4 (486291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54314218	54314223	+	IGR	DEL	CACACC	-	-	rs71198329		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54314218_54314223delCACACC								None (None upstream) : CBLN4 (258274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54406679	54406679	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54406679delA								None (None upstream) : CBLN4 (165818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55235604	55235605	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55235604_55235605insT								TFAP2C (21268 upstream) : BMP7 (508204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55490916	55490917	+	IGR	DEL	TG	-	-	rs11468254		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55490916_55490917delTG								TFAP2C (276580 upstream) : BMP7 (252892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55733388	55733389	+	IGR	DEL	CA	-	-	rs74940860		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55733388_55733389delCA								TFAP2C (519052 upstream) : BMP7 (10420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56327348	56327348	+	IGR	DEL	T	-	-	rs138994757		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56327348delT								PMEPA1 (40807 upstream) : C20orf85 (398635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56342498	56342499	+	IGR	DEL	AC	-	-	rs111716844		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56342498_56342499delAC								PMEPA1 (55957 upstream) : C20orf85 (383484 downstream)																																			---	---	---	---
RAB22A	57403	broad.mit.edu	37	20	56897922	56897923	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56897922_56897923insT	uc002xyz.2	+							NM_020673	NP_065724			RAS-related protein RAB-22A						endocytosis|endosome organization|protein transport|small GTPase mediated signal transduction	early endosome|endosome membrane|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_epithelial(3;5.09e-14)|Lung NSC(12;0.000122)|all_lung(29;0.00042)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;4.73e-08)|all cancers(14;4.83e-07)															---	---	---	---
VAPB	9217	broad.mit.edu	37	20	56969631	56969631	+	Intron	DEL	C	-	-	rs11478373		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56969631delC	uc002xza.2	+						VAPB_uc002xzb.2_Intron|VAPB_uc010zzo.1_Intron|VAPB_uc002xzc.2_Intron	NM_004738	NP_004729			VAMP-associated protein B/C						cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity			kidney(1)	1	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)															---	---	---	---
VAPB	9217	broad.mit.edu	37	20	57010342	57010343	+	Intron	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57010342_57010343insA	uc002xza.2	+						VAPB_uc002xzb.2_Intron|VAPB_uc010zzo.1_Intron|VAPB_uc002xzc.2_Intron	NM_004738	NP_004729			VAMP-associated protein B/C						cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity			kidney(1)	1	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57654187	57654187	+	IGR	DEL	T	-	-	rs68024969		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57654187delT								SLMO2 (36286 upstream) : ZNF831 (111888 downstream)																																			---	---	---	---
EDN3	1908	broad.mit.edu	37	20	57899654	57899654	+	Intron	DEL	C	-	-	rs111992101		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57899654delC	uc002yap.2	+						EDN3_uc002yaq.2_3'UTR|EDN3_uc002yar.2_3'UTR|EDN3_uc002yas.2_3'UTR	NM_000114	NP_000105			endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	57999346	57999346	+	IGR	DEL	A	-	-	rs116370576	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57999346delA								EDN3 (98300 upstream) : PHACTR3 (153218 downstream)																																			---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58500031	58500032	+	Intron	INS	-	ACCA	ACCA	rs139687078	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58500031_58500032insACCA	uc002yaz.2	-							NM_014258	NP_055073			synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	58831370	58831371	+	Intron	INS	-	ATG	ATG	rs147927372	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58831370_58831371insATG	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59108884	59108885	+	Intron	DEL	TG	-	-	rs141461875		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59108884_59108885delTG	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59241614	59241615	+	IGR	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59241614_59241615delGA								MIR646 (357989 upstream) : CDH4 (585944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59394437	59394438	+	IGR	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59394437_59394438delAC								MIR646 (510812 upstream) : CDH4 (433121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59456916	59456917	+	IGR	INS	-	T	T	rs141879864		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59456916_59456917insT								MIR646 (573291 upstream) : CDH4 (370642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59690488	59690488	+	IGR	DEL	T	-	-	rs71956838		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59690488delT								MIR646 (806863 upstream) : CDH4 (137071 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59896518	59896519	+	Intron	INS	-	C	C	rs74221022	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59896518_59896519insC	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60608794	60608794	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60608794delA	uc002ybs.2	-							NM_003185	NP_003176			TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61169335	61169336	+	IGR	INS	-	T	T	rs71323591	byFrequency	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61169335_61169336insT								C20orf166 (1365 upstream) : SLCO4A1 (104461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	61171601	61171604	+	IGR	DEL	AGAC	-	-	rs144585627		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61171601_61171604delAGAC								C20orf166 (3631 upstream) : SLCO4A1 (102193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9846841	9846842	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9846841_9846842insT								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC100132288	100132288	broad.mit.edu	37	21	9917081	9917084	+	Intron	DEL	TGTG	-	-	rs71275186		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9917081_9917084delTGTG	uc002zka.1	-							NM_001033515	NP_001028687			hypothetical protein LOC100132288												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	10500653	10500653	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10500653delC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10745931	10745931	+	IGR	DEL	T	-	-	rs111734254		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10745931delT								None (None upstream) : TPTE (160812 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11071049	11071050	+	Intron	INS	-	G	G	rs112958643		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071049_11071050insG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11101772	11101772	+	5'Flank	DEL	G	-	-	rs112193718		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11101772delG	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11141441	11141443	+	IGR	DEL	TAT	-	-	rs141753912		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11141441_11141443delTAT								BAGE (42504 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14762873	14762874	+	IGR	INS	-	AA	AA	rs3975372		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14762873_14762874insAA								C21orf99 (272304 upstream) : POTED (219624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	15440471	15440471	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15440471delC	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																														---	---	---	---
CXADR	1525	broad.mit.edu	37	21	18944690	18944690	+	Intron	DEL	A	-	-	rs71333562		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18944690delA	uc002ykj.1	+							NM_001338	NP_001329			coxsackie virus and adenovirus receptor						blood coagulation|cell adhesion|interspecies interaction between organisms|leukocyte migration|regulation of immune response	adherens junction|basolateral plasma membrane|extracellular region|integral to plasma membrane|nucleus|tight junction	receptor activity			ovary(1)	1				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)														---	---	---	---
CHODL	140578	broad.mit.edu	37	21	19272722	19272722	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19272722delT	uc002ykr.2	+							NM_024944	NP_079220			chondrolectin precursor						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20063498	20063499	+	Intron	INS	-	TGTT	TGTT	rs143454120	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20063498_20063499insTGTT	uc010glf.1	-						uc002ykx.2_Intron					Homo sapiens, clone IMAGE:5392784, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	20305179	20305180	+	IGR	INS	-	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20305179_20305180insA								TMPRSS15 (529209 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	20639816	20639817	+	IGR	DEL	TG	-	-	rs71318180		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20639816_20639817delTG								TMPRSS15 (863846 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	20938496	20938497	+	IGR	INS	-	A	A	rs140414778	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20938496_20938497insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21661677	21661678	+	IGR	INS	-	GATAC	GATAC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21661677_21661678insGATAC								None (None upstream) : C21orf131 (453236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	22065010	22065010	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22065010delT								None (None upstream) : C21orf131 (49904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23110563	23110564	+	IGR	DEL	AG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23110563_23110564delAG								NCAM2 (199349 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	23183962	23183963	+	IGR	INS	-	T	T	rs139884453	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23183962_23183963insT								NCAM2 (272748 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24720407	24720408	+	IGR	INS	-	GT	GT	rs149272870	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24720407_24720408insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25302989	25303067	+	IGR	DEL	AGGGAGGAAGGAAAAGGAAAGAGGGAAAAAGGGAAATGAAGGAGTGAAGGAAGAAAGGGCAGAAGAAAGGATAGAAGAG	-	-	rs71182215		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25302989_25303067delAGGGAGGAAGGAAAAGGAAAGAGGGAAAAAGGGAAATGAAGGAGTGAAGGAAGAAAGGGCAGAAGAAAGGATAGAAGAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25630292	25630293	+	IGR	DEL	GT	-	-	rs71903068		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25630292_25630293delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	27188893	27188893	+	IGR	DEL	T	-	-	rs143733862		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27188893delT								GABPA (44123 upstream) : APP (63969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	27838501	27838501	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27838501delA								APP (295055 upstream) : CYYR1 (28 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29760355	29760356	+	IGR	INS	-	TA	TA			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29760355_29760356insTA								C21orf94 (364827 upstream) : NCRNA00161 (151284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	30804187	30804187	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30804187delT								BACH1 (69970 upstream) : GRIK1 (105069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	31690520	31690520	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31690520delC								KRTAP25-1 (28688 upstream) : KRTAP26-1 (932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33164674	33164675	+	IGR	DEL	TG	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33164674_33164675delTG								SFRS15 (60243 upstream) : HUNK (80953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	34263587	34263587	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34263587delA								C21orf62 (77534 upstream) : OLIG2 (134652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	34337429	34337430	+	IGR	DEL	AC	-	-	rs67637880		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34337429_34337430delAC								C21orf62 (151376 upstream) : OLIG2 (60809 downstream)																																			---	---	---	---
IFNAR2	3455	broad.mit.edu	37	21	34605238	34605238	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34605238delA	uc002yrd.2	+						IFNAR2_uc002yrb.2_Intron|IFNAR2_uc002yrc.2_Intron|IFNAR2_uc002yre.2_Intron|IFNAR2_uc002yrf.2_Intron	NM_207585	NP_997468			interferon alpha/beta receptor 2 isoform a						JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to interferon-alpha|response to virus|type I interferon-mediated signaling pathway	extracellular region|extracellular space|integral to plasma membrane	protein kinase binding|type I interferon binding|type I interferon receptor activity				0					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)													---	---	---	---
TMEM50B	757	broad.mit.edu	37	21	34819647	34819648	+	Intron	INS	-	AGTCCTAGCTACTC	AGTCCTAGCTACTC	rs141906778	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34819647_34819648insAGTCCTAGCTACTC	uc002yrs.1	-							NM_006134				transmembrane protein 50B							endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2																		---	---	---	---
ERG	2078	broad.mit.edu	37	21	40023684	40023685	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40023684_40023685insC	uc010gnw.2	-						ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627			ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	40471199	40471199	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40471199delA								ETS2 (274323 upstream) : PSMG1 (76191 downstream)																																			---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40882326	40882327	+	Intron	DEL	AC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40882326_40882327delAC	uc002yya.2	+						SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367			SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	41337503	41337504	+	IGR	INS	-	CA	CA	rs141231717	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41337503_41337504insCA								PCP4 (36183 upstream) : DSCAM (46839 downstream)																																			---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41929467	41929479	+	Intron	DEL	GAGACCAAGATGG	-	-	rs58276228		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41929467_41929479delGAGACCAAGATGG	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42083797	42083797	+	Intron	DEL	A	-	-	rs36040261		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42083797delA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	42375601	42375601	+	IGR	DEL	G	-	-	rs77313761		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42375601delG								DSCAM (156562 upstream) : C21orf130 (137826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	42507064	42507065	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42507064_42507065insT								DSCAM (288025 upstream) : C21orf130 (6362 downstream)																																			---	---	---	---
UBASH3A	53347	broad.mit.edu	37	21	43856092	43856097	+	Intron	DEL	TAGTTA	-	-	rs11278015		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43856092_43856097delTAGTTA	uc002zbe.2	+						UBASH3A_uc002zbf.2_Intron|UBASH3A_uc010gpc.2_Intron|UBASH3A_uc010gpd.2_Intron|UBASH3A_uc010gpe.2_Intron	NM_018961	NP_061834			ubiquitin associated and SH3 domain containing,							cytosol|nucleus				ovary(3)	3																		---	---	---	---
UBASH3A	53347	broad.mit.edu	37	21	43859818	43859818	+	Intron	DEL	C	-	-	rs35849649		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43859818delC	uc002zbe.2	+						UBASH3A_uc002zbf.2_Intron|UBASH3A_uc010gpc.2_Intron|UBASH3A_uc010gpd.2_Intron|UBASH3A_uc010gpe.2_Intron	NM_018961	NP_061834			ubiquitin associated and SH3 domain containing,							cytosol|nucleus				ovary(3)	3																		---	---	---	---
RSPH1	89765	broad.mit.edu	37	21	43914815	43914815	+	Intron	DEL	T	-	-	rs113496002		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43914815delT	uc002zbg.2	-						SLC37A1_uc002zbh.1_5'Flank	NM_080860	NP_543136			testis-specific gene A2						meiosis	cytosol|nucleus				ovary(1)	1																		---	---	---	---
WDR4	10785	broad.mit.edu	37	21	44287502	44287502	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44287502delC	uc002zci.2	-						WDR4_uc002zck.1_Intron|WDR4_uc002zcl.1_Intron|WDR4_uc010gpg.1_Intron|WDR4_uc011aew.1_Intron|WDR4_uc010gph.1_Intron	NM_033661	NP_387510			WD repeat domain 4 protein						tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	44373508	44373509	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44373508_44373509delGT								NDUFV3 (43736 upstream) : PKNOX1 (21134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	45248835	45248836	+	IGR	DEL	CC	-	-	rs112341431		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45248835_45248836delCC								LOC284837 (16387 upstream) : AGPAT3 (36280 downstream)																																			---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45684929	45684929	+	5'Flank	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45684929delT	uc002zeg.1	-						DNMT3L_uc002zeh.1_5'Flank	NM_175867	NP_787063			cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	46449152	46449152	+	IGR	DEL	A	-	-	rs142874427		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46449152delA								NCRNA00162 (24510 upstream) : C21orf122 (41721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	47478996	47479003	+	IGR	DEL	CACAGGTC	-	-	rs111797497		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47478996_47479003delCACAGGTC								COL6A1 (54033 upstream) : COL6A2 (39030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16872713	16872714	+	IGR	INS	-	A	A	rs146779655	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16872713_16872714insA								OR11H1 (422909 upstream) : CCT8L2 (198934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17223854	17223855	+	IGR	INS	-	T	T	rs146294570	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17223854_17223855insT								psiTPTE22 (44333 upstream) : XKR3 (40458 downstream)																																			---	---	---	---
CECR1	51816	broad.mit.edu	37	22	17673720	17673720	+	Intron	DEL	A	-	-	rs35262317		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17673720delA	uc002zmk.1	-						CECR1_uc010gqu.1_Intron|CECR1_uc011agi.1_Intron|CECR1_uc011agj.1_Intron|CECR1_uc002zmj.1_Intron	NM_017424	NP_059120			cat eye syndrome critical region protein 1						adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	19145008	19145008	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19145008delA								GSC2 (7212 upstream) : SLC25A1 (18087 downstream)																																			---	---	---	---
COMT	1312	broad.mit.edu	37	22	19941741	19941742	+	Intron	INS	-	A	A	rs361699		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19941741_19941742insA	uc002zqu.2	+						COMT_uc002zqt.2_Intron|COMT_uc002zqv.2_Intron|COMT_uc002zqw.2_Intron|COMT_uc011ahd.1_Intron|COMT_uc002zqx.2_Intron	NM_000754	NP_000745			catechol-O-methyltransferase isoform MB-COMT						neurotransmitter biosynthetic process|neurotransmitter catabolic process|xenobiotic metabolic process	cytosol|integral to membrane|intracellular membrane-bounded organelle|microsome|plasma membrane|soluble fraction	catechol O-methyltransferase activity|magnesium ion binding|protein binding			ovary(1)	1	Colorectal(54;0.0993)				Carbidopa(DB00190)|Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Folic Acid(DB00158)|L-Valine(DB00161)|Levodopa(DB01235)|Methyldopa(DB00968)|Modafinil(DB00745)|Morphine(DB00295)|S-Adenosylmethionine(DB00118)|Tolcapone(DB00323)											OREG0026303	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	22	20149873	20149875	+	IGR	DEL	ACC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20149873_20149875delACC								ZDHHC8 (14344 upstream) : LOC150197 (43980 downstream)																																			---	---	---	---
SNAP29	9342	broad.mit.edu	37	22	21242638	21242645	+	3'UTR	DEL	CACACACT	-	-	rs361998	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21242638_21242645delCACACACT	uc011ahw.1	+	5						NM_004782	NP_004773			synaptosomal-associated protein 29						cellular membrane fusion|exocytosis|protein transport|vesicle targeting	cell junction|cytoplasm|nucleus|synapse|synaptosome	SNAP receptor activity				0	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)															---	---	---	---
PPIL2	23759	broad.mit.edu	37	22	22031976	22031981	+	Intron	DEL	GGGAGC	-	-	rs10604344		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22031976_22031981delGGGAGC	uc010gtj.1	+						PPIL2_uc002zvh.3_Intron|PPIL2_uc002zvi.3_Intron|PPIL2_uc002zvg.3_Intron|PPIL2_uc011aij.1_Intron	NM_148175	NP_680480			peptidylprolyl isomerase-like 2 isoform a						blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity			ovary(2)	2	Colorectal(54;0.105)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	23806571	23806573	+	Intron	DEL	ACC	-	-	rs149834310		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23806571_23806573delACC	uc010gtz.1	-											Homo sapiens hypothetical LOC388882, mRNA (cDNA clone MGC:46300 IMAGE:5164270), complete cds.																														---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24489373	24489373	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24489373delG	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron	NM_012295	NP_036427			calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
C22orf13	83606	broad.mit.edu	37	22	24948738	24948738	+	Intron	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24948738delA	uc003aah.2	-						C22orf13_uc003aal.2_Intron|C22orf13_uc003aai.3_Intron|C22orf13_uc003aaj.3_Intron|C22orf13_uc003aak.3_Intron|SNRPD3_uc003aam.1_5'Flank|SNRPD3_uc011aju.1_5'Flank	NM_031444	NP_113632			chromosome 22 open reading frame 13												0																		---	---	---	---
KIAA1671	85379	broad.mit.edu	37	22	25532213	25532214	+	Intron	DEL	CT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25532213_25532214delCT	uc003abn.2	+						KIAA1671_uc003abl.2_Intron	NM_001145206	NP_001138678			hypothetical protein LOC85379											lung(1)	1																		---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26313512	26313513	+	Intron	INS	-	GTGTGT	GTGTGT	rs142419492	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26313512_26313513insGTGTGT	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997			myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27394100	27394112	+	IGR	DEL	AAACAAACAAACT	-	-	rs71817363		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27394100_27394112delAAACAAACAAACT								MIAT (279151 upstream) : MN1 (750154 downstream)																																			---	---	---	---
SFI1	9814	broad.mit.edu	37	22	31894635	31894636	+	Intron	INS	-	A	A	rs144678407		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31894635_31894636insA	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron	NM_001007467	NP_001007468			spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1																		---	---	---	---
LARGE	9215	broad.mit.edu	37	22	34303557	34303558	+	Intron	INS	-	T	T	rs34936785		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34303557_34303558insT	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
RBM9	23543	broad.mit.edu	37	22	36325863	36325863	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36325863delC	uc003aon.3	-						RBM9_uc010gwu.2_Intron|RBM9_uc003aoo.3_Intron	NM_001082578	NP_001076047			RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0																		---	---	---	---
RBM9	23543	broad.mit.edu	37	22	36422589	36422590	+	Intron	INS	-	AC	AC	rs138314887		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36422589_36422590insAC	uc003aon.3	-						RBM9_uc003aoo.3_Intron	NM_001082578	NP_001076047			RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0																		---	---	---	---
EIF3D	8664	broad.mit.edu	37	22	36922660	36922661	+	Intron	INS	-	T	T	rs67729807		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36922660_36922661insT	uc003apq.2	-						EIF3D_uc003apr.2_Intron|EIF3D_uc011ams.1_Intron|EIF3D_uc011amt.1_Intron	NM_003753	NP_003744			eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1																		---	---	---	---
CACNG2	10369	broad.mit.edu	37	22	37003199	37003199	+	Intron	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37003199delC	uc003aps.1	-							NM_006078	NP_006069			voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0																		---	---	---	---
RAC2	5880	broad.mit.edu	37	22	37623648	37623649	+	Intron	INS	-	A	A	rs141637447	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37623648_37623649insA	uc003arc.2	-							NM_002872	NP_002863			ras-related C3 botulinum toxin substrate 2						axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding			breast(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
TRIOBP	11078	broad.mit.edu	37	22	38095555	38095555	+	Intron	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38095555delT	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atq.1_Intron|TRIOBP_uc003ats.1_Intron	NM_001039141	NP_001034230			TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
CSNK1E	1454	broad.mit.edu	37	22	38785472	38785473	+	Intron	INS	-	A	A	rs139055491		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38785472_38785473insA	uc003avm.1	-						LOC400927_uc010gxm.2_Intron|LOC400927_uc011ans.1_Intron|LOC400927_uc011ant.1_Intron|LOC400927_uc003avr.1_Intron	NM_152221	NP_689407			casein kinase 1 epsilon						DNA repair|G2/M transition of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|signal transduction	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Melanoma(58;0.045)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	39834059	39834059	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39834059delG								TAB1 (927 upstream) : MGAT3 (19266 downstream)																																			---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	40016243	40016254	+	Intron	DEL	TCCATCCATCCA	-	-	rs67971450		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40016243_40016254delTCCATCCATCCA	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40725436	40725437	+	3'UTR	INS	-	T	T	rs139164362	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40725436_40725437insT	uc011aor.1	+	23					TNRC6B_uc003aym.2_3'UTR|TNRC6B_uc003ayn.3_3'UTR	NM_001162501	NP_001155973			trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41294785	41294786	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41294785_41294786delCA	uc003azh.2	+						XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_Intron	NM_022098	NP_071381			X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
MEI1	150365	broad.mit.edu	37	22	42158554	42158554	+	Intron	DEL	A	-	-	rs76661151	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42158554delA	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_Intron|MEI1_uc003bbb.1_Intron|MEI1_uc003bbc.1_Intron|MEI1_uc010gym.1_Intron|MEI1_uc003bbd.1_Intron	NM_152513	NP_689726			meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
SERHL	94009	broad.mit.edu	37	22	42917496	42917497	+	Intron	INS	-	T	T	rs148804476		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42917496_42917497insT	uc011apm.1	+						RRP7A_uc003bcq.2_5'Flank					RecName: Full=Serine hydrolase-like protein;          EC=3.1.-.-;												0																		---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43286011	43286011	+	Intron	DEL	T	-	-	rs67500400		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43286011delT	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45194410	45194410	+	Intron	DEL	T	-	-	rs66649969		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45194410delT	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	45666971	45666972	+	IGR	INS	-	G	G	rs74184691		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45666971_45666972insG								C22orf9 (30321 upstream) : UPK3A (13917 downstream)																																			---	---	---	---
SMC1B	27127	broad.mit.edu	37	22	45803347	45803348	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45803347_45803348insT	uc003bgc.2	-						SMC1B_uc003bgd.2_Intron|SMC1B_uc003bge.1_5'Flank	NM_148674	NP_683515			SMC1 structural maintenance of chromosomes						chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)														---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47172589	47172590	+	Intron	DEL	GA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47172589_47172590delGA	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47175213	47175213	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47175213delG	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	47634445	47634447	+	IGR	DEL	CTC	-	-	rs147275137		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47634445_47634447delCTC								TBC1D22A (64723 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	47778219	47778219	+	IGR	DEL	T	-	-	rs72100090		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47778219delT								TBC1D22A (208497 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49650349	49650350	+	IGR	INS	-	AC	AC	rs138886331	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49650349_49650350insAC								FAM19A5 (502607 upstream) : C22orf34 (157826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49780342	49780343	+	IGR	INS	-	TT	TT	rs72190680		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49780342_49780343insTT								FAM19A5 (632600 upstream) : C22orf34 (27833 downstream)																																			---	---	---	---
C22orf34	348645	broad.mit.edu	37	22	49974195	49974196	+	Intron	DEL	CA	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49974195_49974196delCA	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0																		---	---	---	---
TTLL8	164714	broad.mit.edu	37	22	50467204	50467205	+	Intron	INS	-	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50467204_50467205insC	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)														---	---	---	---
TUBGCP6	85378	broad.mit.edu	37	22	50676566	50676567	+	Intron	INS	-	AG	AG	rs146778199	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50676566_50676567insAG	uc003bkb.1	-						TUBGCP6_uc010har.1_Intron|TUBGCP6_uc010has.1_Intron	NM_020461	NP_065194			tubulin, gamma complex associated protein 6						G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)														---	---	---	---
MAPK11	5600	broad.mit.edu	37	22	50704398	50704399	+	Intron	INS	-	GT	GT	rs139636742	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50704398_50704399insGT	uc003bkr.2	-						MAPK11_uc010hax.2_Intron|MAPK11_uc011ars.1_Intron|MAPK11_uc010hay.1_Intron	NM_002751	NP_002742			mitogen-activated protein kinase 11						activation of MAPK activity|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			lung(1)|breast(1)	2		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
SAPS2	9701	broad.mit.edu	37	22	50818798	50818799	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50818798_50818799insT	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493			SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	384828	384828	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:384828delA								PPP2R3B (37201 upstream) : SHOX (200251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	465676	465676	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:465676delT								PPP2R3B (118049 upstream) : SHOX (119403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	811443	811443	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:811443delG								SHOX (191298 upstream) : CRLF2 (503444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	833170	833175	+	IGR	DEL	GTGTGC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:833170_833175delGTGTGC								SHOX (213025 upstream) : CRLF2 (481712 downstream)																																			---	---	---	---
CRLF2	64109	broad.mit.edu	37	X	1331699	1331700	+	5'Flank	INS	-	AC	AC			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1331699_1331700insAC	uc004cpm.1	-											Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)						Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	X	1880939	1880939	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1880939delT								ASMT (118966 upstream) : DHRSX (256618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2009650	2009650	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2009650delA								ASMT (247677 upstream) : DHRSX (127907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2558252	2558253	+	Intron	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2558252_2558253insT	uc004cqj.1	+											Homo sapiens cDNA FLJ13471 fis, clone PLACE1003566.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	26237169	26237169	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26237169delG								MAGEB6 (23407 upstream) : VENTXP1 (339285 downstream)																																			---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29809085	29809085	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29809085delG	uc004dby.2	+							NM_014271	NP_055086			interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
KDM6A	7403	broad.mit.edu	37	X	44958540	44958541	+	Intron	INS	-	T	T	rs11380643		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44958540_44958541insT	uc004dge.3	+						KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron|KDM6A_uc011mld.1_Intron	NM_021140	NP_066963			ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84								D|N|F|S		renal|oesophageal SCC|MM								---	---	---	---
Unknown	0	broad.mit.edu	37	X	50568323	50568324	+	IGR	DEL	GT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50568323_50568324delGT								SHROOM4 (11279 upstream) : LOC347376 (80108 downstream)																																			---	---	---	---
WNK3	65267	broad.mit.edu	37	X	54372236	54372236	+	Intron	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54372236delG	uc004dtd.1	-						WNK3_uc004dtc.1_Intron	NM_001002838	NP_001002838			WNK lysine deficient protein kinase 3 isoform 2						intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	58536135	58536135	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:58536135delT								ZXDA (599068 upstream) : None (None downstream)																																			---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	103870993	103870994	+	Intron	DEL	GC	-	-	rs1998300	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103870993_103870994delGC	uc004elz.1	+							NM_017416	NP_059112			interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	108554034	108554034	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108554034delA								IRS4 (574427 upstream) : GUCY2F (62102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	115872252	115872252	+	IGR	DEL	C	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115872252delC								CXorf61 (278115 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	116131700	116131703	+	IGR	DEL	ACCT	-	-	rs67084144		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116131700_116131703delACCT								CXorf61 (537563 upstream) : KLHL13 (900074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118475144	118475144	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118475144delT								PGRMC1 (96716 upstream) : SLC25A43 (57879 downstream)																																			---	---	---	---
C1GALT1C1	29071	broad.mit.edu	37	X	119761134	119761134	+	5'UTR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119761134delA	uc004esy.2	-	2					C1GALT1C1_uc004esz.2_Intron	NM_152692	NP_689905			C1GALT1-specific chaperone 1							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	123391251	123391251	+	IGR	DEL	T	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123391251delT								STAG2 (154748 upstream) : SH2D1A (88897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	136655320	136655320	+	IGR	DEL	C	-	-	rs73230547		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136655320delC								ZIC3 (1063 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	153680001	153680002	+	IGR	INS	-	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153680001_153680002insT								FAM50A (1000 upstream) : PLXNA3 (6621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9938908	9938908	+	IGR	DEL	C	-	-	rs112473917		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9938908delC								TTTY22 (288054 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9954147	9954147	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9954147delA								TTTY22 (303293 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13296498	13296499	+	IGR	DEL	AG	-	-	rs112881488		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13296498_13296499delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13410352	13410352	+	IGR	DEL	C	-	-	rs140676082		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13410352delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13424520	13424523	+	IGR	DEL	TTGT	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13424520_13424523delTTGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13473485	13473485	+	IGR	DEL	A	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13473485delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13717340	13717344	+	IGR	DEL	GGAAC	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13717340_13717344delGGAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	22509012	22509012	+	IGR	DEL	G	-	-			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:22509012delG								KDM5D (602187 upstream) : TTTY10 (118542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28807470	28807480	+	IGR	DEL	CAAATAGAATG	-	-	rs75191104		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28807470_28807480delCAAATAGAATG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59013018	59013018	+	IGR	DEL	G	-	-	rs77943856		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59013018delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59026962	59026962	+	IGR	DEL	C	-	-	rs34699366		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59026962delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59028268	59028268	+	IGR	DEL	A	-	-	rs111580006		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59028268delA								None (None upstream) : None (None downstream)																																			---	---	---	---
SPEN	23013	broad.mit.edu	37	1	16259202	16259202	+	Missense_Mutation	SNP	C	T	T	rs142682023		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16259202C>T	uc001axk.1	+	11	6671	c.6467C>T	c.(6466-6468)TCT>TTT	p.S2156F	SPEN_uc010obp.1_Missense_Mutation_p.S2115F	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2156	Interaction with MSX2 (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)														---	---	---	---
FBXO42	54455	broad.mit.edu	37	1	16577664	16577664	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577664G>T	uc001ayg.2	-	10	1871	c.1655C>A	c.(1654-1656)TCC>TAC	p.S552Y	FBXO42_uc001aye.3_Missense_Mutation_p.S270Y|FBXO42_uc001ayf.2_Missense_Mutation_p.S459Y	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	552										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)														---	---	---	---
NECAP2	55707	broad.mit.edu	37	1	16774401	16774401	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16774401C>T	uc001ayo.2	+	3	320	c.230C>T	c.(229-231)CCT>CTT	p.P77L	NECAP2_uc001ayp.3_RNA|NECAP2_uc010ocd.1_Missense_Mutation_p.P51L|NECAP2_uc001ayq.2_Missense_Mutation_p.P77L	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1	77					endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
KIF17	57576	broad.mit.edu	37	1	21031165	21031165	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21031165G>T	uc001bdr.3	-	5	1016	c.898C>A	c.(898-900)CTG>ATG	p.L300M	KIF17_uc001bds.3_Missense_Mutation_p.L300M	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	300					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)														---	---	---	---
MATN1	4146	broad.mit.edu	37	1	31189038	31189038	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31189038C>T	uc001brz.2	-	5	959	c.925G>A	c.(925-927)GAC>AAC	p.D309N	uc001bsb.1_5'Flank|MATN1_uc001bsa.1_Missense_Mutation_p.D227N	NM_002379	NP_002370	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein precursor	309	VWFA 2.				protein complex assembly	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			central_nervous_system(1)	1		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PTP4A2	8073	broad.mit.edu	37	1	32384577	32384577	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32384577G>C	uc001bty.1	-	2	1084	c.90C>G	c.(88-90)TTC>TTG	p.F30L	PTP4A2_uc010ogs.1_Missense_Mutation_p.F30L|PTP4A2_uc001btz.1_Missense_Mutation_p.F30L	NM_080391	NP_536316	Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2	30						early endosome|plasma membrane	prenylated protein tyrosine phosphatase activity|protein binding|protein tyrosine/serine/threonine phosphatase activity				0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)																---	---	---	---
TMEM39B	55116	broad.mit.edu	37	1	32542828	32542828	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32542828G>A	uc010ogv.1	+	5	645	c.499G>A	c.(499-501)GTT>ATT	p.V167I	TMEM39B_uc010ogt.1_Intron|TMEM39B_uc010ogu.1_Missense_Mutation_p.V40I|TMEM39B_uc001bue.3_Missense_Mutation_p.V167I|TMEM39B_uc001buf.3_Intron|TMEM39B_uc010ogw.1_Intron	NM_018056	NP_060526	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	167	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)																---	---	---	---
DLGAP3	58512	broad.mit.edu	37	1	35370299	35370299	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35370299T>A	uc001byc.2	-	1	686	c.686A>T	c.(685-687)CAC>CTC	p.H229L		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	229	Poly-His.				cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)																---	---	---	---
NDUFS5	4725	broad.mit.edu	37	1	39494551	39494551	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39494551C>A	uc001ccx.2	+	2	226	c.155C>A	c.(154-156)GCA>GAA	p.A52E	NDUFS5_uc001ccy.2_Missense_Mutation_p.A52E	NM_004552	NP_004543	O43920	NDUS5_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 5,	52					mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.93e-18)		NADH(DB00157)													---	---	---	---
TSPAN1	10103	broad.mit.edu	37	1	46650072	46650072	+	Intron	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46650072G>C	uc001cpd.2	+						TSPAN1_uc009vyd.1_Intron	NM_005727	NP_005718			tetraspan 1							integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)																---	---	---	---
PCSK9	255738	broad.mit.edu	37	1	55518046	55518046	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55518046A>T	uc001cyf.1	+	4	910	c.619A>T	c.(619-621)AAT>TAT	p.N207Y	PCSK9_uc010ool.1_RNA|PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	207	Peptidase S8.				cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103345437	103345437	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103345437A>T	uc001dul.2	-	66	5394	c.5076T>A	c.(5074-5076)AAT>AAA	p.N1692K	COL11A1_uc001duk.2_Missense_Mutation_p.N888K|COL11A1_uc001dum.2_Missense_Mutation_p.N1704K|COL11A1_uc001dun.2_Missense_Mutation_p.N1653K|COL11A1_uc009weh.2_Missense_Mutation_p.N1576K	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1692	Fibrillar collagen NC1.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120497790	120497790	+	Missense_Mutation	SNP	T	C	C	rs145027507		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120497790T>C	uc001eik.2	-	13	2348	c.2092A>G	c.(2092-2094)ATC>GTC	p.I698V	NOTCH2_uc001eil.2_Missense_Mutation_p.I698V|NOTCH2_uc001eim.3_Missense_Mutation_p.I615V	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	698	EGF-like 18; calcium-binding (Potential).|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150933636	150933636	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150933636A>G	uc001evu.2	+	16	3288	c.3098A>G	c.(3097-3099)GAT>GGT	p.D1033G	SETDB1_uc001evv.2_Missense_Mutation_p.D1033G|SETDB1_uc009wmg.1_Missense_Mutation_p.D1033G	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1033	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152279828	152279828	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152279828T>G	uc001ezu.1	-	3	7570	c.7534A>C	c.(7534-7536)AGT>CGT	p.S2512R		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2512	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
IVL	3713	broad.mit.edu	37	1	152882720	152882720	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152882720A>G	uc001fau.2	+	2	493	c.447A>G	c.(445-447)AAA>AAG	p.K149K		NM_005547	NP_005538	P07476	INVO_HUMAN	involucrin	149					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine|keratinization|response to UV-B	cornified envelope|cytoplasm	protein binding, bridging|structural molecule activity			ovary(3)	3	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
CADM3	57863	broad.mit.edu	37	1	159163699	159163699	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159163699C>T	uc001ftl.2	+	5	702	c.560C>T	c.(559-561)ACC>ATC	p.T187I	CADM3_uc009wsy.1_Intron|CADM3_uc001ftk.2_Missense_Mutation_p.T221I	NM_001127173	NP_001120645	Q8N126	CADM3_HUMAN	cell adhesion molecule 3 isoform 2	187	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
APCS	325	broad.mit.edu	37	1	159557888	159557888	+	Intron	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159557888C>A	uc001ftv.2	+							NM_001639	NP_001630			serum amyloid P component precursor						acute-phase response|chaperone-mediated protein complex assembly|protein folding	extracellular space	metal ion binding|sugar binding|unfolded protein binding			ovary(1)|breast(1)	2	all_hematologic(112;0.0429)																	---	---	---	---
CD247	919	broad.mit.edu	37	1	167409918	167409918	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167409918A>G	uc001gei.3	-	2	290	c.145T>C	c.(145-147)TTG>CTG	p.L49L	CD247_uc001gej.3_Silent_p.L49L|CD247_uc001gek.2_Silent_p.L49L	NM_198053	NP_932170	P20963	CD3Z_HUMAN	T-cell receptor zeta chain isoform 1 precursor	49	Helical; (Potential).				interspecies interaction between organisms|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytoplasm|integral to membrane	protein homodimerization activity|transmembrane receptor activity				0			LUSC - Lung squamous cell carcinoma(543;0.236)															---	---	---	---
ASTN1	460	broad.mit.edu	37	1	176845669	176845669	+	Intron	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176845669T>C	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron	NM_004319	NP_004310			astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
PRG4	10216	broad.mit.edu	37	1	186276229	186276229	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276229A>G	uc001gru.3	+	7	1429	c.1378A>G	c.(1378-1380)ACA>GCA	p.T460A	PRG4_uc001grt.3_Missense_Mutation_p.T419A|PRG4_uc009wyl.2_Missense_Mutation_p.T367A|PRG4_uc009wym.2_Missense_Mutation_p.T326A|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	460	15.|59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
SRGAP2	23380	broad.mit.edu	37	1	206628355	206628355	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206628355T>A	uc001hdy.2	+	18	2564	c.2231T>A	c.(2230-2232)CTT>CAT	p.L744H	SRGAP2_uc001hdx.2_Missense_Mutation_p.L744H|SRGAP2_uc010pru.1_Missense_Mutation_p.L667H	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	831					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)																	---	---	---	---
EDARADD	128178	broad.mit.edu	37	1	236590702	236590702	+	Silent	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236590702T>C	uc001hxu.1	+	4	236	c.171T>C	c.(169-171)TGT>TGC	p.C57C	EDARADD_uc001hxv.1_Silent_p.C47C	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A	57					cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
OR11L1	391189	broad.mit.edu	37	1	248004351	248004351	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004351G>C	uc001idn.1	-	1	848	c.848C>G	c.(847-849)CCA>CGA	p.P283R		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)															---	---	---	---
KIF3C	3797	broad.mit.edu	37	2	26174743	26174743	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26174743C>A	uc002rgu.2	-	5	2578	c.1921G>T	c.(1921-1923)GAG>TAG	p.E641*	KIF3C_uc010eyj.1_RNA|KIF3C_uc010ykr.1_Nonsense_Mutation_p.E641*	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	641	Globular (Potential).				blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
FEZ2	9637	broad.mit.edu	37	2	36818094	36818094	+	Silent	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36818094C>T	uc002rph.2	-	2	374	c.327G>A	c.(325-327)TCG>TCA	p.S109S	FEZ2_uc002rpf.2_5'UTR|FEZ2_uc002rpg.2_Silent_p.S109S|FEZ2_uc002rpi.2_Intron|FEZ2_uc002rpj.2_Silent_p.S109S	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1	109					axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)																---	---	---	---
EN1	2019	broad.mit.edu	37	2	119600557	119600557	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119600557T>C	uc002tlm.2	-	2	2152	c.1136A>G	c.(1135-1137)AAC>AGC	p.N379S		NM_001426	NP_001417	Q05925	HME1_HUMAN	engrailed homeobox 1	379					skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|lung(1)	2																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141108445	141108445	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141108445C>T	uc002tvj.1	-	77	12785	c.11813G>A	c.(11812-11814)AGT>AAT	p.S3938N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3938	Extracellular (Potential).|LDL-receptor class B 33.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
PER2	8864	broad.mit.edu	37	2	239161909	239161909	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239161909T>C	uc002vyc.2	-	19	2992	c.2755A>G	c.(2755-2757)AAC>GAC	p.N919D	PER2_uc010znv.1_Missense_Mutation_p.N919D	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	919	Pro-rich.				circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1189719	1189719	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1189719T>G	uc003boz.2	+	2	294	c.27T>G	c.(25-27)ATT>ATG	p.I9M	CNTN6_uc010hbo.2_Translation_Start_Site|CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Missense_Mutation_p.I9M	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	9					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
MKRN2	23609	broad.mit.edu	37	3	12616331	12616331	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12616331T>G	uc003bxd.2	+	5	739	c.683T>G	c.(682-684)TTT>TGT	p.F228C	MKRN2_uc003bxe.2_Missense_Mutation_p.F226C|MKRN2_uc011aus.1_Missense_Mutation_p.F185C	NM_014160	NP_054879	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	228						intracellular	ligase activity|nucleic acid binding|zinc ion binding				0																		---	---	---	---
TMEM43	79188	broad.mit.edu	37	3	14172328	14172328	+	Missense_Mutation	SNP	G	A	A	rs151010429		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14172328G>A	uc003byk.2	+	3	423	c.169G>A	c.(169-171)GCA>ACA	p.A57T	TMEM43_uc003byl.1_5'UTR	NM_024334	NP_077310	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	57	Lumenal (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|nuclear inner membrane				ovary(1)	1																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16268973	16268973	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16268973G>A	uc003car.3	+	10	2361	c.1886G>A	c.(1885-1887)CGT>CAT	p.R629H	GALNTL2_uc003caq.3_Missense_Mutation_p.R362H|GALNTL2_uc003cas.3_Missense_Mutation_p.R159H	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	629	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19479762	19479762	+	Silent	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19479762G>A	uc003cbk.1	+	8	1479	c.1284G>A	c.(1282-1284)ACG>ACA	p.T428T	KCNH8_uc011awe.1_Silent_p.T428T|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_Silent_p.T59T	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	428						integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
STT3B	201595	broad.mit.edu	37	3	31677476	31677476	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31677476A>G	uc011axe.1	+	16	2401	c.2401A>G	c.(2401-2403)ACT>GCT	p.T801A		NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated	801					protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0																		---	---	---	---
NISCH	11188	broad.mit.edu	37	3	52507842	52507842	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52507842G>T	uc011beg.1	+	8	834	c.762G>T	c.(760-762)ATG>ATT	p.M254I	NISCH_uc003ded.3_Missense_Mutation_p.M254I|NISCH_uc003dec.1_Missense_Mutation_p.M254I	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	254	Necessary for homooligomerization and targeting to endosomes.|Interaction with PAK1 (By similarity).				apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78666885	78666885	+	Silent	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78666885G>A	uc003dqe.2	-	27	4390	c.4182C>T	c.(4180-4182)GAC>GAT	p.D1394D	ROBO1_uc003dqb.2_Silent_p.D1355D|ROBO1_uc003dqc.2_Silent_p.D1294D|ROBO1_uc003dqd.2_Silent_p.D1349D|ROBO1_uc010hoh.2_Silent_p.D586D|ROBO1_uc011bgl.1_Silent_p.D966D	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1394	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96962916	96962916	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96962916A>C	uc010how.1	+	5	1434	c.1391A>C	c.(1390-1392)AAG>ACG	p.K464T	EPHA6_uc003drp.1_Missense_Mutation_p.K464T	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	369	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
MRPS22	56945	broad.mit.edu	37	3	139075837	139075837	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139075837G>A	uc003etb.2	+	8	1072	c.1064G>A	c.(1063-1065)CGC>CAC	p.R355H	MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_Missense_Mutation_p.R354H|MRPS22_uc003ete.2_Missense_Mutation_p.R314H	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	355						mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3																		---	---	---	---
PDCD10	11235	broad.mit.edu	37	3	167414858	167414858	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167414858T>G	uc003fex.2	-	5	605	c.207A>C	c.(205-207)AAA>AAC	p.K69N	PDCD10_uc003fez.2_Missense_Mutation_p.K69N|PDCD10_uc003fey.2_Missense_Mutation_p.K69N	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	69					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2														Familial_Cerebral_Cavernous_Angioma				---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	192997242	192997242	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192997242A>G	uc011bsq.1	-	28	3228	c.3228T>C	c.(3226-3228)TAT>TAC	p.Y1076Y		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	1076					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79293935	79293935	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79293935A>G	uc003hlb.2	+	24	3373	c.2933A>G	c.(2932-2934)GAT>GGT	p.D978G	FRAS1_uc003hkw.2_Missense_Mutation_p.D978G	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	978	FU 12.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
NPY1R	4886	broad.mit.edu	37	4	164246631	164246631	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164246631A>C	uc003iqm.1	-	3	1245	c.979T>G	c.(979-981)TTC>GTC	p.F327V	NPY1R_uc011cjj.1_Missense_Mutation_p.F84V	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	327	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
TNPO1	3842	broad.mit.edu	37	5	72178909	72178909	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72178909G>A	uc003kck.3	+	11	1147	c.1000G>A	c.(1000-1002)GAA>AAA	p.E334K	TNPO1_uc011csi.1_RNA|TNPO1_uc011csj.1_Missense_Mutation_p.E284K|TNPO1_uc003kch.2_Missense_Mutation_p.E326K|TNPO1_uc003kci.3_Missense_Mutation_p.E326K|TNPO1_uc003kcg.3_Missense_Mutation_p.E326K	NM_002270	NP_002261	Q92973	TNPO1_HUMAN	transportin 1 isoform 1	334					interspecies interaction between organisms|mRNA metabolic process|protein import into nucleus, translocation	cytosol|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			skin(3)|urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)	7		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)														---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	136974776	136974776	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136974776C>T	uc010jek.2	-	10	1529	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q	KLHL3_uc011cyc.1_Missense_Mutation_p.R131Q|KLHL3_uc003lbr.3_Missense_Mutation_p.R280Q|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_Missense_Mutation_p.R131Q|KLHL3_uc010jem.1_Missense_Mutation_p.R322Q	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3	362	Kelch 2.					cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15368932	15368932	+	Intron	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15368932C>T	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
DCDC2	51473	broad.mit.edu	37	6	24301956	24301956	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24301956C>A	uc003ndx.2	-	4	846	c.544G>T	c.(544-546)GGG>TGG	p.G182W	DCDC2_uc003ndy.2_Missense_Mutation_p.G182W	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	182	Doublecortin 2.				cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---
OR5V1	81696	broad.mit.edu	37	6	29323361	29323361	+	Silent	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29323361G>A	uc011dlo.1	-	1	694	c.612C>T	c.(610-612)GTC>GTT	p.V204V		NM_030876	NP_110503	Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|kidney(1)	4																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38843525	38843525	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38843525G>C	uc003ooe.1	+	51	7728	c.7128G>C	c.(7126-7128)CAG>CAC	p.Q2376H		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
PTCRA	171558	broad.mit.edu	37	6	42891978	42891978	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42891978A>G	uc003osx.2	+	3	472	c.391A>G	c.(391-393)ACA>GCA	p.T131A	PTCRA_uc010jxx.1_Silent_p.L91L|PTCRA_uc010jxy.2_Missense_Mutation_p.T106A|PTCRA_uc010jxz.2_Missense_Mutation_p.T24A	NM_138296	NP_612153	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha precursor	131	Extracellular (Potential).					integral to membrane	receptor activity			ovary(2)	2	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)															---	---	---	---
DDX43	55510	broad.mit.edu	37	6	74124323	74124323	+	Silent	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74124323C>A	uc003pgw.2	+	14	2003	c.1659C>A	c.(1657-1659)GTC>GTA	p.V553V		NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43	553	Helicase C-terminal.					intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4																		---	---	---	---
CCNC	892	broad.mit.edu	37	6	100009250	100009250	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100009250T>G	uc003pqe.2	-	4	574	c.287A>C	c.(286-288)AAA>ACA	p.K96T	uc003pqc.2_Intron|CCNC_uc003pqd.2_Missense_Mutation_p.K11T|CCNC_uc010kcr.2_RNA|CCNC_uc010kcs.2_Missense_Mutation_p.K96T|CCNC_uc011eah.1_Missense_Mutation_p.K11T|CCNC_uc003pqf.2_Missense_Mutation_p.K96T	NM_005190	NP_005181	P24863	CCNC_HUMAN	cyclin C isoform a	96	Cyclin N-terminal.				regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	DNA-directed RNA polymerase II, holoenzyme	protein kinase binding				0		all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)														---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112454100	112454100	+	Intron	SNP	C	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112454100C>G	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676			laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
GPRC6A	222545	broad.mit.edu	37	6	117113436	117113436	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117113436T>C	uc003pxj.1	-	6	2672	c.2650A>G	c.(2650-2652)AGC>GGC	p.S884G	GPRC6A_uc003pxk.1_Missense_Mutation_p.S709G|GPRC6A_uc003pxl.1_Missense_Mutation_p.S813G	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	884	Cytoplasmic (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)														---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117724370	117724370	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117724370C>T	uc003pxp.1	-	6	708	c.509G>A	c.(508-510)TGG>TAG	p.W170*	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	170	Fibronectin type-III 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
TAAR2	9287	broad.mit.edu	37	6	132938501	132938501	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132938501T>C	uc003qdl.1	-	2	844	c.844A>G	c.(844-846)ATT>GTT	p.I282V	TAAR2_uc010kfr.1_Missense_Mutation_p.I237V	NM_001033080	NP_001028252	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	282	Helical; Name=6; (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)														---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143094562	143094562	+	Silent	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143094562G>A	uc003qjd.2	-	5	2057	c.1314C>T	c.(1312-1314)CTC>CTT	p.L438L		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	438					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152265346	152265346	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152265346C>T	uc003qom.3	+	6	1169	c.799C>T	c.(799-801)CAC>TAC	p.H267Y	ESR1_uc010kin.2_Missense_Mutation_p.H267Y|ESR1_uc010kio.2_Missense_Mutation_p.H269Y|ESR1_uc010kip.2_Missense_Mutation_p.H266Y|ESR1_uc003qon.3_Missense_Mutation_p.H267Y|ESR1_uc003qoo.3_Missense_Mutation_p.H267Y|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Missense_Mutation_p.H48Y|ESR1_uc010kit.1_Missense_Mutation_p.H4Y|ESR1_uc011eey.1_Missense_Mutation_p.H4Y	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	267	Interaction with AKAP13.|Hinge.|Mediates interaction with DNTTIP2.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152629626	152629626	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152629626C>A	uc010kiw.2	-	91	17946	c.17344G>T	c.(17344-17346)GAG>TAG	p.E5782*	SYNE1_uc010kiv.2_Nonsense_Mutation_p.E306*|SYNE1_uc003qos.3_Nonsense_Mutation_p.E306*|SYNE1_uc003qot.3_Nonsense_Mutation_p.E5711*|SYNE1_uc003qou.3_Nonsense_Mutation_p.E5782*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5782	Cytoplasmic (Potential).|Spectrin 19.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
QKI	9444	broad.mit.edu	37	6	163876390	163876390	+	Silent	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163876390T>C	uc003qui.2	+	2	773	c.222T>C	c.(220-222)GAT>GAC	p.D74D	QKI_uc003que.2_Silent_p.D74D|QKI_uc003quf.2_Silent_p.D74D|QKI_uc003qug.2_Silent_p.D74D|QKI_uc003quh.2_Silent_p.D74D|QKI_uc003quj.2_Silent_p.D74D	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	74					mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)														---	---	---	---
UPP1	7378	broad.mit.edu	37	7	48146563	48146563	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48146563T>A	uc003toj.2	+	8	1059	c.530T>A	c.(529-531)ATC>AAC	p.I177N	UPP1_uc003tok.2_Missense_Mutation_p.I177N|UPP1_uc003tol.2_Missense_Mutation_p.I177N|UPP1_uc011kch.1_5'UTR|UPP1_uc003ton.2_Missense_Mutation_p.I40N|UPP1_uc003too.2_Missense_Mutation_p.I40N	NM_181597	NP_853628	Q16831	UPP1_HUMAN	uridine phosphorylase 1	177					nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity				0																		---	---	---	---
SEMA3A	10371	broad.mit.edu	37	7	83591004	83591004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83591004C>T	uc003uhz.2	-	17	2314	c.1999G>A	c.(1999-2001)GTC>ATC	p.V667I		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	667					axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4																		---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94051241	94051241	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94051241C>T	uc003ung.1	+	39	2851	c.2380C>T	c.(2380-2382)CGG>TGG	p.R794W	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	794			Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	131122617	131122617	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131122617G>A	uc011kpm.1	+	10	1098	c.1034G>A	c.(1033-1035)CGT>CAT	p.R345H	MKLN1_uc011kpl.1_Missense_Mutation_p.R322H|MKLN1_uc010lmh.2_Missense_Mutation_p.R345H|MKLN1_uc003vqs.2_Missense_Mutation_p.R138H	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing	345	Kelch 2.				signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149481083	149481083	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149481083C>G	uc010lpk.2	+	18	2565	c.2565C>G	c.(2563-2565)AGC>AGG	p.S855R	SSPO_uc010lpl.1_Missense_Mutation_p.S190R	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	855	TIL 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
HR	55806	broad.mit.edu	37	8	21986672	21986672	+	Silent	SNP	C	T	T	rs148136587		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21986672C>T	uc003xas.2	-	2	677	c.12G>A	c.(10-12)ACG>ACA	p.T4T	HR_uc003xat.2_Silent_p.T4T|HR_uc010lts.2_Silent_p.T4T	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	4							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)														---	---	---	---
ZNF703	80139	broad.mit.edu	37	8	37556076	37556076	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37556076T>A	uc003xjy.1	+	2	1854	c.1657T>A	c.(1657-1659)TTA>ATA	p.L553I		NM_025069	NP_079345	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	553					adherens junction assembly|mammary gland epithelial cell differentiation|negative regulation of homotypic cell-cell adhesion|negative regulation of transcription, DNA-dependent|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of mammary gland epithelial cell proliferation|regulation of canonical Wnt receptor signaling pathway|regulation of cell cycle|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)															---	---	---	---
ANK1	286	broad.mit.edu	37	8	41519052	41519052	+	Intron	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41519052C>T	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.D1013N|ANK1_uc003xoi.2_Missense_Mutation_p.D1859N|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron|ANK1_uc011lcl.1_Intron|ANK1_uc003xod.2_Missense_Mutation_p.D134N|ANK1_uc003xoc.2_Intron|ANK1_uc003xof.2_Intron|MIR486_hsa-mir-486|MI0002470_5'Flank	NM_020476	NP_065209			ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)															---	---	---	---
YTHDF3	253943	broad.mit.edu	37	8	64099640	64099640	+	Silent	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64099640T>C	uc003xuy.2	+	5	1387	c.1071T>C	c.(1069-1071)CCT>CCC	p.P357P	YTHDF3_uc010lys.2_Silent_p.P301P|YTHDF3_uc003xuz.2_Silent_p.P301P|YTHDF3_uc003xva.2_Silent_p.P301P|YTHDF3_uc011len.1_Silent_p.P301P	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	357											0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77766465	77766465	+	Silent	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766465G>A	uc003yav.2	+	10	7560	c.7173G>A	c.(7171-7173)TCG>TCA	p.S2391S	ZFHX4_uc003yau.1_Silent_p.S2436S|ZFHX4_uc003yaw.1_Silent_p.S2391S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2391	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885398	88885398	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885398A>T	uc003ydz.2	-	1	899	c.802T>A	c.(802-804)TCC>ACC	p.S268T		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	268	WD 1.									ovary(1)	1																		---	---	---	---
COL14A1	7373	broad.mit.edu	37	8	121290428	121290428	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121290428G>C	uc003yox.2	+	27	3557	c.3292G>C	c.(3292-3294)GAT>CAT	p.D1098H	COL14A1_uc003yoz.2_Missense_Mutation_p.D63H	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	1098	VWFA 2.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
UHRF2	115426	broad.mit.edu	37	9	6420926	6420926	+	Silent	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6420926T>C	uc003zjy.2	+	2	508	c.168T>C	c.(166-168)TAT>TAC	p.Y56Y	UHRF2_uc003zjz.2_RNA	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains	56	Ubiquitin-like.				cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)														---	---	---	---
HNRNPK	3190	broad.mit.edu	37	9	86589475	86589475	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86589475G>T	uc004ang.3	-	7	511	c.287C>A	c.(286-288)ACA>AAA	p.T96K	HNRNPK_uc011lsw.1_5'UTR|HNRNPK_uc004and.3_5'UTR|HNRNPK_uc004ank.3_Missense_Mutation_p.T96K|HNRNPK_uc004anf.3_Missense_Mutation_p.T96K|HNRNPK_uc004anh.3_Missense_Mutation_p.T96K|HNRNPK_uc011lsx.1_Missense_Mutation_p.T96K|HNRNPK_uc004ani.3_Missense_Mutation_p.T96K|HNRNPK_uc004anj.3_Missense_Mutation_p.T96K|HNRNPK_uc004ann.3_Missense_Mutation_p.T96K|HNRNPK_uc004anl.3_Missense_Mutation_p.T96K|HNRNPK_uc004anm.3_Missense_Mutation_p.T96K	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	96	KH 1.|5 X 4 AA repeats of G-X-G-G.|Necessary for interaction with DDX1.|2 X 22 AA approximate repeats.|Interaction with ASFV p30.				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1																		---	---	---	---
CEP110	11064	broad.mit.edu	37	9	123907515	123907515	+	Intron	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123907515T>A	uc004bkx.1	+						CEP110_uc004bky.1_Intron|CEP110_uc004bla.1_Intron|CEP110_uc010mvo.1_Intron	NM_007018	NP_008949			centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0																		---	---	---	---
MAP3K8	1326	broad.mit.edu	37	10	30739222	30739222	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30739222A>C	uc001ivi.1	+	5	1236	c.540A>C	c.(538-540)GAA>GAC	p.E180D	MAP3K8_uc009xlf.1_Missense_Mutation_p.E180D|MAP3K8_uc001ivj.1_Missense_Mutation_p.E180D	NM_005204	NP_005195	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase	180	Protein kinase.				cell cycle|T cell costimulation	cytosol	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			breast(3)|central_nervous_system(1)	4		Prostate(175;0.151)																---	---	---	---
A1CF	29974	broad.mit.edu	37	10	52580420	52580420	+	Intron	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52580420G>T	uc001jjj.2	-						A1CF_uc010qhn.1_Intron|A1CF_uc001jji.2_Intron|A1CF_uc001jjh.2_Intron|A1CF_uc010qho.1_Intron|A1CF_uc009xov.2_Intron	NM_138932	NP_620310			apobec-1 complementation factor isoform 2						cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1																		---	---	---	---
PDCD11	22984	broad.mit.edu	37	10	105184797	105184797	+	Silent	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105184797C>T	uc001kwy.1	+	20	2907	c.2820C>T	c.(2818-2820)GCC>GCT	p.A940A		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	940					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3803335	3803335	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3803335A>T	uc001lyh.2	-	2	304	c.13T>A	c.(13-15)TCA>ACA	p.S5T	NUP98_uc001lyi.2_Missense_Mutation_p.S5T|NUP98_uc001lyj.1_Missense_Mutation_p.S5T|NUP98_uc001lyk.1_Missense_Mutation_p.S5T|NUP98_uc010qxv.1_Missense_Mutation_p.S5T	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	5					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
OR51A4	401666	broad.mit.edu	37	11	4967758	4967758	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4967758A>G	uc010qys.1	-	1	573	c.573T>C	c.(571-573)TGT>TGC	p.C191C		NM_001005329	NP_001005329	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A,	191	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR51A2	401667	broad.mit.edu	37	11	4976371	4976371	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4976371A>G	uc010qyt.1	-	1	573	c.573T>C	c.(571-573)TGT>TGC	p.C191C		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	191	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
HBE1	3046	broad.mit.edu	37	11	5290869	5290869	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5290869C>T	uc001mal.1	-	2	383	c.130G>A	c.(130-132)GAC>AAC	p.D44N	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Missense_Mutation_p.D44N	NM_005330	NP_005321	P02100	HBE_HUMAN	epsilon globin	44					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
IPO7	10527	broad.mit.edu	37	11	9463634	9463634	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9463634A>G	uc001mho.2	+	24	3051	c.2909A>G	c.(2908-2910)CAA>CGA	p.Q970R		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	970					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)														---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9761798	9761798	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9761798G>A	uc001mhw.2	+	9	1358	c.1259G>A	c.(1258-1260)CGG>CAG	p.R420Q	SWAP70_uc001mhv.2_Missense_Mutation_p.R420Q|SWAP70_uc001mhx.2_Missense_Mutation_p.R362Q	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein	420	Potential.					cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)														---	---	---	---
SLC6A5	9152	broad.mit.edu	37	11	20652300	20652300	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20652300C>G	uc001mqd.2	+	10	1836	c.1563C>G	c.(1561-1563)TTC>TTG	p.F521L	SLC6A5_uc009yic.2_Missense_Mutation_p.F286L	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	521	Helical; Name=7; (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)													---	---	---	---
FSHB	2488	broad.mit.edu	37	11	30253471	30253471	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30253471T>G	uc001msl.2	+	2	91	c.22T>G	c.(22-24)TTC>GTC	p.F8V	FSHB_uc001msm.2_Missense_Mutation_p.F8V|FSHB_uc001msn.2_Missense_Mutation_p.F8V	NM_000510	NP_000501	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	8					cellular nitrogen compound metabolic process|female gamete generation|female pregnancy|ovarian follicle development|peptide hormone processing|progesterone biosynthetic process|spermatogenesis|transforming growth factor beta receptor signaling pathway	cytoplasm|extracellular region|soluble fraction	follicle-stimulating hormone activity|protein heterodimerization activity			ovary(3)	3					Follitropin beta(DB00066)|Thyrotropin Alfa(DB00024)|Urofollitropin(DB00094)													---	---	---	---
ZDHHC5	25921	broad.mit.edu	37	11	57466361	57466361	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57466361G>C	uc001nkx.1	+	11	2709	c.1453G>C	c.(1453-1455)GTG>CTG	p.V485L	ZDHHC5_uc001nky.1_Missense_Mutation_p.V432L|ZDHHC5_uc001nkz.1_Missense_Mutation_p.V299L	NM_015457	NP_056272	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC domain containing 5	485						integral to membrane	acyltransferase activity|zinc ion binding			skin(1)	1																		---	---	---	---
CCDC90B	60492	broad.mit.edu	37	11	82991248	82991248	+	Silent	SNP	A	T	T	rs141993989		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82991248A>T	uc001pae.2	-	2	518	c.156T>A	c.(154-156)ACT>ACA	p.T52T	CCDC90B_uc001pac.2_5'UTR|CCDC90B_uc001pad.2_5'UTR|CCDC90B_uc001paf.2_Silent_p.T43T	NM_021825	NP_068597	Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B precursor	52						integral to membrane|mitochondrion|mitochondrion					0		Acute lymphoblastic leukemia(157;0.103)																---	---	---	---
OR10G9	219870	broad.mit.edu	37	11	123894599	123894599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123894599G>T	uc010sad.1	+	1	880	c.880G>T	c.(880-882)GTG>TTG	p.V294L		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	294	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)														---	---	---	---
ERBB3	2065	broad.mit.edu	37	12	56488259	56488259	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56488259T>C	uc001sjh.2	+	15	1971	c.1778T>C	c.(1777-1779)GTC>GCC	p.V593A	ERBB3_uc009zoj.2_Intron|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.V534A|ERBB3_uc009zok.2_Missense_Mutation_p.V35A|ERBB3_uc001sjk.2_5'Flank	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	593	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)															---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85449893	85449893	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85449893T>A	uc001tac.2	+	8	1433	c.1322T>A	c.(1321-1323)CTA>CAA	p.L441Q	LRRIQ1_uc001tab.1_Missense_Mutation_p.L441Q|LRRIQ1_uc001taa.1_Missense_Mutation_p.L416Q	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	441										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
LRRIQ1	84125	broad.mit.edu	37	12	85449894	85449894	+	Silent	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85449894A>G	uc001tac.2	+	8	1434	c.1323A>G	c.(1321-1323)CTA>CTG	p.L441L	LRRIQ1_uc001tab.1_Silent_p.L441L|LRRIQ1_uc001taa.1_Silent_p.L416L	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	441										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)														---	---	---	---
SELPLG	6404	broad.mit.edu	37	12	109017093	109017093	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109017093C>A	uc001tni.2	-	2	1151	c.991G>T	c.(991-993)GCC>TCC	p.A331S	SELPLG_uc001tnh.2_Missense_Mutation_p.A321S|SELPLG_uc010sxe.1_Missense_Mutation_p.A347S	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	331	Helical; (Potential).				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0																		---	---	---	---
UNG	7374	broad.mit.edu	37	12	109547685	109547685	+	Silent	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109547685A>C	uc001tnz.1	+	7	923	c.853A>C	c.(853-855)AGA>CGA	p.R285R	UNG_uc001toa.1_Silent_p.R276R	NM_080911	NP_550433	P13051	UNG_HUMAN	uracil-DNA glycosylase isoform UNG2	285					base-excision repair|interspecies interaction between organisms	mitochondrion|nucleus	protein binding|uracil DNA N-glycosylase activity			lung(1)|central_nervous_system(1)	2													BER_DNA_glycosylases	Immune_Deficiency_with_Hyper-IgM				---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111779737	111779737	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111779737A>G	uc001tsa.1	+	21	3692	c.3539A>G	c.(3538-3540)AAG>AGG	p.K1180R		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1180	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112696939	112696939	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112696939G>T	uc009zwc.2	-	12	1726	c.1708C>A	c.(1708-1710)CAG>AAG	p.Q570K	C12orf51_uc010syk.1_Missense_Mutation_p.Q393K|C12orf51_uc001tts.2_Missense_Mutation_p.Q393K|C12orf51_uc001ttt.3_Missense_Mutation_p.Q391K	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
PARP4	143	broad.mit.edu	37	13	25072316	25072316	+	Missense_Mutation	SNP	G	A	A	rs138375910	byFrequency	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25072316G>A	uc001upl.2	-	6	635	c.529C>T	c.(529-531)CGG>TGG	p.R177W	PARP4_uc010tdc.1_Missense_Mutation_p.R177W	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	177					cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---
RNF17	56163	broad.mit.edu	37	13	25444802	25444802	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25444802G>T	uc001upr.2	+	32	4413	c.4372G>T	c.(4372-4374)GAG>TAG	p.E1458*	RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Nonsense_Mutation_p.E1454*|RNF17_uc001ups.2_Nonsense_Mutation_p.E1397*|RNF17_uc010aac.2_Nonsense_Mutation_p.E650*|RNF17_uc010aad.2_Nonsense_Mutation_p.E468*	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1458					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)														---	---	---	---
NUPL1	9818	broad.mit.edu	37	13	25899140	25899140	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25899140C>A	uc001uqi.2	+	10	1211	c.965C>A	c.(964-966)GCT>GAT	p.A322D	NUPL1_uc001uqg.1_Missense_Mutation_p.A322D|NUPL1_uc001uqj.2_Missense_Mutation_p.A310D	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	322	14 X 2 AA repeats of F-G.|Potential.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)														---	---	---	---
C13orf26	122046	broad.mit.edu	37	13	31540442	31540442	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31540442A>T	uc001uti.2	+	5	572	c.553A>T	c.(553-555)AAT>TAT	p.N185Y		NM_152325	NP_689538	Q8N6G2	CM026_HUMAN	hypothetical protein LOC122046	185										ovary(2)|skin(1)	3		Lung SC(185;0.0281)		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37453538	37453538	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37453538G>A	uc001uvw.2	-	2	632	c.289C>T	c.(289-291)CGC>TGC	p.R97C	SMAD9_uc001uvx.2_Missense_Mutation_p.R97C|SMAD9_uc010tep.1_5'UTR	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	97	MH1.				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
RCBTB2	1102	broad.mit.edu	37	13	49087036	49087036	+	Intron	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49087036A>T	uc001vch.2	-						RCBTB2_uc010tgg.1_Intron|RCBTB2_uc001vci.2_Intron|RCBTB2_uc010tgh.1_Intron|RCBTB2_uc001vcj.2_Intron|RCBTB2_uc010acv.1_Intron|RCBTB2_uc010tgi.1_Intron	NM_001268	NP_001259			regulator of chromosome condensation and BTB								Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)														---	---	---	---
NALCN	259232	broad.mit.edu	37	13	101759853	101759853	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101759853C>T	uc001vox.1	-	22	2753	c.2564G>A	c.(2563-2565)CGA>CAA	p.R855Q		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	855	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
SOX1	6656	broad.mit.edu	37	13	112722169	112722169	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112722169G>A	uc001vsb.1	+	1	257	c.197G>A	c.(196-198)CGG>CAG	p.R66Q		NM_005986	NP_005977	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	66	HMG box.				chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)														---	---	---	---
ACIN1	22985	broad.mit.edu	37	14	23532233	23532233	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23532233C>T	uc001wit.3	-	14	3290	c.2962G>A	c.(2962-2964)GGA>AGA	p.G988R	ACIN1_uc001wio.3_RNA|ACIN1_uc001wip.3_Missense_Mutation_p.G230R|ACIN1_uc001wiq.3_Missense_Mutation_p.G230R|ACIN1_uc001wir.3_Missense_Mutation_p.G261R|ACIN1_uc001wis.3_Missense_Mutation_p.G669R|ACIN1_uc010akg.2_Missense_Mutation_p.G975R	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	988					apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)														---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32295866	32295866	+	Silent	SNP	C	A	A	rs35330765	by1000genomes	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32295866C>A	uc001wrk.3	+	8	694	c.639C>A	c.(637-639)ATC>ATA	p.I213I	NUBPL_uc010amj.2_RNA|NUBPL_uc010tpl.1_Silent_p.I117I	NM_025152	NP_079428	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	213					mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
SDCCAG1	9147	broad.mit.edu	37	14	50292612	50292612	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50292612G>C	uc001wxc.2	-	16	1618	c.1550C>G	c.(1549-1551)TCT>TGT	p.S517C	SDCCAG1_uc010anj.1_Missense_Mutation_p.S517C|SDCCAG1_uc010tqi.1_Missense_Mutation_p.S517C|SDCCAG1_uc001wxe.2_Missense_Mutation_p.S475C|SDCCAG1_uc001wxd.1_5'UTR|SDCCAG1_uc010anq.1_Missense_Mutation_p.S288C	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	517						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)														---	---	---	---
DENND4A	10260	broad.mit.edu	37	15	65968973	65968973	+	Splice_Site	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65968973C>T	uc002aph.2	-	23	4426	c.4048_splice	c.e23-1	p.D1350_splice	DENND4A_uc002api.2_Splice_Site_p.D1393_splice	NM_005848	NP_005839			DENN/MADD domain containing 4A isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
RPL4	6124	broad.mit.edu	37	15	66792620	66792620	+	Intron	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66792620T>C	uc002apv.2	-						SNAPC5_uc002apu.1_5'Flank|RPL4_uc010bhr.2_Intron|RPL4_uc002apw.2_Intron|RPL4_uc002apx.2_Intron	NM_000968	NP_000959			ribosomal protein L4						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71211502	71211502	+	Silent	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71211502T>A	uc002asw.2	+	7	928	c.681T>A	c.(679-681)CTT>CTA	p.L227L	LRRC49_uc002asu.2_Silent_p.L217L|LRRC49_uc002asx.2_Silent_p.L183L|LRRC49_uc010ukf.1_Silent_p.L232L|LRRC49_uc002asy.2_5'UTR|LRRC49_uc002asz.2_Silent_p.L199L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	227	LRR 6.					cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
SRRM2	23524	broad.mit.edu	37	16	2814369	2814369	+	Silent	SNP	G	A	A	rs144705999		TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2814369G>A	uc002crk.2	+	11	4389	c.3840G>A	c.(3838-3840)GTG>GTA	p.V1280V	SRRM2_uc002crj.1_Silent_p.V1184V|SRRM2_uc002crl.1_Silent_p.V1280V|SRRM2_uc010bsu.1_Silent_p.V1184V	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1280	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
CREBBP	1387	broad.mit.edu	37	16	3807914	3807914	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3807914G>T	uc002cvv.2	-	18	3709	c.3505C>A	c.(3505-3507)CGC>AGC	p.R1169S	CREBBP_uc002cvw.2_Missense_Mutation_p.R1131S	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1169	Bromo.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)				T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				---	---	---	---
ERI2	112479	broad.mit.edu	37	16	20810658	20810658	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20810658C>T	uc010vbb.1	-	8	702	c.659G>A	c.(658-660)CGG>CAG	p.R220Q	ERI2_uc002dht.3_Missense_Mutation_p.R127Q|ERI2_uc002dhs.2_Missense_Mutation_p.R220Q|ERI2_uc010bwh.2_Missense_Mutation_p.R127Q|ERI2_uc010vbc.1_5'UTR|ERI2_uc002dhu.1_Missense_Mutation_p.R220Q	NM_001142725	NP_001136197	A8K979	ERI2_HUMAN	exoribonuclease 2 isoform 1	220	Exonuclease.					intracellular	exonuclease activity|nucleic acid binding|zinc ion binding			large_intestine(1)	1																		---	---	---	---
CLEC3A	10143	broad.mit.edu	37	16	78062046	78062046	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78062046C>G	uc002ffh.3	+	2	239	c.158C>G	c.(157-159)ACA>AGA	p.T53R		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	53					skeletal system development	extracellular region	sugar binding				0																		---	---	---	---
GH2	2689	broad.mit.edu	37	17	61957821	61957821	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61957821A>G	uc002jco.1	-	5	576	c.514T>C	c.(514-516)TTT>CTT	p.F172L	GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Missense_Mutation_p.V256A|GH2_uc002jcm.1_Silent_p.S170S|GH2_uc002jcn.1_Missense_Mutation_p.F157L	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	172						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3																		---	---	---	---
RAB37	326624	broad.mit.edu	37	17	72739328	72739328	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72739328G>A	uc002jlk.2	+	4	363	c.307G>A	c.(307-309)GCT>ACT	p.A103T	RAB37_uc002jlc.2_Missense_Mutation_p.A96T|RAB37_uc010dfu.2_Missense_Mutation_p.A96T|RAB37_uc002jld.2_Missense_Mutation_p.A96T|RAB37_uc010wrb.1_Missense_Mutation_p.A71T|RAB37_uc010wrc.1_Missense_Mutation_p.A108T|RAB37_uc010wrd.1_Missense_Mutation_p.A71T|RAB37_uc010wre.1_Missense_Mutation_p.A66T|RAB37_uc002jll.3_RNA	NM_001006638	NP_001006639	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family isoform 2	103					protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1																		---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	7038939	7038939	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7038939T>C	uc002knm.2	-	11	1527	c.1433A>G	c.(1432-1434)GAG>GGG	p.E478G	LAMA1_uc010wzj.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	478	Laminin EGF-like 4.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
LRRC30	339291	broad.mit.edu	37	18	7231361	7231361	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231361A>T	uc010wzk.1	+	1	225	c.225A>T	c.(223-225)AAA>AAT	p.K75N		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	75	LRR 1.									ovary(1)|liver(1)	2																		---	---	---	---
SYT4	6860	broad.mit.edu	37	18	40851729	40851729	+	Silent	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40851729C>A	uc002law.2	-	3	1287	c.918G>T	c.(916-918)GTG>GTT	p.V306V	SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Silent_p.V288V|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	306	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5																		---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43534750	43534750	+	Silent	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43534750A>C	uc002lbm.2	-	2	718	c.618T>G	c.(616-618)GGT>GGG	p.G206G	KIAA1632_uc002lbo.1_Silent_p.G206G	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	206					autophagy						0																		---	---	---	---
GMIP	51291	broad.mit.edu	37	19	19740837	19740837	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19740837C>T	uc002nnd.2	-	21	2965	c.2848G>A	c.(2848-2850)GAG>AAG	p.E950K	LPAR2_uc002nnb.3_5'Flank|LPAR2_uc002nna.3_5'Flank|LPAR2_uc002nnc.3_5'Flank|GMIP_uc010xrb.1_Missense_Mutation_p.E924K|GMIP_uc010xrc.1_Missense_Mutation_p.E921K	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	950					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1																		---	---	---	---
ZNF527	84503	broad.mit.edu	37	19	37880687	37880687	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37880687A>G	uc010efk.1	+	5	1847	c.1736A>G	c.(1735-1737)GAA>GGA	p.E579G	ZNF527_uc002ogf.3_Missense_Mutation_p.E547G|ZNF527_uc010xtq.1_RNA	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	579					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
YIF1B	90522	broad.mit.edu	37	19	38798272	38798272	+	Silent	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38798272G>T	uc002ohz.2	-	6	709	c.660C>A	c.(658-660)ATC>ATA	p.I220I	YIF1B_uc002ohw.2_Silent_p.I189I|YIF1B_uc002ohx.2_Silent_p.I205I|YIF1B_uc010xtx.1_Silent_p.I203I|YIF1B_uc010xty.1_Silent_p.I189I|YIF1B_uc002oia.2_Silent_p.I217I|YIF1B_uc002ohy.2_Silent_p.I217I|YIF1B_uc002oib.2_Silent_p.I217I	NM_001039672	NP_001034761	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B isoform 5	220	Helical; (Potential).					integral to membrane					0	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
RYR1	6261	broad.mit.edu	37	19	39052081	39052081	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39052081G>T	uc002oit.2	+	90	12741	c.12611G>T	c.(12610-12612)TGG>TTG	p.W4204L	RYR1_uc002oiu.2_Missense_Mutation_p.W4199L|RYR1_uc002oiv.1_Missense_Mutation_p.W1113L	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4204					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
IRGQ	126298	broad.mit.edu	37	19	44097387	44097387	+	Silent	SNP	G	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44097387G>T	uc002oww.2	-	2	781	c.663C>A	c.(661-663)GGC>GGA	p.G221G	IRGQ_uc010eiv.2_Silent_p.G221G	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	221							protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)																---	---	---	---
ZNF761	388561	broad.mit.edu	37	19	53958695	53958695	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53958695A>G	uc010eqp.2	+	7	1392	c.934A>G	c.(934-936)ATA>GTA	p.I312V	ZNF761_uc010ydy.1_Missense_Mutation_p.I258V|ZNF761_uc002qbt.1_Missense_Mutation_p.I258V	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	312	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)														---	---	---	---
LILRB5	10990	broad.mit.edu	37	19	54756239	54756239	+	Silent	SNP	C	T	T			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54756239C>T	uc002qex.2	-	11	1674	c.1563G>A	c.(1561-1563)GAG>GAA	p.E521E	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.E513E|LILRB5_uc002qey.2_Silent_p.E522E|LILRB5_uc002qez.2_Silent_p.E422E|LILRB5_uc002qfa.1_3'UTR	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	521	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
ZNF548	147694	broad.mit.edu	37	19	57910688	57910688	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57910688T>A	uc002qom.2	+	3	1283	c.1033T>A	c.(1033-1035)TTT>ATT	p.F345I	ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Missense_Mutation_p.F348I	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	345	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
STK4	6789	broad.mit.edu	37	20	43629151	43629151	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43629151A>G	uc002xnb.2	+	8	1040	c.950A>G	c.(949-951)GAA>GGA	p.E317G	STK4_uc010ggx.2_Missense_Mutation_p.E317G|STK4_uc010ggy.2_Missense_Mutation_p.E262G|STK4_uc010ggw.1_Missense_Mutation_p.E317G	NM_006282	NP_006273	Q13043	STK4_HUMAN	serine/threonine kinase 4	317					apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
TFAP2C	7022	broad.mit.edu	37	20	55212916	55212916	+	Silent	SNP	T	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55212916T>C	uc002xya.2	+	7	1443	c.1200T>C	c.(1198-1200)TTT>TTC	p.F400F	TFAP2C_uc010zzi.1_Silent_p.F231F	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma	400	H-S-H (helix-span-helix), dimerization.				cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)															---	---	---	---
RTEL1	51750	broad.mit.edu	37	20	62316938	62316938	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62316938A>C	uc002yfu.1	+	15	1597	c.1254A>C	c.(1252-1254)TTA>TTC	p.L418F	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.L418F|RTEL1_uc011abd.1_Missense_Mutation_p.L442F|RTEL1_uc011abe.1_Missense_Mutation_p.L195F|RTEL1_uc002yfw.2_RNA	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	418					DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)															---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47860964	47860964	+	Missense_Mutation	SNP	G	A	A	rs149001544	byFrequency	TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47860964G>A	uc002zji.3	+	43	9697	c.9590G>A	c.(9589-9591)CGC>CAC	p.R3197H	PCNT_uc002zjj.2_Missense_Mutation_p.R3000H	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	3197	Interaction with NEK2.|Calmodulin-binding.			FR->AA: Decrease in calmodulin binding.	cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
LIMK2	3985	broad.mit.edu	37	22	31658191	31658191	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31658191A>G	uc003akh.2	+	6	768	c.623A>G	c.(622-624)AAT>AGT	p.N208S	LIMK2_uc003akg.2_Missense_Mutation_p.N125S|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Missense_Mutation_p.N187S|LIMK2_uc003akk.2_Missense_Mutation_p.N187S|LIMK2_uc011aln.1_Missense_Mutation_p.N125S	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	208	PDZ.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
SOX10	6663	broad.mit.edu	37	22	38374096	38374096	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38374096G>A	uc003aun.1	-	3	753	c.475C>T	c.(475-477)CGG>TGG	p.R159W	POLR2F_uc003aum.2_Intron|SOX10_uc003auo.1_Missense_Mutation_p.R159W	NM_006941	NP_008872	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	159	HMG box.					cytoplasm|nucleus	DNA binding|identical protein binding|transcription coactivator activity				0	Melanoma(58;0.045)																	---	---	---	---
CSF2RA	1438	broad.mit.edu	37	X	1404744	1404744	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1404744C>A	uc010nct.2	+	5	472	c.150C>A	c.(148-150)GAC>GAA	p.D50E	CSF2RA_uc011mhb.1_Missense_Mutation_p.D50E|CSF2RA_uc004cpq.2_Missense_Mutation_p.D50E|CSF2RA_uc004cpn.2_Missense_Mutation_p.D50E|CSF2RA_uc004cpo.2_Missense_Mutation_p.D50E|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_Intron|CSF2RA_uc004cpp.2_Missense_Mutation_p.D50E|CSF2RA_uc010ncv.2_Missense_Mutation_p.D50E|CSF2RA_uc004cpr.2_Missense_Mutation_p.D50E	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	50	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)													---	---	---	---
FAM47A	158724	broad.mit.edu	37	X	34148699	34148699	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4277-01	TCGA-BR-4277-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148699G>C	uc004ddg.2	-	1	1730	c.1697C>G	c.(1696-1698)TCC>TGC	p.S566C		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	566										ovary(4)|central_nervous_system(1)	5																		---	---	---	---
