Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRKCZ	5590	broad.mit.edu	37	1	2038182	2038183	+	Intron	INS	-	T	T	rs142626853	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2038182_2038183insT	uc001aiq.2	+						PRKCZ_uc001air.2_Intron|PRKCZ_uc010nyw.1_Intron|PRKCZ_uc001ais.2_Intron	NM_002744	NP_002735			protein kinase C, zeta isoform 1						anti-apoptosis|intracellular signal transduction|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein complex assembly|peptidyl-serine phosphorylation|platelet activation	endosome	ATP binding|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(2)	6	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)														---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3282508	3282509	+	Intron	INS	-	CA	CA	rs151037004	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3282508_3282509insCA	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
Unknown	0	broad.mit.edu	37	1	4001632	4001632	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4001632delG	uc001ali.1	+											Homo sapiens cDNA FLJ42718 fis, clone BRAMY3010411.																														---	---	---	---
ESPN	83715	broad.mit.edu	37	1	6502632	6502632	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6502632delA	uc001amy.2	+							NM_031475	NP_113663			espin						sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7559589	7559592	+	Intron	DEL	GTGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7559589_7559592delGTGT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	8995146	8995146	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8995146delT								ENO1 (56366 upstream) : CA6 (10776 downstream)																																			---	---	---	---
SLC25A33	84275	broad.mit.edu	37	1	9616740	9616741	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9616740_9616741delTG	uc001apw.2	+						SLC25A33_uc001apx.2_Intron	NM_032315	NP_115691			mitochondrial carrier protein MGC4399						transport	integral to membrane|mitochondrial inner membrane					0	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11628572	11628572	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11628572delT								PTCHD2 (30933 upstream) : FBXO2 (79878 downstream)																																			---	---	---	---
NPPB	4879	broad.mit.edu	37	1	11921016	11921017	+	5'Flank	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11921016_11921017delTG	uc001atj.2	-							NM_002521	NP_002512			natriuretic peptide precursor B preproprotein						body fluid secretion|cGMP biosynthetic process|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation	extracellular space	diuretic hormone activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)|Nesiritide(DB04899)|Testosterone(DB00624)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	12210941	12210944	+	IGR	DEL	AGTA	-	-	rs34365284		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12210941_12210944delAGTA								TNFRSF8 (6679 upstream) : TNFRSF1B (16116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14667573	14667573	+	IGR	DEL	G	-	-	rs36093736		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14667573delG								PRDM2 (516001 upstream) : KAZ (257640 downstream)																																			---	---	---	---
SPATA21	374955	broad.mit.edu	37	1	16729987	16729987	+	Intron	DEL	C	-	-	rs57948110		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16729987delC	uc001ayn.2	-						SPATA21_uc001ayl.1_Intron|SPATA21_uc010occ.1_Intron	NM_198546	NP_940948			spermatogenesis associated 21								calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	16857968	16857968	+	IGR	DEL	A	-	-	rs35890807		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16857968delA								CROCCL2 (38772 upstream) : NBPF1 (32444 downstream)																																			---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17224596	17224596	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17224596delC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17231626	17231626	+	Intron	DEL	C	-	-	rs67781706		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17231626delC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17730705	17730706	+	IGR	INS	-	TCCCTGCA	TCCCTGCA	rs148026761	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17730705_17730706insTCCCTGCA								PADI6 (2510 upstream) : RCC2 (2546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	18774151	18774152	+	IGR	INS	-	ACAC	ACAC	rs147080604	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18774151_18774152insACAC								IGSF21 (69175 upstream) : KLHDC7A (33272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	19189794	19189795	+	IGR	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19189794_19189795delAG								TAS1R2 (3639 upstream) : ALDH4A1 (8131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	23249252	23249252	+	IGR	DEL	G	-	-	rs35730381		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23249252delG								EPHB2 (7430 upstream) : KDM1A (96689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	24814056	24814057	+	IGR	INS	-	GGGA	GGGA	rs138251460	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24814056_24814057insGGGA								NIPAL3 (14584 upstream) : RCAN3 (15330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	25371430	25371430	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25371430delG								RUNX3 (79818 upstream) : SYF2 (177337 downstream)																																			---	---	---	---
NUDC	10726	broad.mit.edu	37	1	27253755	27253756	+	Intron	INS	-	GTGTGTGT	GTGTGTGT	rs60238934		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27253755_27253756insGTGTGTGT	uc001bng.1	+						NUDC_uc001bnh.1_Intron|NUDC_uc009vsq.1_Intron	NM_006600	NP_006591			nuclear distribution gene C homolog						cell proliferation|cytokinesis|mitotic prometaphase|multicellular organismal development	cytosol|microtubule|nucleoplasm	protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	28927485	28927485	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28927485delA								RAB42 (6399 upstream) : TAF12 (2126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30390115	30390118	+	IGR	DEL	CCTT	-	-	rs67289327		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30390115_30390118delCCTT								PTPRU (736800 upstream) : MATN1 (794008 downstream)																																			---	---	---	---
LCK	3932	broad.mit.edu	37	1	32717244	32717245	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32717244_32717245delCA	uc001bux.2	+							NM_005356	NP_005347			lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)			T	TRB@	T-ALL								---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34380012	34380013	+	Intron	DEL	TT	-	-	rs71278760		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34380012_34380013delTT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
ZMYM4	9202	broad.mit.edu	37	1	35826545	35826546	+	Intron	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35826545_35826546delTT	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron|ZMYM4_uc009vuv.2_Intron	NM_005095	NP_005086			zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
PSMB2	5690	broad.mit.edu	37	1	36093250	36093250	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36093250delA	uc001bzf.1	-						PSMB2_uc001bzd.1_Intron|PSMB2_uc010ohz.1_Intron|PSMB2_uc001bzg.1_Intron	NM_002794	NP_002785			proteasome beta 2 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)			Bortezomib(DB00188)													---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37387218	37387218	+	Intron	DEL	T	-	-	rs5773552		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37387218delT	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	37713258	37713259	+	IGR	INS	-	G	G	rs144340093	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37713258_37713259insG								GRIK3 (213414 upstream) : ZC3H12A (226860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	38601749	38601750	+	IGR	DEL	CT	-	-	rs71985067	byFrequency	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38601749_38601750delCT								POU3F1 (89299 upstream) : RRAGC (703265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	40372755	40372756	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40372755_40372756insT								MYCL1 (5068 upstream) : MFSD2A (48028 downstream)																																			---	---	---	---
RLF	6018	broad.mit.edu	37	1	40625376	40625377	+	5'Flank	INS	-	T	T	rs35252815		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40625376_40625377insT	uc001cfc.3	+							NM_012421	NP_036553			rearranged L-myc fusion						chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40895385	40895410	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGTATGTTC	-	-	rs71758403		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40895385_40895410delGTGTGTGTGTGTGTGTGTGTATGTTC								SMAP2 (6393 upstream) : ZNF643 (20369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	41962315	41962316	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41962315_41962316insG								EDN2 (11971 upstream) : HIVEP3 (13369 downstream)																																			---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	41992915	41992916	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41992915_41992916delCA	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	41997540	41997541	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41997540_41997541delAG	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42029864	42029869	+	Intron	DEL	AACAAC	-	-	rs111651796		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42029864_42029869delAACAAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42753985	42753986	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42753985_42753986delAC	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	43211310	43211311	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43211310_43211311delAC								CLDN19 (5385 upstream) : LEPRE1 (695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	43594572	43594575	+	Intron	DEL	ACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43594572_43594575delACAC	uc009vwn.1	+											Homo sapiens cDNA, FLJ99785.																														---	---	---	---
RNF220	55182	broad.mit.edu	37	1	45032425	45032425	+	Intron	DEL	A	-	-	rs34534355		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45032425delA	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620			ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
EIF2B3	8891	broad.mit.edu	37	1	45323742	45323743	+	Intron	INS	-	TT	TT	rs34216953		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45323742_45323743insTT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098			eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
AKR1A1	10327	broad.mit.edu	37	1	46017651	46017652	+	Intron	INS	-	TGTA	TGTA	rs151130624	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46017651_46017652insTGTA	uc001cod.2	+						AKR1A1_uc009vxw.2_Intron|AKR1A1_uc001coe.2_Intron	NM_006066	NP_006057			aldo-keto reductase family 1, member A1						glucose metabolic process		alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
TMEM69	51249	broad.mit.edu	37	1	46157213	46157214	+	Intron	INS	-	A	A	rs139037973		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46157213_46157214insA	uc001cor.1	+							NM_016486	NP_057570			transmembrane protein 69							integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
CYP4Z1	199974	broad.mit.edu	37	1	47574193	47574194	+	Intron	INS	-	A	A	rs146408398	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47574193_47574194insA	uc001cqu.1	+							NM_178134	NP_835235			cytochrome P450 4Z1							endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1																		---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49068405	49068407	+	Intron	DEL	GAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49068405_49068407delGAA	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49390822	49390823	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49390822_49390823delAC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
ELAVL4	1996	broad.mit.edu	37	1	50584176	50584176	+	Intron	DEL	G	-	-	rs34446002		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50584176delG	uc001csb.2	+						ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc009vyu.2_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771			ELAV-like 4 isoform 1						mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	50834811	50834812	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50834811_50834812insG								ELAVL4 (167271 upstream) : DMRTA2 (48417 downstream)																																			---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54021942	54021943	+	Intron	INS	-	GT	GT	rs141155406		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54021942_54021943insGT	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56197743	56197743	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56197743delT	uc001cyi.1	+	3	1131	c.698delT	c.(697-699)CTTfs	p.L233fs						SubName: Full=cDNA FLJ45337 fis, clone BRHIP3007960;																														---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57654064	57654064	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57654064delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57920791	57920791	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57920791delA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
FGGY	55277	broad.mit.edu	37	1	60049430	60049430	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60049430delC	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron|FGGY_uc001czm.3_Intron	NM_018291	NP_060761			FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)																	---	---	---	---
NFIA	4774	broad.mit.edu	37	1	61896327	61896328	+	Intron	INS	-	T	T	rs139341915	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61896327_61896328insT	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron|NFIA_uc001czx.2_Intron|NFIA_uc009wae.2_Intron	NM_001134673	NP_001128145			nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2																		---	---	---	---
ROR1	4919	broad.mit.edu	37	1	64326261	64326262	+	Intron	INS	-	AT	AT	rs4988640		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64326261_64326262insAT	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003			receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19																		---	---	---	---
LEPR	3953	broad.mit.edu	37	1	66006524	66006524	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66006524delT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294			leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)														---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75701086	75701086	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75701086delT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
GIPC2	54810	broad.mit.edu	37	1	78524567	78524567	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78524567delA	uc001dik.2	+							NM_017655	NP_060125			PDZ domain protein GIPC2							cytoplasm				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	79156848	79156848	+	IGR	DEL	T	-	-	rs113890110		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79156848delT								IFI44 (27087 upstream) : ELTD1 (198603 downstream)																																			---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85991986	85991987	+	Intron	INS	-	A	A	rs145128420		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85991986_85991987insA	uc001dlc.2	-							NM_001134445	NP_001127917			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
COL24A1	255631	broad.mit.edu	37	1	86478408	86478408	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86478408delT	uc001dlj.2	-						COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850			collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)														---	---	---	---
PKN2	5586	broad.mit.edu	37	1	89284330	89284331	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89284330_89284331insA	uc001dmn.2	+						PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron|PKN2_uc010osr.1_Intron	NM_006256	NP_006247			protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)														---	---	---	---
GBP5	115362	broad.mit.edu	37	1	89732536	89732537	+	Intron	DEL	AT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89732536_89732537delAT	uc001dnc.2	-						GBP5_uc001dnd.2_Intron|GBP5_uc001dne.1_Intron	NM_052942	NP_443174			guanylate-binding protein 5							plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)														---	---	---	---
TGFBR3	7049	broad.mit.edu	37	1	92210134	92210135	+	Intron	INS	-	A	A	rs146023266	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92210134_92210135insA	uc001doh.2	-						TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234			transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)														---	---	---	---
BRDT	676	broad.mit.edu	37	1	92449770	92449770	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92449770delT	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072			testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	102570687	102570692	+	IGR	DEL	ACACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102570687_102570692delACACAC								OLFM3 (107897 upstream) : COL11A1 (771332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	115912945	115912945	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115912945delT								NGF (32088 upstream) : VANGL1 (271629 downstream)																																			---	---	---	---
CASQ2	845	broad.mit.edu	37	1	116285390	116285397	+	Intron	DEL	TGTTTGTT	-	-	rs113458296		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116285390_116285397delTGTTTGTT	uc001efx.3	-						CASQ2_uc010owu.1_Intron	NM_001232	NP_001223			cardiac calsequestrin 2 precursor						heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	116777559	116777560	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116777559_116777560insA								C1orf161 (99698 upstream) : ATP1A1 (137444 downstream)																																			---	---	---	---
IGSF3	3321	broad.mit.edu	37	1	117137539	117137540	+	Intron	INS	-	G	G	rs143026687		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117137539_117137540insG	uc001egr.1	-						IGSF3_uc001egq.1_Intron|IGSF3_uc001egs.1_Intron	NM_001007237	NP_001007238			immunoglobulin superfamily, member 3 isoform 2							integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119280999	119280999	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119280999delA								SPAG17 (553151 upstream) : TBX15 (144667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	120431013	120431014	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120431013_120431014insG								NBPF7 (43234 upstream) : ADAM30 (5143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142547915	142547916	+	IGR	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142547915_142547916delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142635221	142635222	+	Intron	INS	-	G	G	rs140870989		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142635221_142635222insG	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142649332	142649333	+	Intron	INS	-	TT	TT	rs141768307	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142649332_142649333insTT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142942940	142942941	+	Intron	DEL	TA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142942940_142942941delTA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143421994	143421994	+	IGR	DEL	T	-	-	rs111792001		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143421994delT								None (None upstream) : LOC100286793 (225645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143541217	143541218	+	IGR	DEL	TA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143541217_143541218delTA								None (None upstream) : LOC100286793 (106421 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144529132	144529133	+	Intron	INS	-	G	G	rs75901853		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144529132_144529133insG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144530924	144530924	+	Intron	DEL	T	-	-	rs11326928		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144530924delT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144855333	144855334	+	Intron	INS	-	G	G	rs112069674		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144855333_144855334insG	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145057178	145057179	+	Intron	INS	-	AGA	AGA	rs3978504		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145057178_145057179insAGA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145112049	145112050	+	Intron	INS	-	GTG	GTG	rs147351886		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145112049_145112050insGTG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145194411	145194413	+	Intron	DEL	AAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145194411_145194413delAAC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145237179	145237179	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145237179delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145268060	145268060	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145268060delC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145310834	145310834	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145310834delA	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_5'Flank|NBPF10_uc010oyl.1_5'Flank|NBPF10_uc001emq.1_Intron|NBPF10_uc010oyj.1_5'Flank	NM_001039703	NP_001034792			hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145582055	145582056	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145582055_145582056delTG	uc001emp.3	+						PIAS3_uc001eoc.1_Intron|PIAS3_uc001eod.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	146471954	146471954	+	IGR	DEL	A	-	-	rs67168403		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146471954delA								NBPF10 (47859 upstream) : LOC728989 (18941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	146522077	146522092	+	IGR	DEL	GGAAGGAAGGAAGGAG	-	-	rs141929879	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146522077_146522092delGGAAGGAAGGAAGGAG								LOC728989 (7478 upstream) : PRKAB2 (104595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848809	148848809	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848809delT								NBPF16 (90498 upstream) : LOC645166 (79477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148855824	148855826	+	IGR	DEL	GGG	-	-	rs59129261		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148855824_148855826delGGG								NBPF16 (97513 upstream) : LOC645166 (72460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152916953	152916953	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152916953delA								IVL (32592 upstream) : SPRR4 (26175 downstream)																																			---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154687909	154687910	+	Intron	INS	-	A	A	rs78293198		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154687909_154687910insA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
PKLR	5313	broad.mit.edu	37	1	155261286	155261286	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155261286delA	uc001fkb.3	-						RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Intron	NM_000298	NP_000289			pyruvate kinase, liver and RBC isoform 1						endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)													---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155459265	155459266	+	Intron	DEL	AA	-	-	rs75302304		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155459265_155459266delAA	uc009wqq.2	-						ASH1L_uc001fkt.2_Intron|ASH1L_uc009wqr.1_Intron	NM_018489	NP_060959			absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	157348865	157348868	+	IGR	DEL	ACAA	-	-	rs10533809		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157348865_157348868delACAA								ETV3 (240482 upstream) : FCRL5 (134300 downstream)																																			---	---	---	---
SLAMF1	6504	broad.mit.edu	37	1	160582213	160582213	+	Intron	DEL	C	-	-	rs2025515	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160582213delC	uc001fwl.3	-						SLAMF1_uc010pjk.1_Intron|SLAMF1_uc010pjl.1_Intron|SLAMF1_uc010pjm.1_Intron	NM_003037	NP_003028			signaling lymphocytic activation molecule family						interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	160647008	160647015	+	IGR	DEL	GTGTGTGC	-	-	rs71090318		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160647008_160647015delGTGTGTGC								SLAMF1 (29927 upstream) : CD48 (1523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	162029217	162029220	+	IGR	DEL	TGTG	-	-	rs147401999		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162029217_162029220delTGTG								OLFML2B (35573 upstream) : NOS1AP (10361 downstream)																																			---	---	---	---
NUF2	83540	broad.mit.edu	37	1	163305960	163305960	+	Intron	DEL	T	-	-	rs35212467		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163305960delT	uc001gcq.1	+						NUF2_uc001gcp.2_Intron|NUF2_uc001gcr.1_Intron|NUF2_uc009wvc.1_Intron	NM_145697	NP_663735			NUF2, NDC80 kinetochore complex component						cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)																	---	---	---	---
TBX19	9095	broad.mit.edu	37	1	168262597	168262598	+	Intron	INS	-	G	G	rs145449033	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168262597_168262598insG	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140			T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)																	---	---	---	---
XCL2	6846	broad.mit.edu	37	1	168513367	168513367	+	5'Flank	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168513367delA	uc001gfn.3	-							NM_003175	NP_003166			chemokine (C motif) ligand 2 precursor						blood circulation|chemotaxis|immune response|signal transduction	extracellular space	chemokine activity			ovary(1)	1	all_hematologic(923;0.215)																	---	---	---	---
NME7	29922	broad.mit.edu	37	1	169187550	169187551	+	Intron	INS	-	C	C	rs150691009	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169187550_169187551insC	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
NME7	29922	broad.mit.edu	37	1	169202364	169202365	+	Intron	INS	-	C	C	rs148001709	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169202364_169202365insC	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462			nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	170055841	170055842	+	IGR	INS	-	TTCC	TTCC	rs71772416		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170055841_170055842insTTCC								KIFAP3 (11962 upstream) : METTL11B (59346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	172826258	172826259	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172826258_172826259delGA								FASLG (190248 upstream) : TNFSF18 (184101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	173997136	173997136	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173997136delA								RC3H1 (34926 upstream) : RABGAP1L (131498 downstream)																																			---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174948083	174948083	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174948083delT	uc001gkd.3	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkh.3_Intron|uc010pmv.1_Intron					RecName: Full=RAB GTPase-activating protein 1-like;						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
TNN	63923	broad.mit.edu	37	1	175043621	175043630	+	Intron	DEL	AAAAAAAAAA	-	-	rs71807343		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175043621_175043630delAAAAAAAAAA	uc001gkl.1	+						TNN_uc010pmx.1_5'Flank	NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
SEC16B	89866	broad.mit.edu	37	1	177982159	177982159	+	Intron	DEL	T	-	-	rs34872192		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177982159delT	uc001glj.1	-						SEC16B_uc001glk.1_Intron|uc001glm.2_Intron	NM_033127	NP_149118			leucine zipper transcription regulator 2						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4																		---	---	---	---
ABL2	27	broad.mit.edu	37	1	179155512	179155514	+	Intron	DEL	TTG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179155512_179155514delTTG	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	1	184320812	184320815	+	IGR	DEL	AGGA	-	-	rs71904036	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184320812_184320815delAGGA								TSEN15 (277471 upstream) : C1orf21 (35335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	185346636	185346638	+	IGR	DEL	AGG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185346636_185346638delAGG								IVNS1ABP (60175 upstream) : HMCN1 (357045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188815192	188815192	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188815192delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191187903	191187904	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191187903_191187904insT								FAM5C (741144 upstream) : RGS18 (939688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192767640	192767640	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192767640delC								RGS13 (138253 upstream) : RGS2 (10529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195108939	195108940	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195108939_195108940insT								None (None upstream) : None (None downstream)																																			---	---	---	---
NEK7	140609	broad.mit.edu	37	1	198237492	198237493	+	Intron	INS	-	GTT	GTT	rs145016298	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198237492_198237493insGTT	uc001gun.3	+							NM_133494	NP_598001			NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198299917	198299918	+	IGR	INS	-	CT	CT	rs138505037	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198299917_198299918insCT								NEK7 (8371 upstream) : ATP6V1G3 (192438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	198936950	198936950	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198936950delA								MIR181A1 (108668 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	198955205	198955205	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198955205delT								MIR181A1 (126923 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	199900646	199900647	+	IGR	INS	-	A	A	rs78974556		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199900646_199900647insA								None (None upstream) : NR5A2 (96123 downstream)																																			---	---	---	---
TMEM9	252839	broad.mit.edu	37	1	201121290	201121291	+	Intron	DEL	GT	-	-	rs34970698		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201121290_201121291delGT	uc001gvw.2	-						TMEM9_uc001gvx.2_Intron|TMEM9_uc001gvy.2_Intron|TMEM9_uc010ppo.1_Intron|TMEM9_uc001gvz.2_Intron|TMEM9_uc001gwa.2_Intron|TMEM9_uc010ppp.1_Intron	NM_016456	NP_057540			transmembrane protein 9 precursor						transport	integral to membrane|late endosome membrane|lysosomal membrane					0		Breast(1374;0.000301)																---	---	---	---
CNTN2	6900	broad.mit.edu	37	1	205013587	205013587	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205013587delG	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron	NM_005076	NP_005067			contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
RASSF5	83593	broad.mit.edu	37	1	206730309	206730309	+	Intron	DEL	A	-	-	rs28362485		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206730309delA	uc001hed.2	+						RASSF5_uc001hec.1_Intron|RASSF5_uc001hee.2_Intron|RASSF5_uc001hef.2_5'Flank	NM_182663	NP_872604			Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	208431041	208431042	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208431041_208431042delTG								PLXNA2 (13376 upstream) : None (None downstream)																																			---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210584941	210584941	+	Intron	DEL	A	-	-	rs3835413		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210584941delA	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron	NM_001122834	NP_001116306			hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	210909161	210909164	+	Intron	DEL	ACAG	-	-	rs34116468		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210909161_210909164delACAG	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	211811089	211811090	+	IGR	INS	-	T	T	rs71652269		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211811089_211811090insT								SLC30A1 (58990 upstream) : NEK2 (25025 downstream)																																			---	---	---	---
DTL	51514	broad.mit.edu	37	1	212237237	212237238	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212237237_212237238insT	uc009xdc.2	+						DTL_uc010ptb.1_Intron|DTL_uc001hiz.3_Intron	NM_016448	NP_057532			denticleless homolog						DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212425053	212425054	+	IGR	INS	-	C	C	rs145280517	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212425053_212425054insC								DTL (146867 upstream) : PPP2R5A (33825 downstream)																																			---	---	---	---
VASH2	79805	broad.mit.edu	37	1	213132790	213132791	+	Intron	DEL	CA	-	-	rs150636800		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213132790_213132791delCA	uc001hjy.2	+						VASH2_uc001hju.2_Intron|VASH2_uc001hjv.2_Intron|VASH2_uc001hjx.2_Intron|VASH2_uc010ptn.1_Intron|VASH2_uc001hjw.2_Intron	NM_001136475	NP_001129947			vasohibin 2 isoform 3						positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	213638123	213638123	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213638123delT								RPS6KC1 (191316 upstream) : PROX1 (523163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	220676844	220676845	+	IGR	INS	-	T	T	rs72227217		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220676844_220676845insT								RAB3GAP2 (231001 upstream) : MARK1 (24723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222060520	222060521	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222060520_222060521delGT								DUSP10 (145059 upstream) : HHIPL2 (635081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224199532	224199541	+	IGR	DEL	GAACGGACAT	-	-	rs66516167	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224199532_224199541delGAACGGACAT								TP53BP2 (165858 upstream) : FBXO28 (102250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224253082	224253087	+	IGR	DEL	AAAAGA	-	-	rs112280480		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224253082_224253087delAAAAGA								TP53BP2 (219408 upstream) : FBXO28 (48704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226633541	226633541	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226633541delT								PARP1 (37740 upstream) : C1orf95 (102960 downstream)																																			---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228504701	228504702	+	Intron	INS	-	CTCC	CTCC	rs138582117	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228504701_228504702insCTCC	uc009xez.1	+						OBSCN_uc001hsn.2_Intron	NM_001098623	NP_001092093			obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228542936	228542936	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228542936delT	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsr.1_Intron|OBSCN_uc009xfa.2_Intron	NM_001098623	NP_001092093			obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230247954	230247955	+	Intron	DEL	AT	-	-	rs150798249		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230247954_230247955delAT	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230327573	230327574	+	Intron	INS	-	T	T	rs139599544	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230327573_230327574insT	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	231276869	231276870	+	IGR	INS	-	TG	TG	rs66888803		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231276869_231276870insTG								FAM89A (100874 upstream) : TRIM67 (21804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232432431	232432432	+	IGR	DEL	TG	-	-	rs76276397		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232432431_232432432delTG								DISC1 (255415 upstream) : SIPA1L2 (101282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234995370	234995370	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234995370delC								IRF2BP2 (250099 upstream) : TOMM20 (277290 downstream)																																			---	---	---	---
LYST	1130	broad.mit.edu	37	1	235854216	235854216	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235854216delT	uc001hxj.2	-						LYST_uc001hxi.2_Intron	NM_000081	NP_000072			lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)											Chediak-Higashi_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	238712537	238712537	+	IGR	DEL	A	-	-	rs34551720		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238712537delA								LOC339535 (63220 upstream) : CHRM3 (837328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	240148045	240148048	+	IGR	DEL	AGGA	-	-	rs74342196		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240148045_240148048delAGGA								CHRM3 (75330 upstream) : FMN2 (107137 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240434718	240434718	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240434718delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyf.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
KMO	8564	broad.mit.edu	37	1	241718443	241718444	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241718443_241718444delAC	uc009xgp.2	+						KMO_uc001hyy.2_Intron|KMO_uc009xgo.1_Intron	NM_003679	NP_003670			kynurenine 3-monooxygenase						pyridine nucleotide biosynthetic process|response to salt stress	cytosol|integral to membrane|mitochondrial outer membrane	electron carrier activity|flavin adenine dinucleotide binding|kynurenine 3-monooxygenase activity|NAD(P)H oxidase activity			ovary(2)	2	Ovarian(103;0.103)|all_lung(81;0.23)		OV - Ovarian serous cystadenocarcinoma(106;0.0176)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245446118	245446118	+	Intron	DEL	A	-	-	rs34770861		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245446118delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245678374	245678375	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245678374_245678375insT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1332690	1332691	+	Intron	INS	-	AC	AC	rs150897263	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1332690_1332691insAC	uc002qwq.2	+						SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1601571	1601572	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1601571_1601572delAC								TPO (55073 upstream) : PXDN (34088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	3013608	3013609	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3013608_3013609delAC	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4457770	4457771	+	IGR	INS	-	TC	TC	rs145936042	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4457770_4457771insTC								ALLC (707512 upstream) : None (None downstream)																																			---	---	---	---
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198			UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
RNF144A	9781	broad.mit.edu	37	2	7104194	7104195	+	Intron	INS	-	A	A	rs148297328	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7104194_7104195insA	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561			ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	8808450	8808451	+	IGR	INS	-	TGGATGGA	TGGATGGA	rs148366581	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8808450_8808451insTGGATGGA								LOC339788 (691473 upstream) : ID2 (10889 downstream)																																			---	---	---	---
KIDINS220	57498	broad.mit.edu	37	2	8979865	8979865	+	5'Flank	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8979865delC	uc002qzc.2	-						KIDINS220_uc010yiv.1_5'Flank|KIDINS220_uc002qzd.2_5'Flank|KIDINS220_uc010yiw.1_5'Flank	NM_020738	NP_065789			kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
TAF1B	9014	broad.mit.edu	37	2	10065718	10065719	+	Intron	INS	-	T	T	rs142118247	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10065718_10065719insT	uc002qzz.2	+						TAF1B_uc010yja.1_Intron|TAF1B_uc010exd.2_Intron	NM_005680	NP_005671			TBP-associated factor 1B						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)|pancreas(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	12293343	12293351	+	Intron	DEL	TTCCTTCCC	-	-	rs112549370		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293343_12293351delTTCCTTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12580572	12580573	+	Intron	INS	-	A	A	rs145160416	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12580572_12580573insA	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	14071686	14071686	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14071686delA								None (None upstream) : FAM84A (701170 downstream)																																			---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15424643	15424643	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15424643delA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15536618	15536618	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15536618delA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	17381237	17381237	+	IGR	DEL	G	-	-	rs150618555	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17381237delG								FAM49A (534141 upstream) : RAD51AP2 (310749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18269646	18269647	+	IGR	INS	-	C	C	rs138920501	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18269646_18269647insC								KCNS3 (155422 upstream) : NT5C1B (466344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19109639	19109640	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19109639_19109640delGA								NT5C1B (338801 upstream) : OSR1 (441607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20316339	20316340	+	IGR	DEL	AC	-	-	rs141918581	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20316339_20316340delAC								LAPTM4A (64550 upstream) : SDC1 (84218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	26529476	26529476	+	IGR	DEL	C	-	-	rs67398764		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26529476delC								HADHB (16144 upstream) : GPR113 (1565 downstream)																																			---	---	---	---
DPYSL5	56896	broad.mit.edu	37	2	27148654	27148655	+	Intron	INS	-	T	T	rs143397965	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27148654_27148655insT	uc002rhu.3	+						DPYSL5_uc002rhv.3_Intron	NM_020134	NP_064519			dihydropyrimidinase-like 5						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28430253	28430255	+	Intron	DEL	CAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28430253_28430255delCAG	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28547495	28547495	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28547495delA	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron|BRE_uc002rlx.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
WDR43	23160	broad.mit.edu	37	2	29123690	29123690	+	Intron	DEL	A	-	-	rs67234759		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29123690delA	uc002rmo.2	+							NM_015131	NP_055946			WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ALK	238	broad.mit.edu	37	2	29723429	29723430	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29723429_29723430insT	uc002rmy.2	-							NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	30878477	30878478	+	IGR	INS	-	AA	AA	rs144477365	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30878477_30878478insAA								LCLAT1 (11387 upstream) : CAPN13 (67162 downstream)																																			---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31337142	31337142	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31337142delA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
TTC27	55622	broad.mit.edu	37	2	32876055	32876056	+	Intron	INS	-	T	T	rs150376405	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32876055_32876056insT	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205			tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1																		---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33328694	33328695	+	Intron	DEL	GA	-	-	rs71871697		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33328694_33328695delGA	uc002ros.2	+							NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	35042712	35042713	+	IGR	DEL	GG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35042712_35042713delGG								None (None upstream) : None (None downstream)																																			---	---	---	---
VIT	5212	broad.mit.edu	37	2	36970546	36970546	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36970546delT	uc002rpl.2	+						VIT_uc002rpk.2_Intron|VIT_uc010ynf.1_Intron|VIT_uc002rpm.2_Intron|VIT_uc010ezv.2_Intron|VIT_uc010ezw.2_Intron	NM_053276	NP_444506			vitrin							proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	37983304	37983304	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37983304delC								CDC42EP3 (83978 upstream) : FAM82A1 (169158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	38009092	38009093	+	IGR	DEL	AA	-	-	rs72152858		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38009092_38009093delAA								CDC42EP3 (109766 upstream) : FAM82A1 (143369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	38098803	38098804	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38098803_38098804delGT								CDC42EP3 (199477 upstream) : FAM82A1 (53658 downstream)																																			---	---	---	---
FAM82A1	151393	broad.mit.edu	37	2	38196934	38196936	+	Intron	DEL	TAT	-	-	rs138514860		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38196934_38196936delTAT	uc002rql.2	+						FAM82A1_uc002rqn.1_Intron|FAM82A1_uc002rqk.1_Intron|FAM82A1_uc002rqm.2_Intron	NM_144713	NP_653314			family with sequence similarity 82, member A1							cytoplasm|integral to membrane|microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40687003	40687004	+	Intron	DEL	AC	-	-	rs4952626	byFrequency;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40687003_40687004delAC	uc002rsd.3	-						SLC8A1_uc002rsc.1_Intron	NM_001112802	NP_001106273			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	40773960	40773960	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40773960delA								SLC8A1 (34385 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	40794680	40794680	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40794680delG								SLC8A1 (55105 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41211409	41211409	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41211409delT								SLC8A1 (471834 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	43419145	43419145	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43419145delA								HAAO (399394 upstream) : ZFP36L2 (30397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	44107472	44107475	+	IGR	DEL	CTGG	-	-	rs146430307		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44107472_44107475delCTGG								ABCG8 (1868 upstream) : LRPPRC (5888 downstream)																																			---	---	---	---
LRPPRC	10128	broad.mit.edu	37	2	44183617	44183618	+	Intron	INS	-	GTGT	GTGT	rs139697233	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44183617_44183618insGTGT	uc002rtr.2	-						LRPPRC_uc010yob.1_Intron	NM_133259	NP_573566			leucine-rich PPR motif-containing protein						mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44601961	44601962	+	Intron	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44601961_44601962insG	uc002rum.2	+						C2orf34_uc002rul.2_Intron	NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	45224046	45224046	+	IGR	DEL	A	-	-	rs34239087		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45224046delA								SIX3 (51656 upstream) : SIX2 (8279 downstream)																																			---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	45935329	45935330	+	Intron	INS	-	TGGTT	TGGTT	rs147829918	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45935329_45935330insTGGTT	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	52179994	52179994	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52179994delT								NRXN1 (920320 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	54540179	54540179	+	IGR	DEL	A	-	-	rs67575344		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54540179delA								ACYP2 (7746 upstream) : C2orf73 (17892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57032240	57032240	+	IGR	DEL	T	-	-	rs79859095		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57032240delT								CCDC85A (418932 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	58628955	58628970	+	IGR	DEL	TTGCATCACTGTGACA	-	-	rs58283809		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58628955_58628970delTTGCATCACTGTGACA								FANCL (160440 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60615804	60615804	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60615804delA								None (None upstream) : BCL11A (62499 downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61483709	61483709	+	Intron	DEL	A	-	-	rs34025877		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61483709delA	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	66513105	66513106	+	IGR	INS	-	A	A	rs146340409	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66513105_66513106insA								SPRED2 (853449 upstream) : MEIS1 (149426 downstream)																																			---	---	---	---
C2orf42	54980	broad.mit.edu	37	2	70397879	70397879	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70397879delA	uc002sgh.2	-							NM_017880	NP_060350			hypothetical protein LOC54980												0																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71799589	71799590	+	Intron	DEL	AA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71799589_71799590delAA	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71845626	71845627	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845626_71845627delTG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	72016356	72016356	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72016356delT								DYSF (102464 upstream) : CYP26B1 (340011 downstream)																																			---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72968233	72968233	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72968233delA	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
TACR1	6869	broad.mit.edu	37	2	75280479	75280480	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75280479_75280480delGT	uc002sng.2	-						TACR1_uc002snh.2_Intron	NM_001058	NP_001049			tachykinin receptor 1 isoform long						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	75669496	75669500	+	IGR	DEL	TCTCT	-	-	rs35233072		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75669496_75669500delTCTCT								TACR1 (242851 upstream) : FAM176A (49944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76921784	76921784	+	IGR	DEL	A	-	-	rs71245360		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76921784delA								C2orf3 (983673 upstream) : LRRTM4 (53074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78233326	78233326	+	IGR	DEL	G	-	-	rs113415601		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78233326delG								SNAR-H (51174 upstream) : None (None downstream)																																			---	---	---	---
VAMP5	10791	broad.mit.edu	37	2	85816341	85816341	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85816341delT	uc002spu.1	+							NM_006634	NP_006625			vesicle-associated membrane protein 5						cell differentiation|vesicle-mediated transport	endomembrane system					0																		---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89080308	89080309	+	Intron	INS	-	T	T	rs148848437	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89080308_89080309insT	uc010fhf.2	+						FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90417154	90417155	+	Intron	INS	-	ATG	ATG			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417154_90417155insATG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91738526	91738527	+	IGR	INS	-	TCA	TCA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91738526_91738527insTCA								None (None upstream) : LOC654342 (66665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91760068	91760069	+	IGR	INS	-	TT	TT	rs71210356		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91760068_91760069insTT								None (None upstream) : LOC654342 (45123 downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91833173	91833174	+	Intron	DEL	GT	-	-	rs141082857	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91833173_91833174delGT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91842719	91842720	+	Intron	INS	-	T	T	rs146839621		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91842719_91842720insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91849866	91849867	+	5'Flank	INS	-	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91849866_91849867insC	uc002sts.3	-						LOC654342_uc002stt.2_5'Flank|LOC654342_uc010yub.1_5'Flank					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	92178604	92178606	+	IGR	DEL	GAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92178604_92178606delGAT								FKSG73 (48110 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92248353	92248353	+	IGR	DEL	G	-	-	rs145975949		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92248353delG								FKSG73 (117859 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92267303	92267303	+	IGR	DEL	G	-	-	rs113640567		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92267303delG								FKSG73 (136809 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317133	92317133	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317133delC								FKSG73 (186639 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																																			---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100167616	100167619	+	3'UTR	DEL	GTGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100167616_100167619delGTGT	uc002tag.2	-	24					AFF3_uc002taf.2_3'UTR	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
IL1R1	3554	broad.mit.edu	37	2	102765406	102765409	+	Intron	DEL	AAAC	-	-	rs113874460		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102765406_102765409delAAAC	uc002tbq.2	+						IL1R1_uc010fix.2_Intron|IL1R1_uc002tbp.2_Intron	NM_000877	NP_000868			interleukin 1 receptor, type I precursor						innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	104943163	104943164	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104943163_104943164insA								None (None upstream) : LOC150568 (107641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105760541	105760541	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105760541delC								MRPS9 (44124 upstream) : GPR45 (97659 downstream)																																			---	---	---	---
SULT1C2	6819	broad.mit.edu	37	2	108911234	108911235	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108911234_108911235delAC	uc002tdy.2	+						SULT1C2_uc010ywp.1_Intron|SULT1C2_uc002tdx.2_Intron|SULT1C2_uc010ywq.1_Intron	NM_001056	NP_001047			sulfotransferase family, cytosolic, 1C, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|amine metabolic process|sulfation|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	sulfotransferase activity			ovary(1)	1																		---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	110017146	110017147	+	Intron	INS	-	CACT	CACT	rs144940599	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110017146_110017147insCACT	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
PAX8	7849	broad.mit.edu	37	2	114004900	114004900	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114004900delC	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457			paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2								T	PPARG	follicular thyroid		Thyroid dysgenesis 						---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115945637	115945638	+	Intron	INS	-	AG	AG	rs147853855	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115945637_115945638insAG	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	117473146	117473147	+	IGR	INS	-	TA	TA	rs140056466	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117473146_117473147insTA								DPP10 (871210 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	117743774	117743775	+	IGR	DEL	AC	-	-	rs112375651		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117743774_117743775delAC								None (None upstream) : DDX18 (828480 downstream)																																			---	---	---	---
SCTR	6344	broad.mit.edu	37	2	120207552	120207555	+	Intron	DEL	GGAA	-	-	rs72227108		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120207552_120207555delGGAA	uc002tma.2	-						SCTR_uc002tlz.2_Intron	NM_002980	NP_002971			secretin receptor precursor						digestion|excretion	integral to plasma membrane	secretin receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3					Secretin(DB00021)													---	---	---	---
RALB	5899	broad.mit.edu	37	2	121034187	121034188	+	Intron	INS	-	A	A	rs4848585		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121034187_121034188insA	uc002tmk.2	+						RALB_uc010yys.1_Intron|RALB_uc002tml.2_Intron|RALB_uc002tmm.2_Intron|RALB_uc010yyt.1_Intron	NM_002881	NP_002872			v-ral simian leukemia viral oncogene homolog B						apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)																---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125594758	125594758	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125594758delA	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	125839724	125839724	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125839724delC								CNTNAP5 (166863 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	125850526	125850529	+	IGR	DEL	CACA	-	-	rs72092004		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125850526_125850529delCACA								CNTNAP5 (177665 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126027230	126027231	+	IGR	INS	-	CTCCTT	CTCCTT	rs145625436	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126027230_126027231insCTCCTT								CNTNAP5 (354369 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127592049	127592050	+	IGR	INS	-	ATC	ATC	rs143740629	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127592049_127592050insATC								GYPC (137804 upstream) : BIN1 (213557 downstream)																																			---	---	---	---
IWS1	55677	broad.mit.edu	37	2	128242573	128242578	+	Intron	DEL	AAAAAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128242573_128242578delAAAAAG	uc002ton.2	-							NM_017969	NP_060439			IWS1 homolog						transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)														---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132981315	132981315	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981315delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133016676	133016677	+	5'Flank	INS	-	TGTC	TGTC	rs67307110		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133016676_133016677insTGTC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133042657	133042658	+	IGR	INS	-	T	T	rs148410218		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133042657_133042658insT								NCRNA00164 (27115 upstream) : GPR39 (131489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133050244	133050245	+	IGR	DEL	TG	-	-	rs8179688		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133050244_133050245delTG								NCRNA00164 (34702 upstream) : GPR39 (123902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133107763	133107764	+	IGR	INS	-	C	C	rs143923523	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133107763_133107764insC								NCRNA00164 (92221 upstream) : GPR39 (66383 downstream)																																			---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136455735	136455735	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136455735delT	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	136932363	136932364	+	IGR	INS	-	T	T	rs140895416	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136932363_136932364insT								CXCR4 (56638 upstream) : THSD7B (590751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143100072	143100073	+	IGR	INS	-	CT	CT	rs140390319	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143100072_143100073insCT								LRP1B (210802 upstream) : KYNU (535122 downstream)																																			---	---	---	---
KYNU	8942	broad.mit.edu	37	2	143789519	143789520	+	Intron	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143789519_143789520delGA	uc002tvl.2	+						KYNU_uc010fnm.2_Intron	NM_003937	NP_003928			kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	145593416	145593416	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145593416delT	uc002twc.2	+											Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	145752730	145752730	+	Intron	DEL	T	-	-	rs71963487		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145752730delT	uc002twc.2	+											Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																														---	---	---	---
LYPD6B	130576	broad.mit.edu	37	2	150055191	150055191	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150055191delT	uc002twv.1	+						LYPD6B_uc002tww.1_Intron|LYPD6B_uc002twx.1_Intron	NM_177964	NP_808879			LY6/PLAUR domain containing 6B							anchored to membrane|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	150976254	150976255	+	IGR	INS	-	GT	GT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150976254_150976255insGT								MMADHC (531924 upstream) : RND3 (348457 downstream)																																			---	---	---	---
FMNL2	114793	broad.mit.edu	37	2	153502243	153502244	+	Intron	INS	-	TATT	TATT	rs147924114	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153502243_153502244insTATT	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137			formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	154025059	154025060	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154025059_154025060delGT								ARL6IP6 (407292 upstream) : RPRM (308792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	155314017	155314018	+	5'Flank	INS	-	T	T	rs148322559	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155314017_155314018insT	uc002tyu.1	-											Homo sapiens cDNA FLJ33594 fis, clone BRAMY2012776.																														---	---	---	---
KCNJ3	3760	broad.mit.edu	37	2	155633554	155633555	+	Intron	INS	-	CACA	CACA	rs139699959	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155633554_155633555insCACA	uc002tyv.1	+						KCNJ3_uc010zce.1_Intron	NM_002239	NP_002230			potassium inwardly-rectifying channel J3						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	157031317	157031324	+	Intron	DEL	CACACACA	-	-	rs112528637		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157031317_157031324delCACACACA	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																														---	---	---	---
UPP2	151531	broad.mit.edu	37	2	158919041	158919042	+	Intron	INS	-	G	G	rs142890977	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158919041_158919042insG	uc002tzo.2	+							NM_001135098	NP_001128570			uridine phosphorylase 2 isoform b						nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160226071	160226072	+	Intron	DEL	AA	-	-	rs35359076		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160226071_160226072delAA	uc002uao.2	-						BAZ2B_uc002uap.2_Intron	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	162968484	162968484	+	IGR	DEL	C	-	-	rs71408201		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162968484delC								DPP4 (37432 upstream) : GCG (30905 downstream)																																			---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168111418	168111418	+	Intron	DEL	T	-	-	rs111733963		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168111418delT	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc010fpq.2_Intron|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594			xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
STK39	27347	broad.mit.edu	37	2	169075797	169075797	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169075797delA	uc002uea.2	-							NM_013233	NP_037365			serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170689445	170689445	+	Intron	DEL	A	-	-	rs140979216		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170689445delA	uc010zdi.1	+							NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
GORASP2	26003	broad.mit.edu	37	2	171783482	171783483	+	5'Flank	INS	-	AA	AA	rs4668347	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171783482_171783483insAA	uc002ugk.2	+						GORASP2_uc002ugj.2_5'Flank|GORASP2_uc010zdl.1_5'Flank|GORASP2_uc010zdm.1_5'Flank	NM_015530	NP_056345			golgi reassembly stacking protein 2							Golgi membrane				breast(1)|central_nervous_system(1)	2																		---	---	---	---
RAPGEF4	11069	broad.mit.edu	37	2	173793097	173793097	+	Intron	DEL	A	-	-	rs3835838		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173793097delA	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc002uhw.3_Intron|RAPGEF4_uc010zec.1_Intron|RAPGEF4_uc010zed.1_Intron|RAPGEF4_uc010zee.1_Intron|RAPGEF4_uc010fqo.2_Intron|RAPGEF4_uc010zef.1_Intron|RAPGEF4_uc010zeg.1_Intron|RAPGEF4_uc010fqp.1_Intron|RAPGEF4_uc010zeh.1_Intron	NM_007023	NP_008954			Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	177591298	177591298	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177591298delC								MIR1246 (125518 upstream) : HNRNPA3 (486124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	177866962	177866962	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177866962delT								MIR1246 (401182 upstream) : HNRNPA3 (210460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	181978885	181978886	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181978885_181978886delGT								UBE2E3 (50735 upstream) : ITGA4 (342733 downstream)																																			---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182370039	182370039	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182370039delT	uc002unu.2	+						ITGA4_uc010frj.1_Intron	NM_000885	NP_000876			integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
PDE1A	5136	broad.mit.edu	37	2	183359651	183359652	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183359651_183359652insT	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683			phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	184388841	184388841	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184388841delA								NUP35 (362434 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185333884	185333884	+	IGR	DEL	C	-	-	rs75772534		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185333884delC								None (None upstream) : ZNF804A (129209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	189044343	189044343	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189044343delT								TFPI (625124 upstream) : GULP1 (112261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	190149798	190149799	+	IGR	DEL	GT	-	-	rs35708879		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190149798_190149799delGT								COL5A2 (105193 upstream) : WDR75 (156360 downstream)																																			---	---	---	---
MYO1B	4430	broad.mit.edu	37	2	192287561	192287561	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192287561delT	uc010fsg.2	+						MYO1B_uc002usq.2_Intron|MYO1B_uc002usr.2_Intron|MYO1B_uc002usu.2_Intron|MYO1B_uc002usv.2_Intron	NM_001130158	NP_001123630			myosin IB isoform 1							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	192415064	192415068	+	IGR	DEL	TCTTT	-	-	rs140639524		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192415064_192415068delTCTTT								MYO1B (124949 upstream) : OBFC2A (127730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	192575827	192575828	+	IGR	DEL	TG	-	-	rs67023395		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192575827_192575828delTG								OBFC2A (22580 upstream) : SDPR (123213 downstream)																																			---	---	---	---
TMEFF2	23671	broad.mit.edu	37	2	193061411	193061411	+	5'Flank	DEL	T	-	-	rs112398432		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193061411delT	uc002utc.2	-						TMEFF2_uc002utd.1_5'Flank	NM_016192	NP_057276			transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	193866302	193866321	+	IGR	DEL	GAAAGAAAGAAAGAAAGAAA	-	-	rs7355353	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193866302_193866321delGAAAGAAAGAAAGAAAGAAA								PCGEM1 (224681 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194871611	194871611	+	IGR	DEL	A	-	-	rs35707364		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194871611delA								None (None upstream) : None (None downstream)																																			---	---	---	---
SATB2	23314	broad.mit.edu	37	2	200239887	200239887	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200239887delA	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080			SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	200609154	200609155	+	IGR	INS	-	AC	AC	rs144649594	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200609154_200609155insAC								FLJ32063 (267496 upstream) : C2orf69 (166824 downstream)																																			---	---	---	---
C2orf47	79568	broad.mit.edu	37	2	200821762	200821763	+	Intron	INS	-	T	T	rs71403495		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200821762_200821763insT	uc002uvm.2	+						C2orf60_uc002uvj.3_5'Flank|C2orf60_uc002uvi.3_5'Flank|C2orf60_uc002uvk.3_5'Flank|C2orf60_uc010fss.2_5'Flank|C2orf60_uc002uvl.2_5'Flank	NM_024520	NP_078796			hypothetical protein LOC79568 precursor							mitochondrion					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	201619757	201619758	+	IGR	INS	-	TG	TG	rs139895685	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201619757_201619758insTG								AOX1 (83542 upstream) : AOX2P (15637 downstream)																																			---	---	---	---
ALS2CR11	151254	broad.mit.edu	37	2	202367621	202367622	+	Intron	INS	-	T	T	rs147931608	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202367621_202367622insT	uc002uye.2	-						ALS2CR11_uc002uyf.2_Intron|ALS2CR11_uc010fti.2_Intron	NM_152525	NP_689738			amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	203870262	203870262	+	IGR	DEL	A	-	-	rs146316458		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203870262delA								ALS2CR8 (19202 upstream) : NBEAL1 (9340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	213613032	213613033	+	IGR	DEL	AT	-	-	rs148296234	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213613032_213613033delAT								ERBB4 (209680 upstream) : IKZF2 (251380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217484706	217484707	+	IGR	INS	-	GT	GT	rs139726700	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217484706_217484707insGT								RPL37A (118520 upstream) : IGFBP2 (13420 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218537764	218537765	+	Intron	INS	-	G	G	rs145256552	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218537764_218537765insG	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218738747	218738748	+	Intron	DEL	AC	-	-	rs3838561		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218738747_218738748delAC	uc002vgt.2	-						TNS1_uc002vgr.2_Intron|TNS1_uc002vgs.2_Intron|TNS1_uc010zjv.1_Intron|TNS1_uc010fvj.1_Intron|TNS1_uc010fvk.1_Intron|TNS1_uc002vgu.3_Intron|TNS1_uc010fvi.1_Intron	NM_022648	NP_072174			tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)														---	---	---	---
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435			RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	223599967	223599968	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223599967_223599968delTG								MOGAT1 (25318 upstream) : ACSL3 (125764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	223831821	223831821	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223831821delC								ACSL3 (22467 upstream) : KCNE4 (85041 downstream)																																			---	---	---	---
AGFG1	3267	broad.mit.edu	37	2	228386580	228386580	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228386580delT	uc002vpc.2	+						AGFG1_uc002vpd.2_Intron|AGFG1_uc002vpe.2_Intron|AGFG1_uc002vpf.2_Intron	NM_004504	NP_004495			HIV-1 Rev binding protein isoform 2						cell differentiation|mRNA export from nucleus|multicellular organismal development|regulation of ARF GTPase activity|spermatogenesis	cytoplasmic membrane-bounded vesicle|Golgi apparatus|nuclear pore	ARF GTPase activator activity|DNA binding|protein binding|RNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	228799970	228799970	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228799970delA								WDR69 (10944 upstream) : SPHKAP (44700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229371229	229371229	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229371229delA								SPHKAP (324868 upstream) : PID1 (517461 downstream)																																			---	---	---	---
PID1	55022	broad.mit.edu	37	2	230003582	230003583	+	Intron	INS	-	A	A	rs146663435	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230003582_230003583insA	uc002vpr.3	-						PID1_uc002vps.3_Intron|PID1_uc002vpt.3_Intron|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288			phosphotyrosine interaction domain containing 1							cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
GPR55	9290	broad.mit.edu	37	2	231784701	231784701	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231784701delA	uc002vrg.2	-						GPR55_uc002vrf.2_Intron|GPR55_uc010fxs.1_Intron	NM_005683	NP_005674			G protein-coupled receptor 55						activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)														---	---	---	---
SPATA3	130560	broad.mit.edu	37	2	231861033	231861059	+	In_Frame_Del	DEL	CAGCAGCCTAGCCCTGAATCCACACCA	-	-	rs72362780	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231861033_231861059delCAGCAGCCTAGCCCTGAATCCACACCA	uc010zmd.1	+	1	195_221	c.85_111delCAGCAGCCTAGCCCTGAATCCACACCA	c.(85-111)CAGCAGCCTAGCCCTGAATCCACACCAdel	p.QQPSPESTP47del	SPATA3_uc002vri.3_RNA|SPATA3_uc002vrk.2_RNA|uc002vrh.1_5'Flank	NM_139073	NP_620712	Q8NHX4	SPTA3_HUMAN	testis and spermatogenesis cell apoptosis	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment_46					apoptosis|spermatogenesis						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	232509782	232509785	+	IGR	DEL	CTTT	-	-	rs144976269		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232509782_232509785delCTTT								C2orf57 (50790 upstream) : PTMA (63450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	232779512	232779515	+	IGR	DEL	CACC	-	-	rs72149301		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232779512_232779515delCACC								MIR1471 (22504 upstream) : NPPC (10620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	233729249	233729249	+	IGR	DEL	T	-	-	rs142790459		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233729249delT								GIGYF2 (3964 upstream) : C2orf82 (5745 downstream)																																			---	---	---	---
HJURP	55355	broad.mit.edu	37	2	234754723	234754724	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234754723_234754724insA	uc002vvg.2	-						HJURP_uc010znd.1_Intron|HJURP_uc010zne.1_Intron	NM_018410	NP_060880			Holliday junction recognition protein						cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)														---	---	---	---
TRPM8	79054	broad.mit.edu	37	2	234909846	234909846	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234909846delG	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron|TRPM8_uc010fyk.2_Intron	NM_024080	NP_076985			transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	235487033	235487036	+	IGR	DEL	ACAG	-	-	rs57728413		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235487033_235487036delACAG								ARL4C (81340 upstream) : SH3BP4 (373592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235577594	235577594	+	IGR	DEL	A	-	-	rs35353958		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235577594delA								ARL4C (171901 upstream) : SH3BP4 (283034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235814284	235814285	+	IGR	INS	-	AGGAAGGA	AGGAAGGA	rs144538901	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235814284_235814285insAGGAAGGA								ARL4C (408591 upstream) : SH3BP4 (46343 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236632409	236632410	+	Intron	INS	-	GTTG	GTTG	rs142782969	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236632409_236632410insGTTG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	237096855	237096855	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237096855delT								GBX2 (20203 upstream) : ASB18 (6661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237099614	237099614	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237099614delG								GBX2 (22962 upstream) : ASB18 (3902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237803587	237803587	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237803587delG								CXCR7 (312595 upstream) : COPS8 (190497 downstream)																																			---	---	---	---
MLPH	79083	broad.mit.edu	37	2	238445094	238445094	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238445094delC	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron|MLPH_uc002vwx.2_Intron|MLPH_uc010fyu.2_Intron	NM_024101	NP_077006			melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)														---	---	---	---
LRRFIP1	9208	broad.mit.edu	37	2	238575383	238575384	+	Intron	INS	-	TTCTTTCA	TTCTTTCA	rs148788618	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238575383_238575384insTTCTTTCA	uc002vxc.2	+							NM_001137550	NP_001131022			leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)														---	---	---	---
CAPN10	11132	broad.mit.edu	37	2	241543625	241543625	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241543625delC	uc002vzq.1	+						GPR35_uc010fzh.1_5'Flank|GPR35_uc010fzi.1_5'Flank	NM_023089	NP_075577			calpain 10 isoform g						actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)														---	---	---	---
ANO7	50636	broad.mit.edu	37	2	242147349	242147349	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242147349delG	uc002wax.2	+							NM_001001891	NP_001001891			transmembrane protein 16G isoform NGEP long							cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	3247054	3247055	+	IGR	INS	-	TTT	TTT	rs147800002		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3247054_3247055insTTT								CRBN (25664 upstream) : SUMF1 (575981 downstream)																																			---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4043726	4043727	+	Intron	INS	-	AG	AG	rs145763818	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4043726_4043727insAG	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4196300	4196301	+	Intron	INS	-	A	A	rs148014227	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4196300_4196301insA	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	4204589	4204590	+	Intron	INS	-	AA	AA	rs35485011		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4204589_4204590insAA	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	6330076	6330077	+	IGR	INS	-	ACTAT	ACTAT	rs140473403	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6330076_6330077insACTAT								None (None upstream) : GRM7 (572725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	8446895	8446895	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8446895delA	uc003bqp.2	-											Homo sapiens cDNA FLJ42094 fis, clone TESOP2002489.																														---	---	---	---
C3orf32	51066	broad.mit.edu	37	3	8716552	8716552	+	Intron	DEL	G	-	-	rs61088154		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8716552delG	uc003bqz.2	-						C3orf32_uc003bqx.2_Intron|C3orf32_uc003bqy.2_Intron	NM_015931	NP_057015			hypothetical protein LOC51066											skin(1)	1																		---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10718210	10718211	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10718210_10718211delCA	uc003bvw.2	-							NM_001683	NP_001674			plasma membrane calcium ATPase 2 isoform 2						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
C3orf31	132001	broad.mit.edu	37	3	11833648	11833648	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11833648delT	uc003bwh.2	-						C3orf31_uc003bwj.2_Intron|C3orf31_uc003bwi.2_Intron	NM_138807	NP_620162			MMP37-like protein, mitochondrial precursor						protein import into mitochondrial matrix	extrinsic to mitochondrial inner membrane					0																		---	---	---	---
FBLN2	2199	broad.mit.edu	37	3	13581628	13581629	+	Intron	INS	-	G	G	rs140695523	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13581628_13581629insG	uc011auz.1	+							NM_001998	NP_001989			fibulin 2 isoform b precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)															---	---	---	---
ZFYVE20	64145	broad.mit.edu	37	3	15136532	15136533	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15136532_15136533delTG	uc003bzm.1	-						ZFYVE20_uc010hek.1_Intron|ZFYVE20_uc011avn.1_Intron	NM_022340	NP_071735			FYVE-finger-containing Rab5 effector protein						blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17325581	17325582	+	Intron	INS	-	AC	AC	rs144105126	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17325581_17325582insAC	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	19025647	19025648	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19025647_19025648delTG								SATB1 (545395 upstream) : KCNH8 (164369 downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21540082	21540083	+	Intron	INS	-	G	G	rs147796268	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21540082_21540083insG	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973			zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22461336	22461337	+	IGR	INS	-	TA	TA	rs35511215		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22461336_22461337insTA								ZNF385D (47213 upstream) : UBE2E2 (783316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	22728029	22728032	+	IGR	DEL	TGTT	-	-	rs10605201		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22728029_22728032delTGTT								ZNF385D (313906 upstream) : UBE2E2 (516621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	28115649	28115650	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28115649_28115650insA								EOMES (351443 upstream) : CMC1 (167474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	29211704	29211705	+	IGR	INS	-	A	A	rs147222810	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29211704_29211705insA								ZCWPW2 (645074 upstream) : RBMS3 (111238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30738762	30738763	+	IGR	DEL	CT	-	-	rs67716009		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30738762_30738763delCT								TGFBR2 (3131 upstream) : GADL1 (28929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	32512512	32512523	+	IGR	DEL	GAAGAAGAAGAA	-	-	rs419851	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32512512_32512523delGAAGAAGAAGAA								CMTM7 (16179 upstream) : CMTM6 (10281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	33024795	33024795	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33024795delT								CCR4 (28392 upstream) : GLB1 (13305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	36343099	36343102	+	IGR	DEL	ATGT	-	-	rs138677376		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36343099_36343102delATGT								ARPP21 (507112 upstream) : STAC (78995 downstream)																																			---	---	---	---
TRANK1	9881	broad.mit.edu	37	3	36871811	36871811	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36871811delA	uc003cgj.2	-							NM_014831	NP_055646			lupus brain antigen 1						DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TRANK1	9881	broad.mit.edu	37	3	36881962	36881963	+	Intron	INS	-	T	T	rs143152210	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36881962_36881963insT	uc003cgj.2	-							NM_014831	NP_055646			lupus brain antigen 1						DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38691567	38691568	+	5'Flank	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38691567_38691568delAC	uc003cio.2	-						SCN5A_uc003cin.2_5'Flank|SCN5A_uc003cil.3_5'Flank|SCN5A_uc010hhi.2_5'Flank|SCN5A_uc010hhk.2_5'Flank|SCN5A_uc011ayr.1_5'Flank	NM_198056	NP_932173			voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	39937408	39937409	+	Intron	DEL	GT	-	-	rs67301098		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39937408_39937409delGT	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41858559	41858560	+	Intron	DEL	TG	-	-	rs112818675		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41858559_41858560delTG	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	42056298	42056299	+	IGR	INS	-	T	T	rs36126155		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42056298_42056299insT								ULK4 (52638 upstream) : TRAK1 (76447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45121343	45121344	+	IGR	INS	-	CTC	CTC	rs144003276	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45121343_45121344insCTC								CLEC3B (43781 upstream) : CDCP1 (2426 downstream)																																			---	---	---	---
PRKAR2A	5576	broad.mit.edu	37	3	48864596	48864597	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48864596_48864597insT	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)														---	---	---	---
SLC25A20	788	broad.mit.edu	37	3	48933574	48933574	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48933574delA	uc003cva.3	-						SLC25A20_uc011bbw.1_Intron|SLC25A20_uc010hkj.2_Intron	NM_000387	NP_000378			carnitine/acylcarnitine translocase						carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)													---	---	---	---
RAD54L2	23132	broad.mit.edu	37	3	51665236	51665236	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51665236delC	uc011bdt.1	+						RAD54L2_uc003dbh.2_Intron|RAD54L2_uc011bdu.1_Intron|RAD54L2_uc003dbj.2_Intron	NM_015106	NP_055921			RAD54-like 2							nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)														---	---	---	---
SEMA3G	56920	broad.mit.edu	37	3	52468302	52468302	+	3'UTR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52468302delA	uc003dea.1	-	16						NM_020163	NP_064548			semaphorin sem2 precursor						multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	52843189	52843189	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52843189delC								ITIH3 (164 upstream) : ITIH4 (3818 downstream)																																			---	---	---	---
DCP1A	55802	broad.mit.edu	37	3	53329505	53329505	+	Intron	DEL	A	-	-	rs112694751		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53329505delA	uc003dgs.3	-						DCP1A_uc003dgt.3_Intron	NM_018403	NP_060873			DCP1 decapping enzyme homolog A						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)														---	---	---	---
CCDC66	285331	broad.mit.edu	37	3	56591278	56591279	+	Frame_Shift_Ins	INS	-	GGGGTAAGCA	GGGGTAAGCA	rs150150392	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56591278_56591279insGGGGTAAGCA	uc003dhz.2	+	1	95_96	c.8_9insGGGGTAAGCA	c.(7-9)TTGfs	p.L3fs	CCDC66_uc003dhy.2_5'UTR|CCDC66_uc003dhu.2_Intron|CCDC66_uc003dhx.2_RNA|CCDC66_uc003dhv.2_RNA|CCDC66_uc003dhw.2_Frame_Shift_Ins_p.L3fs	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1	3										breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	56732629	56732630	+	IGR	INS	-	A	A	rs11406950		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56732629_56732630insA								C3orf63 (15494 upstream) : ARHGEF3 (28816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	57243640	57243640	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57243640delG								HESX1 (9360 upstream) : APPL1 (18125 downstream)																																			---	---	---	---
FAM107A	11170	broad.mit.edu	37	3	58614165	58614165	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58614165delT	uc003dko.2	-							NM_007177	NP_009108			downregulated in renal cell carcinoma						regulation of cell growth	nucleus	protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000189)|Kidney(10;0.000536)|KIRC - Kidney renal clear cell carcinoma(10;0.000716)|OV - Ovarian serous cystadenocarcinoma(275;0.154)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62790229	62790230	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62790229_62790230insT	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	67938405	67938406	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67938405_67938406insA	uc003dnc.2	+											Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																														---	---	---	---
FAM19A1	407738	broad.mit.edu	37	3	68337530	68337531	+	Intron	INS	-	A	A	rs72584293	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68337530_68337531insA	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774			family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)														---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69336796	69336796	+	Intron	DEL	T	-	-	rs78688753		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69336796delT	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnx.1_Intron	NM_015123	NP_055938			FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	70299560	70299561	+	IGR	DEL	TC	-	-	rs71674617		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70299560_70299561delTC								MITF (282074 upstream) : FOXP1 (705176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	71685374	71685375	+	IGR	INS	-	T	T	rs11436770		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71685374_71685375insT								FOXP1 (52234 upstream) : EIF4E3 (43067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73168133	73168134	+	IGR	DEL	TA	-	-	rs34652130		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73168133_73168134delTA								PPP4R2 (53122 upstream) : PDZRN3 (263518 downstream)																																			---	---	---	---
PDZRN3	23024	broad.mit.edu	37	3	73481001	73481002	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73481001_73481002delGT	uc003dpl.1	-						PDZRN3_uc011bgh.1_Intron|PDZRN3_uc010hoe.1_Intron|PDZRN3_uc011bgf.1_Intron|PDZRN3_uc011bgg.1_Intron	NM_015009	NP_055824			PDZ domain containing ring finger 3								ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)														---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75759317	75759317	+	RNA	DEL	A	-	-	rs139095200		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75759317delA	uc003dpw.3	-	6		c.1818delT								Homo sapiens cDNA FLJ41782 fis, clone IMR322018192, weakly  similar to ZINC FINGER PROTEIN 90.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75821362	75821363	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75821362_75821363delAG	uc011bgi.1	-						ZNF717_uc003dpw.3_Intron	NM_001128223	NP_001121695			zinc finger protein 717						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	75977922	75977923	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75977922_75977923delGT								ZNF717 (143252 upstream) : None (None downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77343480	77343480	+	Intron	DEL	T	-	-	rs56081629		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77343480delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	78320228	78320229	+	IGR	INS	-	C	C	rs149101175	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78320228_78320229insC								ROBO2 (623567 upstream) : ROBO1 (326159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80451378	80451379	+	IGR	INS	-	GGGGTCA	GGGGTCA	rs142602969	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80451378_80451379insGGGGTCA								ROBO1 (634319 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82035691	82035691	+	Intron	DEL	G	-	-	rs140604142	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82035691delG	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	82386024	82386025	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82386024_82386025delGT	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	82440566	82440567	+	Intron	DEL	TG	-	-	rs149832190		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82440566_82440567delTG	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	83601797	83601798	+	IGR	INS	-	A	A	rs143685499	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83601797_83601798insA								None (None upstream) : None (None downstream)																																			---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85397500	85397501	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85397500_85397501delTG	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85715860	85715861	+	Intron	INS	-	A	A	rs72585637		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85715860_85715861insA	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85801224	85801225	+	Intron	INS	-	AATCAC	AATCAC	rs140902837	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85801224_85801225insAATCAC	uc003dqj.2	+						CADM2_uc003dqk.2_Intron|CADM2_uc003dql.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
ARL13B	200894	broad.mit.edu	37	3	93723476	93723476	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93723476delA	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899			ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	94102125	94102125	+	IGR	DEL	T	-	-	rs78186349		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94102125delT								NSUN3 (256495 upstream) : LOC255025 (554982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	98028704	98028705	+	IGR	DEL	AG	-	-	rs148697717		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98028704_98028705delAG								OR5H2 (26028 upstream) : OR5K4 (43993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	98872647	98872647	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98872647delA								DCBLD2 (252114 upstream) : COL8A1 (484807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99100454	99100455	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99100454_99100455insT								DCBLD2 (479921 upstream) : COL8A1 (256999 downstream)																																			---	---	---	---
TOMM70A	9868	broad.mit.edu	37	3	100100774	100100775	+	Intron	INS	-	T	T	rs149548888	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100100774_100100775insT	uc003dtw.2	-							NM_014820	NP_055635			translocase of outer mitochondrial membrane 70						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane translocase complex	protein binding|protein transmembrane transporter activity			ovary(1)	1																		---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100330087	100330088	+	Intron	INS	-	TTTCCTTC	TTTCCTTC	rs71981038		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330087_100330088insTTTCCTTC	uc003duc.2	+							NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	102853530	102853531	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102853530_102853531delAC								ZPLD1 (654845 upstream) : None (None downstream)																																			---	---	---	---
MORC1	27136	broad.mit.edu	37	3	108759252	108759253	+	Intron	INS	-	G	G	rs58166584		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108759252_108759253insG	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244			MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8																		---	---	---	---
NAA50	80218	broad.mit.edu	37	3	113446005	113446005	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113446005delT	uc003ean.1	-						NAA50_uc010hqm.1_Intron|NAA50_uc011bij.1_Intron	NM_025146	NP_079422			N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0																		---	---	---	---
GRAMD1C	54762	broad.mit.edu	37	3	113545187	113545192	+	5'Flank	DEL	ACACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113545187_113545192delACACAC	uc011bil.1	+											Homo sapiens cDNA FLJ35862 fis, clone TESTI2007346.							integral to membrane				ovary(2)|skin(1)	3																		---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	115591056	115591056	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115591056delG	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	117195531	117195531	+	IGR	DEL	T	-	-	rs63411460		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117195531delT								LOC285194 (759646 upstream) : None (None downstream)																																			---	---	---	---
GSK3B	2932	broad.mit.edu	37	3	119672136	119672140	+	Intron	DEL	ATAAC	-	-	rs78565063		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119672136_119672140delATAAC	uc003edo.2	-						GSK3B_uc003edn.2_Intron	NM_001146156	NP_001139628			glycogen synthase kinase 3 beta isoform 2						axon guidance|epithelial to mesenchymal transition|ER overload response|glycogen metabolic process|hippocampus development|negative regulation of apoptosis|negative regulation of protein binding|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|positive regulation of cell-matrix adhesion|positive regulation of protein complex assembly|positive regulation of protein export from nucleus|positive regulation of Rac GTPase activity|regulation of microtubule-based process|superior temporal gyrus development	Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|nucleus|plasma membrane	ATP binding|beta-catenin binding|NF-kappaB binding|p53 binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|RNA polymerase II transcription factor binding|tau-protein kinase activity|ubiquitin protein ligase binding			lung(2)	2				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)													---	---	---	---
PARP15	165631	broad.mit.edu	37	3	122339668	122339669	+	Intron	INS	-	CTC	CTC	rs144316888	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122339668_122339669insCTC	uc003efm.2	+						PARP15_uc003efn.2_Intron|PARP15_uc003efo.1_Intron|PARP15_uc003efp.1_Intron|PARP15_uc011bjt.1_Intron	NM_001113523	NP_001106995			poly (ADP-ribose) polymerase family, member 15						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)														---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123332186	123332187	+	3'UTR	INS	-	T	T	rs148759894	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123332186_123332187insT	uc003ego.2	-	34					uc003egk.2_Intron|MYLK_uc003egl.2_3'UTR|MYLK_uc003egm.2_3'UTR|MYLK_uc010hrr.2_3'UTR|MYLK_uc011bjv.1_3'UTR|MYLK_uc011bjw.1_3'UTR|MYLK_uc003egp.2_3'UTR|MYLK_uc003egq.2_3'UTR|MYLK_uc003egr.2_3'UTR|MYLK_uc003egs.2_3'UTR	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
KALRN	8997	broad.mit.edu	37	3	123823355	123823355	+	Intron	DEL	T	-	-	rs78824676		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123823355delT	uc003ehg.2	+						KALRN_uc003ehd.2_Intron|KALRN_uc003ehe.2_Intron|KALRN_uc010hru.1_Intron|KALRN_uc010hrv.1_Intron|KALRN_uc010hrw.1_Intron|KALRN_uc003ehf.1_Intron|KALRN_uc011bjy.1_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
HEG1	57493	broad.mit.edu	37	3	124750498	124750499	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124750498_124750499delCA	uc003ehs.3	-						HEG1_uc011bke.1_Intron	NM_020733	NP_065784			HEG homolog 1 precursor							extracellular region|integral to membrane	calcium ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125118759	125118759	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125118759delT								ZNF148 (24561 upstream) : SNX4 (46736 downstream)																																			---	---	---	---
TXNRD3IT1	645840	broad.mit.edu	37	3	126352628	126352629	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126352628_126352629delGT	uc003ejd.1	-						TXNRD3IT1_uc011bkl.1_Intron					RecName: Full=Thioredoxin reductase 3;          EC=1.8.1.9; AltName: Full=Thioredoxin reductase TR2; AltName: Full=Thioredoxin and glutathione reductase;												0																		---	---	---	---
RAB7A	7879	broad.mit.edu	37	3	128442313	128442313	+	5'Flank	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128442313delA	uc003eks.1	+						RAB7A_uc010hsv.1_5'Flank	NM_004637	NP_004628			RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)														---	---	---	---
RAB7A	7879	broad.mit.edu	37	3	128470843	128470843	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128470843delC	uc003eks.1	+						RAB7A_uc010hsv.1_Intron	NM_004637	NP_004628			RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	129762944	129762945	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129762944_129762945delAC								TRH (66168 upstream) : ALG1L2 (37729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	133214593	133214594	+	IGR	INS	-	TGTGTG	TGTGTG			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133214593_133214594insTGTGTG								BFSP2 (20537 upstream) : CDV3 (77840 downstream)																																			---	---	---	---
TOPBP1	11073	broad.mit.edu	37	3	133361872	133361872	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133361872delT	uc003eps.2	-							NM_007027	NP_008958			topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7													Other_conserved_DNA_damage_response_genes					---	---	---	---
TF	7018	broad.mit.edu	37	3	133419816	133419816	+	5'UTR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133419816delT	uc003epu.1	+	2						NM_001063	NP_001054			transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	134298168	134298168	+	IGR	DEL	T	-	-	rs76315311		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134298168delT								CEP63 (4316 upstream) : KY (20599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	136769772	136769772	+	IGR	DEL	T	-	-	rs11287432		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136769772delT								IL20RB (39852 upstream) : SOX14 (713807 downstream)																																			---	---	---	---
CEP70	80321	broad.mit.edu	37	3	138314704	138314705	+	5'Flank	DEL	CA	-	-	rs141225493		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138314704_138314705delCA	uc003esl.2	-						CEP70_uc011bmk.1_5'Flank|CEP70_uc011bml.1_5'Flank|CEP70_uc011bmm.1_5'Flank|CEP70_uc003esm.2_5'Flank	NM_024491	NP_077817			centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1																		---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	139955704	139955707	+	Intron	DEL	TGTA	-	-	rs34438265		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139955704_139955707delTGTA	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
TRIM42	287015	broad.mit.edu	37	3	140395792	140395792	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140395792delT	uc003eto.1	+							NM_152616	NP_689829			tripartite motif-containing 42							intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143160671	143160672	+	Intron	INS	-	TCAT	TCAT	rs144760598	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143160671_143160672insTCAT	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	143904064	143904064	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143904064delG								C3orf58 (192855 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144792208	144792208	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144792208delC								None (None upstream) : PLOD2 (995020 downstream)																																			---	---	---	---
PLSCR2	57047	broad.mit.edu	37	3	146213571	146213574	+	Intron	DEL	TAGG	-	-	rs72286809		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146213571_146213574delTAGG	uc003evv.1	-						PLSCR2_uc003evw.1_Intron	NM_020359	NP_065092			phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	148094665	148094668	+	IGR	DEL	AAGG	-	-	rs56664243		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148094665_148094668delAAGG								ZIC1 (960161 upstream) : AGTR1 (320990 downstream)																																			---	---	---	---
RNF13	11342	broad.mit.edu	37	3	149599126	149599127	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149599126_149599127insT	uc003exn.3	+						RNF13_uc003exp.3_Intron|RNF13_uc010hvh.2_Intron	NM_007282	NP_009213			ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
RNF13	11342	broad.mit.edu	37	3	149636480	149636481	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149636480_149636481insT	uc003exn.3	+						RNF13_uc003exp.3_Intron|RNF13_uc010hvh.2_Intron	NM_007282	NP_009213			ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	149704765	149704768	+	IGR	DEL	GTTT	-	-	rs113990269		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149704765_149704768delGTTT								PFN2 (16024 upstream) : TSC22D2 (422020 downstream)																																			---	---	---	---
FAM194A	131831	broad.mit.edu	37	3	150421899	150421900	+	5'Flank	INS	-	C	C	rs148177227	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150421899_150421900insC	uc003eyg.2	-						FAM194A_uc003eyh.2_5'Flank	NM_152394	NP_689607			hypothetical protein LOC131831											skin(2)|ovary(1)	3																		---	---	---	---
CLRN1OS	116933	broad.mit.edu	37	3	150755152	150755152	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150755152delA	uc011bny.1	+						CLRN1OS_uc003eyl.2_Intron					Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0																		---	---	---	---
GPR171	29909	broad.mit.edu	37	3	150916119	150916120	+	3'UTR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150916119_150916120insT	uc003eyq.3	-	3					MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_013308	NP_037440			G protein-coupled receptor 171							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	153576370	153576370	+	IGR	DEL	T	-	-	rs11323991		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153576370delT								C3orf79 (355887 upstream) : SGEF (262779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	154483927	154483927	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154483927delG								GPR149 (336423 upstream) : MME (257986 downstream)																																			---	---	---	---
MLF1	4291	broad.mit.edu	37	3	158302456	158302457	+	Intron	INS	-	TGTT	TGTT	rs145296437	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158302456_158302457insTGTT	uc003fcb.2	+						MLF1_uc003fbz.2_Intron|MLF1_uc003fca.2_Intron|MLF1_uc003fbx.2_Intron|MLF1_uc003fcc.2_Intron|MLF1_uc003fby.2_Intron|MLF1_uc010hvx.2_Intron	NM_022443	NP_071888			myeloid leukemia factor 1 isoform 1						cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding				0		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)					T	NPM1	AML								---	---	---	---
RARRES1	5918	broad.mit.edu	37	3	158418231	158418232	+	Intron	INS	-	A	A	rs148404905	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158418231_158418232insA	uc003fci.2	-							NM_206963	NP_996846			retinoic acid receptor responder (tazarotene						negative regulation of cell proliferation	integral to membrane					0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)		Tretinoin(DB00755)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	161554638	161554639	+	IGR	INS	-	TTTG	TTTG	rs148429028	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161554638_161554639insTTTG								OTOL1 (332910 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164196006	164196007	+	IGR	INS	-	CCA	CCA	rs146501549	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164196006_164196007insCCA								MIR720 (136768 upstream) : SI (500680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164222800	164222801	+	IGR	INS	-	TG	TG	rs140259804	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164222800_164222801insTG								MIR720 (163562 upstream) : SI (473886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164541224	164541225	+	IGR	DEL	GT	-	-	rs72050433		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164541224_164541225delGT								MIR720 (481986 upstream) : SI (155462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166572939	166572940	+	IGR	DEL	CT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166572939_166572940delCT								None (None upstream) : ZBBX (385141 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169197058	169197059	+	Intron	INS	-	GT	GT	rs140877276	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169197058_169197059insGT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
SPATA16	83893	broad.mit.edu	37	3	172647347	172647348	+	Intron	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172647347_172647348delTC	uc003fin.3	-							NM_031955	NP_114161			spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173333534	173333535	+	Intron	DEL	TT	-	-	rs11294091		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173333534_173333535delTT	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	176388552	176388553	+	IGR	INS	-	AC	AC	rs145642034	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176388552_176388553insAC								NAALADL2 (865126 upstream) : TBL1XR1 (349990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176487539	176487542	+	IGR	DEL	AGGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176487539_176487542delAGGA								NAALADL2 (964113 upstream) : TBL1XR1 (251001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177193725	177193725	+	IGR	DEL	T	-	-	rs150000504		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177193725delT								TBL1XR1 (278677 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	178569564	178569565	+	Intron	INS	-	CC	CC	rs141910700	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178569564_178569565insCC	uc003fjb.1	-						uc003fjc.1_Intron					Homo sapiens clone N11 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	178601889	178601889	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178601889delA								KCNMB2 (39673 upstream) : ZMAT3 (139638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	179210614	179210614	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179210614delA								GNB4 (41243 upstream) : ACTL6A (70094 downstream)																																			---	---	---	---
USP13	8975	broad.mit.edu	37	3	179369129	179369129	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179369129delT	uc003fkh.2	+						USP13_uc003fkf.2_5'Flank	NM_003940	NP_003931			ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180462991	180462992	+	Intron	INS	-	T	T	rs139635906	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180462991_180462992insT	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	181692836	181692836	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181692836delT	uc003fky.2	+											Homo sapiens cDNA clone IMAGE:5296886.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	181860032	181860032	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181860032delA								SOX2OT (401029 upstream) : ATP11B (651259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	183301161	183301162	+	IGR	INS	-	A	A	rs146919489	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183301161_183301162insA								KLHL6 (27662 upstream) : KLHL24 (52249 downstream)																																			---	---	---	---
YEATS2	55689	broad.mit.edu	37	3	183520276	183520277	+	Intron	DEL	TG	-	-	rs72153823		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183520276_183520277delTG	uc003fly.2	+							NM_018023	NP_060493			YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183696686	183696688	+	Intron	DEL	TTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183696686_183696688delTTC	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679			ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
VPS8	23355	broad.mit.edu	37	3	184770402	184770403	+	3'UTR	INS	-	CTGG	CTGG	rs146346023	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184770402_184770403insCTGG	uc003fpb.1	+	47					VPS8_uc010hyd.1_3'UTR|VPS8_uc010hye.1_3'UTR	NM_015303	NP_056118			vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)															---	---	---	---
SENP2	59343	broad.mit.edu	37	3	185311015	185311015	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185311015delA	uc003fpn.2	+						SENP2_uc011brv.1_Intron|SENP2_uc011brw.1_Intron	NM_021627	NP_067640			SUMO1/sentrin/SMT3 specific protease 2						mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
DGKG	1608	broad.mit.edu	37	3	186067679	186067679	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186067679delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	187700802	187700802	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187700802delA								BCL6 (237327 upstream) : LPP (170917 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	189295780	189295800	+	IGR	DEL	TTCCTTCCTTCCTTCTTTCTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295780_189295800delTTCCTTCCTTCCTTCTTTCTT								TPRG1 (254510 upstream) : TP63 (53416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190976448	190976449	+	IGR	INS	-	A	A	rs112506713		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190976448_190976449insA								OSTN (8540 upstream) : UTS2D (8496 downstream)																																			---	---	---	---
UTS2D	257313	broad.mit.edu	37	3	191012821	191012826	+	Intron	DEL	AACAAC	-	-	rs113794484		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191012821_191012826delAACAAC	uc003fsu.2	-							NM_198152	NP_937795			urotensin 2 domain containing precursor							extracellular region	hormone activity				0	all_cancers(143;1.77e-09)|Ovarian(172;0.103)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	191635964	191635965	+	IGR	INS	-	TTG	TTG	rs139590035	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191635964_191635965insTTG								PYDC2 (456721 upstream) : FGF12 (223719 downstream)																																			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	191919942	191919942	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191919942delA	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360			fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	194358147	194358147	+	IGR	DEL	A	-	-	rs35166308		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194358147delA								TMEM44 (3729 upstream) : LSG1 (3371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194664225	194664226	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194664225_194664226delCA								FAM43A (254461 upstream) : C3orf21 (124789 downstream)																																			---	---	---	---
C3orf21	152002	broad.mit.edu	37	3	194910397	194910398	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194910397_194910398insA	uc003fum.3	-						C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744			hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197845126	197845126	+	IGR	DEL	C	-	-	rs143129956	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197845126delC								LOC348840 (37584 upstream) : FAM157A (34111 downstream)																																			---	---	---	---
FAM157A	728262	broad.mit.edu	37	3	197900525	197900525	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197900525delA	uc011bup.1	+						FAM157A_uc011buq.1_Intron	NM_001145248	NP_001138720			family with sequence similarity 157, member A												0																		---	---	---	---
WHSC1	7468	broad.mit.edu	37	4	1975943	1975943	+	Intron	DEL	T	-	-	rs112710017		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1975943delT	uc003gdz.3	+						WHSC1_uc003geb.3_Intron|WHSC1_uc003gec.3_Intron|WHSC1_uc003ged.3_Intron|WHSC1_uc003gee.3_Intron|WHSC1_uc003gef.3_Intron|WHSC1_uc003gei.3_Intron|WHSC1_uc011bvh.1_Intron|WHSC1_uc010icf.2_Intron|SCARNA22_uc003gej.2_5'Flank	NM_001042424	NP_001035889			Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)				T	IGH@	MM								---	---	---	---
Unknown	0	broad.mit.edu	37	4	2768387	2768388	+	IGR	INS	-	G	G	rs146562913	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2768387_2768388insG								TNIP2 (10284 upstream) : SH3BP2 (26362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3061119	3061120	+	IGR	INS	-	T	T	rs78202838		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3061119_3061120insT								GRK4 (18645 upstream) : HTT (15288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3570036	3570037	+	IGR	DEL	AT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3570036_3570037delAT								LRPAP1 (35812 upstream) : ADRA2C (198038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3585546	3585547	+	Intron	DEL	AT	-	-	rs140342020		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3585546_3585547delAT	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3607512	3607513	+	IGR	INS	-	C	C	rs144084479	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607512_3607513insC								LRPAP1 (73288 upstream) : ADRA2C (160562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	4826539	4826542	+	IGR	DEL	AGAC	-	-	rs10609944		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4826539_4826542delAGAC								STX18 (282764 upstream) : MSX1 (34850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	6664125	6664126	+	IGR	INS	-	C	C	rs141917200	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6664125_6664126insC								MRFAP1 (19676 upstream) : LOC93622 (11692 downstream)																																			---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7340148	7340149	+	Intron	INS	-	GGAT	GGAT	rs146823899	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7340148_7340149insGGAT	uc003gkb.3	+							NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8886277	8886277	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8886277delT								HMX1 (12734 upstream) : LOC650293 (65200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	9117904	9117904	+	IGR	DEL	C	-	-	rs1811572	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9117904delC								LOC650293 (165778 upstream) : USP17 (242205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11392764	11392765	+	IGR	INS	-	TT	TT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11392764_11392765insTT								MIR572 (22219 upstream) : HS3ST1 (7224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13500135	13500136	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13500135_13500136delAC								RAB28 (14146 upstream) : NKX3-2 (42318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13685394	13685394	+	Intron	DEL	T	-	-	rs35335417		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13685394delT	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	16975919	16975919	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16975919delA								LDB2 (75495 upstream) : QDPR (512101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17353580	17353581	+	IGR	INS	-	ACAC	ACAC	rs143573545	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17353580_17353581insACAC								LDB2 (453156 upstream) : QDPR (134439 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20925397	20925397	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20925397delA	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	23057392	23057393	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23057392_23057393delGT	uc003gqr.1	+											full-length cDNA clone CS0DB009YA06 of Neuroblastoma Cot 10-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	25504413	25504414	+	IGR	INS	-	GAGGATCA	GAGGATCA	rs138953835	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25504413_25504414insGAGGATCA								ANAPC4 (84294 upstream) : SLC34A2 (153021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	25954387	25954387	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25954387delT								C4orf52 (22887 upstream) : RBPJ (366945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33501559	33501561	+	IGR	DEL	ACC	-	-	rs147473335	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33501559_33501561delACC								None (None upstream) : None (None downstream)																																			---	---	---	---
TBC1D1	23216	broad.mit.edu	37	4	37920072	37920072	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37920072delT	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_015173	NP_055988			TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
KLHL5	51088	broad.mit.edu	37	4	39047657	39047657	+	Intron	DEL	T	-	-	rs71643260		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39047657delT	uc003gtp.2	+						KLHL5_uc003gtq.2_Intron	NM_001007075	NP_001007076			kelch-like 5 isoform 3							cytoplasm|cytoskeleton	actin binding			ovary(1)	1																		---	---	---	---
KLB	152831	broad.mit.edu	37	4	39441069	39441070	+	Intron	INS	-	TGTTGT	TGTTGT	rs144490438	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39441069_39441070insTGTTGT	uc003gua.2	+						KLB_uc011byj.1_Intron	NM_175737	NP_783864			klotho beta						carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	40844648	40844648	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40844648delG	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc003gvk.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	43043854	43043854	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43043854delA								GRXCR1 (11181 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	43758445	43758448	+	IGR	DEL	GTGT	-	-	rs144699680		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43758445_43758448delGTGT								GRXCR1 (725772 upstream) : KCTD8 (417474 downstream)																																			---	---	---	---
GABRG1	2565	broad.mit.edu	37	4	46091125	46091125	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46091125delT	uc003gxb.2	-							NM_173536	NP_775807			gamma-aminobutyric acid A receptor, gamma 1						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49217676	49217677	+	IGR	INS	-	C	C	rs146012723	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49217676_49217677insC								CWH43 (153583 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49223466	49223467	+	IGR	INS	-	G	G	rs144045729		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49223466_49223467insG								CWH43 (159373 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53455915	53455915	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53455915delA								SPATA18 (492458 upstream) : USP46 (1214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56962797	56962798	+	IGR	INS	-	AA	AA	rs34745267		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56962797_56962798insAA								CEP135 (63271 upstream) : KIAA1211 (73563 downstream)																																			---	---	---	---
HOPX	84525	broad.mit.edu	37	4	57518025	57518030	+	Intron	DEL	AGAGAG	-	-	rs72305569		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57518025_57518030delAGAGAG	uc011cad.1	-						HOPX_uc003hcc.2_Intron|HOPX_uc003hca.2_Intron|HOPX_uc003hcb.2_Intron|HOPX_uc003hcd.2_Intron|HOPX_uc003hce.2_Intron|HOPX_uc003hbz.2_Intron	NM_001145459	NP_001138931			HOP homeobox isoform b						negative regulation of cell differentiation|trophectodermal cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	58261965	58261966	+	IGR	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58261965_58261966delTC								IGFBP7 (285426 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59821583	59821584	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59821583_59821584insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60463533	60463533	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60463533delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65021031	65021032	+	IGR	DEL	TG	-	-	rs62408464		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65021031_65021032delTG								None (None upstream) : TECRL (123153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65656143	65656143	+	IGR	DEL	C	-	-	rs10707593		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65656143delC								TECRL (380965 upstream) : EPHA5 (529139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66003229	66003230	+	IGR	INS	-	T	T	rs147675492	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66003229_66003230insT								TECRL (728051 upstream) : EPHA5 (182052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66061381	66061384	+	IGR	DEL	CCAT	-	-	rs11471063		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66061381_66061384delCCAT								TECRL (786203 upstream) : EPHA5 (123898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66084344	66084344	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66084344delA								TECRL (809166 upstream) : EPHA5 (100938 downstream)																																			---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66482146	66482147	+	Intron	INS	-	AC	AC	rs138218681	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66482146_66482147insAC	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67148090	67148091	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67148090_67148091delCA								MIR1269 (5444 upstream) : None (None downstream)																																			---	---	---	---
SLC4A4	8671	broad.mit.edu	37	4	72236465	72236466	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72236465_72236466insT	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc003hga.2_Intron|SLC4A4_uc003hgb.3_Intron	NM_001098484	NP_001091954			solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	72741832	72741868	+	IGR	DEL	GTTCCTTCCTTCCTTCTCTCCCTTCCTTCCTTCCTTT	-	-	rs62302243	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72741832_72741868delGTTCCTTCCTTCCTTCTCTCCCTTCCTTCCTTCCTTT								GC (72074 upstream) : NPFFR2 (155653 downstream)																																			---	---	---	---
NPFFR2	10886	broad.mit.edu	37	4	72944804	72944805	+	Intron	INS	-	AT	AT	rs150336442	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72944804_72944805insAT	uc003hgg.2	+						NPFFR2_uc010iig.1_Intron|NPFFR2_uc003hgi.2_Intron|NPFFR2_uc003hgh.2_Intron	NM_004885	NP_004876			neuropeptide FF receptor 2 isoform 1						detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)															---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73252307	73252308	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73252307_73252308delAG	uc003hgk.1	-							NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73261530	73261531	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73261530_73261531delTG	uc003hgk.1	-							NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
MTHFD2L	441024	broad.mit.edu	37	4	75142871	75142872	+	Intron	INS	-	T	T	rs34775353		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75142871_75142872insT	uc011cbk.1	+						MTHFD2L_uc003hhu.2_Intron	NM_001144978	NP_001138450			methylenetetrahydrofolate dehydrogenase 2-like						folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process		binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity			ovary(1)|central_nervous_system(1)	2			all cancers(17;0.0101)|Lung(101;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78270221	78270222	+	IGR	INS	-	AG	AG	rs149326620	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78270221_78270222insAG								CCNG2 (179011 upstream) : CXCL13 (162685 downstream)																																			---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79101922	79101922	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79101922delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	82613662	82613667	+	IGR	DEL	ACACAC	-	-	rs113495572		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82613662_82613667delACACAC								RASGEF1B (220601 upstream) : HNRNPD (660800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	83082999	83083000	+	IGR	INS	-	C	C	rs142626688	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83082999_83083000insC								RASGEF1B (689938 upstream) : HNRNPD (191467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	83342987	83342987	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83342987delT								HNRNPD (47838 upstream) : HNRPDL (1362 downstream)																																			---	---	---	---
THAP9	79725	broad.mit.edu	37	4	83830065	83830065	+	Intron	DEL	T	-	-	rs151031304		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83830065delT	uc003hnt.2	+						THAP9_uc003hns.1_Intron|THAP9_uc003hnu.1_Intron|THAP9_uc003hnv.2_Intron	NM_024672	NP_078948			THAP domain containing 9								DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)																---	---	---	---
HPSE	10855	broad.mit.edu	37	4	84243940	84243941	+	Intron	INS	-	TT	TT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84243940_84243941insTT	uc003hoj.3	-						HPSE_uc010ika.2_Intron|HPSE_uc011ccq.1_Intron|HPSE_uc011ccr.1_Intron|HPSE_uc011ccs.1_Intron|HPSE_uc011cct.1_Intron|HPSE_uc003hok.3_Intron	NM_001098540	NP_001092010			heparanase precursor						carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	86108620	86108620	+	IGR	DEL	T	-	-	rs113926151		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86108620delT								C4orf12 (180452 upstream) : ARHGAP24 (287664 downstream)																																			---	---	---	---
HERC3	8916	broad.mit.edu	37	4	89611992	89611992	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89611992delT	uc003hrw.1	+						HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_014606	NP_055421			hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	90335200	90335201	+	IGR	INS	-	AA	AA	rs35971262		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90335200_90335201insAA								GPRIN3 (106039 upstream) : SNCA (310050 downstream)																																			---	---	---	---
SNCA	6622	broad.mit.edu	37	4	90709231	90709232	+	Intron	DEL	GA	-	-	rs147934079		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90709231_90709232delGA	uc003hsq.2	-						SNCA_uc010ikt.2_Intron|SNCA_uc003hso.2_Intron|SNCA_uc003hsp.2_Intron|SNCA_uc003hsr.2_Intron	NM_001146054	NP_001139526			alpha-synuclein isoform NACP140						activation of caspase activity|anti-apoptosis|negative regulation of dopamine uptake|negative regulation of exocytosis|negative regulation of histone acetylation|negative regulation of microtubule polymerization|negative regulation of monooxygenase activity|negative regulation of norepinephrine uptake|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of serotonin uptake|negative regulation of thrombin receptor signaling pathway|negative regulation of transporter activity|positive regulation of endocytosis|positive regulation of inositol phosphate biosynthetic process|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein serine/threonine kinase activity|positive regulation of receptor recycling|positive regulation of release of sequestered calcium ion into cytosol|receptor internalization|regulation of phospholipase activity|response to interferon-gamma|response to interleukin-1|response to iron(II) ion|response to lipopolysaccharide|response to magnesium ion|synaptic vesicle endocytosis	actin cytoskeleton|axon|cell cortex|cell junction|cytosol|fibril|growth cone|nucleus|synapse	alpha-tubulin binding|calcium ion binding|caspase inhibitor activity|dynein binding|ferrous iron binding|histone binding|Hsp70 protein binding|kinesin binding|magnesium ion binding|phosphoprotein binding|tau protein binding|zinc ion binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.42e-05)	Melatonin(DB01065)													---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91912307	91912308	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91912307_91912308insT	uc003hsv.3	+						FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	93192353	93192354	+	Intron	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93192353_93192354delTT	uc010ikw.1	-											Homo sapiens chromosome 4 isolate HA_003381 mRNA sequence.																														---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94501905	94501905	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94501905delT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
PDLIM5	10611	broad.mit.edu	37	4	95477819	95477819	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95477819delT	uc003hti.2	+						PDLIM5_uc003htf.2_Intron|PDLIM5_uc003htg.2_Intron|PDLIM5_uc011cdx.1_Intron|PDLIM5_uc003hth.2_Intron|PDLIM5_uc003htj.2_Intron|PDLIM5_uc003htk.2_Intron|PDLIM5_uc011cdy.1_Intron	NM_006457	NP_006448			PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	97000819	97000819	+	IGR	DEL	A	-	-	rs35239030		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97000819delA								PDHA2 (238195 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	97756583	97756584	+	IGR	INS	-	G	G	rs149525949	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97756583_97756584insG								PDHA2 (993959 upstream) : C4orf37 (723450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	99084453	99084454	+	IGR	INS	-	A	A	rs77920319		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99084453_99084454insA								C4orf37 (20062 upstream) : RAP1GDS1 (98073 downstream)																																			---	---	---	---
EMCN	51705	broad.mit.edu	37	4	101413176	101413176	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101413176delA	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326			endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	101824782	101824783	+	IGR	INS	-	A	A	rs145232829	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101824782_101824783insA								EMCN (385532 upstream) : PPP3CA (119804 downstream)																																			---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102713627	102713627	+	Intron	DEL	T	-	-	rs145045137		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102713627delT	uc003hvy.3	+						BANK1_uc003hvx.3_Intron|BANK1_uc010ill.2_Intron	NM_017935	NP_060405			B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
TET2	54790	broad.mit.edu	37	4	106195988	106195988	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106195988delT	uc003hxk.2	+						TET2_uc011cez.1_Intron	NM_001127208	NP_001120680			tet oncogene family member 2 isoform a						cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)				Mis N|F		MDS								---	---	---	---
Unknown	0	broad.mit.edu	37	4	107724839	107724839	+	IGR	DEL	T	-	-	rs67843467		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107724839delT								AIMP1 (454460 upstream) : DKK2 (118121 downstream)																																			---	---	---	---
COL25A1	84570	broad.mit.edu	37	4	110092067	110092067	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110092067delA	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014			collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)														---	---	---	---
CCDC109B	55013	broad.mit.edu	37	4	110592563	110592563	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110592563delT	uc011cfs.1	+						CCDC109B_uc010imf.2_Intron	NM_017918	NP_060388			coiled-coil domain containing 109B							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	116787189	116787190	+	IGR	INS	-	GT	GT	rs142750624	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116787189_116787190insGT								NDST4 (752157 upstream) : MIR1973 (433691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	119387265	119387265	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119387265delA								PRSS12 (113343 upstream) : CEP170L (50230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	121288882	121288883	+	IGR	INS	-	GAAGAA	GAAGAA	rs150032254	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121288882_121288883insGAAGAA								MAD2L1 (300869 upstream) : PRDM5 (327047 downstream)																																			---	---	---	---
TNIP3	79931	broad.mit.edu	37	4	122053369	122053376	+	3'UTR	DEL	ACACACAC	-	-	rs71971394		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122053369_122053376delACACACAC	uc010ing.2	-	11					TNIP3_uc010inh.2_3'UTR|TNIP3_uc011cgj.1_3'UTR	NM_024873	NP_079149			TNFAIP3 interacting protein 3											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	123520194	123520194	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123520194delT								IL2 (142544 upstream) : IL21 (13589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	125652745	125652746	+	IGR	DEL	CT	-	-	rs72151798		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125652745_125652746delCT								ANKRD50 (18858 upstream) : FAT4 (584821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	129579829	129579831	+	IGR	DEL	AAG	-	-	rs71893682		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129579829_129579831delAAG								PGRMC2 (370881 upstream) : PHF17 (150948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	130519979	130519980	+	IGR	INS	-	A	A	rs147395812	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130519979_130519980insA								C4orf33 (486137 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	134882541	134882541	+	IGR	DEL	G	-	-	rs112096871		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134882541delG								PCDH10 (769810 upstream) : PABPC4L (234950 downstream)																																			---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140786640	140786640	+	Intron	DEL	T	-	-	rs111426440		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140786640delT	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	141149698	141149715	+	IGR	DEL	TGTGTGTGTGTGTGTGTA	-	-	rs36028837		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141149698_141149715delTGTGTGTGTGTGTGTGTA								MAML3 (74465 upstream) : SCOC (28725 downstream)																																			---	---	---	---
SCOC	60592	broad.mit.edu	37	4	141197930	141197930	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141197930delA	uc003iib.2	+							NM_032547	NP_115936			short coiled-coil protein isoform 4							Golgi apparatus|nucleus	protein binding				0	all_hematologic(180;0.162)																	---	---	---	---
RNF150	57484	broad.mit.edu	37	4	142008677	142008678	+	Intron	DEL	TC	-	-	rs144582140		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142008677_142008678delTC	uc003iio.1	-						RNF150_uc010iok.1_Intron|RNF150_uc003iip.1_Intron	NM_020724	NP_065775			ring finger protein 150 precursor							integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
USP38	84640	broad.mit.edu	37	4	144130642	144130643	+	Intron	INS	-	A	A	rs111830994		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144130642_144130643insA	uc003ijb.2	+						USP38_uc003ija.3_Intron|USP38_uc003ijc.2_Intron	NM_032557	NP_115946			ubiquitin specific peptidase 38						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)																	---	---	---	---
SMARCA5	8467	broad.mit.edu	37	4	144434194	144434194	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144434194delT	uc003ijg.2	+							NM_003601	NP_003592			SWI/SNF-related matrix-associated						CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)																	---	---	---	---
OTUD4	54726	broad.mit.edu	37	4	146087655	146087655	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146087655delA	uc003ika.3	-						OTUD4_uc003ijz.3_Intron|OTUD4_uc003ikb.3_Intron	NM_001102653	NP_001096123			OTU domain containing 4 protein isoform 3								protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	147040245	147040245	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147040245delT	uc003iko.1	-						uc010ioy.1_Intron					Homo sapiens cDNA FLJ32671 fis, clone TESTI1000128.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	149717176	149717176	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149717176delT								NR3C2 (353533 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	150575681	150575681	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150575681delC	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																														---	---	---	---
FAM160A1	729830	broad.mit.edu	37	4	152452657	152452657	+	Intron	DEL	T	-	-	rs10711474		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152452657delT	uc003imj.2	+							NM_001109977	NP_001103447			hypothetical protein LOC729830												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	152791362	152791363	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152791362_152791363delGT								PET112L (109216 upstream) : FBXW7 (451048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	152824123	152824123	+	IGR	DEL	A	-	-	rs66501919		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152824123delA								PET112L (141977 upstream) : FBXW7 (418288 downstream)																																			---	---	---	---
KIAA0922	23240	broad.mit.edu	37	4	154545053	154545053	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154545053delT	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron|KIAA0922_uc010ipq.2_Intron	NM_015196	NP_056011			hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	156181286	156181287	+	IGR	INS	-	A	A	rs144444613	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156181286_156181287insA								NPY2R (43060 upstream) : MAP9 (82527 downstream)																																			---	---	---	---
FNIP2	57600	broad.mit.edu	37	4	159710468	159710473	+	Intron	DEL	TGTGTA	-	-	rs58194510		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159710468_159710473delTGTGTA	uc003iqe.3	+						FNIP2_uc003iqd.2_Intron	NM_020840	NP_065891			folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	161423994	161423997	+	IGR	DEL	ACAT	-	-	rs59736263		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161423994_161423997delACAT								None (None upstream) : FSTL5 (881054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163127101	163127101	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163127101delT								FSTL5 (41915 upstream) : NAF1 (920759 downstream)																																			---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164632655	164632655	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164632655delT	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	165205487	165205488	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165205487_165205488delAG	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	167048251	167048252	+	IGR	INS	-	T	T	rs142706163	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167048251_167048252insT								TLL1 (23258 upstream) : SPOCK3 (606284 downstream)																																			---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169728429	169728430	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169728429_169728430delCA	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	4	170844492	170844493	+	Intron	INS	-	C	C	rs147037321	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170844492_170844493insC	uc003ism.1	-											Homo sapiens cDNA FLJ43052 fis, clone BRTHA3006318.																														---	---	---	---
GLRA3	8001	broad.mit.edu	37	4	175583974	175583975	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175583974_175583975insT	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520			glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	175978865	175978865	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175978865delA								ADAM29 (79535 upstream) : GPM6A (575224 downstream)																																			---	---	---	---
GPM6A	2823	broad.mit.edu	37	4	176758279	176758280	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176758279_176758280delAG	uc003iug.2	-						GPM6A_uc003iuh.2_Intron	NM_005277	NP_005268			glycoprotein M6A isoform 1							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	178213743	178213744	+	IGR	DEL	CA	-	-	rs35979678		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178213743_178213744delCA								VEGFC (499848 upstream) : NEIL3 (17247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180783553	180783553	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180783553delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180835185	180835186	+	IGR	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180835185_180835186delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183095655	183095656	+	Intron	INS	-	CACA	CACA	rs150293458	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183095655_183095656insCACA	uc010irv.1	+											Homo sapiens ODZ3 (ODZ3) mRNA, partial cds.						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183588055	183588055	+	Intron	DEL	A	-	-	rs76802292		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183588055delA	uc003ivd.1	+							NM_001080477	NP_001073946			odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	183934459	183934482	+	IGR	DEL	TCTTCCTCTTCCTCCTCTTCTTCC	-	-	rs139034545		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183934459_183934482delTCTTCCTCTTCCTCCTCTTCTTCC								DCTD (95829 upstream) : FAM92A3 (24336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184717532	184717536	+	IGR	DEL	CAAAC	-	-	rs113367400		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184717532_184717536delCAAAC								C4orf41 (82788 upstream) : STOX2 (108973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190546312	190546313	+	IGR	DEL	TT	-	-	rs137889406		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190546312_190546313delTT								None (None upstream) : FRG1 (315661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190555360	190555378	+	IGR	DEL	CTGGGTGACCCATTTGTGG	-	-	rs140577538	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190555360_190555378delCTGGGTGACCCATTTGTGG								None (None upstream) : FRG1 (306596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190578545	190578546	+	IGR	INS	-	TG	TG	rs75843150		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190578545_190578546insTG								None (None upstream) : FRG1 (283428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190582423	190582424	+	IGR	INS	-	A	A	rs143592182		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190582423_190582424insA								None (None upstream) : FRG1 (279550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190629928	190629929	+	IGR	DEL	AT	-	-	rs146357307		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190629928_190629929delAT								None (None upstream) : FRG1 (232045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190832285	190832286	+	Intron	DEL	GA	-	-	rs73876003		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190832285_190832286delGA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190893819	190893824	+	IGR	DEL	GGGAAA	-	-	rs74723046		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190893819_190893824delGGGAAA								FRG1 (9461 upstream) : TUBB4Q (9855 downstream)																																			---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1026394	1026395	+	Intron	INS	-	A	A	rs142195086		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1026394_1026395insA	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111			naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)															---	---	---	---
SLC12A7	10723	broad.mit.edu	37	5	1065276	1065277	+	Intron	INS	-	AGGGGACAGTG	AGGGGACAGTG	rs150605410	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1065276_1065277insAGGGGACAGTG	uc003jbu.2	-							NM_006598	NP_006589			solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	1660587	1660587	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1660587delA								LOC728613 (26467 upstream) : MRPL36 (137913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1782899	1782900	+	IGR	INS	-	CA	CA	rs143596028	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1782899_1782900insCA								LOC728613 (148779 upstream) : MRPL36 (15600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3434632	3434632	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3434632delA	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7822840	7822841	+	Intron	DEL	TG	-	-	rs33999538		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7822840_7822841delTG	uc003jdz.1	+						ADCY2_uc011cmo.1_Intron|ADCY2_uc010itm.1_Intron	NM_020546	NP_065433			adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11656530	11656531	+	Intron	INS	-	A	A	rs11430294		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11656530_11656531insA	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14323638	14323639	+	Intron	INS	-	AGAT	AGAT	rs147149873	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14323638_14323639insAGAT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	18007401	18007402	+	IGR	INS	-	TT	TT	rs143248434	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18007401_18007402insTT								BASP1 (730466 upstream) : None (None downstream)																																			---	---	---	---
CDH9	1007	broad.mit.edu	37	5	27035783	27035790	+	Intron	DEL	GTGTGTGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27035783_27035790delGTGTGTGT	uc003jgs.1	-						CDH9_uc010iug.2_Intron	NM_016279	NP_057363			cadherin 9, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	27391886	27391886	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27391886delT								CDH9 (353197 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29398176	29398179	+	IGR	DEL	TCTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29398176_29398179delTCTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29431910	29431910	+	IGR	DEL	A	-	-	rs34147754		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29431910delA								None (None upstream) : None (None downstream)																																			---	---	---	---
GOLPH3	64083	broad.mit.edu	37	5	32134627	32134627	+	Intron	DEL	A	-	-	rs323840	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32134627delA	uc003jhp.1	-							NM_022130	NP_071413			golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1																		---	---	---	---
SUB1	10923	broad.mit.edu	37	5	32592819	32592819	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32592819delA	uc003jhs.2	+						SUB1_uc003jht.2_Intron	NM_006713	NP_006704			activated RNA polymerase II transcription						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus|transcription factor complex	protein binding|single-stranded DNA binding|transcription coactivator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	33183336	33183337	+	IGR	INS	-	G	G	rs149853300	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33183336_33183337insG								C5orf23 (391517 upstream) : TARS (257465 downstream)																																			---	---	---	---
TARS	6897	broad.mit.edu	37	5	33438715	33438716	+	5'Flank	INS	-	TA	TA	rs146029246	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33438715_33438716insTA	uc003jhy.2	+						TARS_uc011cob.1_5'Flank|TARS_uc010iup.1_5'Flank|TARS_uc011coc.1_5'Flank|TARS_uc003jhz.2_5'Flank|TARS_uc011cod.1_5'Flank	NM_152295	NP_689508			threonyl-tRNA synthetase						threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	37788563	37788563	+	IGR	DEL	C	-	-	rs139631949		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37788563delC								WDR70 (35791 upstream) : GDNF (27191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	40305614	40305615	+	IGR	DEL	TT	-	-	rs72346397		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40305614_40305615delTT								DAB2 (880279 upstream) : PTGER4 (374417 downstream)																																			---	---	---	---
NNT	23530	broad.mit.edu	37	5	43677502	43677503	+	Intron	DEL	GA	-	-	rs111577191		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43677502_43677503delGA	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475			nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	45954061	45954061	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45954061delG								HCN1 (257841 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49438933	49438933	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49438933delC								None (None upstream) : EMB (253100 downstream)																																			---	---	---	---
EMB	133418	broad.mit.edu	37	5	49738348	49738349	+	5'Flank	INS	-	AC	AC	rs138294354	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49738348_49738349insAC	uc003jom.2	-						EMB_uc010ivr.2_5'Flank	NM_198449	NP_940851			embigin precursor							integral to membrane					0	Lung SC(58;0.218)	Lung NSC(810;0.0795)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	52042030	52042030	+	IGR	DEL	G	-	-	rs61311189		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52042030delG								None (None upstream) : ITGA1 (41744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52423204	52423205	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52423204_52423205insG								MOCS2 (17606 upstream) : FST (353390 downstream)																																			---	---	---	---
SNX18	112574	broad.mit.edu	37	5	53818576	53818576	+	Intron	DEL	A	-	-	rs11301248		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53818576delA	uc003jpi.3	+						SNX18_uc011cqg.1_Intron	NM_001102575	NP_001096045			sorting nexin 18 isoform a						cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	54258645	54258646	+	IGR	DEL	TA	-	-	rs35693314		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54258645_54258646delTA								SNX18 (416230 upstream) : ESM1 (15050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55627008	55627008	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55627008delA								ANKRD55 (97822 upstream) : MAP3K1 (483892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	56809603	56809604	+	IGR	DEL	TG	-	-	rs72337845		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56809603_56809604delTG								ACTBL2 (30967 upstream) : PLK2 (940208 downstream)																																			---	---	---	---
RAB3C	115827	broad.mit.edu	37	5	58129152	58129153	+	Intron	DEL	CA	-	-	rs111327758		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58129152_58129153delCA	uc003jrp.2	+							NM_138453	NP_612462			RAB3C, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			ovary(1)|central_nervous_system(1)	2		all_cancers(5;9.93e-10)|all_epithelial(5;1.49e-10)|all_lung(5;8.97e-05)|Lung NSC(5;0.000139)|Prostate(74;0.0664)		OV - Ovarian serous cystadenocarcinoma(10;1.8e-34)														---	---	---	---
FLJ37543	285668	broad.mit.edu	37	5	60956393	60956400	+	Intron	DEL	GTGAGAGA	-	-	rs58852178		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60956393_60956400delGTGAGAGA	uc003jst.1	+						uc003jsu.1_Intron	NM_173667	NP_775938			hypothetical protein LOC285668 precursor							extracellular region					0		Lung NSC(810;0.000468)|Prostate(74;0.0283)|Breast(144;0.237)																---	---	---	---
KIF2A	3796	broad.mit.edu	37	5	61614918	61614918	+	Intron	DEL	C	-	-	rs34749891		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61614918delC	uc003jsy.3	+						KIF2A_uc003jsz.3_Intron|KIF2A_uc010iwp.2_Intron|KIF2A_uc003jsx.3_Intron	NM_004520	NP_004511			kinesin heavy chain member 2 isoform 1						blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	62507027	62507027	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62507027delT								ISCA1P1 (433857 upstream) : HTR1A (749252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71326064	71326070	+	IGR	DEL	TCTGACT	-	-	rs67388417		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71326064_71326070delTCTGACT								CARTPT (309192 upstream) : MAP1B (77048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	72913244	72913244	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72913244delA								UTP15 (35450 upstream) : RGNEF (8739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74264904	74264904	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74264904delG								FAM169A (73116 upstream) : GCNT4 (58386 downstream)																																			---	---	---	---
S100Z	170591	broad.mit.edu	37	5	76165071	76165071	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76165071delA	uc003kep.1	+						S100Z_uc003keq.3_Intron	NM_130772	NP_570128			S100 calcium binding protein Z								calcium ion binding			ovary(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;8.91e-51)|Epithelial(54;5.43e-45)|all cancers(79;1.82e-40)														---	---	---	---
CRHBP	1393	broad.mit.edu	37	5	76256006	76256006	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76256006delG	uc003ker.2	+							NM_001882	NP_001873			corticotropin releasing hormone binding protein						female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76948166	76948166	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76948166delG								OTP (13644 upstream) : TBCA (38829 downstream)																																			---	---	---	---
LOC441089	441089	broad.mit.edu	37	5	79646840	79646840	+	RNA	DEL	T	-	-	rs34240292		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79646840delT	uc010jaj.1	-	1		c.946delA				NR_003665				Homo sapiens CRSP8 pseudogene (LOC441089), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	80248526	80248526	+	IGR	DEL	A	-	-	rs72429792		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80248526delA								MSH3 (75893 upstream) : RASGRF2 (8032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	82201553	82201553	+	IGR	DEL	T	-	-	rs36079817		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82201553delT								ATP6AP1L (587407 upstream) : TMEM167A (147114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85978108	85978108	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85978108delA								COX7C (61527 upstream) : RASA1 (586043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	86719041	86719041	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86719041delT								CCNH (10205 upstream) : TMEM161B (771983 downstream)																																			---	---	---	---
LOC100129716	100129716	broad.mit.edu	37	5	90713990	90713993	+	Intron	DEL	CTCT	-	-	rs35704375	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90713990_90713993delCTCT	uc003kka.3	+							NR_027435				Homo sapiens hypothetical protein LOC285620, mRNA (cDNA clone IMAGE:5286379).												0																		---	---	---	---
RHOBTB3	22836	broad.mit.edu	37	5	95109858	95109858	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95109858delT	uc003klm.2	+							NM_014899	NP_055714			rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)														---	---	---	---
PCSK1	5122	broad.mit.edu	37	5	95739596	95739596	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95739596delA	uc003kls.1	-						PCSK1_uc010jbi.1_Intron	NM_000439	NP_000430			proprotein convertase subtilisin/kexin type 1						cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	97159431	97159432	+	IGR	INS	-	C	C	rs143612619	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97159431_97159432insC								RIOK2 (640426 upstream) : RGMB (945567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	97981248	97981248	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97981248delA								None (None upstream) : RGMB (123751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99170821	99170831	+	IGR	DEL	GGAGGAAGGAA	-	-	rs78947777		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99170821_99170831delGGAGGAAGGAA								CHD1 (908583 upstream) : LOC100133050 (544378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	100090485	100090486	+	IGR	INS	-	AC	AC	rs145334487	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100090485_100090486insAC								FAM174A (168045 upstream) : ST8SIA4 (52154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	105816415	105816416	+	IGR	INS	-	TCTC	TCTC			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105816415_105816416insTCTC								None (None upstream) : EFNA5 (896175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	112011047	112011047	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112011047delC								FLJ11235 (254374 upstream) : APC (32171 downstream)																																			---	---	---	---
REEP5	7905	broad.mit.edu	37	5	112249618	112249619	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112249618_112249619delTG	uc003kqe.1	-						REEP5_uc011cvw.1_Intron|REEP5_uc011cvx.1_Intron|REEP5_uc011cvy.1_Intron|REEP5_uc011cvz.1_Intron	NM_005669	NP_005660			receptor accessory protein 5							integral to membrane	protein binding				0		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)														---	---	---	---
MCC	4163	broad.mit.edu	37	5	112478550	112478564	+	Intron	DEL	GATGCTCGTCTCTAA	-	-	rs71817766		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112478550_112478564delGATGCTCGTCTCTAA	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378			mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
ATG12	9140	broad.mit.edu	37	5	115168268	115168268	+	Intron	DEL	C	-	-	rs68015035		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115168268delC	uc003krh.2	-						ATG12_uc003kri.2_Intron|ATG12_uc003krj.2_Intron	NM_004707	NP_004698			APG12 autophagy 12-like						autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	115381476	115381479	+	IGR	DEL	TGTA	-	-	rs71659632		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115381476_115381479delTGTA								AQPEP (18178 upstream) : COMMD10 (39248 downstream)																																			---	---	---	---
SEMA6A	57556	broad.mit.edu	37	5	115841152	115841153	+	Intron	DEL	CG	-	-	rs145809434	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115841152_115841153delCG	uc010jck.2	-						SEMA6A_uc003krx.3_Intron	NM_020796	NP_065847			sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	119474631	119474631	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119474631delA								FAM170A (503115 upstream) : PRR16 (325388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	121459239	121459240	+	IGR	INS	-	TG	TG	rs141056674	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121459239_121459240insTG								LOX (45184 upstream) : ZNF474 (5975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	122962432	122962434	+	IGR	DEL	AAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122962432_122962434delAAC								CSNK1G3 (9970 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123171527	123171528	+	IGR	DEL	AA	-	-	rs145856418		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123171527_123171528delAA								CSNK1G3 (219065 upstream) : ZNF608 (801082 downstream)																																			---	---	---	---
GRAMD3	65983	broad.mit.edu	37	5	125747533	125747534	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs147604532	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125747533_125747534insGTGTGTGTGT	uc011cwt.1	+						GRAMD3_uc011cwu.1_Intron	NM_001146319	NP_001139791			GRAM domain containing 3 isoform 1											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)														---	---	---	---
ACSL6	23305	broad.mit.edu	37	5	131176301	131176302	+	Intron	INS	-	T	T	rs143636469	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131176301_131176302insT	uc003kvv.1	-							NM_015256				acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	131368611	131368612	+	IGR	INS	-	GAAA	GAAA	rs140068665	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131368611_131368612insGAAA								ACSL6 (20741 upstream) : IL3 (27735 downstream)																																			---	---	---	---
CDKL3	51265	broad.mit.edu	37	5	133626388	133626389	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133626388_133626389insT	uc011cxm.1	-						CDKL3_uc011cxn.1_Intron|CDKL3_uc010jdw.2_Intron|CDKL3_uc011cxo.1_Intron|CDKL3_uc011cxp.1_Intron	NM_001113575	NP_001107047			cyclin-dependent kinase-like 3 isoform 1							cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	135154854	135154854	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135154854delT								LOC340074 (165230 upstream) : LOC153328 (15511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	135431916	135431917	+	IGR	INS	-	TG	TG	rs144900114	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135431916_135431917insTG								MIR886 (15619 upstream) : SMAD5OS (33288 downstream)																																			---	---	---	---
TRPC7	57113	broad.mit.edu	37	5	135649060	135649063	+	Intron	DEL	TGTC	-	-	rs5871600		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135649060_135649063delTGTC	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122			transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	135819075	135819075	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135819075delT								TRPC7 (126002 upstream) : SPOCK1 (491913 downstream)																																			---	---	---	---
KIAA0141	9812	broad.mit.edu	37	5	141308061	141308061	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141308061delC	uc003lls.2	+						KIAA0141_uc003llt.2_Intron	NM_001142603	NP_001136075			hypothetical protein LOC9812 precursor						apoptosis|regulation of caspase activity	mitochondrion	protein binding			skin(1)	1		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	142137009	142137010	+	IGR	DEL	GT	-	-	rs140893047		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142137009_142137010delGT								FGF1 (59374 upstream) : ARHGAP26 (13282 downstream)																																			---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142344255	142344255	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142344255delG	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	142902548	142902549	+	IGR	DEL	TG	-	-	rs113241223		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142902548_142902549delTG								NR3C1 (87471 upstream) : HMHB1 (289177 downstream)																																			---	---	---	---
SH3RF2	153769	broad.mit.edu	37	5	145343835	145343836	+	Intron	INS	-	TTCC	TTCC			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145343835_145343836insTTCC	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron	NM_152550	NP_689763			SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
TCERG1	10915	broad.mit.edu	37	5	145850069	145850070	+	Intron	INS	-	TAT	TAT	rs149948888	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145850069_145850070insTAT	uc003lob.2	+						TCERG1_uc003loc.2_Intron|TCERG1_uc011dbt.1_Intron	NM_006706	NP_006697			transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	146565536	146565537	+	IGR	INS	-	T	T	rs146738561		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146565536_146565537insT								PPP2R2B (104482 upstream) : STK32A (49042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	149233951	149233952	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149233951_149233952delTG								PPARGC1B (6684 upstream) : PDE6A (3568 downstream)																																			---	---	---	---
CSF1R	1436	broad.mit.edu	37	5	149440722	149440723	+	Intron	DEL	GG	-	-	rs216139	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149440722_149440723delGG	uc003lrl.2	-						CSF1R_uc011dcd.1_Intron|CSF1R_uc010jhc.2_Intron|CSF1R_uc003lrm.2_Intron	NM_005211	NP_005202			colony stimulating factor 1 receptor precursor						cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)													---	---	---	---
SYNPO	11346	broad.mit.edu	37	5	150036995	150036998	+	3'UTR	DEL	CACA	-	-	rs72285115	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150036995_150036998delCACA	uc003lsp.2	+	3						NM_007286	NP_009217			synaptopodin isoform A						positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
GM2A	2760	broad.mit.edu	37	5	150992162	150992163	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150992162_150992163delGT	uc011dcs.1	+							NM_000405				GM2 ganglioside activator precursor							lysosome|nucleolus	sphingolipid activator protein activity				0		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	152081613	152081614	+	Intron	INS	-	TA	TA	rs150293142	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152081613_152081614insTA	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	152505682	152505683	+	IGR	INS	-	A	A	rs143243877	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152505682_152505683insA								NMUR2 (720842 upstream) : GRIA1 (363492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152611628	152611628	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152611628delT								NMUR2 (826788 upstream) : GRIA1 (257547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	153867666	153867667	+	IGR	INS	-	GT	GT	rs140047771	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153867666_153867667insGT								HAND1 (9842 upstream) : MIR1303 (197669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	161427345	161427348	+	IGR	DEL	GTGA	-	-	rs5872738		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161427345_161427348delGTGA								GABRA1 (100382 upstream) : GABRG2 (67300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165535655	165535656	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165535655_165535656insT								None (None upstream) : None (None downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167431523	167431526	+	Intron	DEL	CACA	-	-	rs4976567		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167431523_167431526delCACA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169382395	169382396	+	Intron	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169382395_169382396delGA	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron|FAM196B_uc003mag.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	169841314	169841315	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169841314_169841315insT	uc003map.2	+							NM_001034838	NP_001030010			Kv channel interacting protein 1 isoform 3						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170529797	170529798	+	Intron	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170529797_170529798delTT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	170940026	170940027	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170940026_170940027delAC								FGF18 (55864 upstream) : FBXW11 (348529 downstream)																																			---	---	---	---
FBXW11	23291	broad.mit.edu	37	5	171305564	171305565	+	Intron	DEL	GA	-	-	rs34933781		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171305564_171305565delGA	uc003mbm.1	-						FBXW11_uc011dey.1_Intron|FBXW11_uc003mbl.1_Intron|FBXW11_uc003mbn.1_Intron	NM_012300	NP_036432			F-box and WD repeat domain containing 11 isoform						cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176480013	176480013	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176480013delT	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	177362810	177362812	+	IGR	DEL	CCT	-	-	rs113173559		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177362810_177362812delCCT								LOC728554 (51543 upstream) : PROP1 (56424 downstream)																																			---	---	---	---
ZFP2	80108	broad.mit.edu	37	5	178344616	178344616	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178344616delA	uc003mjn.1	+						ZFP2_uc010jky.2_Intron|ZFP2_uc010jkx.1_Intron	NM_030613	NP_085116			zinc finger protein 2 homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	178840839	178840843	+	IGR	DEL	CCCTG	-	-	rs146032763		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178840839_178840843delCCCTG								ADAMTS2 (68510 upstream) : RUFY1 (136728 downstream)																																			---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179442525	179442525	+	Intron	DEL	G	-	-	rs66797381		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442525delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
RASGEF1C	255426	broad.mit.edu	37	5	179556872	179556872	+	Intron	DEL	C	-	-	rs34409819		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179556872delC	uc003mlq.2	-						RASGEF1C_uc003mlr.2_Intron|RASGEF1C_uc003mlp.3_Intron	NM_175062	NP_778232			RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	937890	937893	+	IGR	DEL	TTCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:937890_937893delTTCT								EXOC2 (244781 upstream) : LOC285768 (23349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1515541	1515607	+	Intron	DEL	GAGCTGCTGCTTCACACTGACTTACACGGTGAGCAGCGGCGGCAGGGGAGGAGGTGGAACCCGCGGC	-	-	rs66528622	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1515541_1515607delGAGCTGCTGCTTCACACTGACTTACACGGTGAGCAGCGGCGGCAGGGGAGGAGGTGGAACCCGCGGC	uc003mto.2	+											Homo sapiens cDNA clone IMAGE:30390216.																														---	---	---	---
MYLK4	340156	broad.mit.edu	37	6	2718414	2718417	+	Intron	DEL	AAAA	-	-	rs66527730		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2718414_2718417delAAAA	uc003mty.3	-							NM_001012418	NP_001012418			myosin light chain kinase family, member 4								ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)																---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3374672	3374680	+	Intron	DEL	AAAACTAGC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3374672_3374680delAAAACTAGC	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297			solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	7537282	7537287	+	IGR	DEL	AAACCA	-	-	rs68003153		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7537282_7537287delAAACCA								RIOK1 (119014 upstream) : DSP (4583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9485367	9485370	+	IGR	DEL	GTGT	-	-	rs143658946		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9485367_9485370delGTGT								HULC (831290 upstream) : TFAP2A (911547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	11459605	11459606	+	Intron	INS	-	GAT	GAT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11459605_11459606insGAT	uc003mzy.2	+											Homo sapiens cDNA clone IMAGE:4812340.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	11795105	11795106	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11795105_11795106insT								C6orf105 (15825 upstream) : HIVEP1 (217618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12340558	12340559	+	IGR	INS	-	GC	GC	rs143644983	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12340558_12340559insGC								EDN1 (43132 upstream) : PHACTR1 (376329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18566437	18566438	+	Intron	INS	-	TCCC	TCCC	rs147177362	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18566437_18566438insTCCC	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	18671018	18671019	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18671018_18671019insT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	19087351	19087354	+	Intron	DEL	CAAA	-	-	rs10539973		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19087351_19087354delCAAA	uc003ncu.1	-											Homo sapiens cDNA FLJ40266 fis, clone TESTI2026461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	24165468	24165468	+	IGR	DEL	A	-	-	rs34866008		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24165468delA								NRSN1 (17711 upstream) : DCDC2 (6516 downstream)																																			---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24946780	24946780	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24946780delA	uc011dju.1	-							NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
BTN3A3	10384	broad.mit.edu	37	6	26441001	26441006	+	Intron	DEL	TGTGTG	-	-	rs72294321		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26441001_26441006delTGTGTG	uc003nhz.2	+						BTN3A3_uc003nia.2_Intron|BTN3A3_uc011dkn.1_Intron	NM_006994	NP_008925			butyrophilin, subfamily 3, member A3 isoform a							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	29021310	29021311	+	IGR	INS	-	AA	AA	rs148300138	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29021310_29021311insAA								OR2W1 (8358 upstream) : OR2B3 (32675 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29922907	29922914	+	Intron	DEL	GCCTACTA	-	-	rs9278500		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29922907_29922914delGCCTACTA	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29922981	29922982	+	Intron	INS	-	CA	CA	rs140817948	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29922981_29922982insCA	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	31410237	31410238	+	IGR	INS	-	AG	AG	rs138382299	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31410237_31410238insAG								MICA (27147 upstream) : HCP5 (20719 downstream)																																			---	---	---	---
NOTCH4	4855	broad.mit.edu	37	6	32173814	32173814	+	Intron	DEL	A	-	-	rs148768186		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32173814delA	uc003obb.2	-						NOTCH4_uc003oba.2_5'Flank|NOTCH4_uc011dpu.1_Intron|NOTCH4_uc011dpv.1_Intron	NM_004557	NP_004548			notch4 preproprotein						cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32210220	32210227	+	IGR	DEL	TTCTTTCC	-	-	rs41286494		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32210220_32210227delTTCTTTCC								NOTCH4 (18376 upstream) : C6orf10 (46076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33517031	33517031	+	IGR	DEL	C	-	-	rs66567654		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33517031delC								ZBTB9 (91713 upstream) : BAK1 (23293 downstream)																																			---	---	---	---
DEF6	50619	broad.mit.edu	37	6	35282913	35282913	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35282913delT	uc003okk.2	+						DEF6_uc010jvs.2_Intron|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330			differentially expressed in FDCP 6 homolog							cytoplasm|nucleus|plasma membrane					0																		---	---	---	---
SRPK1	6732	broad.mit.edu	37	6	35849896	35849898	+	Intron	DEL	TAG	-	-	rs138059211		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35849896_35849898delTAG	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128			SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1																		---	---	---	---
MDGA1	266727	broad.mit.edu	37	6	37611054	37611054	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37611054delT	uc003onu.1	-						MDGA1_uc003onv.1_Intron	NM_153487	NP_705691			MAM domain containing						brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37763479	37763479	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37763479delC								MDGA1 (97713 upstream) : ZFAND3 (23828 downstream)																																			---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38685404	38685404	+	Intron	DEL	T	-	-	rs34952417		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38685404delT	uc003ood.1	+											SubName: Full=Axonemal dynein heavy chain 8 isoform 2; SubName: Full=Axonemal dynein heavy chain 8 isoform 3; SubName: Full=Putative uncharacterized protein DNAH8; Flags: Fragment;											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40530573	40530574	+	Intron	DEL	CT	-	-	rs59544562		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40530573_40530574delCT	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	40589421	40589422	+	IGR	INS	-	GCAC	GCAC	rs139807413	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40589421_40589422insGCAC								LRFN2 (34295 upstream) : UNC5CL (405350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	41477712	41477713	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41477712_41477713delGT	uc003oqk.1	+											Homo sapiens mRNA sequence.																														---	---	---	---
CCND3	896	broad.mit.edu	37	6	41915872	41915875	+	Intron	DEL	CCTA	-	-	rs71692891		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41915872_41915875delCCTA	uc003orp.2	-						CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron	NM_001136017	NP_001129489			cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)					T	IGH@	MM								---	---	---	---
RSPH9	221421	broad.mit.edu	37	6	43623774	43623782	+	Intron	DEL	CCCTTCTTT	-	-	rs70993404		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43623774_43623782delCCCTTCTTT	uc003ovw.1	+						RSPH9_uc003ovx.1_Intron	NM_152732	NP_689945			radial spoke head 9 homolog						cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton				upper_aerodigestive_tract(1)|skin(1)	2														Kartagener_syndrome				---	---	---	---
SLC35B2	347734	broad.mit.edu	37	6	44222161	44222162	+	3'UTR	INS	-	TG	TG	rs146831088	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44222161_44222162insTG	uc003oxd.2	-	4					SLC35B2_uc011dvt.1_3'UTR|SLC35B2_uc011dvu.1_3'UTR	NM_178148	NP_835361			solute carrier family 35, member B2						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	44593870	44593871	+	IGR	INS	-	GTGA	GTGA	rs138103459	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44593870_44593871insGTGA								CDC5L (179091 upstream) : SUPT3H (183183 downstream)																																			---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45500873	45500874	+	Intron	DEL	GT	-	-	rs35189372		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45500873_45500874delGT	uc011dvx.1	+						RUNX2_uc011dvy.1_Intron|RUNX2_uc003oxt.2_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	45523634	45523634	+	IGR	DEL	T	-	-	rs142868815		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45523634delT								RUNX2 (4816 upstream) : CLIC5 (342556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	45610769	45610772	+	IGR	DEL	CCTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45610769_45610772delCCTT								RUNX2 (91951 upstream) : CLIC5 (255418 downstream)																																			---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	46028462	46028463	+	Intron	INS	-	T	T	rs140875070	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46028462_46028463insT	uc003oxv.3	-							NM_001114086	NP_001107558			chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	49540187	49540188	+	IGR	INS	-	TCCTTCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCTTCCT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49540187_49540188insTCCTTCCTTCCTTCCTTCCT								C6orf141 (10562 upstream) : RHAG (32705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51207195	51207195	+	IGR	DEL	A	-	-	rs76677880		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51207195delA								TFAP2B (391870 upstream) : PKHD1 (272950 downstream)																																			---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51796621	51796622	+	Intron	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51796621_51796622delGA	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Intron	NM_138694	NP_619639			fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	52118670	52118670	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52118670delC								IL17F (9372 upstream) : MCM3 (10142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53103063	53103066	+	IGR	DEL	ACAC	-	-	rs36033260		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53103063_53103066delACAC								GCM1 (89439 upstream) : ELOVL5 (29130 downstream)																																			---	---	---	---
HMGCLL1	54511	broad.mit.edu	37	6	55442034	55442042	+	Intron	DEL	ATAGAAAAA	-	-	rs59821254		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55442034_55442042delATAGAAAAA	uc003pcn.2	-						HMGCLL1_uc003pco.2_Intron|HMGCLL1_uc010jzx.2_Intron|HMGCLL1_uc011dxc.1_Intron|HMGCLL1_uc011dxd.1_Intron|HMGCLL1_uc011dxe.1_Intron|HMGCLL1_uc003pcp.2_Intron	NM_019036	NP_061909			3-hydroxymethyl-3-methylglutaryl-Coenzyme A								hydroxymethylglutaryl-CoA lyase activity|metal ion binding			skin(2)|ovary(1)|pancreas(1)	4	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---
RAB23	51715	broad.mit.edu	37	6	57074849	57074850	+	Intron	INS	-	A	A	rs143894243	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57074849_57074850insA	uc003pds.2	-						RAB23_uc003pdt.2_Intron|RAB23_uc010kac.2_Intron|RAB23_uc010kad.2_Intron	NM_183227	NP_899050			Ras-related protein Rab-23						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			skin(1)	1	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57211816	57211819	+	Intron	DEL	TGTT	-	-	rs10577577		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57211816_57211819delTGTT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57217527	57217528	+	Intron	INS	-	T	T	rs146230952	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57217527_57217528insT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57373874	57373874	+	Intron	DEL	C	-	-	rs113195192		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57373874delC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57438823	57438823	+	Intron	DEL	G	-	-	rs145954948		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57438823delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57439748	57439750	+	Intron	DEL	TTC	-	-	rs78957849		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57439748_57439750delTTC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57445593	57445594	+	Intron	DEL	AG	-	-	rs59098943		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57445593_57445594delAG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57446095	57446113	+	Intron	DEL	AGGTGCAGTGGCTCATGCT	-	-	rs144596314	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57446095_57446113delAGGTGCAGTGGCTCATGCT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57457703	57457704	+	Intron	INS	-	G	G	rs146176331		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57457703_57457704insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57466519	57466519	+	Intron	DEL	T	-	-	rs5876632		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57466519delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57466660	57466660	+	Intron	DEL	A	-	-	rs11313599		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57466660delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57482564	57482574	+	Intron	DEL	GGGCAACATAG	-	-	rs113381289		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57482564_57482574delGGGCAACATAG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57542931	57542931	+	IGR	DEL	G	-	-	rs112793267		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57542931delG								PRIM2 (29556 upstream) : GUSBL2 (703228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57558300	57558301	+	IGR	DEL	AC	-	-	rs145307612		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57558300_57558301delAC								PRIM2 (44925 upstream) : GUSBL2 (687858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57561998	57561998	+	IGR	DEL	A	-	-	rs111734895		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57561998delA								PRIM2 (48623 upstream) : GUSBL2 (684161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57564637	57564638	+	IGR	INS	-	G	G	rs145275344		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564637_57564638insG								PRIM2 (51262 upstream) : GUSBL2 (681521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57564682	57564682	+	IGR	DEL	C	-	-	rs67730656		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564682delC								PRIM2 (51307 upstream) : GUSBL2 (681477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58142655	58142656	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58142655_58142656insT								PRIM2 (629280 upstream) : GUSBL2 (103503 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64934729	64934729	+	Intron	DEL	T	-	-	rs34708103		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64934729delT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
BAI3	577	broad.mit.edu	37	6	69722089	69722090	+	Intron	INS	-	TT	TT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69722089_69722090insTT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	71303397	71303397	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71303397delG								C6orf57 (4791 upstream) : SMAP1 (74082 downstream)																																			---	---	---	---
FILIP1	27145	broad.mit.edu	37	6	76195713	76195714	+	Intron	DEL	AT	-	-	rs150985944	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76195713_76195714delAT	uc003pia.2	-						FILIP1_uc003phy.1_Intron|FILIP1_uc010kbe.2_Intron	NM_015687	NP_056502			filamin A interacting protein 1											skin(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	77637828	77637829	+	IGR	INS	-	TT	TT	rs112632181		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77637828_77637829insTT								IMPG1 (855493 upstream) : HTR1B (534119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78525183	78525184	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78525183_78525184insT								HTR1B (352063 upstream) : None (None downstream)																																			---	---	---	---
UBE2CBP	90025	broad.mit.edu	37	6	83654311	83654311	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83654311delA	uc003pjp.2	-						UBE2CBP_uc011dyx.1_Intron	NM_198920	NP_944602			ubiquitin-conjugating enzyme E2C binding							cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)														---	---	---	---
UBE2CBP	90025	broad.mit.edu	37	6	83731752	83731752	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83731752delT	uc003pjp.2	-						UBE2CBP_uc011dyx.1_Intron|UBE2CBP_uc003pjq.2_Intron	NM_198920	NP_944602			ubiquitin-conjugating enzyme E2C binding							cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	87284392	87284393	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87284392_87284393insA								SNHG5 (895941 upstream) : HTR1E (362631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87325079	87325080	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87325079_87325080insA								SNHG5 (936628 upstream) : HTR1E (321944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89147044	89147044	+	IGR	DEL	A	-	-	rs138932969		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89147044delA								CNR1 (271277 upstream) : RNGTT (172945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93167537	93167537	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93167537delT								None (None upstream) : EPHA7 (782205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	94754583	94754583	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94754583delA								TSG1 (268384 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	95124950	95124950	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95124950delC								TSG1 (638751 upstream) : MANEA (900463 downstream)																																			---	---	---	---
KLHL32	114792	broad.mit.edu	37	6	97563868	97563869	+	Intron	INS	-	TGTT	TGTT	rs142433185	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97563868_97563869insTGTT	uc010kcm.1	+						KLHL32_uc011ead.1_Intron|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Intron|KLHL32_uc003ppa.2_Intron	NM_052904	NP_443136			kelch-like 32											ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	98611659	98611660	+	IGR	DEL	TG	-	-	rs72347090		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98611659_98611660delTG								MIR2113 (139162 upstream) : POU3F2 (670920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99032105	99032106	+	IGR	INS	-	T	T	rs146476151	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99032105_99032106insT								MIR2113 (559608 upstream) : POU3F2 (250474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99270464	99270465	+	IGR	INS	-	AAC	AAC	rs140656246	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99270464_99270465insAAC								MIR2113 (797967 upstream) : POU3F2 (12115 downstream)																																			---	---	---	---
MCHR2	84539	broad.mit.edu	37	6	100420528	100420528	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100420528delT	uc003pqh.1	-						MCHR2_uc003pqi.1_Intron	NM_001040179	NP_001035269			melanin-concentrating hormone receptor 2							integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	100608087	100608088	+	IGR	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100608087_100608088delAG								MCHR2 (165973 upstream) : SIM1 (228663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	101557311	101557330	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTT	-	-	rs71028063	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101557311_101557330delCTTCCTTCCTTCCTTCCTTT								ASCC3 (228087 upstream) : GRIK2 (289575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	103782173	103782173	+	IGR	DEL	G	-	-	rs147179272		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103782173delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104343149	104343149	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104343149delA								None (None upstream) : HACE1 (832819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104984512	104984513	+	IGR	INS	-	T	T	rs10686653		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104984512_104984513insT								None (None upstream) : HACE1 (191455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	106327110	106327111	+	IGR	DEL	AC	-	-	rs3036182		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106327110_106327111delAC								PREP (476141 upstream) : PRDM1 (207084 downstream)																																			---	---	---	---
ATG5	9474	broad.mit.edu	37	6	106706082	106706082	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106706082delA	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840			APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	111594711	111594712	+	IGR	INS	-	TG	TG			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111594711_111594712insTG								KIAA1919 (4452 upstream) : REV3L (25523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113906228	113906229	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113906228_113906229delGT								None (None upstream) : MARCKS (272298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	114683128	114683151	+	IGR	DEL	TCCTTCCTTCCTTCCTTCCTTCCT	-	-	rs71028412		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114683128_114683151delTCCTTCCTTCCTTCCTTCCTTCCT								HS3ST5 (19588 upstream) : None (None downstream)																																			---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117704314	117704315	+	Intron	DEL	GC	-	-	rs112993324		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117704314_117704315delGC	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935			proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
Unknown	0	broad.mit.edu	37	6	120898851	120898851	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120898851delA								None (None upstream) : C6orf170 (501776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122710568	122710569	+	IGR	DEL	AA	-	-	rs10587692		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122710568_122710569delAA								GJA1 (939696 upstream) : HSF2 (10127 downstream)																																			---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123550677	123550677	+	Intron	DEL	T	-	-	rs12111031	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123550677delT	uc003pzj.1	-						TRDN_uc010kem.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123899202	123899202	+	Intron	DEL	A	-	-	rs149925879		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123899202delA	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|TRDN_uc010keo.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	127439022	127439025	+	Intron	DEL	GAAA	-	-	rs71861915	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127439022_127439025delGAAA	uc003qaq.1	-						RSPO3_uc003qar.2_5'Flank|RSPO3_uc003qas.1_5'Flank					Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	128274976	128274976	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128274976delC								THEMIS (35234 upstream) : PTPRK (14949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	130253517	130253520	+	IGR	DEL	AGAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130253517_130253520delAGAG								C6orf191 (71101 upstream) : L3MBTL3 (86214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	130877221	130877221	+	IGR	DEL	C	-	-	rs11307734		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130877221delC								TMEM200A (113013 upstream) : LOC285733 (271103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	132443728	132443728	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132443728delA								CTGF (171210 upstream) : MOXD1 (173467 downstream)																																			---	---	---	---
MOXD1	26002	broad.mit.edu	37	6	132718752	132718753	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132718752_132718753delAG	uc003qdf.2	-							NM_015529	NP_056344			monooxygenase, DBH-like 1 isoform 2						catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	133381810	133381811	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133381810_133381811delTG								RPS12 (243108 upstream) : LOC285735 (27408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	136635879	136635880	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136635879_136635880insA								BCLAF1 (24890 upstream) : MAP7 (27993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	137372578	137372579	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137372578_137372579delTG								IL20RA (6280 upstream) : IL22RA2 (92379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	139683980	139683981	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139683980_139683981delGT								TXLNB (70772 upstream) : CITED2 (9416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142176148	142176149	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142176148_142176149delAC	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	145613842	145613842	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145613842delA								UTRN (439674 upstream) : EPM2A (332604 downstream)																																			---	---	---	---
EPM2A	7957	broad.mit.edu	37	6	146012112	146012113	+	Intron	INS	-	A	A	rs73579483	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146012112_146012113insA	uc003qkw.2	-						EPM2A_uc003qkv.2_Intron|EPM2A_uc010khr.2_Intron|EPM2A_uc003qkx.2_Intron	NM_005670	NP_005661			laforin isoform a						glycogen metabolic process	cytosol|endoplasmic reticulum|nucleus|plasma membrane|polysome	carbohydrate binding|identical protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	146814988	146814989	+	IGR	DEL	AC	-	-	rs112696710		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146814988_146814989delAC								GRM1 (56257 upstream) : RAB32 (49839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148620012	148620015	+	IGR	DEL	GGAG	-	-	rs113332172	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148620012_148620015delGGAG								SAMD5 (728855 upstream) : SASH1 (43714 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149395685	149395685	+	3'UTR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149395685delA	uc003qmg.2	+	8						NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
C6orf97	80129	broad.mit.edu	37	6	151867080	151867082	+	Intron	DEL	TTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151867080_151867082delTTT	uc003qol.2	+							NM_025059	NP_079335			hypothetical protein LOC80129												0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)														---	---	---	---
OPRM1	4988	broad.mit.edu	37	6	154420428	154420443	+	Intron	DEL	AAGGAAGGAAGGAAGA	-	-	rs150542233	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154420428_154420443delAAGGAAGGAAGGAAGA	uc003qpr.2	+						OPRM1_uc011efc.1_Intron|OPRM1_uc011efd.1_Intron|OPRM1_uc011efe.1_Intron|OPRM1_uc011eff.1_Intron|OPRM1_uc011efg.1_Intron|OPRM1_uc011efh.1_Intron|OPRM1_uc003qpq.1_Intron|OPRM1_uc003qpt.1_Intron|OPRM1_uc011efi.1_Intron|OPRM1_uc003qpp.2_Intron|OPRM1_uc003qps.2_Intron|OPRM1_uc010kjg.2_Intron	NM_000914	NP_000905			opioid receptor, mu 1 isoform MOR-1						behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	154971783	154971784	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154971783_154971784delGA								CNKSR3 (140030 upstream) : RBM16 (82728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156412693	156412693	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156412693delA								MIR1202 (144680 upstream) : ARID1B (686393 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	158023522	158023523	+	Intron	DEL	AA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158023522_158023523delAA	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjm.1_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
TMEM181	57583	broad.mit.edu	37	6	159025368	159025369	+	Intron	DEL	GT	-	-	rs72016994		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159025368_159025369delGT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874			G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)														---	---	---	---
FNDC1	84624	broad.mit.edu	37	6	159646326	159646326	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159646326delT	uc010kjv.2	+						FNDC1_uc010kjw.1_Intron	NM_032532	NP_115921			fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)														---	---	---	---
FNDC1	84624	broad.mit.edu	37	6	159658541	159658541	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159658541delC	uc010kjv.2	+						FNDC1_uc010kjw.1_Intron	NM_032532	NP_115921			fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	160356319	160356320	+	IGR	DEL	CA	-	-	rs71854069		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160356319_160356320delCA								MAS1 (27214 upstream) : IGF2R (33811 downstream)																																			---	---	---	---
LPA	4018	broad.mit.edu	37	6	161005267	161005272	+	Intron	DEL	TCTTCC	-	-	rs60317645	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161005267_161005272delTCTTCC	uc003qtl.2	-							NM_005577	NP_005568			lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
PARK2	5071	broad.mit.edu	37	6	161980161	161980161	+	Intron	DEL	T	-	-	rs7749872	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161980161delT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166115135	166115136	+	IGR	INS	-	TGTG	TGTG	rs72116517		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166115135_166115136insTGTG								PDE10A (39551 upstream) : C6orf176 (222400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166171974	166171975	+	IGR	INS	-	AGAAAGA	AGAAAGA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166171974_166171975insAGAAAGA								PDE10A (96390 upstream) : C6orf176 (165561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166209964	166209964	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166209964delA	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166271223	166271226	+	Intron	DEL	GTGA	-	-	rs33995220	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166271223_166271226delGTGA	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168052216	168052217	+	IGR	INS	-	TG	TG	rs149093424		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168052216_168052217insTG								TCP10 (254218 upstream) : C6orf123 (133004 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169240556	169240557	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169240556_169240557insA								SMOC2 (171885 upstream) : THBS2 (375319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	169266929	169266929	+	IGR	DEL	C	-	-	rs11346951		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169266929delC								SMOC2 (198258 upstream) : THBS2 (348947 downstream)																																			---	---	---	---
WDR27	253769	broad.mit.edu	37	6	169933919	169933920	+	Intron	INS	-	TG	TG	rs139595353	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169933919_169933920insTG	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	108476	108477	+	IGR	INS	-	TT	TT	rs10650061		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108476_108477insTT								None (None upstream) : FAM20C (84492 downstream)																																			---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	623126	623127	+	Intron	DEL	GT	-	-	rs66895842		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:623126_623127delGT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
KIAA1908	114796	broad.mit.edu	37	7	1612513	1612513	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1612513delG	uc003sla.2	+						PSMG3_uc003skx.2_5'Flank|PSMG3_uc011jvx.1_5'Flank|KIAA1908_uc003sky.1_Intron|KIAA1908_uc003skz.1_Intron	NR_021487				Homo sapiens mRNA for KIAA1908 protein, partial cds.												0																		---	---	---	---
SNX8	29886	broad.mit.edu	37	7	2343801	2343802	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2343801_2343802insA	uc003slw.2	-							NM_013321	NP_037453			sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2919733	2919734	+	IGR	DEL	TA	-	-	rs67095706		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2919733_2919734delTA								GNA12 (35774 upstream) : CARD11 (26035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	2936688	2936690	+	IGR	DEL	TCC	-	-	rs143888830		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2936688_2936690delTCC								GNA12 (52729 upstream) : CARD11 (9079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	3157136	3157142	+	IGR	DEL	GGGGAGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3157136_3157142delGGGGAGA								CARD11 (73557 upstream) : SDK1 (183938 downstream)																																			---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3626933	3626936	+	Intron	DEL	GTGT	-	-	rs144795211		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3626933_3626936delGTGT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
GRID2IP	392862	broad.mit.edu	37	7	6551011	6551011	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6551011delT	uc011jwx.1	-							NM_001145118	NP_001138590			glutamate receptor, ionotropic, delta 2 (Grid2)						actin cytoskeleton organization	cell junction|postsynaptic membrane	actin binding				0																		---	---	---	---
ICA1	3382	broad.mit.edu	37	7	8192490	8192492	+	Intron	DEL	CCG	-	-	rs111329555	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8192490_8192492delCCG	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682			islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)														---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11709599	11709600	+	Intron	DEL	TG	-	-	rs35769040		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11709599_11709600delTG	uc003ssf.3	-							NM_015204	NP_056019			thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)											HNSCC(18;0.044)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	13348754	13348754	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13348754delT								ARL4A (618198 upstream) : ETV1 (582104 downstream)																																			---	---	---	---
ETV1	2115	broad.mit.edu	37	7	13956341	13956341	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13956341delC	uc011jxq.1	-						ETV1_uc011jxn.1_Intron|ETV1_uc011jxo.1_Intron|ETV1_uc011jxp.1_Intron|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_Intron|ETV1_uc011jxr.1_Intron|ETV1_uc011jxs.1_Intron|ETV1_uc010ktv.2_Intron	NM_004956	NP_004947			ets variant gene 1 isoform a						transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35								T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								---	---	---	---
Unknown	0	broad.mit.edu	37	7	15224032	15224033	+	IGR	INS	-	GGAA	GGAA	rs147194127	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15224032_15224033insGGAA								DGKB (281482 upstream) : TMEM195 (15910 downstream)																																			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18178136	18178137	+	Intron	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18178136_18178137delGA	uc011jya.1	+							NM_014707	NP_055522			histone deacetylase 9 isoform 3						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
DFNA5	1687	broad.mit.edu	37	7	24747303	24747304	+	Intron	DEL	AC	-	-	rs66969664		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24747303_24747304delAC	uc010kus.1	-						DFNA5_uc003swz.2_Intron|DFNA5_uc003sxa.1_Intron|DFNA5_uc010kut.1_Intron	NM_001127453	NP_001120925			deafness, autosomal dominant 5 protein isoform						sensory perception of sound					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25277973	25277973	+	IGR	DEL	A	-	-	rs5882971		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25277973delA								NPVF (9868 upstream) : MIR148A (711566 downstream)																																			---	---	---	---
SKAP2	8935	broad.mit.edu	37	7	26945517	26945518	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26945517_26945518insA	uc011jzj.1	-							NM_003930	NP_003921			src kinase associated phosphoprotein 2						B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	27407882	27407883	+	IGR	INS	-	CACATACT	CACATACT	rs148117455	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27407882_27407883insCACATACT								EVX1 (121690 upstream) : HIBADH (157180 downstream)																																			---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29490395	29490395	+	Intron	DEL	T	-	-	rs113713432		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29490395delT	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29551808	29551808	+	Intron	DEL	C	-	-	rs60887780		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29551808delC	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron|CHN2_uc010kvg.2_Intron|CHN2_uc010kvh.2_Intron|CHN2_uc010kvi.2_Intron|CHN2_uc010kve.2_Intron|CHN2_uc003taa.2_Intron|CHN2_uc010kvf.2_Intron|CHN2_uc010kvj.2_Intron|CHN2_uc010kvk.2_Intron|CHN2_uc010kvl.2_Intron|CHN2_uc010kvm.2_Intron|CHN2_uc011jzv.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
PDE1C	5137	broad.mit.edu	37	7	31926458	31926459	+	Intron	INS	-	GAATA	GAATA	rs140923964	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31926458_31926459insGAATA	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011			phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	35744796	35744796	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35744796delT								HERPUD2 (10024 upstream) : SEPT7 (95831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36170919	36170920	+	IGR	INS	-	A	A	rs148519185	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36170919_36170920insA								SEPT7 (226004 upstream) : EEPD1 (21916 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	36998304	36998305	+	Intron	INS	-	T	T	rs111588384	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36998304_36998305insT	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	37549040	37549040	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37549040delA								ELMO1 (60510 upstream) : GPR141 (230956 downstream)																																			---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37887511	37887516	+	5'Flank	DEL	GAAGAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37887511_37887516delGAAGAA	uc003tfn.2	+							NM_016616	NP_057700			thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	41563037	41563037	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41563037delA								C7orf10 (662680 upstream) : INHBA (165566 downstream)																																			---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43510340	43510341	+	Intron	INS	-	CA	CA	rs144181499	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43510340_43510341insCA	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	45237900	45237900	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45237900delA								RAMP3 (14053 upstream) : ADCY1 (375839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48902777	48902778	+	IGR	INS	-	T	T	rs142330028	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48902777_48902778insT								ABCA13 (215686 upstream) : CDC14C (61379 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48913733	48913733	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48913733delG								ABCA13 (226642 upstream) : CDC14C (50424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49159713	49159715	+	IGR	DEL	CTT	-	-	rs139591285		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49159713_49159715delCTT								CDC14C (192664 upstream) : VWC2 (653542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49539331	49539332	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49539331_49539332delAC								CDC14C (572282 upstream) : VWC2 (273925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51865795	51865796	+	IGR	INS	-	AC	AC	rs141090315	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51865795_51865796insAC								COBL (481280 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53717311	53717312	+	IGR	INS	-	TG	TG	rs145942691	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53717311_53717312insTG								POM121L12 (612694 upstream) : HPVC1 (551605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55509296	55509300	+	IGR	DEL	ATTAA	-	-	rs66515051		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55509296_55509300delATTAA								LANCL2 (7863 upstream) : VOPP1 (29007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55512906	55512909	+	IGR	DEL	ACAG	-	-	rs145051208	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55512906_55512909delACAG								LANCL2 (11473 upstream) : VOPP1 (25398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56076871	56076874	+	IGR	DEL	TTTC	-	-	rs145230373		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56076871_56076874delTTTC								GBAS (9000 upstream) : PSPH (1872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56905859	56905862	+	IGR	DEL	TTCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56905859_56905862delTTCT								DKFZp434L192 (340882 upstream) : ZNF479 (281466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57610864	57610864	+	IGR	DEL	A	-	-	rs113931962		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57610864delA								ZNF716 (77599 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57648800	57648800	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57648800delT								ZNF716 (115535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57728682	57728683	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57728682_57728683delTG								ZNF716 (195417 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58031182	58031182	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58031182delC								ZNF716 (497917 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61510628	61510628	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61510628delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61531452	61531452	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61531452delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61790126	61790127	+	IGR	INS	-	CAG	CAG	rs142560201		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61790126_61790127insCAG								None (None upstream) : LOC643955 (961545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61794839	61794840	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61794839_61794840insG								None (None upstream) : LOC643955 (956832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62002105	62002105	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62002105delT								None (None upstream) : LOC643955 (749567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62690425	62690425	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62690425delA								None (None upstream) : LOC643955 (61247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62828475	62828475	+	IGR	DEL	A	-	-	rs113557250		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62828475delA								LOC100287704 (16324 upstream) : ZNF727 (677346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63555328	63555328	+	IGR	DEL	A	-	-	rs36035162		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63555328delA								ZNF727 (16403 upstream) : ZNF735 (112253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63566116	63566121	+	IGR	DEL	TGTTAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63566116_63566121delTGTTAG								ZNF727 (27191 upstream) : ZNF735 (101460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64961321	64961321	+	IGR	DEL	T	-	-	rs35970258		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64961321delT								ZNF92 (95324 upstream) : INTS4L2 (151456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67317835	67317843	+	IGR	DEL	GGAGGAGGG	-	-	rs13238498		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67317835_67317843delGGAGGAGGG								STAG3L4 (531323 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67481264	67481267	+	IGR	DEL	CTTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67481264_67481267delCTTT								STAG3L4 (694752 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68611347	68611348	+	IGR	INS	-	TC	TC	rs73153237		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68611347_68611348insTC								None (None upstream) : AUTS2 (452557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68885010	68885010	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68885010delA								None (None upstream) : AUTS2 (178895 downstream)																																			---	---	---	---
FZD9	8326	broad.mit.edu	37	7	72846493	72846493	+	5'Flank	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72846493delA	uc003tyb.2	+							NM_003508	NP_003499			frizzled 9 precursor						B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	73062959	73062960	+	IGR	INS	-	TCTT	TCTT	rs144479473	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73062959_73062960insTCTT								MLXIPL (24089 upstream) : VPS37D (19214 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73388038	73388038	+	Intron	DEL	T	-	-	rs111499880		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73388038delT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
CCDC146	57639	broad.mit.edu	37	7	76845079	76845081	+	Intron	DEL	ACT	-	-	rs71689344		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76845079_76845081delACT	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930			coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)																---	---	---	---
PION	54103	broad.mit.edu	37	7	76985342	76985345	+	Intron	DEL	CAAG	-	-	rs10608343		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76985342_76985345delCAAG	uc003ugf.2	-						PION_uc003ugg.1_Intron	NM_017439	NP_059135			pigeon homolog						beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78031511	78031512	+	Intron	DEL	GG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78031511_78031512delGG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	79630386	79630387	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79630386_79630387insA								MAGI2 (547496 upstream) : GNAI1 (133753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85478932	85478933	+	IGR	INS	-	TG	TG	rs113473977		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85478932_85478933insTG								SEMA3D (662761 upstream) : GRM3 (794297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89010645	89010646	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89010645_89010646delGT								ZNF804B (44301 upstream) : DPY19L2P4 (738068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89237264	89237265	+	IGR	DEL	GT	-	-	rs112169148		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89237264_89237265delGT								ZNF804B (270920 upstream) : DPY19L2P4 (511449 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90475107	90475107	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90475107delT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	91367441	91367444	+	IGR	DEL	TGTG	-	-	rs13308786		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91367441_91367444delTGTG								FZD1 (469310 upstream) : MTERF (64016 downstream)																																			---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	98007492	98007492	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98007492delA	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	98030812	98030812	+	5'Flank	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98030812delG	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
C7orf43	55262	broad.mit.edu	37	7	99756779	99756780	+	5'Flank	INS	-	A	A	rs150331470		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99756779_99756780insA	uc003utr.2	-						C7orf43_uc010lgo.2_5'Flank|C7orf43_uc010lgp.2_5'Flank|C7orf43_uc011kjj.1_5'Flank|C7orf43_uc003uts.2_5'Flank	NM_018275	NP_060745			hypothetical protein LOC55262												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100553821	100553821	+	Intron	DEL	T	-	-	rs34850374		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100553821delT	uc003uxk.1	+						uc003uxl.1_Intron					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	101414093	101414095	+	IGR	DEL	CTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101414093_101414095delCTT								MYL10 (141517 upstream) : CUX1 (45197 downstream)																																			---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104049753	104049764	+	Intron	DEL	TGTGTGTGTGTG	-	-	rs68088842		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104049753_104049764delTGTGTGTGTGTG	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104429021	104429021	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104429021delG	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	104576235	104576235	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104576235delA								LOC723809 (9143 upstream) : LOC100216545 (74754 downstream)																																			---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105302458	105302465	+	Intron	DEL	TTTCTTTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105302458_105302465delTTTCTTTC	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	114067400	114067400	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114067400delT	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	114725884	114725884	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114725884delT	uc003vhh.1	+											Homo sapiens, clone IMAGE:4276820, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	114932408	114932409	+	IGR	INS	-	TG	TG	rs149778662	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114932408_114932409insTG								MDFIC (273145 upstream) : TFEC (642793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115119665	115119673	+	IGR	DEL	CCTTCCTTT	-	-	rs67672148		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115119665_115119673delCCTTCCTTT								MDFIC (460402 upstream) : TFEC (455529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115441187	115441188	+	IGR	INS	-	GT	GT	rs138945853	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115441187_115441188insGT								MDFIC (781924 upstream) : TFEC (134014 downstream)																																			---	---	---	---
WNT2	7472	broad.mit.edu	37	7	116921284	116921286	+	Intron	DEL	TGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116921284_116921286delTGT	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382			wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	118102745	118102752	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118102745_118102752delACACACAC								ANKRD7 (219963 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	123409876	123409876	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123409876delA								WASL (20760 upstream) : HYALP1 (44317 downstream)																																			---	---	---	---
POT1	25913	broad.mit.edu	37	7	124554190	124554191	+	Intron	INS	-	A	A	rs35946307		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124554190_124554191insA	uc003vlm.2	-						POT1_uc011koe.1_Intron|POT1_uc003vlk.2_Intron|POT1_uc003vll.2_Intron|POT1_uc003vlo.2_Intron|POT1_uc003vln.2_Intron	NM_015450	NP_056265			protection of telomeres 1 isoform 1						DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1																		---	---	---	---
SND1	27044	broad.mit.edu	37	7	127574211	127574212	+	Intron	INS	-	AA	AA	rs72575002	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127574211_127574212insAA	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
AHCYL2	23382	broad.mit.edu	37	7	128875259	128875261	+	Intron	DEL	TTC	-	-	rs35487046		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128875259_128875261delTTC	uc011kov.1	+						AHCYL2_uc003vot.2_Intron	NM_015328	NP_056143			S-adenosylhomocysteine hydrolase-like 2 isoform						one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2																		---	---	---	---
UBE2H	7328	broad.mit.edu	37	7	129594432	129594433	+	5'Flank	INS	-	C	C	rs144656759	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129594432_129594433insC	uc003vpf.1	-						UBE2H_uc003vpg.1_5'Flank	NM_003344	NP_003335			ubiquitin-conjugating enzyme E2H isoform 1						protein K11-linked ubiquitination|protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin-protein ligase activity			skin(1)	1	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	129801494	129801495	+	IGR	INS	-	A	A	rs146840269	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129801494_129801495insA								KLHDC10 (27901 upstream) : TMEM209 (3060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	129862002	129862002	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129862002delT								C7orf45 (5319 upstream) : CPA2 (44701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131319257	131319260	+	IGR	DEL	TTCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131319257_131319260delTTCT								PODXL (77881 upstream) : PLXNA4 (488832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	136230460	136230460	+	IGR	DEL	A	-	-	rs5887782		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136230460delA								LUZP6 (568256 upstream) : CHRM2 (322939 downstream)																																			---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137368112	137368113	+	Intron	INS	-	TGTT	TGTT	rs142346709	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137368112_137368113insTGTT	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139476414	139476415	+	Intron	INS	-	A	A	rs146561544	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139476414_139476415insA	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron|TBXAS1_uc003vvh.2_5'Flank|TBXAS1_uc010lne.2_5'Flank	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	141175589	141175589	+	5'Flank	DEL	T	-	-	rs113351644		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141175589delT	uc003vwg.1	+											Homo sapiens cDNA FLJ42883 fis, clone BRHIP3006683.																														---	---	---	---
ARHGEF5	7984	broad.mit.edu	37	7	144071639	144071640	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144071639_144071640delGT	uc003wel.2	+						ARHGEF5_uc003wek.2_Intron|ARHGEF5_uc003wem.2_Intron	NM_005435	NP_005426			rho guanine nucleotide exchange factor 5						intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)																	---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144378882	144378882	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144378882delT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146374782	146374783	+	Intron	INS	-	T	T	rs111298471		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146374782_146374783insT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
ZNF775	285971	broad.mit.edu	37	7	150081260	150081260	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150081260delG	uc003whf.1	+							NM_173680	NP_775951			zinc finger protein 775						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152103923	152103924	+	Intron	INS	-	G	G	rs62845260		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152103923_152103924insG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152110686	152110686	+	Intron	DEL	C	-	-	rs68123937		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152110686delC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152151861	152151861	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152151861delT								FABP5L3 (11763 upstream) : LOC100128822 (9348 downstream)																																			---	---	---	---
ACTR3B	57180	broad.mit.edu	37	7	152532141	152532141	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152532141delT	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178			actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)														---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156652265	156652265	+	Intron	DEL	A	-	-	rs2365749		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156652265delA	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156675729	156675729	+	Intron	DEL	A	-	-	rs34681713		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156675729delA	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
UBE3C	9690	broad.mit.edu	37	7	156940801	156940802	+	Intron	INS	-	T	T	rs147531982		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156940801_156940802insT	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486			ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)														---	---	---	---
UBE3C	9690	broad.mit.edu	37	7	156982520	156982521	+	Intron	DEL	TC	-	-	rs138322799		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156982520_156982521delTC	uc010lqs.2	+						UBE3C_uc003wng.2_Intron	NM_014671	NP_055486			ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157826317	157826317	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157826317delA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157943772	157943775	+	Intron	DEL	CCTG	-	-	rs66759675		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157943772_157943775delCCTG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2047842	2047844	+	Intron	DEL	CTT	-	-	rs71993575		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2047842_2047844delCTT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961			myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2085552	2085553	+	Intron	DEL	TG	-	-	rs113254399		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2085552_2085553delTG	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961			myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2213903	2213907	+	IGR	DEL	AAATG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2213903_2213907delAAATG								MYOM2 (120524 upstream) : CSMD1 (578969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2546966	2546968	+	IGR	DEL	TTT	-	-	rs7843270		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2546966_2546968delTTT								MYOM2 (453587 upstream) : CSMD1 (245908 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3415889	3415891	+	Intron	DEL	TGG	-	-	rs112896491		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3415889_3415891delTGG	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3419659	3419660	+	Intron	INS	-	G	G	rs71203443		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3419659_3419660insG	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5075012	5075012	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5075012delT								CSMD1 (222684 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5330866	5330866	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5330866delA								CSMD1 (478538 upstream) : MCPH1 (933255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9058224	9058224	+	Intron	DEL	T	-	-	rs77062444		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9058224delT	uc003wsp.1	+											Homo sapiens cDNA clone IMAGE:4096591, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	9892004	9892004	+	IGR	DEL	A	-	-	rs34541696		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9892004delA								MIR124-1 (131022 upstream) : MSRA (19826 downstream)																																			---	---	---	---
RP1L1	94137	broad.mit.edu	37	8	10494194	10494195	+	Intron	INS	-	A	A	rs144983919	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10494194_10494195insA	uc003wtc.2	-							NM_178857	NP_849188			retinitis pigmentosa 1-like 1						intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11810490	11810490	+	IGR	DEL	A	-	-	rs35728022		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11810490delA								CTSB (84844 upstream) : DEFB136 (20958 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12380029	12380031	+	Intron	DEL	TCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12380029_12380031delTCT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12430743	12430744	+	Intron	INS	-	T	T	rs137908130		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12430743_12430744insT	uc003wvy.3	-						uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12431520	12431520	+	Intron	DEL	A	-	-	rs113159264		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12431520delA	uc003wvy.3	-						uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16720152	16720152	+	IGR	DEL	A	-	-	rs149974148		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16720152delA								MSR1 (669852 upstream) : FGF20 (130182 downstream)																																			---	---	---	---
PCM1	5108	broad.mit.edu	37	8	17804342	17804343	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17804342_17804343delGT	uc003wyi.3	+						PCM1_uc011kyh.1_Intron|PCM1_uc003wyj.3_Intron|PCM1_uc003wyg.2_Intron|PCM1_uc003wyh.2_Intron|PCM1_uc010lta.1_Intron	NM_006197	NP_006188			pericentriolar material 1						centrosome organization|cilium assembly|G2/M transition of mitotic cell cycle|interkinetic nuclear migration|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome	centriolar satellite|cytosol|nuclear membrane|pericentriolar material	identical protein binding		PCM1/JAK2(30)	haematopoietic_and_lymphoid_tissue(30)|breast(4)|ovary(2)	36				Colorectal(111;0.0789)				T	RET|JAK2	papillary thyroid|CML|MPD								---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19328652	19328652	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19328652delA	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron|CSGALNACT1_uc003wzh.2_Intron	NM_001130518	NP_001123990			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	19990799	19990799	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19990799delG								LPL (166030 upstream) : SLC18A1 (11568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20479472	20479473	+	IGR	DEL	CA	-	-	rs113769337		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20479472_20479473delCA								LZTS1 (366669 upstream) : None (None downstream)																																			---	---	---	---
SORBS3	10174	broad.mit.edu	37	8	22418384	22418387	+	Intron	DEL	GTGC	-	-	rs71975352	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22418384_22418387delGTGC	uc003xbv.2	+						SORBS3_uc011kzk.1_Intron	NM_005775	NP_005766			sorbin and SH3 domain containing 3 isoform 1						muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)														---	---	---	---
BIN3	55909	broad.mit.edu	37	8	22506407	22506408	+	Intron	INS	-	GTAT	GTAT	rs142391555	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22506407_22506408insGTAT	uc003xcl.2	-						BIN3_uc010ltw.2_Intron	NM_018688	NP_061158			bridging integrator 3						actin filament organization|barrier septum formation|cell cycle|protein localization|unidimensional cell growth	cytoplasm|cytoskeleton	cytoskeletal adaptor activity				0		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	24049347	24049347	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24049347delT								STC1 (337027 upstream) : ADAM28 (102233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24751787	24751788	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24751787_24751788insA								ADAM7 (367306 upstream) : NEFM (19486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	24863579	24863580	+	IGR	INS	-	AGGG	AGGG	rs143114548	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24863579_24863580insAGGG								NEFL (49448 upstream) : DOCK5 (178707 downstream)																																			---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25735229	25735229	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25735229delG	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_Intron	NM_022659	NP_073150			early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
C8orf75	619351	broad.mit.edu	37	8	29584425	29584425	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29584425delC	uc003xhn.2	-							NR_026765				Homo sapiens chromosome 8 open reading frame 75, mRNA (cDNA clone IMAGE:3607242), partial cds.												0																		---	---	---	---
LEPROTL1	23484	broad.mit.edu	37	8	29957732	29957732	+	Intron	DEL	T	-	-	rs76155250		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29957732delT	uc003xhw.3	+						LEPROTL1_uc003xhx.2_Intron	NM_015344	NP_056159			leptin receptor overlapping transcript-like 1							integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32079548	32079549	+	Intron	INS	-	AT	AT	rs150402572	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32079548_32079549insAT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	32772555	32772555	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32772555delA								NRG1 (149997 upstream) : FUT10 (455791 downstream)																																			---	---	---	---
MAK16	84549	broad.mit.edu	37	8	33354873	33354873	+	Intron	DEL	C	-	-	rs68152666		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33354873delC	uc003xjj.2	+						C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898			MAK16 homolog							nucleolus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	33444977	33444978	+	IGR	INS	-	CCTC	CCTC	rs151092943	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33444977_33444978insCCTC								RNF122 (20334 upstream) : DUSP26 (3878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33563873	33563874	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33563873_33563874insA								DUSP26 (106434 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	37183360	37183361	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37183360_37183361insT								KCNU1 (389719 upstream) : ZNF703 (369940 downstream)																																			---	---	---	---
WHSC1L1	54904	broad.mit.edu	37	8	38174703	38174703	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38174703delG	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_3'UTR	NM_023034	NP_075447			WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)					T	NUP98	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	8	38521769	38521788	+	IGR	DEL	AAAGAAAGAAGGAAAGAAAG	-	-	rs141710195		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38521769_38521788delAAAGAAAGAAGGAAAGAAAG								RNF5P1 (62994 upstream) : TACC1 (63916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	39968845	39968846	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39968845_39968846delTG								IDO2 (94935 upstream) : C8orf4 (42143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	50341036	50341037	+	IGR	DEL	GA	-	-	rs34623760		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50341036_50341037delGA								C8orf22 (352395 upstream) : SNTG1 (481312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	53484677	53484677	+	IGR	DEL	T	-	-	rs35644764		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53484677delT								FAM150A (6656 upstream) : RB1CC1 (50342 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55174235	55174235	+	IGR	DEL	T	-	-	rs34388353		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55174235delT								MRPL15 (113161 upstream) : SOX17 (196260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55763611	55763612	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55763611_55763612delGT								RP1 (81080 upstream) : XKR4 (251405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57583947	57583948	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57583947_57583948delAC								PENK (224665 upstream) : IMPAD1 (286543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61798496	61798496	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61798496delT								CHD7 (19033 upstream) : CLVS1 (402029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62719507	62719508	+	IGR	INS	-	T	T	rs35438428		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62719507_62719508insT								ASPH (92308 upstream) : NKAIN3 (441993 downstream)																																			---	---	---	---
CYP7B1	9420	broad.mit.edu	37	8	65518413	65518414	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65518413_65518414delAC	uc003xvj.2	-							NM_004820	NP_004811			cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)																---	---	---	---
CYP7B1	9420	broad.mit.edu	37	8	65629022	65629022	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65629022delG	uc003xvj.2	-							NM_004820	NP_004811			cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)																---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69038876	69038876	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69038876delT	uc003xxv.1	+							NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	70176899	70176901	+	IGR	DEL	CAG	-	-	rs5892183		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70176899_70176901delCAG								C8orf34 (445643 upstream) : SULF1 (201958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	70364237	70364241	+	IGR	DEL	AATAG	-	-	rs71790581		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70364237_70364241delAATAG								C8orf34 (632981 upstream) : SULF1 (14618 downstream)																																			---	---	---	---
SULF1	23213	broad.mit.edu	37	8	70398666	70398667	+	Intron	INS	-	A	A	rs140367527	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70398666_70398667insA	uc010lza.1	+						SULF1_uc003xyd.2_Intron|SULF1_uc003xye.2_Intron	NM_015170	NP_055985			sulfatase 1 precursor						apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	73299968	73299970	+	Intron	DEL	AAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73299968_73299970delAAG	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	76682636	76682636	+	IGR	DEL	A	-	-	rs147433505		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76682636delA								HNF4G (203577 upstream) : LOC100192378 (840479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78445969	78445970	+	IGR	DEL	TT	-	-	rs72168279		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78445969_78445970delTT								PEX2 (533445 upstream) : PKIA (982366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81206461	81206461	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81206461delG								TPD52 (122625 upstream) : ZBTB10 (191393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	82507725	82507725	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82507725delA								FABP12 (64175 upstream) : IMPA1 (61426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83582471	83582472	+	IGR	DEL	TG	-	-	rs72274025		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83582471_83582472delTG								SNX16 (827950 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84358459	84358460	+	IGR	DEL	TG	-	-	rs72225802		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84358459_84358460delTG								None (None upstream) : RALYL (736993 downstream)																																			---	---	---	---
CA13	377677	broad.mit.edu	37	8	86198400	86198401	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86198400_86198401insA	uc003ydf.1	+											Homo sapiens cDNA FLJ36434 fis, clone THYMU2012002.						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	87892098	87892098	+	Intron	DEL	A	-	-	rs34760629		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87892098delA	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	92653777	92653777	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92653777delC								SLC26A7 (243397 upstream) : RUNX1T1 (317375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94201845	94201846	+	IGR	INS	-	A	A	rs149875045	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94201845_94201846insA								C8orf83 (171944 upstream) : FAM92A1 (510927 downstream)																																			---	---	---	---
CCNE2	9134	broad.mit.edu	37	8	95892993	95892993	+	3'UTR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95892993delA	uc003yhc.2	-	12						NM_057749	NP_477097			cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	96737085	96737086	+	IGR	INS	-	T	T	rs142152084	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96737085_96737086insT								C8orf37 (455648 upstream) : GDF6 (417474 downstream)																																			---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97507736	97507737	+	Intron	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97507736_97507737insG	uc003yhv.1	+							NM_002998	NP_002989			syndecan 2 precursor							integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	108776393	108776393	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108776393delA								ANGPT1 (266139 upstream) : RSPO2 (135152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109409791	109409791	+	IGR	DEL	A	-	-	rs34117481		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109409791delA								EIF3E (148832 upstream) : TTC35 (46062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109939331	109939331	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109939331delA								TMEM74 (139561 upstream) : TRHR (160408 downstream)																																			---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110428077	110428077	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110428077delA	uc003yne.2	+							NM_177531	NP_803875			fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	113068899	113068899	+	IGR	DEL	T	-	-	rs147064242		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113068899delT								None (None upstream) : CSMD3 (166262 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113254086	113254087	+	Intron	DEL	CG	-	-	rs1548987		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113254086_113254087delCG	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
TRPS1	7227	broad.mit.edu	37	8	116474869	116474869	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116474869delT	uc003ynz.2	-						TRPS1_uc011lhy.1_Intron|TRPS1_uc003yny.2_Intron|TRPS1_uc010mcy.2_Intron	NM_014112	NP_054831			zinc finger transcription factor TRPS1						negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)											Langer-Giedion_syndrome				---	---	---	---
ENPP2	5168	broad.mit.edu	37	8	120638282	120638283	+	Intron	INS	-	A	A	rs149710626	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120638282_120638283insA	uc003yot.1	-						ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181			autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122494056	122494056	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122494056delT								SNTB1 (669747 upstream) : HAS2 (131215 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125722928	125722931	+	Intron	DEL	TGTG	-	-	rs149769261		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125722928_125722931delTGTG	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126363596	126363596	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126363596delA	uc003yrw.2	+							NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	127898898	127898900	+	IGR	DEL	CTC	-	-	rs141040317		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127898898_127898900delCTC								FAM84B (328432 upstream) : LOC727677 (403162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128199754	128199754	+	IGR	DEL	G	-	-	rs112856158		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128199754delG								FAM84B (629288 upstream) : LOC727677 (102308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128691842	128691843	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128691842_128691843delGA								LOC727677 (197458 upstream) : MYC (55922 downstream)																																			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133176588	133176589	+	Intron	INS	-	T	T	rs72007031		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133176588_133176589insT	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
NDRG1	10397	broad.mit.edu	37	8	134292669	134292669	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134292669delT	uc003yuh.2	-						NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714			N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
ST3GAL1	6482	broad.mit.edu	37	8	134557149	134557151	+	Intron	DEL	CTT	-	-	rs141039403		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134557149_134557151delCTT	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479			ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)															---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136508809	136508809	+	Intron	DEL	A	-	-	rs5895313		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136508809delA	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
KCNK9	51305	broad.mit.edu	37	8	140708958	140708959	+	Intron	INS	-	TGGG	TGGG	rs143977736	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140708958_140708959insTGGG	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685			potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)															---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141282112	141282113	+	Intron	INS	-	AG	AG	rs150940391	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141282112_141282113insAG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141282215	141282216	+	Intron	INS	-	ATGATG	ATGATG	rs138421200	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141282215_141282216insATGATG	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
FLJ43860	389690	broad.mit.edu	37	8	142477454	142477463	+	Intron	DEL	CCTGGCCCTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142477454_142477463delCCTGGCCCTT	uc003ywi.2	-						FLJ43860_uc011ljs.1_Intron|FLJ43860_uc010meu.1_Intron	NM_207414	NP_997297			hypothetical protein LOC389690								binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142678205	142678205	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142678205delG								FLJ43860 (160875 upstream) : MIR1302-7 (189398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144310020	144310020	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144310020delC								GPIHBP1 (10977 upstream) : ZFP41 (18971 downstream)																																			---	---	---	---
TOP1MT	116447	broad.mit.edu	37	8	144403622	144403634	+	Intron	DEL	CACACACGCACGC	-	-	rs62524730	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144403622_144403634delCACACACGCACGC	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_Intron|TOP1MT_uc011lkf.1_Intron|TOP1MT_uc010mfd.1_Intron	NM_052963	NP_443195			mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)													---	---	---	---
EPPK1	83481	broad.mit.edu	37	8	144940081	144940081	+	Intron	DEL	C	-	-	rs60421625		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940081delC	uc003zaa.1	-							NM_031308	NP_112598			epiplakin 1							cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
ARHGAP39	80728	broad.mit.edu	37	8	145769869	145769870	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145769869_145769870delTG	uc003zdt.1	-						ARHGAP39_uc011llk.1_Intron|ARHGAP39_uc003zds.1_Intron	NM_025251	NP_079527			KIAA1688 protein						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	251973	251973	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:251973delT	uc003zgf.2	+						DOCK8_uc011lls.1_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
DMRT1	1761	broad.mit.edu	37	9	883229	883229	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:883229delA	uc003zgv.2	+						DMRT1_uc003zgu.1_Intron	NM_021951	NP_068770			doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)														---	---	---	---
RFX3	5991	broad.mit.edu	37	9	3375961	3375962	+	Intron	DEL	AA	-	-	rs76686581		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3375961_3375962delAA	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304			regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	4462635	4462648	+	IGR	DEL	ACACGCACACACAC	-	-	rs56233060		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4462635_4462648delACACGCACACACAC								GLIS3 (162600 upstream) : SLC1A1 (27796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	6186577	6186577	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6186577delG								RANBP6 (170937 upstream) : IL33 (29230 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	9261648	9261649	+	Intron	DEL	GT	-	-	rs35276416		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:9261648_9261649delGT	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12365178	12365179	+	IGR	INS	-	GT	GT	rs147097576	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12365178_12365179insGT								None (None upstream) : TYRP1 (328207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13759254	13759265	+	IGR	DEL	CTCTGCCCCCGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13759254_13759265delCTCTGCCCCCGA								MPDZ (479691 upstream) : NFIB (322583 downstream)																																			---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18506592	18506593	+	Intron	INS	-	A	A	rs5013435	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18506592_18506593insA	uc003zne.3	+						ADAMTSL1_uc003znb.2_Intron|ADAMTSL1_uc003znc.3_Intron	NM_001040272	NP_001035362			ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
HAUS6	54801	broad.mit.edu	37	9	19082754	19082760	+	Intron	DEL	AAAAAAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082754_19082760delAAAAAAC	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115			HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2																		---	---	---	---
CDKN2BAS	100048912	broad.mit.edu	37	9	22071509	22071509	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22071509delA	uc010miw.1	+						CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron					Homo sapiens hypothetical methylthioadenosine phosphorylase fusion protein mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	22298809	22298809	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22298809delT								CDKN2BAS (177718 upstream) : DMRTA1 (148031 downstream)																																			---	---	---	---
LINGO2	158038	broad.mit.edu	37	9	28174920	28174921	+	Intron	DEL	GA	-	-	rs67688361	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28174920_28174921delGA	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783			leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	31502259	31502260	+	IGR	DEL	GT	-	-	rs58288896		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31502259_31502260delGT								None (None upstream) : ACO1 (882341 downstream)																																			---	---	---	---
ANXA2P2	304	broad.mit.edu	37	9	33623306	33623307	+	5'Flank	INS	-	CTC	CTC	rs150377200	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33623306_33623307insCTC	uc010mjx.2	+							NM_004039	NP_004030			annexin A2 isoform 2												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	33662120	33662121	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33662120_33662121delCA								ANXA2P2 (36590 upstream) : PTENP1 (11386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	33703314	33703314	+	IGR	DEL	A	-	-	rs142033942		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33703314delA								PTENP1 (25896 upstream) : PRSS3 (47201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	34357888	34357890	+	IGR	DEL	CTT	-	-	rs75743654		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34357888_34357890delCTT								NUDT2 (14193 upstream) : KIAA1161 (11018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	35885301	35885301	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35885301delA								OR13J1 (14903 upstream) : HRCT1 (20888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	36787651	36787652	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36787651_36787652delGT								MELK (109973 upstream) : PAX5 (50879 downstream)																																			---	---	---	---
FBXO10	26267	broad.mit.edu	37	9	37551681	37551682	+	Intron	INS	-	GGTCT	GGTCT	rs141212248	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37551681_37551682insGGTCT	uc004aab.2	-						FBXO10_uc004aac.2_Intron|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298			F-box protein 10							ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)														---	---	---	---
FBXO10	26267	broad.mit.edu	37	9	37573881	37573882	+	Intron	INS	-	AAAG	AAAG	rs151197282	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37573881_37573882insAAAG	uc004aab.2	-						FBXO10_uc004aac.2_Intron|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298			F-box protein 10							ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66977674	66977677	+	IGR	DEL	TGTC	-	-	rs138306016	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66977674_66977677delTGTC								LOC442421 (474647 upstream) : AQP7P1 (276590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69810347	69810347	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69810347delG								LOC100133920 (145398 upstream) : FOXD4L5 (365362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70667775	70667775	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70667775delG								CBWD3 (167712 upstream) : FOXD4L3 (250008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	78960514	78960515	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78960514_78960515insT	uc004akc.1	+											Homo sapiens cDNA FLJ16215 fis, clone CTONG2025610, moderately similar to PC6B.																														---	---	---	---
GNA14	9630	broad.mit.edu	37	9	80253291	80253292	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80253291_80253292insA	uc004aku.2	-							NM_004297	NP_004288			G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	81424163	81424163	+	IGR	DEL	T	-	-	rs11349555		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81424163delT								PSAT1 (479156 upstream) : TLE4 (762715 downstream)																																			---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82328767	82328769	+	Intron	DEL	TTG	-	-	rs34351474		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82328767_82328769delTTG	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936			transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	82508853	82508853	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82508853delG								TLE4 (167196 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83211589	83211590	+	IGR	DEL	AT	-	-	rs72445869		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83211589_83211590delAT								TLE4 (869932 upstream) : TLE1 (987010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83567368	83567371	+	IGR	DEL	TGAT	-	-	rs144732160		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83567368_83567371delTGAT								None (None upstream) : TLE1 (631229 downstream)																																			---	---	---	---
RASEF	158158	broad.mit.edu	37	9	85619330	85619331	+	Intron	INS	-	TTTATTCTATTA	TTTATTCTATTA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85619330_85619331insTTTATTCTATTA	uc004amo.1	-							NM_152573	NP_689786			RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	86795313	86795313	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86795313delA								RMI1 (176331 upstream) : SLC28A3 (97779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87096230	87096230	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87096230delT								SLC28A3 (112817 upstream) : NTRK2 (187236 downstream)																																			---	---	---	---
WNK2	65268	broad.mit.edu	37	9	96063211	96063213	+	Intron	DEL	CTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96063211_96063213delCTC	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron	NM_006648	NP_006639			WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	97067015	97067016	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97067015_97067016delGT								ZNF169 (1724 upstream) : FAM22F (13462 downstream)																																			---	---	---	---
HSD17B3	3293	broad.mit.edu	37	9	99055944	99055945	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99055944_99055945delTG	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188			estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)													---	---	---	---
TMEM38B	55151	broad.mit.edu	37	9	108468576	108468577	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108468576_108468577insT	uc004bcu.1	+						TMEM38B_uc010mtn.1_Intron	NM_018112	NP_060582			transmembrane protein 38B							integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	108622125	108622128	+	IGR	DEL	AGAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108622125_108622128delAGAA								TMEM38B (84681 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	108877283	108877284	+	Intron	DEL	TG	-	-	rs140685531		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108877283_108877284delTG	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	109789483	109789484	+	Intron	INS	-	AT	AT	rs146115056	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109789483_109789484insAT	uc004bdc.1	-											Homo sapiens cDNA FLJ40387 fis, clone TESTI2036129.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	110301231	110301232	+	IGR	INS	-	A	A	rs149826549	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110301231_110301232insA								KLF4 (49184 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111119215	111119216	+	IGR	DEL	AT	-	-	rs149260031		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111119215_111119216delAT								KLF4 (867168 upstream) : ACTL7B (497655 downstream)																																			---	---	---	---
C9orf152	401546	broad.mit.edu	37	9	112962443	112962450	+	3'UTR	DEL	GAAAGAAA	-	-	rs76094720		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112962443_112962450delGAAAGAAA	uc011lwk.1	-	2						NM_001012993	NP_001013011			hypothetical protein LOC401546												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	113050732	113050732	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113050732delC								TXN (31899 upstream) : TXNDC8 (15136 downstream)																																			---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113129690	113129692	+	Intron	DEL	TGC	-	-	rs35388210		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113129690_113129692delTGC	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197			polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114892878	114892882	+	Intron	DEL	AAGGA	-	-	rs138689929	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114892878_114892882delAAGGA	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114928166	114928169	+	Intron	DEL	AAAG	-	-	rs10622700		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114928166_114928169delAAAG	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
SNX30	401548	broad.mit.edu	37	9	115620072	115620075	+	Intron	DEL	CCAA	-	-	rs67956394		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115620072_115620075delCCAA	uc004bgj.3	+						SNX30_uc004bgi.3_Intron	NM_001012994	NP_001013012			sorting nexin family member 30						cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0																		---	---	---	---
COL27A1	85301	broad.mit.edu	37	9	116928547	116928554	+	Intron	DEL	CCATCCAC	-	-	rs72227039	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116928547_116928554delCCATCCAC	uc011lxl.1	+						COL27A1_uc004bii.2_5'Flank|COL27A1_uc010mvd.1_5'Flank	NM_032888	NP_116277			collagen, type XXVII, alpha 1 precursor						cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119537865	119537868	+	Intron	DEL	AGGG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119537865_119537868delAGGG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	123516310	123516311	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123516310_123516311insA								MEGF9 (39698 upstream) : FBXW2 (2943 downstream)																																			---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126217667	126217667	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126217667delC	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126800880	126800880	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126800880delT								LHX2 (5438 upstream) : NEK6 (219006 downstream)																																			---	---	---	---
OLFML2A	169611	broad.mit.edu	37	9	127565192	127565192	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127565192delT	uc004bov.2	+						OLFML2A_uc010mwr.1_Intron|OLFML2A_uc004bow.2_Intron	NM_182487	NP_872293			olfactomedin-like 2A precursor												0																		---	---	---	---
SCAI	286205	broad.mit.edu	37	9	127825381	127825382	+	Intron	INS	-	C	C	rs148655325	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127825381_127825382insC	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349			suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5																		---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128365336	128365339	+	Intron	DEL	TCTT	-	-	rs67808052		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128365336_128365339delTCTT	uc004bpv.2	-						MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
PBX3	5090	broad.mit.edu	37	9	128520577	128520577	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128520577delT	uc004bqb.2	+						PBX3_uc004bqc.2_Intron|PBX3_uc004bqd.2_Intron|PBX3_uc011lzw.1_Intron	NM_006195	NP_006186			pre-B-cell leukemia homeobox 3 isoform 1						anterior compartment pattern formation|posterior compartment specification		sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
LRSAM1	90678	broad.mit.edu	37	9	130215711	130215712	+	Intron	INS	-	T	T	rs139069232	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130215711_130215712insT	uc004brb.1	+						RPL12_uc004bqx.1_5'Flank|RPL12_uc004bqy.1_5'Flank|RPL12_uc004bqz.1_5'Flank|LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron	NM_001005373	NP_001005373			leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
ST6GALNAC6	30815	broad.mit.edu	37	9	130651085	130651086	+	Intron	INS	-	AAAC	AAAC	rs147526142	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130651085_130651086insAAAC	uc004bso.1	-						ST6GALNAC6_uc004bsn.1_Intron|ST6GALNAC6_uc011man.1_Intron|ST6GALNAC6_uc004bsp.1_Intron|ST6GALNAC6_uc004bsq.1_Intron|ST6GALNAC6_uc004bsr.2_Intron|ST6GALNAC6_uc010mxp.1_Intron	NM_013443	NP_038471			sialytransferase 7F						protein glycosylation	integral to Golgi membrane|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	130812299	130812299	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130812299delA								FAM102A (69804 upstream) : NAIF1 (11214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	130881292	130881304	+	5'Flank	DEL	GGGGTACAGGGAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130881292_130881304delGGGGTACAGGGAT	uc004btg.1	-											Homo sapiens cDNA FLJ42733 fis, clone BRAWH2013871.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	132105449	132105449	+	5'Flank	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132105449delA	uc004bxu.2	+											Homo sapiens cDNA clone IMAGE:6277875, partial cds.																														---	---	---	---
TOR1A	1861	broad.mit.edu	37	9	132584177	132584177	+	Intron	DEL	A	-	-	rs36012219		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132584177delA	uc004byl.2	-						TOR1A_uc004bym.2_Intron|TOR1A_uc004byn.2_3'UTR	NM_000113	NP_000104			torsin A precursor						chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)																---	---	---	---
ASS1	445	broad.mit.edu	37	9	133364632	133364632	+	Intron	DEL	A	-	-	rs543048	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133364632delA	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_Intron|ASS1_uc010mzc.2_Intron	NM_000050	NP_000041			argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)													---	---	---	---
FUBP3	8939	broad.mit.edu	37	9	133481372	133481374	+	Intron	DEL	AAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133481372_133481374delAAC	uc004bzr.1	+						FUBP3_uc010mzd.1_Intron|FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925			far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	133829204	133829207	+	IGR	DEL	TTTG	-	-	rs111414765	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133829204_133829207delTTTG								FIBCD1 (14749 upstream) : LAMC3 (55297 downstream)																																			---	---	---	---
NTNG2	84628	broad.mit.edu	37	9	135047435	135047435	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135047435delC	uc004cbh.2	+							NM_032536	NP_115925			netrin G2 precursor						axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	136157948	136157948	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136157948delT								ABO (7318 upstream) : SURF6 (39605 downstream)																																			---	---	---	---
OLFM1	10439	broad.mit.edu	37	9	137976437	137976438	+	Intron	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137976437_137976438delTC	uc004cfl.3	+						OLFM1_uc004cfk.3_Intron	NM_014279	NP_055094			olfactomedin related ER localized protein						nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138315170	138315170	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138315170delA								OLFM1 (302139 upstream) : KIAA0649 (56478 downstream)																																			---	---	---	---
NACC2	138151	broad.mit.edu	37	9	138965500	138965501	+	Intron	INS	-	A	A	rs150785150	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138965500_138965501insA	uc004cgw.2	-						NACC2_uc010nbh.2_Intron	NM_144653	NP_653254			BTB (POZ) domain containing 14A						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0																		---	---	---	---
EXD3	54932	broad.mit.edu	37	9	140224289	140224289	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140224289delG	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290			exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	951601	951619	+	IGR	DEL	GGGAGGAGCTGAGGAGCAA	-	-	rs72388873		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:951601_951619delGGGAGGAGCTGAGGAGCAA								LARP4B (19899 upstream) : GTPBP4 (82730 downstream)																																			---	---	---	---
WDR37	22884	broad.mit.edu	37	10	1135583	1135608	+	Intron	DEL	GCCTTCCCGTGCTCACCCGCAGTTCG	-	-	rs71930905		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1135583_1135608delGCCTTCCCGTGCTCACCCGCAGTTCG	uc001igf.1	+						WDR37_uc001ige.2_Intron|WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron|WDR37_uc001igg.1_Intron|uc001igh.1_5'Flank	NM_014023	NP_054742			WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2878033	2878034	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2878033_2878034delAC								None (None upstream) : PFKP (231718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3349884	3349884	+	IGR	DEL	T	-	-	rs112500371		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3349884delT								PITRM1 (134881 upstream) : KLF6 (468305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3388700	3388700	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3388700delA	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	3450956	3450957	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3450956_3450957delAG	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	4324550	4324551	+	IGR	INS	-	CCT	CCT	rs148016856	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4324550_4324551insCCT								KLF6 (497077 upstream) : LOC100216001 (296893 downstream)																																			---	---	---	---
TAF3	83860	broad.mit.edu	37	10	7900788	7900789	+	Intron	INS	-	GC	GC	rs71477299		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7900788_7900789insGC	uc010qbd.1	+							NM_031923	NP_114129			RNA polymerase II transcription factor TAFII140						maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	9158155	9158155	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9158155delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	12333659	12333660	+	IGR	DEL	TG	-	-	rs150507314		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12333659_12333660delTG								CDC123 (41072 upstream) : CAMK1D (57923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	13406686	13406687	+	IGR	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13406686_13406687delTT								SEPHS1 (16406 upstream) : BEND7 (73797 downstream)																																			---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14423846	14423847	+	Intron	INS	-	CA	CA	rs142476158	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14423846_14423847insCA	uc001imv.2	-						FRMD4A_uc001imw.1_Intron					Homo sapiens mRNA for KIAA1294 protein, partial cds.							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
NMT2	9397	broad.mit.edu	37	10	15186730	15186730	+	Intron	DEL	A	-	-	rs79010165		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15186730delA	uc001inz.1	-						NMT2_uc001ioa.1_Intron|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Intron	NM_004808	NP_004799			N-myristoyltransferase 2						N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15804360	15804366	+	IGR	DEL	CTCTTCC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15804360_15804366delCTCTTCC								ITGA8 (42590 upstream) : FAM188A (15809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	16351805	16351806	+	IGR	INS	-	A	A	rs147967994	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16351805_16351806insA								FAM188A (449286 upstream) : PTER (127161 downstream)																																			---	---	---	---
TRDMT1	1787	broad.mit.edu	37	10	17185913	17185917	+	3'UTR	DEL	ATTTG	-	-	rs112711850		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17185913_17185917delATTTG	uc001iop.2	-	11					TRDMT1_uc001ioq.2_3'UTR|TRDMT1_uc001ior.2_3'UTR|TRDMT1_uc001ios.2_3'UTR|TRDMT1_uc009xjt.2_3'UTR	NM_004412	NP_004403			tRNA aspartic acid methyltransferase 1 isoform						tRNA processing	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	18410684	18410686	+	IGR	DEL	TGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18410684_18410686delTGT								SLC39A12 (78463 upstream) : CACNB2 (18920 downstream)																																			---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18848412	18848416	+	Intron	DEL	GAATG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18848412_18848416delGAATG	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20404109	20404109	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20404109delA	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24527539	24527540	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24527539_24527540delCA	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_5'Flank	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26019127	26019127	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26019127delC	uc001isl.1	+											Homo sapiens cDNA FLJ41446 fis, clone BRSTN2003590.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	27235266	27235266	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27235266delC								NCRNA00202 (4336 upstream) : ANKRD26 (57779 downstream)																																			---	---	---	---
MPP7	143098	broad.mit.edu	37	10	28439543	28439543	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28439543delT	uc001iua.1	-						MPP7_uc009xkz.1_Intron|MPP7_uc001iub.1_Intron|MPP7_uc009xla.2_Intron|MPP7_uc010qdv.1_Intron	NM_173496	NP_775767			palmitoylated membrane protein 7						establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29076577	29076578	+	IGR	INS	-	TAAG	TAAG	rs138792869	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29076577_29076578insTAAG								BAMBI (104709 upstream) : LYZL1 (501412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30231546	30231546	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30231546delG								SVIL (205682 upstream) : KIAA1462 (70183 downstream)																																			---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33487690	33487691	+	Intron	INS	-	G	G	rs148626522	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33487690_33487691insG	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron	NM_003873	NP_003864			neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	34330775	34330776	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34330775_34330776insA								NRP1 (706769 upstream) : PARD3 (69322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	35528738	35528738	+	IGR	DEL	T	-	-	rs72525151		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35528738delT								CREM (26853 upstream) : CCNY (7215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36119658	36119659	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36119658_36119659insT								FZD8 (189296 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36209602	36209603	+	IGR	INS	-	T	T	rs146340141	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36209602_36209603insT								FZD8 (279240 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37527025	37527025	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37527025delT								ANKRD30A (5530 upstream) : ZNF248 (563422 downstream)																																			---	---	---	---
ZNF37A	7587	broad.mit.edu	37	10	38412051	38412052	+	3'UTR	INS	-	G	G	rs140631900	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38412051_38412052insG	uc001izk.2	+	8					ZNF37A_uc001izl.2_3'UTR|ZNF37A_uc001izm.2_3'UTR	NM_001007094	NP_001007095			zinc finger protein 37a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	38564334	38564335	+	IGR	INS	-	AA	AA	rs138623941	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38564334_38564335insAA								LOC100129055 (61062 upstream) : HSD17B7P2 (80973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38776399	38776400	+	IGR	INS	-	AATGG	AATGG	rs12765770		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38776399_38776400insAATGG								LOC399744 (35319 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38888421	38888421	+	IGR	DEL	T	-	-	rs137950424	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38888421delT								LOC399744 (147341 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39104870	39104874	+	IGR	DEL	ATTCC	-	-	rs112508761		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39104870_39104874delATTCC								LOC399744 (363790 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42626332	42626334	+	IGR	DEL	ATT	-	-	rs78701857		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42626332_42626334delATT								None (None upstream) : LOC441666 (200981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42800222	42800226	+	IGR	DEL	TTGGG	-	-	rs147989481		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42800222_42800226delTTGGG								None (None upstream) : LOC441666 (27089 downstream)																																			---	---	---	---
RASGEF1A	221002	broad.mit.edu	37	10	43743088	43743089	+	Intron	INS	-	A	A	rs145441782	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43743088_43743089insA	uc001jap.1	-							NM_145313	NP_660356			RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44680545	44680546	+	IGR	DEL	GT	-	-	rs138274553		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44680545_44680546delGT								HNRNPA3P1 (394680 upstream) : CXCL12 (185061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45355663	45355664	+	Intron	DEL	GT	-	-	rs72148827		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45355663_45355664delGT	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																														---	---	---	---
GPRIN2	9721	broad.mit.edu	37	10	46992445	46992445	+	5'Flank	DEL	A	-	-	rs5784699		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46992445delA	uc001jec.2	+							NM_014696	NP_055511			G protein-regulated inducer of neurite outgrowth												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	47623558	47623559	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47623558_47623559insT								FAM35B2 (202322 upstream) : ANTXRL (34675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	51823051	51823051	+	Intron	DEL	T	-	-	rs60451660		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51823051delT	uc001jiz.1	-											Homo sapiens cDNA FLJ31813 fis, clone NT2RI2009517.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54115982	54115985	+	IGR	DEL	CACT	-	-	rs72319092		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54115982_54115985delCACT								DKK1 (38566 upstream) : MBL2 (409156 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60377088	60377088	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60377088delG	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	60594104	60594104	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60594104delG								BICC1 (5259 upstream) : PHYHIPL (342244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63651975	63651975	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63651975delA								C10orf107 (125886 upstream) : ARID5B (9468 downstream)																																			---	---	---	---
ZNF365	22891	broad.mit.edu	37	10	64323085	64323086	+	Intron	DEL	GC	-	-	rs35797046	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64323085_64323086delGC	uc001jmd.1	+						ZNF365_uc001jmc.2_Intron	NM_199452	NP_955524			zinc finger protein 365 isoform D											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)																	---	---	---	---
JMJD1C	221037	broad.mit.edu	37	10	65178837	65178837	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65178837delA	uc001jmn.2	-						JMJD1C_uc001jmr.1_Intron	NM_032776	NP_116165			jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)																	---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	67810183	67810183	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67810183delT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69724536	69724537	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69724536_69724537insT	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
MYPN	84665	broad.mit.edu	37	10	69963465	69963466	+	Intron	INS	-	AT	AT	rs138452463	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69963465_69963466insAT	uc001jnm.3	+						MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Intron|MYPN_uc009xpt.2_Intron|MYPN_uc010qit.1_Intron|MYPN_uc010qiu.1_Intron	NM_032578	NP_115967			myopalladin							nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71339042	71339043	+	IGR	INS	-	ACAC	ACAC	rs145278104	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71339042_71339043insACAC								NEUROG3 (5920 upstream) : C10orf35 (50960 downstream)																																			---	---	---	---
P4HA1	5033	broad.mit.edu	37	10	74794996	74794996	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74794996delA	uc010qka.1	-						P4HA1_uc001jtg.2_Intron|P4HA1_uc001jth.2_Intron|P4HA1_uc010qkb.1_Intron|P4HA1_uc001jti.2_Intron	NM_001142595	NP_001136067			prolyl 4-hydroxylase, alpha I subunit isoform 2							endoplasmic reticulum lumen|mitochondrion	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			ovary(1)	1	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
ADK	132	broad.mit.edu	37	10	75945948	75945949	+	Intron	INS	-	CCTTC	CCTTC	rs145702466	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75945948_75945949insCCTTC	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
MYST4	23522	broad.mit.edu	37	10	76764975	76764976	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76764975_76764976insT	uc001jwn.1	+						MYST4_uc001jwm.1_Intron|MYST4_uc001jwo.1_Intron|MYST4_uc001jwp.1_Intron	NM_012330	NP_036462			MYST histone acetyltransferase (monocytic						histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)							T	CREBBP	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	10	76829829	76829840	+	IGR	DEL	AAGGAAGGAAGG	-	-	rs71686294		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76829829_76829840delAAGGAAGGAAGG								DUPD1 (11557 upstream) : DUSP13 (24352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	77471071	77471071	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77471071delT								MIR606 (158760 upstream) : C10orf11 (71448 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78640071	78640071	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78640071delA	uc001jxj.2	-						KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron	NM_001014797	NP_001014797			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	79821508	79821508	+	IGR	DEL	G	-	-	rs35597260		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79821508delG								RPS24 (4938 upstream) : LOC283050 (881576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	82204553	82204560	+	IGR	DEL	CACACACG	-	-	rs111587784		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82204553_82204560delCACACACG								C10orf58 (7684 upstream) : TSPAN14 (9478 downstream)																																	OREG0020325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87766373	87766375	+	Intron	DEL	AAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87766373_87766375delAAA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90027499	90027499	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90027499delT	uc010qms.1	-											SubName: Full=cDNA FLJ55083, highly similar to Renalase (EC 1.4.-.-);							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90040640	90040641	+	Intron	DEL	TA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90040640_90040641delTA	uc001kfd.2	-						RNLS_uc010qms.1_Intron	NM_018363	NP_060833			renalase isoform 2							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90237018	90237019	+	Intron	INS	-	T	T	rs138964539	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90237018_90237019insT	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	91585004	91585005	+	IGR	INS	-	A	A	rs138640243	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91585004_91585005insA								KIF20B (50304 upstream) : HTR7 (915573 downstream)																																			---	---	---	---
IDE	3416	broad.mit.edu	37	10	94302979	94302979	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94302979delG	uc001kia.2	-							NM_004969	NP_004960			insulin-degrading enzyme isoform 1 precursor						beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	94838831	94838831	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94838831delT								CYP26A1 (1190 upstream) : MYOF (227356 downstream)																																			---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95133354	95133354	+	Intron	DEL	A	-	-	rs78591205		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95133354delA	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
HELLS	3070	broad.mit.edu	37	10	96352599	96352599	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96352599delA	uc001kjt.2	+						HELLS_uc001kjs.2_Intron|HELLS_uc009xul.2_Intron|HELLS_uc009xum.2_Intron|HELLS_uc009xun.2_Intron|HELLS_uc009xuo.2_Intron|HELLS_uc001kju.2_Intron|HELLS_uc009xup.2_Intron|HELLS_uc009xuq.2_Intron|HELLS_uc009xur.2_Intron	NM_018063	NP_060533			helicase, lymphoid-specific						cell division|centromeric heterochromatin formation|lymphocyte proliferation|maintenance of DNA methylation|methylation-dependent chromatin silencing|mitosis|transcription, DNA-dependent	centromeric heterochromatin|nucleus	ATP binding|DNA binding|helicase activity			ovary(1)|kidney(1)	2		Colorectal(252;0.0429)		all cancers(201;2.13e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	96994872	96994872	+	IGR	DEL	A	-	-	rs66534441		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96994872delA								C10orf129 (6187 upstream) : PDLIM1 (2460 downstream)																																			---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98602098	98602098	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98602098delC	uc009xvg.1	+						LCOR_uc001kmr.2_Intron|LCOR_uc001kms.1_Intron|LCOR_uc001kmt.1_Intron|LCOR_uc001kmu.1_Intron	NM_015652	NP_056467			hypothetical protein LOC26148											skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
CRTAC1	55118	broad.mit.edu	37	10	99772313	99772314	+	Intron	INS	-	A	A	rs146791834	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99772313_99772314insA	uc001kou.1	-						CRTAC1_uc001kov.2_5'Flank	NM_018058	NP_060528			cartilage acidic protein 1 precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	101633943	101633944	+	IGR	INS	-	T	T	rs149834824	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101633943_101633944insT								ABCC2 (22281 upstream) : DNMBP (1390 downstream)																																			---	---	---	---
FGF8	2253	broad.mit.edu	37	10	103536612	103536613	+	5'Flank	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103536612_103536613delCA	uc001ktp.1	-						FGF8_uc001ktq.1_5'Flank|FGF8_uc001ktr.1_5'Flank|FGF8_uc001kts.1_5'Flank|FGF8_uc009xwr.1_5'Flank	NM_033164	NP_149354			fibroblast growth factor 8 isoform E precursor						bone development|dopaminergic neuron differentiation|fibroblast growth factor receptor signaling pathway|gastrulation|gonad development|insulin receptor signaling pathway|mesonephros development|metanephros development|negative regulation of cardiac muscle tissue development|neuroepithelial cell differentiation|odontogenesis|positive regulation of cell division|positive regulation of cell proliferation	extracellular region|extracellular space	growth factor activity|growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)														---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104336837	104336838	+	Intron	INS	-	TT	TT	rs143333481	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104336837_104336838insTT	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron	NM_016169	NP_057253			suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104338464	104338465	+	Intron	DEL	AA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104338464_104338465delAA	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron	NM_016169	NP_057253			suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
CNNM2	54805	broad.mit.edu	37	10	104812275	104812275	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104812275delC	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron	NM_017649	NP_060119			cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107707321	107707322	+	IGR	INS	-	A	A	rs11428757		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107707321_107707322insA								SORCS3 (682328 upstream) : SORCS1 (626100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	109000513	109000514	+	IGR	INS	-	CACACA	CACACA	rs67876783		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109000513_109000514insCACACA								SORCS1 (76221 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	114958544	114958544	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114958544delT								TCF7L2 (31110 upstream) : HABP2 (354234 downstream)																																			---	---	---	---
FAM160B1	57700	broad.mit.edu	37	10	116633711	116633711	+	Intron	DEL	A	-	-	rs10715018		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116633711delA	uc001lcc.2	+							NM_001135051	NP_001128523			hypothetical protein LOC57700 isoform b											lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	117763450	117763451	+	IGR	INS	-	TGTT	TGTT	rs71010062		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117763450_117763451insTGTT								ATRNL1 (54956 upstream) : GFRA1 (52993 downstream)																																			---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123807909	123807912	+	Intron	DEL	TTCC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123807909_123807912delTTCC	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	125039903	125039903	+	IGR	DEL	T	-	-	rs71792908		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125039903delT								BUB3 (115017 upstream) : GPR26 (385968 downstream)																																			---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126823365	126823375	+	Intron	DEL	CCCCAGCCTTT	-	-	rs72065700		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126823365_126823375delCCCCAGCCTTT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
C10orf122	387718	broad.mit.edu	37	10	127372518	127372518	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127372518delT	uc001lij.2	-						C10orf122_uc001lik.3_5'Flank|uc001lil.2_Intron	NM_001128202	NP_001121674			hypothetical protein LOC387718												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	132174104	132174104	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132174104delC								GLRX3 (191320 upstream) : TCERG1L (716552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132214807	132214809	+	IGR	DEL	CCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132214807_132214809delCCT								GLRX3 (232023 upstream) : TCERG1L (675847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132803860	132803860	+	IGR	DEL	G	-	-	rs34846270		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132803860delG								GLRX3 (821076 upstream) : TCERG1L (86796 downstream)																																			---	---	---	---
PAOX	196743	broad.mit.edu	37	10	135202325	135202359	+	Intron	DEL	GTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	-	-	rs144417516	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135202325_135202359delGTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	uc001lmv.2	+						PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_Intron|PAOX_uc001lna.2_Intron|PAOX_uc001lnb.2_Intron|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875			polyamine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	135446925	135446926	+	IGR	INS	-	C	C	rs140691302	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135446925_135446926insC								FRG2B (6626 upstream) : LOC653544 (43353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	135474657	135474658	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135474657_135474658delCA								FRG2B (34358 upstream) : LOC653544 (15621 downstream)																																			---	---	---	---
PTDSS2	81490	broad.mit.edu	37	11	447981	447982	+	5'Flank	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:447981_447982insA	uc001lpj.2	+						PTDSS2_uc009ybv.1_5'Flank	NM_030783	NP_110410			phosphatidylserine synthase 2							integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)													---	---	---	---
IGF2	3481	broad.mit.edu	37	11	2158447	2158449	+	5'UTR	DEL	AGG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2158447_2158449delAGG	uc009yde.2	-	1					IGF2_uc001lvg.2_Intron|IGF2_uc009ydf.2_Intron|IGF2_uc001lvh.2_Intron|INS-IGF2_uc001lvi.2_Intron|INS-IGF2_uc001lvj.1_RNA	NM_001007139	NP_001007140			insulin-like growth factor 2 isoform 1						glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)														---	---	---	---
AMPD3	272	broad.mit.edu	37	11	10510014	10510022	+	Intron	DEL	GAGAGAGTC	-	-	rs72071959		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10510014_10510022delGAGAGAGTC	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_Intron|AMPD3_uc009yfy.2_Intron	NM_001025389	NP_001020560			adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)														---	---	---	---
ARNTL	406	broad.mit.edu	37	11	13345927	13345927	+	Intron	DEL	T	-	-	rs66551927		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13345927delT	uc001mkr.2	+						ARNTL_uc001mko.2_Intron|ARNTL_uc001mkp.2_Intron|ARNTL_uc001mkq.2_Intron|ARNTL_uc001mks.2_Intron|ARNTL_uc001mkt.2_Intron|ARNTL_uc001mku.2_Intron	NM_001178	NP_001169			aryl hydrocarbon receptor nuclear						circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)														---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19473655	19473660	+	Intron	DEL	GTGTGT	-	-	rs72309190		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19473655_19473660delGTGTGT	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	20045246	20045247	+	Intron	DEL	GT	-	-	rs112683662	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20045246_20045247delGT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	24246688	24246689	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24246688_24246689delGA								None (None upstream) : LUZP2 (271867 downstream)																																			---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26662758	26662759	+	Intron	DEL	CA	-	-	rs67228876		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26662758_26662759delCA	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606			transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	27343209	27343210	+	IGR	INS	-	T	T	rs146847912	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27343209_27343210insT								BBOX1 (193855 upstream) : CCDC34 (16851 downstream)																																			---	---	---	---
MPPED2	744	broad.mit.edu	37	11	30605889	30605896	+	Intron	DEL	ACACACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30605889_30605896delACACACAC	uc001msq.3	-						MPPED2_uc009yji.2_5'Flank	NM_001145399	NP_001138871			metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1																		---	---	---	---
ABTB2	25841	broad.mit.edu	37	11	34209046	34209047	+	Intron	INS	-	TT	TT	rs111507348		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34209046_34209047insTT	uc001mvl.1	-							NM_145804	NP_665803			ankyrin repeat and BTB (POZ) domain containing								DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	34752392	34752393	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34752392_34752393insA								EHF (69311 upstream) : APIP (144321 downstream)																																			---	---	---	---
PRR5L	79899	broad.mit.edu	37	11	36316093	36316093	+	5'Flank	DEL	T	-	-	rs67907070		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36316093delT	uc001mwo.3	+							NM_001160167	NP_001153639			protor-2 isoform a											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	39429801	39429802	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39429801_39429802insA								None (None upstream) : LRRC4C (705951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45609387	45609398	+	IGR	DEL	GAAGGAAGGAAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45609387_45609398delGAAGGAAGGAAG								SYT13 (301503 upstream) : CHST1 (61029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	47962581	47962582	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47962581_47962582delTG								NUP160 (92524 upstream) : PTPRJ (39528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48780402	48780402	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48780402delC								OR4A47 (269130 upstream) : FOLH1 (387786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48794003	48794003	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48794003delA								OR4A47 (282731 upstream) : FOLH1 (374185 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48828474	48828474	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48828474delT								OR4A47 (317202 upstream) : FOLH1 (339714 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50725578	50725578	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50725578delA								LOC646813 (345775 upstream) : OR4A5 (685870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54963886	54963886	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54963886delT								None (None upstream) : TRIM48 (65772 downstream)																																			---	---	---	---
PRG2	5553	broad.mit.edu	37	11	57170996	57170996	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57170996delG	uc001nke.2	-											Homo sapiens mRNA for FOAP-13, complete cds.						defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	59472527	59472527	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59472527delT								PATL1 (36016 upstream) : OR10V1 (7862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	60096000	60096003	+	IGR	DEL	ACAC	-	-	rs35996897		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60096000_60096003delACAC								MS4A4A (19556 upstream) : MS4A6E (6352 downstream)																																			---	---	---	---
MS4A10	341116	broad.mit.edu	37	11	60553657	60553662	+	Intron	DEL	CACACG	-	-	rs59542777		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60553657_60553662delCACACG	uc001npz.1	+							NM_206893	NP_996776			membrane-spanning 4-domains, subfamily A, member							integral to membrane	receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	64235924	64235932	+	IGR	DEL	AACAACAAC	-	-	rs111763166		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64235924_64235932delAACAACAAC								RPS6KA4 (96238 upstream) : SLC22A11 (87166 downstream)																																			---	---	---	---
TPCN2	219931	broad.mit.edu	37	11	68844705	68844737	+	Intron	DEL	CCTGCCCTCCTGCCACGTCCCTCCACCTGCCCT	-	-	rs67482528	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68844705_68844737delCCTGCCCTCCTGCCACGTCCCTCCACCTGCCCT	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_Intron	NM_139075	NP_620714			two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	69663419	69663420	+	IGR	INS	-	TC	TC			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69663419_69663420insTC								FGF3 (29227 upstream) : ANO1 (260988 downstream)																																			---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70593441	70593441	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70593441delG	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	71005062	71005063	+	IGR	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71005062_71005063delTC								SHANK2 (69254 upstream) : DHCR7 (140396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71091621	71091622	+	IGR	INS	-	GGGC	GGGC	rs72550567		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71091621_71091622insGGGC								SHANK2 (155813 upstream) : DHCR7 (53837 downstream)																																			---	---	---	---
FCHSD2	9873	broad.mit.edu	37	11	72794603	72794603	+	Intron	DEL	A	-	-	rs112192571		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72794603delA	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639			FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)															---	---	---	---
CHRDL2	25884	broad.mit.edu	37	11	74409275	74409276	+	Intron	INS	-	TT	TT	rs59506250		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74409275_74409276insTT	uc001ovi.2	-						CHRDL2_uc001ovg.2_Intron|CHRDL2_uc001ovh.2_Intron					RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;						cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	75251724	75251724	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75251724delC								GDPD5 (15125 upstream) : SERPINH1 (21446 downstream)																																			---	---	---	---
MYO7A	4647	broad.mit.edu	37	11	76892814	76892820	+	Intron	DEL	TTTTTTT	-	-	rs10522799		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892814_76892820delTTTTTTT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251			myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4																		---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78493816	78493817	+	Intron	INS	-	A	A	rs2511828	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78493816_78493817insA	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79794226	79794229	+	IGR	DEL	CCTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79794226_79794229delCCTC								ODZ4 (642531 upstream) : None (None downstream)																																			---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82539955	82539955	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82539955delA	uc001ozs.2	-						PRCP_uc001ozr.2_Intron	NM_005040	NP_005031			prolylcarboxypeptidase isoform 1 preproprotein						blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83458319	83458322	+	Intron	DEL	CTTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83458319_83458322delCTTC	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83978275	83978279	+	Intron	DEL	TAGAT	-	-	rs146563864		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83978275_83978279delTAGAT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	86672215	86672215	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86672215delT	uc001pcf.2	+											Homo sapiens cDNA clone IMAGE:5303543.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	87535871	87535872	+	IGR	DEL	AG	-	-	rs36022347		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87535871_87535872delAG								TMEM135 (501303 upstream) : RAB38 (310559 downstream)																																			---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89106467	89106467	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89106467delC	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627			NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
TRIM49	57093	broad.mit.edu	37	11	89538892	89538892	+	Intron	DEL	T	-	-	rs56089597		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89538892delT	uc001pdb.2	-							NM_020358	NP_065091			ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)																---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92551674	92551674	+	Intron	DEL	C	-	-	rs143129076		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92551674delC	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95110003	95110006	+	IGR	DEL	CCTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110003_95110006delCCTC								SESN3 (144298 upstream) : FAM76B (392100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	100339444	100339445	+	IGR	INS	-	TTT	TTT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100339444_100339445insTTT								CNTN5 (111972 upstream) : ARHGAP42 (218962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	104193299	104193300	+	IGR	INS	-	ATAC	ATAC	rs141986998		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104193299_104193300insATAC								PDGFD (158272 upstream) : CASP12 (563142 downstream)																																			---	---	---	---
CASP5	838	broad.mit.edu	37	11	104885024	104885024	+	Intron	DEL	T	-	-	rs35041238		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104885024delT	uc010rva.1	-						CASP5_uc010ruz.1_Intron|CASP5_uc010rvb.1_Intron|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338			caspase 5 isoform a precursor						apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	111297344	111297345	+	Intron	DEL	CA	-	-	rs141722511		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111297344_111297345delCA	uc001plh.1	-											Homo sapiens, clone IMAGE:4694422, mRNA.																														---	---	---	---
ZBTB16	7704	broad.mit.edu	37	11	114061453	114061454	+	Intron	DEL	AC	-	-	rs10558106	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114061453_114061454delAC	uc001pop.2	+						ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997			promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)														---	---	---	---
ZBTB16	7704	broad.mit.edu	37	11	114088754	114088754	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114088754delG	uc001pop.2	+						ZBTB16_uc001poq.2_Intron	NM_006006	NP_005997			promyelocytic leukemia zinc finger protein						apoptosis|central nervous system development|mesonephros development|myeloid cell differentiation|negative regulation of myeloid cell differentiation|negative regulation of transcription, DNA-dependent	nuclear speck|PML body|transcriptional repressor complex	protein homodimerization activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	115876608	115876609	+	IGR	INS	-	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115876608_115876609insC								CADM1 (501367 upstream) : BUD13 (742279 downstream)																																			---	---	---	---
CEP164	22897	broad.mit.edu	37	11	117190775	117190776	+	5'Flank	INS	-	AA	AA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117190775_117190776insAA	uc001prb.2	+							NM_014956	NP_055771			centrosomal protein 164kDa						cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	119381903	119381904	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119381903_119381904delAC	uc001pwp.1	+											Homo sapiens cDNA FLJ40501 fis, clone TESTI2045171.																														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120769801	120769801	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120769801delT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
TECTA	7007	broad.mit.edu	37	11	121005034	121005035	+	Intron	INS	-	CA	CA	rs140288404	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121005034_121005035insCA	uc010rzo.1	+							NM_005422	NP_005413			tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127794215	127794215	+	IGR	DEL	C	-	-	rs36123128		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127794215delC								KIRREL3 (920860 upstream) : ETS1 (534441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128525885	128525888	+	IGR	DEL	CTTT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128525885_128525888delCTTT								ETS1 (68432 upstream) : FLI1 (30542 downstream)																																			---	---	---	---
BARX2	8538	broad.mit.edu	37	11	129245003	129245003	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129245003delT	uc001qfc.3	+							NM_003658	NP_003649			BarH-like homeobox 2												0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)														---	---	---	---
NTM	50863	broad.mit.edu	37	11	131546332	131546333	+	Intron	DEL	TG	-	-	rs141262035	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131546332_131546333delTG	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131982613	131982616	+	Intron	DEL	ACAC	-	-	rs113888941		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131982613_131982616delACAC	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	134642447	134642450	+	IGR	DEL	ATAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134642447_134642450delATAC								B3GAT1 (360635 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	843283	843284	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:843283_843284delGT								NINJ2 (70528 upstream) : WNK1 (18941 downstream)																																			---	---	---	---
NTF3	4908	broad.mit.edu	37	12	5596047	5596054	+	Intron	DEL	GTGTGTGT	-	-	rs111941703		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5596047_5596054delGTGTGTGT	uc001qnk.3	+							NM_001102654	NP_001096124			neurotrophin 3 isoform 1 preproprotein						signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1																		---	---	---	---
ANO2	57101	broad.mit.edu	37	12	6032422	6032423	+	Intron	DEL	AT	-	-	rs71064176	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6032422_6032423delAT	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
MLF2	8079	broad.mit.edu	37	12	6868583	6868584	+	Intron	DEL	GC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6868583_6868584delGC	uc009zey.1	-							NM_005439	NP_005430			myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1																		---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7290353	7290354	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7290353_7290354delTG	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533			calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7962489	7962489	+	IGR	DEL	A	-	-	rs71038770		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7962489delA								NANOG (13834 upstream) : SLC2A14 (3909 downstream)																																			---	---	---	---
LOC389634	389634	broad.mit.edu	37	12	8524619	8524619	+	Intron	DEL	T	-	-	rs71451955		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8524619delT	uc001quk.3	-							NR_024420				Homo sapiens cDNA FLJ90405 fis, clone NT2RP2006099.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	10031748	10031749	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10031748_10031749insA								CLEC2B (9290 upstream) : CLEC2A (19523 downstream)																																			---	---	---	---
C12orf59	120939	broad.mit.edu	37	12	10341149	10341150	+	Intron	INS	-	GAAAAC	GAAAAC	rs138907777	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10341149_10341150insGAAAAC	uc001qxr.2	+						C12orf59_uc001qxq.2_Intron					RecName: Full=Uncharacterized protein C12orf59; Flags: Precursor;							integral to membrane				ovary(1)	1																		---	---	---	---
ETV6	2120	broad.mit.edu	37	12	11827550	11827559	+	Intron	DEL	TGTGTGTGTG	-	-	rs5796457		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11827550_11827559delTGTGTGTGTG	uc001qzz.2	+							NM_001987	NP_001978			ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)						T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								---	---	---	---
GPR19	2842	broad.mit.edu	37	12	12851551	12851552	+	5'Flank	INS	-	T	T	rs144439936	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12851551_12851552insT	uc001raq.2	-						GPR19_uc001ras.1_5'Flank	NM_006143	NP_006134			G protein-coupled receptor 19							integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	13624480	13624481	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13624480_13624481delGT								C12orf36 (94835 upstream) : GRIN2B (89929 downstream)																																			---	---	---	---
EPS8	2059	broad.mit.edu	37	12	15908740	15908740	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15908740delT	uc001rdb.2	-						EPS8_uc009zig.2_Intron	NM_004447	NP_004438			epidermal growth factor receptor pathway						cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)														---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24152103	24152112	+	Intron	DEL	TGTGTGTGTA	-	-	rs113615267		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24152103_24152112delTGTGTGTGTA	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26684587	26684588	+	Intron	INS	-	AC	AC	rs144906868	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26684587_26684588insAC	uc001rhg.2	-							NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	28926147	28926148	+	IGR	DEL	TG	-	-	rs140225148		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28926147_28926148delTG								CCDC91 (223049 upstream) : FAR2 (376084 downstream)																																			---	---	---	---
IPO8	10526	broad.mit.edu	37	12	30832921	30832921	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30832921delT	uc001rjd.2	-						IPO8_uc010sjt.1_5'Flank	NM_006390	NP_006381			importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	32537649	32537651	+	IGR	DEL	TTC	-	-	rs111399032		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32537649_32537651delTTC								BICD1 (6509 upstream) : FGD4 (101255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34236543	34236543	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34236543delC								ALG10 (55309 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34758470	34758471	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34758470_34758471delCA								ALG10 (577236 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38006085	38006086	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38006085_38006086insA								None (None upstream) : ALG10B (704471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	39547348	39547348	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39547348delC								CPNE8 (247928 upstream) : KIF21A (139683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	46097441	46097442	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46097441_46097442delTG								ANO6 (263254 upstream) : LOC400027 (22368 downstream)																																			---	---	---	---
VDR	7421	broad.mit.edu	37	12	48251854	48251855	+	Intron	INS	-	GT	GT	rs145030017	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48251854_48251855insGT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535			vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)													---	---	---	---
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535			vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	48673823	48673824	+	IGR	DEL	AG	-	-	rs10594485		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48673823_48673824delAG								OR10AD1 (76748 upstream) : H1FNT (48939 downstream)																																			---	---	---	---
C12orf41	54934	broad.mit.edu	37	12	49047487	49047488	+	3'UTR	DEL	AC	-	-	rs142093273		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49047487_49047488delAC	uc001rrx.2	-	10					C12orf41_uc001rrw.2_3'UTR|C12orf41_uc001rrz.2_3'UTR|C12orf41_uc001rry.2_RNA|C12orf41_uc001rru.2_3'UTR|C12orf41_uc001rrv.2_3'UTR	NM_017822	NP_060292			hypothetical protein LOC54934											ovary(2)	2																		---	---	---	---
FAIM2	23017	broad.mit.edu	37	12	50272306	50272307	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50272306_50272307delTG	uc001rvj.1	-						FAIM2_uc001rvi.1_Intron|FAIM2_uc001rvk.1_Intron	NM_012306	NP_036438			Fas apoptotic inhibitory molecule 2						anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
LARP4	113251	broad.mit.edu	37	12	50809911	50809911	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50809911delG	uc001rwp.1	+						LARP4_uc001rwo.1_Intron|LARP4_uc001rwq.1_Intron|LARP4_uc001rwr.1_Intron|LARP4_uc001rws.1_Intron|LARP4_uc001rwm.2_Intron|LARP4_uc001rwn.2_Intron	NM_052879	NP_443111			c-Mpl binding protein isoform a								nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	51036809	51036810	+	Intron	INS	-	TG	TG	rs143796974	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51036809_51036810insTG	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron|DIP2B_uc009zls.1_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	51342714	51342715	+	IGR	INS	-	GGA	GGA	rs144151583	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51342714_51342715insGGA								METTL7A (16415 upstream) : HIGD1C (5067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	53269380	53269393	+	IGR	DEL	ACACACACTCACAT	-	-	rs72485710	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53269380_53269393delACACACACTCACAT								KRT78 (26602 upstream) : KRT8 (21578 downstream)																																			---	---	---	---
KRT8	3856	broad.mit.edu	37	12	53322973	53322973	+	Intron	DEL	T	-	-	rs66803905		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53322973delT	uc009zml.1	-						KRT8_uc009zmk.1_5'Flank|KRT8_uc009zmm.1_Intron	NM_002273	NP_002264			keratin 8						cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PCBP2	5094	broad.mit.edu	37	12	53872656	53872656	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53872656delT	uc001sdl.3	+						PCBP2_uc001sdc.3_Intron|PCBP2_uc001sdb.3_Intron|PCBP2_uc001sde.3_Intron|PCBP2_uc001sdi.3_Intron|PCBP2_uc001sdd.3_Intron|PCBP2_uc001sdf.3_Intron|PCBP2_uc009zna.2_Intron|PCBP2_uc010soi.1_Intron|PCBP2_uc001sdj.3_Intron|PCBP2_uc010soj.1_Intron|PCBP2_uc001sdk.3_Intron	NM_001128911	NP_001122383			poly(rC) binding protein 2 isoform d						innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	54260106	54260106	+	IGR	DEL	T	-	-	rs5798282		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54260106delT								CALCOCO1 (138799 upstream) : HOXC13 (72470 downstream)																																			---	---	---	---
COPZ1	22818	broad.mit.edu	37	12	54744007	54744007	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54744007delT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141			coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0																		---	---	---	---
RAB5B	5869	broad.mit.edu	37	12	56370699	56370699	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56370699delT	uc001siv.2	+						RAB5B_uc001siw.2_Intron|RAB5B_uc009zog.2_Intron|RAB5B_uc010spz.1_Intron	NM_002868	NP_002859			RAB5B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	early endosome membrane|melanosome|membrane fraction|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity				0			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.235)															---	---	---	---
RDH16	8608	broad.mit.edu	37	12	57374107	57374107	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57374107delC	uc010sqx.1	-											Synthetic construct DNA, clone: pF1KSDA0352, Homo sapiens ZBTB39 gene for zinc finger and BTB domain-containing protein 39, complete cds, without stop codon, in Flexi system.						lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	59018153	59018153	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59018153delT	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	61263464	61263487	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCCTTCC	-	-	rs72204013	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61263464_61263487delTTCCTTCCTTCCTTCCTTCCTTCC								None (None upstream) : FAM19A2 (838556 downstream)																																			---	---	---	---
PPM1H	57460	broad.mit.edu	37	12	63062536	63062536	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63062536delT	uc001srk.3	-							NM_020700	NP_065751			protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	65189924	65189925	+	Intron	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65189924_65189925delTT	uc001ssh.1	+											RecName: Full=TBC1 domain family member 30;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	67837123	67837124	+	IGR	DEL	CT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67837123_67837124delCT								CAND1 (128735 upstream) : DYRK2 (205388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68341037	68341037	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68341037delA								DYRK2 (284594 upstream) : IFNG (207513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77054675	77054676	+	IGR	INS	-	A	A	rs34680604		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054675_77054676insA								OSBPL8 (101086 upstream) : ZDHHC17 (103178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77061286	77061286	+	IGR	DEL	T	-	-	rs11362692		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77061286delT								OSBPL8 (107697 upstream) : ZDHHC17 (96568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80765684	80765686	+	Intron	DEL	GAA	-	-	rs56017107		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80765684_80765686delGAA	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	81453064	81453064	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81453064delT								LIN7A (121370 upstream) : ACSS3 (18745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	84927700	84927700	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84927700delA								None (None upstream) : SLC6A15 (325569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	88851760	88851761	+	IGR	DEL	TG	-	-	rs56940226	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88851760_88851761delTG								TMTC3 (258097 upstream) : KITLG (34808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91409238	91409239	+	IGR	INS	-	AC	AC	rs146539055	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91409238_91409239insAC								EPYC (10435 upstream) : KERA (35034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92113679	92113682	+	IGR	DEL	GAAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92113679_92113682delGAAG								DCN (536873 upstream) : BTG1 (265184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92322889	92322889	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92322889delC								DCN (746083 upstream) : BTG1 (55977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	93328615	93328616	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93328615_93328616insA								EEA1 (5508 upstream) : NUDT4 (443085 downstream)																																			---	---	---	---
NDUFA12	55967	broad.mit.edu	37	12	95374592	95374593	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95374592_95374593insT	uc001tdl.2	-							NM_018838	NP_061326			13kDa differentiation-associated protein						respiratory electron transport chain|respiratory gaseous exchange|response to oxidative stress|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	96548057	96548058	+	IGR	DEL	TC	-	-	rs111331011		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96548057_96548058delTC								LTA4H (110759 upstream) : ELK3 (40149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98209910	98209911	+	IGR	DEL	TC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98209910_98209911delTC								RMST (251117 upstream) : LOC100128191 (696842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98614903	98614904	+	IGR	INS	-	ACAA	ACAA	rs146367999	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98614903_98614904insACAA								RMST (656110 upstream) : LOC100128191 (291849 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100155014	100155015	+	Intron	INS	-	AC	AC	rs147419547	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100155014_100155015insAC	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	103367247	103367248	+	IGR	INS	-	TTCT	TTCT	rs147902551	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103367247_103367248insTTCT								ASCL1 (12960 upstream) : C12orf42 (264122 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104934893	104934898	+	Intron	DEL	CTCTCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104934893_104934898delCTCTCT	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	105780324	105780325	+	IGR	DEL	TT	-	-	rs73181888		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105780324_105780325delTT								C12orf75 (15029 upstream) : NUAK1 (676800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106045670	106045670	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106045670delA								C12orf75 (280375 upstream) : NUAK1 (411455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	107692878	107692879	+	IGR	INS	-	TA	TA	rs11113257		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107692878_107692879insTA								CRY1 (205280 upstream) : BTBD11 (19318 downstream)																																			---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107921056	107921056	+	Intron	DEL	T	-	-	rs34506110		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107921056delT	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108636844	108636845	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108636844_108636845insT	uc001tms.2	+						WSCD2_uc001tmt.2_Intron|WSCD2_uc001tmu.2_Intron	NM_014653	NP_055468			WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108790258	108790259	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108790258_108790259insT								CMKLR1 (57164 upstream) : FICD (118792 downstream)																																			---	---	---	---
OAS3	4940	broad.mit.edu	37	12	113400826	113400826	+	Intron	DEL	C	-	-	rs67947098		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113400826delC	uc001tug.2	+							NM_006187	NP_006178			2'-5'oligoadenylate synthetase 3						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	114124112	114124113	+	IGR	DEL	CA	-	-	rs11066684	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114124112_114124113delCA								LHX5 (214235 upstream) : RBM19 (130430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	114874979	114874980	+	IGR	DEL	AC	-	-	rs71447932		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114874979_114874980delAC								TBX5 (28732 upstream) : TBX3 (233079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116175504	116175504	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116175504delA								None (None upstream) : MED13L (220879 downstream)																																			---	---	---	---
FBXW8	26259	broad.mit.edu	37	12	117430903	117430904	+	Intron	INS	-	T	T	rs147176315		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117430903_117430904insT	uc001twg.1	+						FBXW8_uc001twf.1_Intron|FBXW8_uc009zwp.1_Intron	NM_153348	NP_699179			F-box and WD repeat domain containing 8 isoform								protein binding			ovary(2)|pancreas(1)	3	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0353)														---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118021211	118021214	+	Intron	DEL	TGGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118021211_118021214delTGGA	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	118420767	118420767	+	IGR	DEL	T	-	-	rs147493415		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118420767delT								KSR2 (14739 upstream) : RFC5 (33741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	118954864	118954864	+	IGR	DEL	T	-	-	rs35001643		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118954864delT								SUDS3 (99025 upstream) : SRRM4 (464532 downstream)																																			---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119872644	119872648	+	Intron	DEL	GCTCA	-	-	rs140982902		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119872644_119872648delGCTCA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	120089916	120089916	+	IGR	DEL	G	-	-	rs67182736		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120089916delG								TMEM233 (10553 upstream) : PRKAB1 (15841 downstream)																																			---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123070619	123070623	+	Intron	DEL	TTTGT	-	-	rs139150222		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123070619_123070623delTTTGT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
C12orf65	91574	broad.mit.edu	37	12	123735342	123735343	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123735342_123735343insT	uc001uen.2	+						C12orf65_uc001ueo.2_Intron|C12orf65_uc010tan.1_Intron	NM_152269	NP_689482			hypothetical protein LOC91574							mitochondrion	translation release factor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000595)|Epithelial(86;0.00199)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	125017531	125017558	+	Intron	DEL	CTCTTTCCCCCACCTCCAAATCGCACTT	-	-	rs71092207	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125017531_125017558delCTCTTTCCCCCACCTCCAAATCGCACTT	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
AACS	65985	broad.mit.edu	37	12	125567379	125567380	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125567379_125567380delAC	uc001uhc.2	+						AACS_uc009zyg.2_Intron|AACS_uc001uhd.2_Intron|AACS_uc009zyh.2_Intron	NM_023928	NP_076417			acetoacetyl-CoA synthetase						fatty acid metabolic process	cytosol	acetoacetate-CoA ligase activity|ATP binding			ovary(1)|liver(1)|central_nervous_system(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125659376	125659376	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125659376delT								AACS (31504 upstream) : TMEM132B (151786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127865270	127865271	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127865270_127865271delCA								LOC100128554 (907940 upstream) : None (None downstream)																																			---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130169452	130169453	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130169452_130169453delTG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130302997	130302998	+	Intron	INS	-	TT	TT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130302997_130302998insTT	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
LOC100190940	100190940	broad.mit.edu	37	12	130527756	130527757	+	5'Flank	DEL	AT	-	-	rs143651813		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130527756_130527757delAT	uc010tbi.1	-							NR_024457				Homo sapiens cDNA FLJ44907 fis, clone BRAMY3007449.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	130601715	130601716	+	IGR	INS	-	T	T	rs148710552	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130601715_130601716insT								LOC100190940 (74828 upstream) : FZD10 (45316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	130702518	130702518	+	IGR	DEL	T	-	-	rs71843595		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130702518delT								FZD10 (52234 upstream) : PIWIL1 (120096 downstream)																																			---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131530578	131530579	+	Intron	INS	-	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131530578_131530579insC	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
LOC116437	116437	broad.mit.edu	37	12	131683902	131683903	+	Intron	INS	-	CTT	CTT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131683902_131683903insCTT	uc001uiw.2	+							NR_026670				Homo sapiens mRNA; cDNA DKFZp434L2430 (from clone DKFZp434L2430).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	132292414	132292414	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132292414delT								SFRS8 (8132 upstream) : MMP17 (20527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133041197	133041199	+	IGR	DEL	CAC	-	-	rs7311442		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133041197_133041199delCAC								GALNT9 (135292 upstream) : FBRSL1 (25958 downstream)																																			---	---	---	---
POLE	5426	broad.mit.edu	37	12	133258000	133258004	+	Intron	DEL	GCTCA	-	-	rs5744732		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133258000_133258004delGCTCA	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222			DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
ZMYM5	9205	broad.mit.edu	37	13	20434610	20434611	+	Intron	INS	-	TA	TA	rs146545202	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20434610_20434611insTA	uc010tcn.1	-						ZMYM5_uc001umn.2_Intron|ZMYM5_uc001umo.2_Intron	NM_001142684	NP_001136156			zinc finger protein 237 isoform 3							nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)														---	---	---	---
XPO4	64328	broad.mit.edu	37	13	21440381	21440382	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21440381_21440382delCA	uc001unq.3	-						XPO4_uc010tcr.1_Intron	NM_022459	NP_071904			exportin 4						protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	21526362	21526363	+	IGR	INS	-	A	A	rs141548911	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21526362_21526363insA								XPO4 (49449 upstream) : LATS2 (20815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22427573	22427574	+	IGR	INS	-	A	A	rs66483069		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22427573_22427574insA								FGF9 (148933 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22581268	22581269	+	IGR	DEL	GT	-	-	rs71733436		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22581268_22581269delGT								FGF9 (302628 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22696216	22696217	+	Intron	INS	-	GC	GC	rs141900109	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22696216_22696217insGC	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22778402	22778406	+	Intron	DEL	GTTCG	-	-	rs148464601		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22778402_22778406delGTTCG	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	23096095	23096095	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23096095delA								FGF9 (817455 upstream) : SGCG (658965 downstream)																																			---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26329536	26329536	+	Intron	DEL	T	-	-	rs5802347		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26329536delT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27375943	27375943	+	IGR	DEL	A	-	-	rs75120926		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27375943delA								GPR12 (41021 upstream) : USP12 (266495 downstream)																																			---	---	---	---
FLT1	2321	broad.mit.edu	37	13	29055579	29055580	+	Intron	INS	-	ACAC	ACAC	rs10633694		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29055579_29055580insACAC	uc001usb.3	-						FLT1_uc010aar.1_Intron|FLT1_uc001usc.3_Intron|FLT1_uc010tdp.1_Intron|FLT1_uc001usd.2_Intron	NM_002019	NP_002010			fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)													---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29978313	29978314	+	Intron	INS	-	AA	AA	rs33920912		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29978313_29978314insAA	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	30514970	30514971	+	Intron	INS	-	T	T	rs139415044	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30514970_30514971insT	uc010aav.2	+											Homo sapiens similar to bA90M5.1 (novel protein), mRNA (cDNA clone IMAGE:40146832).																														---	---	---	---
B3GALTL	145173	broad.mit.edu	37	13	31856786	31856787	+	Intron	INS	-	A	A	rs35082419		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31856786_31856787insA	uc010aaz.2	+						B3GALTL_uc001utn.3_Intron	NM_194318	NP_919299			beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	32000735	32000736	+	IGR	INS	-	TCA	TCA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32000735_32000736insTCA								B3GALTL (94326 upstream) : RXFP2 (312943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	32211072	32211073	+	IGR	INS	-	TCTC	TCTC			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32211072_32211073insTCTC								B3GALTL (304663 upstream) : RXFP2 (102606 downstream)																																			---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33212795	33212796	+	Intron	INS	-	AA	AA	rs138007798	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33212795_33212796insAA	uc010abf.2	+						PDS5B_uc001uun.2_Intron|PDS5B_uc001uuo.2_Intron|PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
STARD13	90627	broad.mit.edu	37	13	33682070	33682071	+	Intron	INS	-	CA	CA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33682070_33682071insCA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron	NM_178006	NP_821074			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
STARD13	90627	broad.mit.edu	37	13	34158474	34158474	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34158474delG	uc001uux.2	-							NM_052851	NP_443083			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	34959709	34959709	+	IGR	DEL	C	-	-	rs5802722		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34959709delC								RFC3 (419015 upstream) : NBEA (556747 downstream)																																			---	---	---	---
NBEA	26960	broad.mit.edu	37	13	35825495	35825495	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35825495delG	uc001uvb.2	+						NBEA_uc010abi.2_Intron	NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
LOC646982	646982	broad.mit.edu	37	13	40953881	40953882	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40953881_40953882delCA	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	44979668	44979673	+	Intron	DEL	ACACAC	-	-	rs112936647		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44979668_44979673delACACAC	uc001uzl.2	-											Homo sapiens hypothetical gene supported by BC025370, mRNA (cDNA clone IMAGE:3945331).																														---	---	---	---
TSC22D1	8848	broad.mit.edu	37	13	45072436	45072439	+	Intron	DEL	AAAC	-	-	rs147439674		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45072436_45072439delAAAC	uc001uzn.3	-						TSC22D1_uc001uzo.1_Intron	NM_183422	NP_904358			TSC22 domain family, member 1 isoform 1						transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46348865	46348865	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46348865delC								SPERT (60172 upstream) : SIAH3 (5553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48279984	48279984	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48279984delT								HTR2A (808934 upstream) : SUCLA2 (236808 downstream)																																			---	---	---	---
CAB39L	81617	broad.mit.edu	37	13	50014978	50014979	+	Intron	DEL	AC	-	-	rs147142005		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50014978_50014979delAC	uc001vcx.2	-						CAB39L_uc010adf.2_Intron	NM_001079670	NP_001073138			calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)														---	---	---	---
KPNA3	3839	broad.mit.edu	37	13	50334059	50334060	+	Intron	DEL	AC	-	-	rs34675509		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50334059_50334060delAC	uc001vdj.2	-							NM_002267	NP_002258			karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	50408638	50408638	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50408638delC								KPNA3 (41581 upstream) : LOC220429 (55907 downstream)																																			---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50825378	50825380	+	Intron	DEL	CAT	-	-	rs2066669		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50825378_50825380delCAT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52546547	52546548	+	Intron	INS	-	TCAAT	TCAAT	rs145238171	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52546547_52546548insTCAAT	uc001vfw.2	-						ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Intron|ATP7B_uc001vfy.2_Intron|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Intron|ATP7B_uc010tgv.1_Intron|ATP7B_uc010tgw.1_Intron	NM_000053	NP_000044			ATPase, Cu++ transporting, beta polypeptide						ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
Unknown	0	broad.mit.edu	37	13	55524893	55524893	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55524893delG								MIR1297 (638710 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56658268	56658269	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56658268_56658269insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57408461	57408462	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57408461_57408462delAC								None (None upstream) : PRR20C (306590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62308593	62308595	+	IGR	DEL	TCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62308593_62308595delTCT								PCDH20 (306514 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66271187	66271187	+	IGR	DEL	A	-	-	rs67856146		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66271187delA								None (None upstream) : PCDH9 (605780 downstream)																																			---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67372088	67372089	+	Intron	DEL	GG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67372088_67372089delGG	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72023253	72023253	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72023253delC	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937			dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	73168598	73168599	+	IGR	INS	-	ACACAA	ACACAA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73168598_73168599insACACAA								DACH1 (727268 upstream) : C13orf37 (113896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74993489	74993492	+	5'Flank	DEL	TCCC	-	-	rs72439247		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74993489_74993492delTCCC	uc001vjj.1	-											Homo sapiens cDNA FLJ35839 fis, clone TESTI2006659.																														---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76341710	76341711	+	Intron	INS	-	A	A	rs141918513	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76341710_76341711insA	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vju.1_Intron	NM_015842	NP_056667			LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78982717	78982717	+	Intron	DEL	A	-	-	rs36027620		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78982717delA	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80452607	80452608	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80452607_80452608delTG	uc001vlh.2	+											Homo sapiens cDNA clone IMAGE:4825993.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80851975	80851975	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80851975delG								NDFIP2 (721770 upstream) : SPRY2 (58139 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86510738	86510741	+	IGR	DEL	TTTC	-	-	rs35784067		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86510738_86510741delTTTC								SLITRK6 (137255 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88256360	88256361	+	Intron	INS	-	AC	AC	rs141443067	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88256360_88256361insAC	uc001vlm.1	-											Homo sapiens clone IMAGE:32106, mRNA sequence.																														---	---	---	---
ABCC4	10257	broad.mit.edu	37	13	95803854	95803859	+	Intron	DEL	AGGAGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95803854_95803859delAGGAGA	uc001vmd.3	-						ABCC4_uc010afk.2_Intron|ABCC4_uc001vme.2_Intron|ABCC4_uc010tih.1_Intron	NM_005845	NP_005836			ATP-binding cassette, sub-family C, member 4						platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)													---	---	---	---
CLDN10	9071	broad.mit.edu	37	13	96116994	96116994	+	Intron	DEL	T	-	-	rs35464755		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96116994delT	uc001vmg.2	+						CLDN10_uc010tii.1_Intron	NM_182848	NP_878268			claudin 10 isoform a						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)															---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99524669	99524670	+	Intron	INS	-	T	T	rs138570063	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99524669_99524670insT	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
CLYBL	171425	broad.mit.edu	37	13	100429751	100429751	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100429751delT	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	104316169	104316172	+	IGR	DEL	ATGT	-	-	rs146082804		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104316169_104316172delATGT								SLC10A2 (596973 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104599293	104599296	+	IGR	DEL	TGTG	-	-	rs71735778		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104599293_104599296delTGTG								SLC10A2 (880097 upstream) : None (None downstream)																																			---	---	---	---
TMCO3	55002	broad.mit.edu	37	13	114160870	114160873	+	Intron	DEL	GTGA	-	-	rs143362422	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114160870_114160873delGTGA	uc001vtu.3	+						TMCO3_uc001vtt.3_Intron	NM_017905	NP_060375			transmembrane and coiled-coil domains 3							integral to membrane	solute:hydrogen antiporter activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)															---	---	---	---
TMCO3	55002	broad.mit.edu	37	13	114174798	114174799	+	Intron	INS	-	A	A	rs71871519		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114174798_114174799insA	uc001vtu.3	+						TMCO3_uc001vtt.3_Intron	NM_017905	NP_060375			transmembrane and coiled-coil domains 3							integral to membrane	solute:hydrogen antiporter activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	19090397	19090398	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19090397_19090398delGT								None (None upstream) : OR11H12 (287196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19450012	19450012	+	IGR	DEL	G	-	-	rs111389162		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19450012delG								OR11H12 (71440 upstream) : POTEG (103353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19634124	19634125	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19634124_19634125insT	uc001vvi.2	+											Homo sapiens prostate-specific P775P mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	21259484	21259484	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21259484delA								RNASE6 (8860 upstream) : RNASE1 (10032 downstream)																																			---	---	---	---
MRPL52	122704	broad.mit.edu	37	14	23296826	23296826	+	5'Flank	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23296826delC	uc001wgw.3	+						MRPL52_uc001wgx.3_5'Flank|MRPL52_uc001wgy.3_5'Flank|MRPL52_uc001wgz.3_5'Flank|MRPL52_uc001wha.3_5'Flank|MRPL52_uc001whb.3_5'Flank	NM_178336	NP_848026			mitochondrial ribosomal protein L52 isoform a						translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)														---	---	---	---
DHRS2	10202	broad.mit.edu	37	14	24104920	24104920	+	5'Flank	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24104920delC	uc001wkt.3	+						DHRS2_uc010aku.1_Intron|DHRS2_uc001wku.3_5'Flank|DHRS2_uc010akv.2_5'Flank|DHRS2_uc001wkv.3_5'Flank	NM_182908	NP_878912			dehydrogenase/reductase member 2 isoform 1						C21-steroid hormone metabolic process|cellular response to oxidative stress|myeloid dendritic cell differentiation|negative regulation of apoptosis|negative regulation of cell proliferation|response to toxin	mitochondrion|nuclear envelope	binding|carbonyl reductase (NADPH) activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00659)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25537235	25537238	+	IGR	DEL	CTTT	-	-	rs10546583		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25537235_25537238delCTTT								STXBP6 (18064 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	26118122	26118123	+	IGR	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26118122_26118123delAG								STXBP6 (598951 upstream) : NOVA1 (796967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27110362	27110363	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27110362_27110363delGA								NOVA1 (43402 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28998696	28998697	+	IGR	INS	-	GGAAGGAG	GGAAGGAG	rs28575094	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28998696_28998697insGGAAGGAG								None (None upstream) : FOXG1 (237590 downstream)																																			---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32283769	32283769	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32283769delT	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428			nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33804237	33804238	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33804237_33804238delTG	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	35423431	35423432	+	IGR	INS	-	A	A	rs34928297		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35423431_35423432insA								C14orf19 (13729 upstream) : SRP54 (28672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	38347405	38347406	+	Intron	INS	-	T	T	rs150414330	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38347405_38347406insT	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																														---	---	---	---
CTAGE5	4253	broad.mit.edu	37	14	39784041	39784042	+	Intron	DEL	TA	-	-	rs2415540	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39784041_39784042delTA	uc001wvg.3	+						CTAGE5_uc010tqe.1_Intron|CTAGE5_uc001wuz.3_Intron|CTAGE5_uc001wuy.3_Intron|CTAGE5_uc001wvb.3_Intron|CTAGE5_uc001wvc.3_Intron|CTAGE5_uc001wva.3_Intron|CTAGE5_uc001wvh.3_Intron|CTAGE5_uc001wvf.3_Intron|CTAGE5_uc001wvi.3_Intron|CTAGE5_uc010amz.2_Intron|CTAGE5_uc001wvj.3_Intron	NM_005930	NP_005921			CTAGE family, member 5 isoform 1								enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)														---	---	---	---
LRFN5	145581	broad.mit.edu	37	14	42149369	42149369	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42149369delA	uc001wvm.2	+							NM_152447	NP_689660			leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)											HNSCC(30;0.082)			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43040581	43040583	+	IGR	DEL	TTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43040581_43040583delTTC								LRFN5 (666831 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	46088424	46088424	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46088424delC								C14orf106 (365819 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	50502696	50502696	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50502696delT								C14orf182 (28458 upstream) : C14orf183 (47674 downstream)																																			---	---	---	---
TRIM9	114088	broad.mit.edu	37	14	51518761	51518765	+	Intron	DEL	AGAAG	-	-	rs79269014		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51518761_51518765delAGAAG	uc001wyx.3	-						TRIM9_uc001wyy.2_Intron|TRIM9_uc001wyz.3_Intron	NM_015163	NP_055978			tripartite motif protein 9 isoform 1						proteasomal ubiquitin-dependent protein catabolic process	cell junction|cytoskeleton|dendrite|synaptic vesicle	protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			skin(2)|lung(1)	3	all_epithelial(31;0.00418)|Breast(41;0.148)																	---	---	---	---
FRMD6	122786	broad.mit.edu	37	14	52111071	52111072	+	Intron	INS	-	CA	CA	rs71443185		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52111071_52111072insCA	uc001wzb.2	+							NM_001042481	NP_001035946			FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)																	---	---	---	---
TXNDC16	57544	broad.mit.edu	37	14	52943147	52943147	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52943147delA	uc001wzs.2	-						TXNDC16_uc010tqu.1_Intron|TXNDC16_uc010aoe.2_Intron	NM_020784	NP_065835			thioredoxin domain containing 16 isoform 1						cell redox homeostasis	extracellular region					0	Breast(41;0.0716)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	53885429	53885429	+	IGR	DEL	A	-	-	rs34351273		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53885429delA								DDHD1 (265383 upstream) : BMP4 (531028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54204302	54204305	+	IGR	DEL	GAAA	-	-	rs71829926		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54204302_54204305delGAAA								DDHD1 (584256 upstream) : BMP4 (212152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	55982494	55982499	+	IGR	DEL	TTGTTG	-	-	rs72365587		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55982494_55982499delTTGTTG								TBPL2 (75231 upstream) : C14orf33 (42191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56929099	56929100	+	IGR	DEL	AA	-	-	rs112514433		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56929099_56929100delAA								PELI2 (161069 upstream) : C14orf101 (117238 downstream)																																			---	---	---	---
EXOC5	10640	broad.mit.edu	37	14	57676594	57676594	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57676594delA	uc001xct.2	-						EXOC5_uc001xcs.2_Intron|EXOC5_uc010trg.1_Intron|EXOC5_uc010trh.1_Intron	NM_006544	NP_006535			SEC10 protein						exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3																		---	---	---	---
PRKCH	5583	broad.mit.edu	37	14	61736445	61736445	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61736445delA	uc010tsa.1	+							NM_006255	NP_006246			protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)												OREG0022719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	14	62662609	62662609	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62662609delG								FLJ43390 (65377 upstream) : KCNH5 (511338 downstream)																																			---	---	---	---
MTHFD1	4522	broad.mit.edu	37	14	64878620	64878621	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64878620_64878621insA	uc001xhb.2	+						MTHFD1_uc010aqe.2_Intron|MTHFD1_uc010aqf.2_Intron	NM_005956	NP_005947			methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)													---	---	---	---
ZBTB25	7597	broad.mit.edu	37	14	64930755	64930755	+	Intron	DEL	T	-	-	rs35093390		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64930755delT	uc001xhc.2	-						AKAP5_uc001xhd.3_5'Flank					Homo sapiens cDNA FLJ40862 fis, clone TRACH2018262, highly similar to Zinc finger and BTB domain-containing protein 25.							cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)														---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67597920	67597920	+	Intron	DEL	T	-	-	rs79436783		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67597920delT	uc001xiy.2	+						GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	71965166	71965166	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71965166delA	uc001xmr.1	+											Homo sapiens high-risk human papilloma viruses E6 oncoproteins targeted protein E6TP1 alpha mRNA, complete cds.						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72854261	72854261	+	Intron	DEL	A	-	-	rs71847575		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72854261delA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
VASH1	22846	broad.mit.edu	37	14	77236955	77236956	+	Intron	INS	-	CTCTGGGCC	CTCTGGGCC	rs143033818	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77236955_77236956insCTCTGGGCC	uc001xst.2	+						VASH1_uc001xss.2_Intron	NM_014909	NP_055724			vasohibin 1						cell cycle arrest|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of endothelial cell proliferation	endoplasmic reticulum|extracellular space					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)														---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	80957249	80957251	+	Intron	DEL	TTG	-	-	rs72037903		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80957249_80957251delTTG	uc010asz.1	-							NM_152446				hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82673173	82673178	+	IGR	DEL	TGTGTG	-	-	rs141485946		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82673173_82673178delTGTGTG								SEL1L (672968 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82925974	82925975	+	IGR	DEL	AC	-	-	rs36213589		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82925974_82925975delAC								SEL1L (925769 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85442425	85442426	+	IGR	DEL	AC	-	-	rs111435814		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85442425_85442426delAC								None (None upstream) : FLRT2 (554062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	88514546	88514547	+	Intron	INS	-	G	G	rs140926583	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88514546_88514547insG	uc001xvw.2	+											Homo sapiens cDNA clone IMAGE:4734409.																														---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89880310	89880312	+	Intron	DEL	GGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89880310_89880312delGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89910695	89910696	+	Intron	INS	-	AT	AT	rs137953591	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89910695_89910696insAT	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
TTC7B	145567	broad.mit.edu	37	14	91110622	91110625	+	Intron	DEL	CACG	-	-	rs147942996	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110622_91110625delCACG	uc001xyp.2	-						TTC7B_uc001xyo.2_5'Flank|TTC7B_uc010ats.2_Intron|uc001xyq.2_Intron	NM_001010854	NP_001010854			tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)																---	---	---	---
CCDC88C	440193	broad.mit.edu	37	14	91862153	91862153	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91862153delC	uc010aty.2	-						CCDC88C_uc010twk.1_Intron|CCDC88C_uc001xzl.3_Intron	NM_001080414	NP_001073883			DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)																---	---	---	---
ATXN3	4287	broad.mit.edu	37	14	92537088	92537089	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537088_92537089insT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984			ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94140621	94140622	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94140621_94140622insA	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97602568	97602569	+	IGR	INS	-	CAC	CAC	rs138158061	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97602568_97602569insCAC								VRK1 (254618 upstream) : C14orf64 (789378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99429704	99429706	+	IGR	DEL	GAG	-	-	rs2933338	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99429704_99429706delGAG								C14orf177 (245607 upstream) : BCL11B (205921 downstream)																																			---	---	---	---
EML1	2009	broad.mit.edu	37	14	100339193	100339194	+	Intron	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100339193_100339194insG	uc001ygs.2	+						EML1_uc010avt.1_Intron|EML1_uc010tww.1_Intron|EML1_uc001ygq.2_Intron|EML1_uc001ygr.2_Intron	NM_004434	NP_004425			echinoderm microtubule associated protein like 1							cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
ZNF839	55778	broad.mit.edu	37	14	102782905	102782906	+	5'Flank	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102782905_102782906delGT	uc001ylo.2	+							NM_018335	NP_060805			zinc finger protein 839							intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CINP	51550	broad.mit.edu	37	14	102821856	102821856	+	Intron	DEL	A	-	-	rs113572507		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102821856delA	uc001ylv.1	-						CINP_uc001ylu.1_Intron	NM_032630	NP_116019			cyclin-dependent kinase 2-interacting protein						cell cycle|cell division|DNA repair|DNA replication	nucleus	protein binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	103615613	103615613	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103615613delC								TNFAIP2 (11837 upstream) : EIF5 (184880 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	104681833	104681833	+	IGR	DEL	A	-	-	rs66509017		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104681833delA								KIF26A (34599 upstream) : C14orf180 (364223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	104754957	104754958	+	IGR	INS	-	TG	TG			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104754957_104754958insTG								KIF26A (107723 upstream) : C14orf180 (291098 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106097365	106097385	+	Intron	DEL	CAGGAAGTGTCCAGCGTGGAC	-	-	rs71960640	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106097365_106097385delCAGGAAGTGTCCAGCGTGGAC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yry.1_5'Flank					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106524047	106524048	+	Intron	INS	-	TT	TT	rs150927656	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106524047_106524048insTT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106785241	106785241	+	Intron	DEL	A	-	-	rs10715730		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106785241delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20001139	20001140	+	IGR	INS	-	G	G	rs149747898		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20001139_20001140insG								None (None upstream) : GOLGA6L6 (735954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20854731	20854732	+	IGR	DEL	AT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20854731_20854732delAT								GOLGA8C (73705 upstream) : BCL8 (15324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	21909859	21909859	+	IGR	DEL	A	-	-	rs112621802		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21909859delA								NF1P1 (775234 upstream) : LOC646214 (22655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24684137	24684137	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24684137delT								PWRN2 (269042 upstream) : PWRN1 (94702 downstream)																																			---	---	---	---
FAM7A3	89837	broad.mit.edu	37	15	32698266	32698267	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32698266_32698267delCA	uc001zgb.2	-											Homo sapiens family with sequence similarity 7, member A3, mRNA (cDNA clone IMAGE:4579054).												0																		---	---	---	---
FMN1	342184	broad.mit.edu	37	15	33293911	33293913	+	Intron	DEL	CCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33293911_33293913delCCT	uc001zhf.3	-							NM_001103184	NP_001096654			formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)														---	---	---	---
AQR	9716	broad.mit.edu	37	15	35172768	35172768	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35172768delA	uc001ziv.2	-							NM_014691	NP_055506			aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	36604802	36604803	+	IGR	DEL	AA	-	-	rs10567832		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36604802_36604803delAA								ATPBD4 (766398 upstream) : C15orf41 (267009 downstream)																																			---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45434984	45434987	+	Intron	DEL	AGGG	-	-	rs67057268		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45434984_45434987delAGGG	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130			dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)														---	---	---	---
DUOX1	53905	broad.mit.edu	37	15	45445725	45445746	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTGTA	-	-	rs72014295		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45445725_45445746delTGTGTGTGTGTGTGTGTGTGTA	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130			dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45540439	45540440	+	IGR	INS	-	TT	TT	rs112157672		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45540439_45540440insTT								SHF (47066 upstream) : SLC28A2 (3988 downstream)																																			---	---	---	---
GATM	2628	broad.mit.edu	37	15	45668604	45668615	+	Intron	DEL	CTTCAGGAAGCT	-	-	rs138059319		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45668604_45668615delCTTCAGGAAGCT	uc001zvc.2	-						GATM_uc001zvb.2_Intron|GATM_uc010uev.1_Intron	NM_001482	NP_001473			L-arginine:glycine amidinotransferase precursor						creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	46140401	46140401	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46140401delA								SQRDL (156923 upstream) : None (None downstream)																																			---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47709641	47709642	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47709641_47709642delAG	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	49272050	49272050	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49272050delT								SHC4 (16409 upstream) : SECISBP2L (8917 downstream)																																			---	---	---	---
ATP8B4	79895	broad.mit.edu	37	15	50266594	50266595	+	Intron	INS	-	T	T	rs35144345		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50266594_50266595insT	uc001zxu.2	-						ATP8B4_uc010ber.2_Intron|ATP8B4_uc010ufd.1_Intron|ATP8B4_uc010ufe.1_Intron	NM_024837	NP_079113			ATPase class I type 8B member 4						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)														---	---	---	---
LYSMD2	256586	broad.mit.edu	37	15	52020593	52020594	+	Intron	INS	-	AC	AC	rs113776739		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52020593_52020594insAC	uc002abi.2	-						LYSMD2_uc002abj.2_Intron	NM_153374	NP_699205			LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process						0				all cancers(107;0.00258)														---	---	---	---
ARPP19	10776	broad.mit.edu	37	15	52853977	52853978	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52853977_52853978insA	uc002acd.1	-						ARPP19_uc002ace.1_Intron	NM_006628	NP_006619			cyclic AMP phosphoprotein, 19 kD						cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of gluconeogenesis|positive regulation of glucose import	cytoplasm	potassium channel regulator activity|protein phosphatase 2A binding|protein phosphatase inhibitor activity|protein phosphatase type 2A regulator activity|receptor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	55835270	55835271	+	5'Flank	DEL	GG	-	-	rs111690532		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55835270_55835271delGG	uc002ade.1	-											Homo sapiens cDNA FLJ30808 fis, clone FEBRA2001383.																														---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58499944	58499945	+	Intron	INS	-	ATTT	ATTT	rs144427233	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58499944_58499945insATTT	uc010ugw.1	-							NM_170697	NP_733798			aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	60628243	60628244	+	IGR	DEL	CC	-	-	rs59981923		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60628243_60628244delCC								FOXB1 (299835 upstream) : ANXA2 (11107 downstream)																																			---	---	---	---
CSNK1G1	53944	broad.mit.edu	37	15	64580770	64580771	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64580770_64580771delTG	uc002anf.2	-						CSNK1G1_uc002ane.2_Intron|CSNK1G1_uc002ang.1_Intron|CSNK1G1_uc002anh.1_Intron|CSNK1G1_uc002anj.2_Intron|CSNK1G1_uc010uip.1_Intron	NM_022048	NP_071331			casein kinase 1, gamma 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0																		---	---	---	---
RBPMS2	348093	broad.mit.edu	37	15	65048716	65048716	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65048716delA	uc002anq.2	-							NM_194272	NP_919248			RNA binding protein with multiple splicing 2								nucleic acid binding|nucleotide binding				0																		---	---	---	---
SNAPC5	10302	broad.mit.edu	37	15	66785993	66785997	+	Intron	DEL	AAACA	-	-	rs68188866		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66785993_66785997delAAACA	uc002apu.1	-						SNAPC5_uc002apt.1_5'Flank	NM_006049	NP_006040			small nuclear RNA activating complex,						transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase III promoter	nucleoplasm	sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	67260228	67260228	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67260228delT								SMAD6 (185893 upstream) : SMAD3 (97967 downstream)																																			---	---	---	---
MAP2K5	5607	broad.mit.edu	37	15	67956671	67956672	+	Intron	INS	-	AA	AA	rs11395465		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67956671_67956672insAA	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143			mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2																		---	---	---	---
PIAS1	8554	broad.mit.edu	37	15	68409397	68409397	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68409397delT	uc002aqz.2	+						PIAS1_uc010ujx.1_Intron	NM_016166	NP_057250			protein inhibitor of activated STAT, 1						androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	70398554	70398554	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70398554delA								TLE3 (8298 upstream) : UACA (548341 downstream)																																			---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71268136	71268136	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71268136delA	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161			leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73252841	73252842	+	IGR	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73252841_73252842delTT								ADPGK (176174 upstream) : NEO1 (92033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73949169	73949169	+	IGR	DEL	T	-	-	rs76879259		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73949169delT								NPTN (23416 upstream) : CD276 (27453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	74101843	74101844	+	IGR	DEL	CA	-	-	rs34779562		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74101843_74101844delCA								C15orf59 (58027 upstream) : TBC1D21 (64124 downstream)																																			---	---	---	---
LOXL1	4016	broad.mit.edu	37	15	74225924	74225924	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74225924delA	uc002awc.1	+							NM_005576	NP_005567			lysyl oxidase-like 1 preproprotein						protein deamination	extracellular space	copper ion binding				0																		---	---	---	---
EDC3	80153	broad.mit.edu	37	15	74944930	74944931	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74944930_74944931insT	uc002ayn.2	-						EDC3_uc002ayo.2_Intron|EDC3_uc002aym.2_Intron	NM_001142443	NP_001135915			enhancer of mRNA decapping 3						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75357853	75357854	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75357853_75357854insA								PPCDC (14787 upstream) : C15orf39 (133379 downstream)																																			---	---	---	---
UBE2Q2	92912	broad.mit.edu	37	15	76175947	76175948	+	Intron	INS	-	T	T	rs79241469		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76175947_76175948insT	uc002bbg.2	+						UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Intron|UBE2Q2_uc002bbi.2_Intron	NM_173469	NP_775740			ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2																		---	---	---	---
TBC1D2B	23102	broad.mit.edu	37	15	78316386	78316386	+	Intron	DEL	T	-	-	rs1992470	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78316386delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173			TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
CHRNA5	1138	broad.mit.edu	37	15	78872986	78872986	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78872986delT	uc002bdy.2	+						CHRNA5_uc002bdz.2_Intron	NM_000745	NP_000736			cholinergic receptor, nicotinic, alpha 5						behavioral response to nicotine	cell junction|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	78980804	78980805	+	IGR	INS	-	A	A	rs113326222		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78980804_78980805insA								CHRNB4 (27930 upstream) : ADAMTS7 (70741 downstream)																																			---	---	---	---
MORF4L1	10933	broad.mit.edu	37	15	79170935	79170936	+	Intron	INS	-	A	A	rs149346921	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79170935_79170936insA	uc002bel.2	+						MORF4L1_uc010bli.1_Intron|MORF4L1_uc010blj.1_Intron|MORF4L1_uc002bem.2_Intron|MORF4L1_uc010une.1_Intron	NM_206839	NP_996670			MORF-related gene 15 isoform 2						double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79268902	79268903	+	Intron	DEL	AC	-	-	rs111923447		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79268902_79268903delAC	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	79456010	79456013	+	IGR	DEL	TTCT	-	-	rs10592830		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79456010_79456013delTTCT								RASGRF1 (72795 upstream) : MIR184 (46117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	81692634	81692634	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81692634delT								TMC3 (26216 upstream) : MEX3B (641494 downstream)																																			---	---	---	---
CPEB1	64506	broad.mit.edu	37	15	83306720	83306720	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83306720delA	uc002biv.2	-						CPEB1_uc010uof.1_Intron	NM_030594	NP_085097			cytoplasmic polyadenylation element binding						mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)															---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84557156	84557156	+	Intron	DEL	T	-	-	rs72211075		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84557156delT	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	88186948	88186948	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88186948delG								NCRNA00052 (64031 upstream) : NTRK3 (233040 downstream)																																			---	---	---	---
NTRK3	4916	broad.mit.edu	37	15	88553980	88553981	+	Intron	DEL	CA	-	-	rs62019237		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88553980_88553981delCA	uc002bme.1	-						NTRK3_uc002bmh.2_Intron|NTRK3_uc002bmf.1_Intron|NTRK3_uc010upl.1_Intron|NTRK3_uc010bnh.1_Intron|NTRK3_uc002bmg.2_Intron|NTRK3_uc010bni.2_Intron	NM_001012338	NP_001012338			neurotrophic tyrosine kinase, receptor, type 3						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity		ETV6/NTRK3(234)	soft_tissue(85)|kidney(66)|breast(56)|salivary_gland(26)|lung(22)|large_intestine(6)|ovary(6)|stomach(5)|central_nervous_system(3)|pancreas(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	281			BRCA - Breast invasive adenocarcinoma(143;0.211)					T	ETV6	congenital fibrosarcoma|Secretory breast 					TSP Lung(13;0.10)			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90649548	90649555	+	IGR	DEL	GTGCAGTG	-	-	rs111302754		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90649548_90649555delGTGCAGTG								IDH2 (3840 upstream) : SEMA4B (78597 downstream)																																			---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92535347	92535348	+	Intron	INS	-	A	A	rs148219493	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92535347_92535348insA	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93094312	93094313	+	IGR	INS	-	A	A	rs142875465	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93094312_93094313insA								C15orf32 (49965 upstream) : LOC100144604 (16735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97266015	97266016	+	IGR	DEL	CA	-	-	rs111544511		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97266015_97266016delCA								NR2F2 (382525 upstream) : SPATA8 (60663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	101629605	101629608	+	IGR	DEL	TGTA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101629605_101629608delTGTA								LRRK1 (19290 upstream) : CHSY1 (86324 downstream)																																	OREG0023523	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PCSK6	5046	broad.mit.edu	37	15	101930559	101930560	+	Intron	INS	-	C	C	rs148739434	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101930559_101930560insC	uc002bwy.2	-						PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Intron|PCSK6_uc002bxg.1_Intron	NM_002570	NP_002561			paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
FBXL16	146330	broad.mit.edu	37	16	749270	749270	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:749270delC	uc002cjc.2	-							NM_153350	NP_699181			F-box and leucine-rich repeat protein 16												0		Hepatocellular(780;0.0218)																---	---	---	---
LMF1	64788	broad.mit.edu	37	16	1003875	1003876	+	Intron	INS	-	CACC	CACC	rs71771835		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1003875_1003876insCACC	uc002ckj.2	-						LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron|LMF1_uc010uuu.1_Intron|LMF1_uc010uuv.1_Intron	NM_022773	NP_073610			lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)																---	---	---	---
LOC146336	146336	broad.mit.edu	37	16	1117756	1117757	+	Intron	INS	-	GGTTGTGGTTTTGTGGT	GGTTGTGGTTTTGTGGT	rs145130165	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1117756_1117757insGGTTGTGGTTTTGTGGT	uc002cko.2	-							NR_027242				SubName: Full=cDNA FLJ32252 fis, clone PROST1000167, weakly similar to SYNAPSIN I;												0																		---	---	---	---
UBE2I	7329	broad.mit.edu	37	16	1356344	1356367	+	5'Flank	DEL	ACCTGCTCCATGACCCTCACCCCT	-	-	rs61151448	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1356344_1356367delACCTGCTCCATGACCCTCACCCCT	uc002clc.1	+						uc010uuy.1_RNA|UBE2I_uc002cld.1_5'Flank	NM_194261	NP_919237			ubiquitin-conjugating enzyme E2I						cell division|chromosome segregation|interspecies interaction between organisms|mitosis|negative regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|protein sumoylation	cytoplasm|PML body|synaptonemal complex	ATP binding|enzyme binding|ubiquitin-protein ligase activity			breast(1)|skin(1)	2		Hepatocellular(780;0.00369)																---	---	---	---
BAIAP3	8938	broad.mit.edu	37	16	1385463	1385464	+	Intron	INS	-	G	G	rs147345623	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1385463_1385464insG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvb.1_Intron|BAIAP3_uc010uvc.1_5'Flank	NM_003933	NP_003924			BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	2268604	2268605	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2268604_2268605insG								PGP (3782 upstream) : E4F1 (4962 downstream)																																			---	---	---	---
ABCA17P	650655	broad.mit.edu	37	16	2459676	2459676	+	Intron	DEL	A	-	-	rs35883813		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2459676delA	uc002cqc.1	+							NR_003574				Homo sapiens cDNA FLJ37881 fis, clone BRSTN2000367.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	3010024	3010035	+	IGR	DEL	ACCTACCTACCT	-	-	rs111260640		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3010024_3010035delACCTACCTACCT								FLYWCH1 (8816 upstream) : KREMEN2 (4182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	5846762	5846762	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5846762delA								FAM86A (698973 upstream) : A2BP1 (222370 downstream)																																			---	---	---	---
ABAT	18	broad.mit.edu	37	16	8776082	8776085	+	Intron	DEL	ACAG	-	-	rs56046317	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8776082_8776085delACAG	uc002czc.3	+							NM_020686	NP_065737			4-aminobutyrate aminotransferase precursor						behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	9237282	9237283	+	IGR	DEL	AC	-	-	rs34142582		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9237282_9237283delAC								C16orf72 (23737 upstream) : GRIN2A (609984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9371039	9371040	+	IGR	INS	-	TTCTTC	TTCTTC	rs141012946	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9371039_9371040insTTCTTC								C16orf72 (157494 upstream) : GRIN2A (476227 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10613644	10613644	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10613644delC								ATF7IP2 (36150 upstream) : EMP2 (8636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10932915	10932915	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10932915delA								FAM18A (20294 upstream) : CIITA (38140 downstream)																																			---	---	---	---
C16orf75	116028	broad.mit.edu	37	16	11415865	11415874	+	Intron	DEL	CATACACATA	-	-	rs36210150		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11415865_11415874delCATACACATA	uc002daq.1	+											Homo sapiens cDNA FLJ41770 fis, clone IMR322007225.						DNA replication	nucleus	DNA binding				0								T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
CPPED1	55313	broad.mit.edu	37	16	12803763	12803771	+	Intron	DEL	GGGAAGGAA	-	-	rs113544358		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12803763_12803771delGGGAAGGAA	uc002dca.3	-						CPPED1_uc002dcb.3_Intron	NM_018340	NP_060810			calcineurin-like phosphoesterase domain								hydrolase activity|metal ion binding				0																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	13000894	13000900	+	Intron	DEL	TCCCCCT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13000894_13000900delTCCCCCT	uc010uyy.1	+						SHISA9_uc002dcd.2_Intron	NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	13337098	13337098	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13337098delA								SHISA9 (2826 upstream) : ERCC4 (676916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	13561181	13561181	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13561181delC								SHISA9 (226909 upstream) : ERCC4 (452833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	16616330	16616331	+	IGR	DEL	CT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16616330_16616331delCT								LOC339047 (171893 upstream) : XYLT1 (579852 downstream)																																			---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22163200	22163200	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22163200delA	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc002dkg.3_Intron|VWA3A_uc010bxe.1_Intron	NM_173615	NP_775886			von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22633377	22633378	+	IGR	INS	-	C	C	rs145197391	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22633377_22633378insC								LOC653786 (45191 upstream) : HS3ST2 (192482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22657968	22657995	+	IGR	DEL	GGAATAAGTTTTTTAAAAAAACTTTGTT	-	-	rs67533589		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22657968_22657995delGGAATAAGTTTTTTAAAAAAACTTTGTT								LOC653786 (69782 upstream) : HS3ST2 (167865 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23193015	23193016	+	5'Flank	INS	-	AAGA	AAGA	rs148796753	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23193015_23193016insAAGA	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24754892	24754892	+	Intron	DEL	T	-	-	rs71383711		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24754892delT	uc002dmm.2	+							NM_014494	NP_055309			trinucleotide repeat containing 6A						negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	25292489	25292490	+	IGR	INS	-	T	T	rs72771387		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25292489_25292490insT								ZKSCAN2 (23634 upstream) : HS3ST4 (410857 downstream)																																			---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25884798	25884801	+	Intron	DEL	TCTC	-	-	rs66595275	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25884798_25884801delTCTC	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	27088704	27088705	+	IGR	INS	-	CTTT	CTTT	rs143025532	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088704_27088705insCTTT								C16orf82 (8218 upstream) : JMJD5 (126102 downstream)																																			---	---	---	---
GSG1L	146395	broad.mit.edu	37	16	27820900	27820900	+	Intron	DEL	A	-	-	rs71387802		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27820900delA	uc002doz.2	-						GSG1L_uc010bya.1_Intron|GSG1L_uc010bxz.1_Intron|GSG1L_uc002doy.2_Intron	NM_001109763	NP_001103233			GSG1-like isoform 1							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	28242474	28242474	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28242474delT								XPO6 (19284 upstream) : SBK1 (61366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	29249718	29249729	+	Intron	DEL	GAAGGAAGGAGG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29249718_29249729delGAAGGAAGGAGG	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
SULT1A3	6818	broad.mit.edu	37	16	29472616	29472616	+	Intron	DEL	A	-	-	rs149925755		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29472616delA	uc002dsu.2	+						LOC440354_uc002dsp.3_Intron|SULT1A3_uc002dsw.2_Intron|SULT1A3_uc002dsz.2_Intron|SULT1A3_uc002dta.2_Intron|SULT1A3_uc010vdp.1_Intron|SULT1A3_uc002dtb.2_Intron|SULT1A3_uc010byw.2_5'Flank	NM_177552	NP_808220			sulfotransferase family, cytosolic, 1A,						3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32431977	32431978	+	IGR	INS	-	T	T	rs141924012		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32431977_32431978insT								HERC2P4 (268103 upstream) : TP53TG3B (252863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32847247	32847247	+	IGR	DEL	T	-	-	rs112612876		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32847247delT								TP53TG3B (158369 upstream) : SLC6A10P (41550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33952873	33952874	+	IGR	INS	-	A	A	rs150976456		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33952873_33952874insA								None (None upstream) : MIR1826 (12634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	35208625	35208626	+	IGR	INS	-	T	T	rs140049172		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35208625_35208626insT								LOC146481 (493658 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46673955	46673956	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46673955_46673956delAC								SHCBP1 (18644 upstream) : VPS35 (19635 downstream)																																			---	---	---	---
ABCC11	85320	broad.mit.edu	37	16	48265572	48265572	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48265572delA	uc002eff.1	-						ABCC11_uc002efg.1_Intron|ABCC11_uc002efh.1_Intron|ABCC11_uc010vgl.1_Intron	NM_033151	NP_149163			ATP-binding cassette, sub-family C, member 11							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)												Cerumen_Type				---	---	---	---
Unknown	0	broad.mit.edu	37	16	48569809	48569810	+	IGR	INS	-	T	T	rs145505496	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48569809_48569810insT								SIAH1 (87500 upstream) : N4BP1 (2829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49017480	49017481	+	IGR	INS	-	GAA	GAA	rs144012511	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49017480_49017481insGAA								N4BP1 (373360 upstream) : CBLN1 (294730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51812755	51812755	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51812755delT								SALL1 (627572 upstream) : TOX3 (659163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59292444	59292445	+	IGR	INS	-	GTCT	GTCT	rs139688187	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59292444_59292445insGTCT								GOT2 (524198 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	61432368	61432369	+	IGR	DEL	TG	-	-	rs112229745		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61432368_61432369delTG								None (None upstream) : CDH8 (254866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64480278	64480278	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64480278delC								None (None upstream) : CDH11 (500407 downstream)																																			---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65101886	65101901	+	Intron	DEL	GAAGGGAGGGAGGGAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65101886_65101901delGAAGGGAGGGAGGGAA	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Intron	NM_001797	NP_001788			cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68713597	68713598	+	Intron	INS	-	AA	AA	rs71382055		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68713597_68713598insAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	68996995	68996995	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68996995delA	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
SNTB2	6645	broad.mit.edu	37	16	69242875	69242876	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69242875_69242876delGT	uc002ewu.2	+							NM_006750	NP_006741			basic beta 2 syntrophin							cell junction|dystrophin-associated glycoprotein complex|membrane fraction|microtubule|transport vesicle membrane	actin binding|calmodulin binding|protein binding				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)														---	---	---	---
CLEC18C	283971	broad.mit.edu	37	16	70117129	70117129	+	Intron	DEL	G	-	-	rs138671570		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70117129delG	uc002exy.2	+							NM_182619	NP_872425			secretory protein LOC348174 precursor							extracellular region	sugar binding				0																		---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70696093	70696096	+	3'UTR	DEL	ATCA	-	-	rs113355803		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70696093_70696096delATCA	uc002ezj.2	-	15						NM_138383	NP_612392			metastasis suppressor 1-like						filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
AP1G1	164	broad.mit.edu	37	16	71841765	71841765	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71841765delA	uc010cgg.2	-						AP1G1_uc002fba.2_Intron|AP1G1_uc002fbb.2_5'UTR|AP1G1_uc010vmg.1_Intron|AP1G1_uc010vmh.1_Intron	NM_001128	NP_001119			adaptor-related protein complex 1, gamma 1						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)																---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72920557	72920557	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72920557delA	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74607697	74607697	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74607697delT	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76429634	76429634	+	Intron	DEL	T	-	-	rs66722954		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76429634delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
WWOX	51741	broad.mit.edu	37	16	78402958	78402959	+	Intron	INS	-	TT	TT	rs147242499	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78402958_78402959insTT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
WWOX	51741	broad.mit.edu	37	16	79024083	79024084	+	Intron	INS	-	A	A	rs76178382		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79024083_79024084insA	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
WWOX	51741	broad.mit.edu	37	16	79235241	79235241	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79235241delT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	82654430	82654430	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82654430delT								MPHOSPH6 (450601 upstream) : CDH13 (6148 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83190896	83190897	+	Intron	INS	-	CT	CT	rs147452309	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83190896_83190897insCT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83357633	83357634	+	Intron	INS	-	TTC	TTC	rs145755687	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83357633_83357634insTTC	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83734294	83734295	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83734294_83734295insA	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	83847635	83847636	+	IGR	INS	-	A	A	rs147074780	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83847635_83847636insA								HSBP1 (1041 upstream) : MLYCD (85094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85467194	85467195	+	IGR	INS	-	TGGA	TGGA	rs145969358	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85467194_85467195insTGGA								FAM92B (321080 upstream) : KIAA0182 (177834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85857220	85857222	+	IGR	DEL	CAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85857220_85857222delCAT								COX4I1 (16615 upstream) : IRF8 (75552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87051075	87051075	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87051075delT								FOXL1 (435772 upstream) : FBXO31 (311869 downstream)																																	OREG0024021	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	16	87053021	87053022	+	IGR	INS	-	AAAC	AAAC	rs143644580	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87053021_87053022insAAAC								FOXL1 (437718 upstream) : FBXO31 (309922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87221668	87221669	+	Intron	DEL	AT	-	-	rs139905070		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87221668_87221669delAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
BANP	54971	broad.mit.edu	37	16	88002105	88002105	+	5'Flank	DEL	T	-	-	rs34080356		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88002105delT	uc002fkr.2	+						BANP_uc002fkp.2_Intron|BANP_uc002fkq.2_Intron|BANP_uc010vow.1_Intron|BANP_uc002fks.3_Intron|BANP_uc002fko.1_Intron|BANP_uc010vov.1_Intron	NM_079837	NP_524576			BTG3 associated nuclear protein isoform b						cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0				BRCA - Breast invasive adenocarcinoma(80;0.00551)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88330125	88330126	+	IGR	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88330125_88330126delCA								BANP (219202 upstream) : ZNF469 (163753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88367469	88367470	+	IGR	INS	-	GTGTGTGTGTGT	GTGTGTGTGTGT	rs150603603	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88367469_88367470insGTGTGTGTGTGT								BANP (256546 upstream) : ZNF469 (126409 downstream)																																			---	---	---	---
CTU2	348180	broad.mit.edu	37	16	88776858	88776860	+	Intron	DEL	AGG	-	-	rs138825073		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88776858_88776860delAGG	uc002flm.2	+						CTU2_uc002fln.2_Intron|CTU2_uc010chz.2_Intron|CTU2_uc010cia.2_Intron	NM_001012759	NP_001012777			cytoplasmic tRNA 2-thiolation protein 2 isoform						tRNA thio-modification|tRNA wobble uridine modification	cytoplasm|protein complex|soluble fraction	protein binding			skin(1)	1																		---	---	---	---
ZNF778	197320	broad.mit.edu	37	16	89289318	89289319	+	Intron	DEL	AG	-	-	rs10560226		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89289318_89289319delAG	uc002fmv.2	+						ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Intron|ZNF778_uc010vpg.1_Intron	NM_182531	NP_872337			zinc finger protein 778						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0269)														---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89372037	89372061	+	Intron	DEL	CACACACGCGCTACCTCTCACTCCG	-	-	rs72243219	by1000genomes;by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89372037_89372061delCACACACGCGCTACCTCTCACTCCG	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|ANKRD11_uc002fnf.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89701013	89701013	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89701013delT	uc010cin.2	+						DPEP1_uc002fnr.3_Intron|DPEP1_uc002fns.3_Intron	NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
VPS53	55275	broad.mit.edu	37	17	612928	612929	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:612928_612929insA	uc002frn.2	-						VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759			vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)														---	---	---	---
ABR	29	broad.mit.edu	37	17	1055710	1055710	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1055710delA	uc002fsd.2	-						ABR_uc002fse.2_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
RPA1	6117	broad.mit.edu	37	17	1758657	1758658	+	Intron	INS	-	TT	TT	rs9303216		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1758657_1758658insTT	uc002fto.2	+							NM_002945	NP_002936			replication protein A1						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0													NER					---	---	---	---
Unknown	0	broad.mit.edu	37	17	5731307	5731307	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5731307delA	uc002gcm.2	+											Homo sapiens hypothetical protein LOC339166, mRNA (cDNA clone IMAGE:5163423), partial cds.																														---	---	---	---
WSCD1	23302	broad.mit.edu	37	17	5973119	5973122	+	Intron	DEL	GTGC	-	-	rs66521205		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5973119_5973122delGTGC	uc010cli.2	+						WSCD1_uc002gcn.2_5'Flank|WSCD1_uc002gco.2_5'Flank	NM_015253	NP_056068			WSC domain containing 1							integral to membrane	sulfotransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	6249414	6249425	+	IGR	DEL	ACACACACACAC	-	-	rs67658825		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6249414_6249425delACACACACACAC								WSCD1 (221669 upstream) : AIPL1 (77635 downstream)																																			---	---	---	---
ASGR2	433	broad.mit.edu	37	17	7016625	7016626	+	Intron	DEL	AT	-	-	rs113103097	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7016625_7016626delAT	uc002gep.3	-						ASGR2_uc002gem.1_Intron|ASGR2_uc002gen.1_Intron|ASGR2_uc002geo.1_Intron|ASGR2_uc002ger.3_Intron|ASGR2_uc002geq.3_Intron|ASGR2_uc010clw.2_Intron|ASGR2_uc010vtl.1_Intron	NM_001181	NP_001172			asialoglycoprotein receptor 2 isoform a						cell surface receptor linked signaling pathway|endocytosis	focal adhesion|integral to membrane|nucleolus	asialoglycoprotein receptor activity|protein binding|sugar binding			ovary(1)	1					Antihemophilic Factor(DB00025)													---	---	---	---
ASGR1	432	broad.mit.edu	37	17	7078322	7078323	+	Intron	DEL	AA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7078322_7078323delAA	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662			asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
ASGR1	432	broad.mit.edu	37	17	7079448	7079449	+	Intron	DEL	CA	-	-	rs115558063	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7079448_7079449delCA	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662			asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
DLG4	1742	broad.mit.edu	37	17	7111052	7111053	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7111052_7111053delCA	uc002get.3	-						DLG4_uc010vtn.1_5'Flank|DLG4_uc010cly.2_Intron|DLG4_uc010vto.1_Intron|DLG4_uc002geu.2_Intron	NM_001365	NP_001356			post-synaptic density protein 95 isoform 1						axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2																		---	---	---	---
NLGN2	57555	broad.mit.edu	37	17	7315332	7315332	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7315332delT	uc002ggt.1	+							NM_020795	NP_065846			neuroligin 2 precursor						cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	neurexin binding|receptor activity			central_nervous_system(1)	1		Prostate(122;0.157)																---	---	---	---
POLR2A	5430	broad.mit.edu	37	17	7398184	7398184	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7398184delT	uc002ghf.3	+						POLR2A_uc002ghe.2_Intron	NM_000937	NP_000928			DNA-directed RNA polymerase II A						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	7856169	7856169	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7856169delA								CNTROB (3274 upstream) : GUCY2D (49819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	7882525	7882525	+	IGR	DEL	T	-	-	rs111728561		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7882525delT								CNTROB (29630 upstream) : GUCY2D (23463 downstream)																																			---	---	---	---
NTN1	9423	broad.mit.edu	37	17	9131021	9131022	+	Intron	INS	-	CA	CA	rs145490097		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9131021_9131022insCA	uc002glw.3	+							NM_004822	NP_004813			netrin 1 precursor						apoptosis|axon guidance		protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	9153451	9153452	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9153451_9153452insT								NTN1 (6135 upstream) : STX8 (337 downstream)																																			---	---	---	---
WDR16	146845	broad.mit.edu	37	17	9485580	9485580	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9485580delC	uc002gly.2	+						WDR16_uc002glz.2_Intron|WDR16_uc010coc.2_Intron	NM_145054	NP_659491			WD40-repeat protein upregulated in HCC isoform							cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11597927	11597930	+	Intron	DEL	CTTT	-	-	rs12946303		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597927_11597930delCTTT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11689402	11689403	+	Intron	INS	-	A	A	rs143607285	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11689402_11689403insA	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	12060022	12060023	+	IGR	INS	-	A	A	rs35656923		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12060022_12060023insA								MAP2K4 (12972 upstream) : MYOCD (509184 downstream)																																			---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16103810	16103816	+	Intron	DEL	AAAAAAA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16103810_16103816delAAAAAAA	uc002gpo.2	-						NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
TNFRSF13B	23495	broad.mit.edu	37	17	16857088	16857089	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16857088_16857089insT	uc002gqs.1	-						TNFRSF13B_uc010vwt.1_Intron|TNFRSF13B_uc002gqt.1_Intron|TNFRSF13B_uc010vwu.1_Intron	NM_012452	NP_036584			tumor necrosis factor receptor 13B						cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding|receptor activity			kidney(2)	2														IgA_Deficiency_Selective				---	---	---	---
Unknown	0	broad.mit.edu	37	17	19628335	19628335	+	IGR	DEL	T	-	-	rs11298387		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19628335delT								SLC47A2 (6043 upstream) : ALDH3A1 (12965 downstream)																																			---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21210484	21210485	+	Intron	INS	-	A	A	rs143826793		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21210484_21210485insA	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21218864	21218865	+	IGR	INS	-	G	G	rs148092055	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21218864_21218865insG								MAP2K3 (315 upstream) : KCNJ12 (60834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21336168	21336169	+	IGR	INS	-	T	T	rs139490573	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21336168_21336169insT								KCNJ12 (12989 upstream) : C17orf51 (95403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21507129	21507129	+	IGR	DEL	A	-	-	rs113637029		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21507129delA								C17orf51 (29398 upstream) : FAM27L (318241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21520240	21520241	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21520240_21520241insA								C17orf51 (42509 upstream) : FAM27L (305129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21524274	21524275	+	IGR	DEL	TT	-	-	rs149328063		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21524274_21524275delTT								C17orf51 (46543 upstream) : FAM27L (301095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25272421	25272422	+	IGR	INS	-	A	A	rs142946657		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25272421_25272422insA								None (None upstream) : WSB1 (348684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25333174	25333175	+	IGR	INS	-	TCC	TCC	rs66926562		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25333174_25333175insTCC								None (None upstream) : WSB1 (287931 downstream)																																			---	---	---	---
TAOK1	57551	broad.mit.edu	37	17	27841848	27841848	+	Intron	DEL	A	-	-	rs111521061		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27841848delA	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron|TAOK1_uc002heb.1_3'UTR	NM_020791	NP_065842			TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	29103591	29103592	+	IGR	INS	-	T	T	rs55974169		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29103591_29103592insT								SUZ12P (6524 upstream) : CRLF3 (6111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	29362730	29362731	+	IGR	INS	-	GTT	GTT	rs78727447	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29362730_29362731insGTT								RNF135 (35805 upstream) : NF1 (59264 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	30149199	30149200	+	IGR	INS	-	A	A	rs142217931	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30149199_30149200insA								MIR365-2 (246659 upstream) : C17orf79 (29685 downstream)																																			---	---	---	---
RHBDL3	162494	broad.mit.edu	37	17	30640130	30640131	+	Intron	INS	-	T	T	rs140048094	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30640130_30640131insT	uc002hhe.1	+						RHBDL3_uc010csw.1_Intron|RHBDL3_uc010csx.1_Intron|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	NM_138328	NP_612201			rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	30711568	30711571	+	IGR	DEL	TGTC	-	-	rs146694354		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30711568_30711571delTGTC								ZNF207 (3593 upstream) : PSMD11 (59931 downstream)																																			---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32221347	32221354	+	Intron	DEL	TGCGTGCG	-	-	rs67852666		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32221347_32221354delTGCGTGCG	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32244983	32244984	+	Intron	DEL	CA	-	-	rs71834998		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32244983_32244984delCA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	32752881	32752881	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32752881delT								CCL1 (62629 upstream) : C17orf102 (148261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	34405470	34405471	+	IGR	INS	-	GT	GT	rs28574786	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34405470_34405471insGT								CCL18 (6630 upstream) : CCL3 (10134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	34409522	34409522	+	IGR	DEL	T	-	-	rs5820141		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34409522delT								CCL18 (10682 upstream) : CCL3 (6083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	35098577	35098578	+	IGR	DEL	GA	-	-	rs67820933		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35098577_35098578delGA								MRM1 (133171 upstream) : LHX1 (195921 downstream)																																			---	---	---	---
AATF	26574	broad.mit.edu	37	17	35306850	35306851	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35306850_35306851insT	uc002hni.2	+						AATF_uc002hnj.2_Intron	NM_012138	NP_036270			apoptosis antagonizing transcription factor						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity				0		Breast(25;0.00607)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	36300681	36300683	+	IGR	DEL	AGA	-	-	rs10631909		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36300681_36300683delAGA								TBC1D3 (5583 upstream) : MRPL45 (152315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	36379064	36379065	+	Intron	INS	-	T	T	rs139253235		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36379064_36379065insT	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																														---	---	---	---
CISD3	284106	broad.mit.edu	37	17	36889466	36889467	+	Intron	INS	-	CCTGC	CCTGC	rs139586171	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36889466_36889467insCCTGC	uc010wds.1	+							NM_001136498	NP_001129970			CDGSH iron sulfur domain 3 precursor							mitochondrion	2 iron, 2 sulfur cluster binding|metal ion binding				0																		---	---	---	---
IKZF3	22806	broad.mit.edu	37	17	37955249	37955250	+	Intron	INS	-	GT	GT	rs139521072	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37955249_37955250insGT	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613			aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	38943214	38943214	+	IGR	DEL	A	-	-	rs35249446		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38943214delA								KRT27 (4428 upstream) : KRT28 (5234 downstream)																																			---	---	---	---
WNT9B	7484	broad.mit.edu	37	17	44932457	44932458	+	Intron	INS	-	A	A	rs76478307		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44932457_44932458insA	uc002ikw.1	+						WNT9B_uc002ikx.1_Intron	NM_003396	NP_003387			wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	45867779	45867779	+	IGR	DEL	C	-	-	rs5820668		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45867779delC								TBX21 (44294 upstream) : OSBPL7 (16954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47059507	47059508	+	IGR	INS	-	TTCC	TTCC			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47059507_47059508insTTCC								GIP (13552 upstream) : IGF2BP1 (15266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	48102173	48102184	+	IGR	DEL	ATGCATGCATGG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48102173_48102184delATGCATGCATGG								DLX3 (29585 upstream) : ITGA3 (31156 downstream)																																			---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48602072	48602073	+	Intron	INS	-	GT	GT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48602072_48602073insGT	uc010wmr.1	+						MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509			Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	52924353	52924368	+	IGR	DEL	TGTGTGTGTGTGTGTG	-	-	rs71361725		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52924353_52924368delTGTGTGTGTGTGTGTG								None (None upstream) : TOM1L1 (53684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	54612339	54612339	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54612339delA								ANKFN1 (52332 upstream) : NOG (58721 downstream)																																			---	---	---	---
MSI2	124540	broad.mit.edu	37	17	55753347	55753347	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55753347delG	uc002iuz.1	+						MSI2_uc010wnm.1_Intron	NM_138962	NP_620412			musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)				T	HOXA9	CML								---	---	---	---
TBX4	9496	broad.mit.edu	37	17	59561014	59561015	+	3'UTR	DEL	TA	-	-	rs77924694		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59561014_59561015delTA	uc002izi.2	+	8					TBX4_uc010ddo.2_3'UTR|TBX4_uc010woy.1_3'UTR	NM_018488	NP_060958			T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	62470669	62470669	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62470669delT								C17orf60 (5910 upstream) : POLG2 (3235 downstream)																																			---	---	---	---
GNA13	10672	broad.mit.edu	37	17	63046536	63046537	+	Intron	DEL	TA	-	-	rs145152837		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63046536_63046537delTA	uc002jfc.2	-						GNA13_uc010wqh.1_Intron	NM_006572	NP_006563			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0																		---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	64117810	64117811	+	Intron	INS	-	T	T	rs111659267		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64117810_64117811insT	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65648966	65648967	+	Intron	INS	-	C	C	rs144053769	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65648966_65648967insC	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
LOC651250	651250	broad.mit.edu	37	17	66139054	66139055	+	Intron	INS	-	CCTTCCTT	CCTTCCTT	rs139365001	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66139054_66139055insCCTTCCTT	uc002jgo.1	+											full-length cDNA clone CS0DD005YM11 of Neuroblastoma Cot 50-normalized of Homo sapiens (human).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	66237483	66237483	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66237483delT								LOC440461 (41047 upstream) : AMZ2 (6662 downstream)																																			---	---	---	---
ABCA5	23461	broad.mit.edu	37	17	67281849	67281850	+	Intron	INS	-	A	A	rs34065708		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67281849_67281850insA	uc002jif.2	-						ABCA5_uc002jic.2_Intron|ABCA5_uc002jid.2_Intron|ABCA5_uc002jie.2_Intron|ABCA5_uc002jig.2_Intron|ABCA5_uc002jih.2_Intron|ABCA5_uc010dfe.2_Intron	NM_018672	NP_061142			ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)																	---	---	---	---
MAP2K6	5608	broad.mit.edu	37	17	67500303	67500304	+	Intron	INS	-	TTC	TTC	rs150054940	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67500303_67500304insTTC	uc002jij.2	+						MAP2K6_uc002jii.2_Intron|MAP2K6_uc002jik.2_5'Flank	NM_002758	NP_002749			mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	68536461	68536462	+	IGR	DEL	GT	-	-	rs72201003		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68536461_68536462delGT								KCNJ2 (360280 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68974494	68974497	+	IGR	DEL	AGGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68974494_68974497delAGGA								KCNJ2 (798313 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69227363	69227364	+	IGR	INS	-	AAC	AAC	rs143535504	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69227363_69227364insAAC								None (None upstream) : SOX9 (889797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70547145	70547145	+	Intron	DEL	T	-	-	rs34475935		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70547145delT	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
CPSF4L	642843	broad.mit.edu	37	17	71255743	71255744	+	Intron	INS	-	ACT	ACT	rs144594533	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71255743_71255744insACT	uc010dfk.1	-							NM_001129885	NP_001123357			cleavage and polyadenylation specific factor								RNA binding|zinc ion binding				0																		---	---	---	---
RAB37	326624	broad.mit.edu	37	17	72728956	72728956	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72728956delT	uc010dfu.2	+						RAB37_uc002jlc.2_Intron|RAB37_uc002jld.2_Intron	NM_175738	NP_783865			RAB37, member RAS oncogene family isoform 3						protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1																		---	---	---	---
GRIN2C	2905	broad.mit.edu	37	17	72843840	72843841	+	Intron	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72843840_72843841delTG	uc002jlt.1	-						GRIN2C_uc010wrh.1_Intron|GRIN2C_uc002jlu.1_Intron	NM_000835	NP_000826			N-methyl-D-aspartate receptor subunit 2C						glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	73409477	73409480	+	IGR	DEL	TCTC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73409477_73409480delTCTC								GRB2 (7687 upstream) : KIAA0195 (43184 downstream)																																			---	---	---	---
JMJD6	23210	broad.mit.edu	37	17	74721488	74721489	+	Intron	INS	-	AA	AA	rs36106744		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74721488_74721489insAA	uc002jso.2	-						JMJD6_uc002jsn.1_Intron|JMJD6_uc010dgz.2_Intron|C17orf95_uc002jsp.2_5'Flank|C17orf95_uc002jsq.2_5'Flank|C17orf95_uc002jsr.2_5'Flank|C17orf95_uc002jss.2_5'Flank|C17orf95_uc002jst.2_5'Flank|C17orf95_uc002jsu.2_5'Flank	NM_015167	NP_055982			jumonji domain containing 6 isoform 2						mRNA processing|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine|regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|sprouting angiogenesis|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-R2 specific)|histone demethylase activity (H4-R3 specific)|identical protein binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-lysine 5-dioxygenase activity|single-stranded RNA binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	75885053	75885056	+	IGR	DEL	AAGA	-	-	rs139547351		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75885053_75885056delAAGA								FLJ45079 (4884 upstream) : TNRC6C (115262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	76624503	76624503	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76624503delG								DNAH17 (155647 upstream) : CYTH1 (45628 downstream)																																			---	---	---	---
EIF4A3	9775	broad.mit.edu	37	17	78112333	78112334	+	Intron	INS	-	AC	AC	rs3071328		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78112333_78112334insAC	uc010wuc.1	-						EIF4A3_uc002jxs.2_Intron	NM_014740	NP_055555			eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)															---	---	---	---
EIF4A3	9775	broad.mit.edu	37	17	78120046	78120047	+	Intron	INS	-	T	T	rs141573878	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78120046_78120047insT	uc010wuc.1	-						EIF4A3_uc002jxs.2_Intron	NM_014740	NP_055555			eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78568837	78568838	+	Intron	DEL	GA	-	-	rs34187919		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78568837_78568838delGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80916801	80916804	+	Intron	DEL	GTGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80916801_80916804delGTGT	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron|B3GNTL1_uc002kge.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80984749	80984749	+	Intron	DEL	A	-	-	rs11346067		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80984749delA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	6252723	6252723	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6252723delA	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron	NM_173464	NP_775735			l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)																---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6891316	6891316	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6891316delT	uc010wzi.1	+						ARHGAP28_uc002knc.2_Intron|ARHGAP28_uc002knd.2_Intron|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Intron					SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	7256308	7256311	+	IGR	DEL	CTGA	-	-	rs66689279		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7256308_7256311delCTGA								LRRC30 (24267 upstream) : PTPRM (311003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	11176632	11176632	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11176632delC								FAM38B (474653 upstream) : GNAL (512504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14213076	14213076	+	IGR	DEL	C	-	-	rs75328904		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14213076delC								ZNF519 (80647 upstream) : LOC284233 (124346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14276303	14276303	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14276303delG								ZNF519 (143874 upstream) : LOC284233 (61119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15391943	15391944	+	IGR	INS	-	A	A	rs142303446		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15391943_15391944insA								LOC644669 (66025 upstream) : None (None downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21612408	21612408	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21612408delA	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
DTNA	1837	broad.mit.edu	37	18	32260146	32260147	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32260146_32260147delAC	uc010dmj.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_Intron	NM_032975	NP_116757			dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0																		---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34300733	34300744	+	Intron	DEL	TCCTCCTCCTCT	-	-	rs61397451		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34300733_34300744delTCCTCCTCCTCT	uc002kzt.1	+						FHOD3_uc002kzs.1_Intron|FHOD3_uc010dmz.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	35525387	35525387	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35525387delG								CELF4 (379387 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38564128	38564130	+	IGR	DEL	CTT	-	-	rs148720964		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38564128_38564130delCTT								None (None upstream) : KC6 (496108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	40884645	40884645	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40884645delG								SYT4 (27030 upstream) : None (None downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42354342	42354343	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42354342_42354343delGT	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	42884962	42884962	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42884962delA	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	47224735	47224736	+	IGR	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47224735_47224736delAC								LIPG (105459 upstream) : ACAA2 (85139 downstream)																																			---	---	---	---
MYO5B	4645	broad.mit.edu	37	18	47501149	47501150	+	Intron	INS	-	CA	CA	rs146410387	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47501149_47501150insCA	uc002leb.2	-						MYO5B_uc002lec.1_Intron	NM_001080467	NP_001073936			myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	58355144	58355146	+	IGR	DEL	AAG	-	-	rs72204105		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58355144_58355146delAAG								MC4R (315143 upstream) : CDH20 (645842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	74373041	74373042	+	IGR	DEL	TG	-	-	rs35642296		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74373041_74373042delTG								LOC284276 (101258 upstream) : ZNF236 (163074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76396308	76396309	+	IGR	DEL	GA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76396308_76396309delGA								None (None upstream) : SALL3 (343966 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76776475	76776476	+	IGR	INS	-	T	T	rs143149433	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76776475_76776476insT								SALL3 (18284 upstream) : ATP9B (52921 downstream)																																			---	---	---	---
PARD6G	84552	broad.mit.edu	37	18	78008072	78008073	+	5'Flank	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:78008072_78008073insA	uc002lny.2	-						PARD6G_uc010xfp.1_5'Flank	NM_032510	NP_115899			PAR-6 gamma protein						cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)														---	---	---	---
GZMM	3004	broad.mit.edu	37	19	544961	544963	+	Intron	DEL	ACC	-	-	rs59558746		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:544961_544963delACC	uc002low.1	+							NM_005317	NP_005308			granzyme M precursor						apoptosis|cytolysis|innate immune response|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
BSG	682	broad.mit.edu	37	19	580992	581005	+	Intron	DEL	CCCGGACCCAGCCC	-	-	rs12977361		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:580992_581005delCCCGGACCCAGCCC	uc002loz.2	+						BSG_uc002loy.2_Intron|BSG_uc002lpa.2_Intron|BSG_uc002lpb.2_Intron|BSG_uc010drr.2_Intron|BSG_uc002lpc.2_Intron|BSG_uc002lpd.2_5'Flank	NM_001728	NP_001719			basigin isoform 1 precursor						blood coagulation|cell surface receptor linked signaling pathway|leukocyte migration|pyruvate metabolic process	Golgi membrane|integral to membrane|melanosome	lactate transmembrane transporter activity|mannose binding|protein binding				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
POLRMT	5442	broad.mit.edu	37	19	630503	630503	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:630503delC	uc002lpf.1	-							NM_005035	NP_005026			mitochondrial DNA-directed RNA polymerase						transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
SBNO2	22904	broad.mit.edu	37	19	1142207	1142208	+	Intron	INS	-	TCC	TCC	rs111656231		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1142207_1142208insTCC	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778			strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ADAMTSL5	339366	broad.mit.edu	37	19	1507809	1507810	+	Intron	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1507809_1507810insG	uc002ltd.2	-						ADAMTSL5_uc010dsl.2_Intron|ADAMTSL5_uc010xgq.1_Intron	NM_213604	NP_998769			ADAMTS-like 5 precursor							proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	1929811	1929811	+	IGR	DEL	A	-	-	rs76066129		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1929811delA								SCAMP4 (3800 upstream) : CSNK1G2 (11350 downstream)																																	OREG0025133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	2363786	2363787	+	IGR	DEL	GA	-	-	rs7256144		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2363786_2363787delGA								SPPL2B (8687 upstream) : TMPRSS9 (25997 downstream)																																			---	---	---	---
PIAS4	51588	broad.mit.edu	37	19	4035907	4035908	+	Intron	DEL	GT	-	-	rs143190193	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4035907_4035908delGT	uc002lzg.2	+							NM_015897	NP_056981			protein inhibitor of activated STAT, 4						positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
EMR4P	326342	broad.mit.edu	37	19	6973316	6973317	+	Intron	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6973316_6973317delTT	uc010xjk.1	-						EMR4P_uc010dve.1_Intron	NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0																		---	---	---	---
FCER2	2208	broad.mit.edu	37	19	7762654	7762655	+	Intron	DEL	TA	-	-	rs151220343		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7762654_7762655delTA	uc002mhn.2	-						FCER2_uc010xjs.1_Intron|FCER2_uc010xjt.1_Intron|FCER2_uc002mhm.2_Intron|FCER2_uc010dvo.2_Intron	NM_002002	NP_001993			Fc fragment of IgE, low affinity II, receptor						positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8230720	8230721	+	IGR	INS	-	AGAAAGG	AGAAAGG			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8230720_8230721insAGAAAGG								FBN3 (18339 upstream) : LASS4 (43496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	8248571	8248573	+	IGR	DEL	AGG	-	-	rs77509436		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8248571_8248573delAGG								FBN3 (36190 upstream) : LASS4 (25644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	9383063	9383063	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9383063delT								OR7E24 (20324 upstream) : ZNF699 (22923 downstream)																																			---	---	---	---
SMARCA4	6597	broad.mit.edu	37	19	11166171	11166172	+	Intron	INS	-	T	T	rs59614858	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11166171_11166172insT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc002mqh.3_Intron	NM_003072	NP_003063			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity			lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)						F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	19	11805943	11805944	+	IGR	INS	-	G	G	rs145071682	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11805943_11805944insG								ZNF833 (8561 upstream) : ZNF823 (26136 downstream)																																			---	---	---	---
ZNF791	163049	broad.mit.edu	37	19	12732279	12732280	+	Intron	INS	-	T	T	rs141563565		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12732279_12732280insT	uc002mua.2	+						ZNF791_uc010xml.1_Intron|ZNF791_uc010dyu.1_Intron|ZNF791_uc010xmm.1_Intron	NM_153358	NP_699189			zinc finger protein 791						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13378604	13378604	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13378604delT	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	13684957	13684960	+	IGR	DEL	ACAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13684957_13684960delACAC								CACNA1A (67683 upstream) : CCDC130 (157614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13729942	13729942	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13729942delG								CACNA1A (112668 upstream) : CCDC130 (112632 downstream)																																			---	---	---	---
LPHN1	22859	broad.mit.edu	37	19	14305890	14305890	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14305890delT	uc010xnn.1	-						LPHN1_uc010xno.1_Intron|uc002myj.1_5'Flank	NM_001008701	NP_001008701			latrophilin 1 isoform 1 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5																		---	---	---	---
PKN1	5585	broad.mit.edu	37	19	14566519	14566520	+	Intron	INS	-	A	A	rs36021085		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14566519_14566520insA	uc002myp.2	+						PKN1_uc002myq.2_Intron	NM_002741	NP_002732			protein kinase N1 isoform 2						activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15107371	15107373	+	Intron	DEL	TTG	-	-	rs71168537		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15107371_15107373delTTG	uc010xod.1	-											SubName: Full=cDNA FLJ53385, highly similar to Excitatory amino acid transporter 4;						synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
LOC126536	126536	broad.mit.edu	37	19	16126825	16126825	+	Intron	DEL	G	-	-	rs34048114		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16126825delG	uc002nbw.2	+						LOC126536_uc002nbz.1_5'Flank	NR_026828				Homo sapiens cDNA FLJ46374 fis, clone TESTI4052217.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	16169146	16169146	+	IGR	DEL	A	-	-	rs10414272		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16169146delA								FLJ25328 (16231 upstream) : TPM4 (9171 downstream)																																			---	---	---	---
EPS15L1	58513	broad.mit.edu	37	19	16486278	16486279	+	Intron	DEL	TG	-	-	rs144847796		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16486278_16486279delTG	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron	NM_021235	NP_067058			epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5																		---	---	---	---
MED26	9441	broad.mit.edu	37	19	16736367	16736367	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16736367delC	uc002nen.1	-						MED26_uc002nee.2_Intron	NM_004831	NP_004822			mediator complex subunit 26						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|RNA polymerase II transcription cofactor activity|transcription coactivator activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	17153980	17153980	+	IGR	DEL	A	-	-	rs11313415		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17153980delA								CPAMD8 (16355 upstream) : HAUS8 (6593 downstream)																																			---	---	---	---
SLC27A1	376497	broad.mit.edu	37	19	17600306	17600307	+	Intron	INS	-	TG	TG	rs75838074		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17600306_17600307insTG	uc002ngu.1	+						SLC27A1_uc002ngt.1_Intron|SLC27A1_uc010xpp.1_Intron	NM_198580	NP_940982			solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	17702814	17702815	+	IGR	INS	-	T	T	rs112033742		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17702814_17702815insT								GLT25D1 (8849 upstream) : UNC13A (9323 downstream)																																			---	---	---	---
LSM4	25804	broad.mit.edu	37	19	18423239	18423239	+	Intron	DEL	G	-	-	rs34213757		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18423239delG	uc002niq.2	-							NM_012321	NP_036453			U6 snRNA-associated Sm-like protein 4						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|mRNA processing|RNA splicing	cytosol|U6 snRNP	protein binding|RNA binding				0																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19332700	19332703	+	Intron	DEL	AAAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19332700_19332703delAAAT	uc002nlz.2	+							NM_004386	NP_004377			chondroitin sulfate proteoglycan 3 precursor						axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
SF4	57794	broad.mit.edu	37	19	19419679	19419679	+	Intron	DEL	T	-	-	rs34260128		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19419679delT	uc002nmh.2	-						SF4_uc002nmi.2_Intron|SF4_uc002nmj.2_Intron|SF4_uc010xqr.1_Intron|SF4_uc010xqs.1_Intron	NM_172231	NP_757386			splicing factor 4						nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	19469907	19469908	+	IGR	INS	-	T	T	rs77398494		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19469907_19469908insT								KIAA0892 (345 upstream) : GATAD2A (26734 downstream)																																			---	---	---	---
CILP2	148113	broad.mit.edu	37	19	19650372	19650373	+	Intron	INS	-	A	A	rs34962863		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19650372_19650373insA	uc002nmv.3	+						CILP2_uc002nmw.3_Intron	NM_153221	NP_694953			cartilage intermediate layer protein 2							proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20952917	20952917	+	IGR	DEL	G	-	-	rs10406439		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20952917delG								ZNF626 (108515 upstream) : ZNF85 (153163 downstream)																																			---	---	---	---
ZNF493	284443	broad.mit.edu	37	19	21608960	21608964	+	3'UTR	DEL	AAAAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21608960_21608964delAAAAG	uc002npx.2	+	2					ZNF493_uc002npw.2_3'UTR|ZNF493_uc002npy.2_3'UTR	NM_175910	NP_787106			zinc finger protein 493 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	24585401	24585402	+	IGR	DEL	CT	-	-	rs143249063		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24585401_24585402delCT								LOC100101266 (239152 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27756415	27756416	+	IGR	INS	-	G	G	rs138912678		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27756415_27756416insG								None (None upstream) : LOC148189 (524986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27761042	27761042	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27761042delT								None (None upstream) : LOC148189 (520360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27839306	27839306	+	IGR	DEL	T	-	-	rs150263142		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27839306delT								None (None upstream) : LOC148189 (442096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27845351	27845352	+	IGR	DEL	AA	-	-	rs71221284		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27845351_27845352delAA								None (None upstream) : LOC148189 (436050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27882741	27882741	+	IGR	DEL	A	-	-	rs113167415		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27882741delA								None (None upstream) : LOC148189 (398661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28318564	28318574	+	IGR	DEL	AACTGGTAGAC	-	-	rs113355980		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28318564_28318574delAACTGGTAGAC								LOC148189 (33716 upstream) : None (None downstream)																																			---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30930079	30930080	+	Intron	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30930079_30930080delCA	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532			zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	31562543	31562544	+	IGR	DEL	GT	-	-	rs68078487		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31562543_31562544delGT								ZNF536 (513578 upstream) : DKFZp566F0947 (78239 downstream)																																			---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33506330	33506331	+	Intron	INS	-	A	A	rs71340519		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33506330_33506331insA	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	33760236	33760237	+	IGR	INS	-	GT	GT	rs144991507	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33760236_33760237insGT								SLC7A10 (43480 upstream) : CEBPA (30605 downstream)																																			---	---	---	---
MAG	4099	broad.mit.edu	37	19	35806694	35806694	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35806694delG	uc002nyz.1	+							NM_002361	NP_002352			myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	36312621	36312621	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36312621delT								PRODH2 (8420 upstream) : NPHS1 (3653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	36757983	36757984	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36757983_36757984delGT								ZNF146 (28310 upstream) : ZFP14 (69178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	38373585	38373585	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38373585delT								ZNF573 (65645 upstream) : WDR87 (1887 downstream)																																			---	---	---	---
RYR1	6261	broad.mit.edu	37	19	39062284	39062285	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39062284_39062285insA	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
ACTN4	81	broad.mit.edu	37	19	39179372	39179373	+	Intron	INS	-	A	A	rs138810803	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39179372_39179373insA	uc002oja.1	+						ACTN4_uc010egc.1_Intron	NM_004924	NP_004915			actinin, alpha 4						platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)															---	---	---	---
HNRNPL	3191	broad.mit.edu	37	19	39322762	39322762	+	Intron	DEL	A	-	-	rs35295397		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39322762delA	uc002ojj.1	-						ECH1_uc002oji.2_5'Flank|ECH1_uc010xuk.1_5'Flank|HNRNPL_uc010ege.1_Intron	NM_001005335	NP_001005335			heterogeneous nuclear ribonucleoprotein L						nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)															---	---	---	---
SARS2	54938	broad.mit.edu	37	19	39424328	39424329	+	5'Flank	INS	-	GT	GT	rs144148942	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39424328_39424329insGT	uc002oka.2	-						SARS2_uc010xup.1_5'Flank|SARS2_uc002okb.2_5'Flank|SARS2_uc010xuq.1_Intron|SARS2_uc010xur.1_5'Flank|SARS2_uc010xus.1_5'Flank	NM_017827	NP_060297			seryl-tRNA synthetase 2 isoform b precursor						seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
HNRNPUL1	11100	broad.mit.edu	37	19	41797899	41797899	+	Intron	DEL	C	-	-	rs66916970		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41797899delC	uc002oqb.3	+						CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_Intron|HNRNPUL1_uc010eho.2_Intron|HNRNPUL1_uc010xvy.1_Intron|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971			heterogeneous nuclear ribonucleoprotein U-like 1						nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
BCKDHA	593	broad.mit.edu	37	19	41926496	41926496	+	Intron	DEL	A	-	-	rs11307062		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41926496delA	uc002oqq.2	+						CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_Intron|BCKDHA_uc002oqr.2_Intron|BCKDHA_uc010xvz.1_Intron	NM_000709	NP_000700			branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																																			---	---	---	---
LYPD3	27076	broad.mit.edu	37	19	43972297	43972297	+	5'Flank	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43972297delC	uc002owl.1	-						LYPD3_uc002owm.2_5'Flank	NM_014400	NP_055215			GPI-anchored metastasis-associated protein							anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)																---	---	---	---
ZNF180	7733	broad.mit.edu	37	19	44997810	44997811	+	Intron	DEL	CT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44997810_44997811delCT	uc002ozf.3	-						ZNF180_uc002ozh.3_Intron|ZNF180_uc002ozi.3_Intron|ZNF180_uc002ozg.3_Intron|ZNF180_uc010ejm.2_Intron	NM_013256	NP_037388			zinc finger protein 180						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Prostate(69;0.0435)																---	---	---	---
CEACAM20	125931	broad.mit.edu	37	19	45014564	45014565	+	Intron	INS	-	A	A	rs79013358		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45014564_45014565insA	uc010ejn.1	-						CEACAM20_uc010ejo.1_Intron|CEACAM20_uc010ejp.1_Intron|CEACAM20_uc010ejq.1_Intron	NM_001102597	NP_001096067			carcinoembryonic antigen-related cell adhesion							integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)																---	---	---	---
SAE1	10055	broad.mit.edu	37	19	47633001	47633001	+	5'Flank	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47633001delT	uc002pgc.2	+						SAE1_uc002pgd.2_5'Flank|SAE1_uc010ekx.2_5'Flank|SAE1_uc010ekw.2_5'Flank|SAE1_uc010xyk.1_5'Flank|SAE1_uc002pge.2_5'Flank	NM_016402	NP_057486			SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;						protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity			ovary(1)	1		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)														---	---	---	---
SAE1	10055	broad.mit.edu	37	19	47683814	47683814	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47683814delG	uc002pgc.2	+						SAE1_uc002pgd.2_Intron|SAE1_uc010ekx.2_Intron|SAE1_uc010ekw.2_Intron|SAE1_uc010xyk.1_Intron|SAE1_uc002pge.2_Intron	NM_016402	NP_057486			SubName: Full=SUMO-1 activating enzyme subunit 1, isoform CRA_b; SubName: Full=cDNA, FLJ96708, Homo sapiens SUMO-1 activating enzyme subunit 1 (SAE1), mRNA;						protein sumoylation|protein ubiquitination	nucleus	ATP-dependent protein binding|enzyme activator activity|ligase activity|protein C-terminus binding|protein heterodimerization activity|ubiquitin activating enzyme activity			ovary(1)	1		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)														---	---	---	---
GLTSCR1	29998	broad.mit.edu	37	19	48151499	48151500	+	Intron	INS	-	T	T	rs139526921	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48151499_48151500insT	uc002phh.3	+							NM_015711	NP_056526			glioma tumor suppressor candidate region gene 1								protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)														---	---	---	---
PLA2G4C	8605	broad.mit.edu	37	19	48608402	48608403	+	Intron	INS	-	AGA	AGA	rs4801748		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48608402_48608403insAGA	uc002phx.2	-						PLA2G4C_uc002phw.2_Intron|PLA2G4C_uc010elr.2_Intron|PLA2G4C_uc010xzd.1_Intron|PLA2G4C_uc002phy.3_Intron	NM_003706	NP_003697			phospholipase A2, group IVC isoform 1 precursor						arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)														---	---	---	---
TULP2	7288	broad.mit.edu	37	19	49384468	49384468	+	Intron	DEL	C	-	-	rs68173909		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49384468delC	uc002pkz.2	-							NM_003323	NP_003314			tubby like protein 2						visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	49581575	49581576	+	IGR	INS	-	A	A	rs146838826	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49581575_49581576insA								KCNA7 (5377 upstream) : SNRNP70 (6889 downstream)																																			---	---	---	---
PRR12	57479	broad.mit.edu	37	19	50110971	50110971	+	Intron	DEL	A	-	-	rs77397027		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50110971delA	uc002poo.3	+							NM_020719	NP_065770			proline rich 12								DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	51258166	51258167	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51258166_51258167insA								CLEC11A (29187 upstream) : GPR32 (15691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	51321023	51321024	+	Intron	INS	-	GT	GT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51321023_51321024insGT	uc002ptj.2	+											Homo sapiens hypothetical gene MGC45922, mRNA (cDNA clone MGC:45922 IMAGE:5428578), complete cds.																														---	---	---	---
CD33	945	broad.mit.edu	37	19	51734858	51734859	+	Intron	INS	-	T	T	rs67958043		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51734858_51734859insT	uc002pwa.2	+						CD33_uc010eos.1_Intron|CD33_uc010eot.1_Intron|CD33_uc010eou.1_Intron	NM_001772	NP_001763			CD33 antigen isoform 1 precursor						cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)													---	---	---	---
ZNF331	55422	broad.mit.edu	37	19	54062632	54062633	+	Intron	DEL	AT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54062632_54062633delAT	uc002qbx.1	+						ZNF331_uc002qby.1_Intron|ZNF331_uc002qbz.1_Intron|ZNF331_uc002qca.1_Intron|ZNF331_uc010eqr.1_Intron|ZNF331_uc002qcb.1_Intron|ZNF331_uc002qcc.1_Intron|ZNF331_uc002qcd.1_Intron	NM_018555	NP_061025			zinc finger protein 331						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)				T	?	follicular thyroid adenoma								---	---	---	---
Unknown	0	broad.mit.edu	37	19	54165813	54165814	+	IGR	INS	-	A	A	rs36117540	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54165813_54165814insA								DPRX (25550 upstream) : MIR512-1 (4119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	54165814	54165815	+	IGR	INS	-	G	G	rs36065728		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54165814_54165815insG								DPRX (25551 upstream) : MIR512-1 (4118 downstream)																																			---	---	---	---
CACNG8	59283	broad.mit.edu	37	19	54483312	54483315	+	Intron	DEL	GTGT	-	-	rs71949256		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54483312_54483315delGTGT	uc002qcs.1	+						MIR935_hsa-mir-935|MI0005757_5'Flank	NM_031895	NP_114101			voltage-dependent calcium channel gamma-8						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic density|postsynaptic membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)														---	---	---	---
SAPS1	22870	broad.mit.edu	37	19	55746003	55746017	+	Intron	DEL	TCACAGCGGCCGCAC	-	-	rs11274918	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55746003_55746017delTCACAGCGGCCGCAC	uc002qjw.3	-						SAPS1_uc002qjv.2_Intron	NM_014931	NP_055746			SAPS domain family, member 1						regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57199564	57199565	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57199564_57199565delTG								ZNF835 (15318 upstream) : ZIM2 (86358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57409809	57409809	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57409809delT								MIMT1 (49887 upstream) : USP29 (221700 downstream)																																			---	---	---	---
SLC27A5	10998	broad.mit.edu	37	19	59016377	59016377	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59016377delA	uc002qtc.2	-							NM_012254	NP_036386			solute carrier family 27 (fatty acid						bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)														---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2557560	2557560	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2557560delT	uc002wgf.1	+						TMC2_uc002wgg.1_Intron|TMC2_uc010zpw.1_Intron|TMC2_uc010zpx.1_Intron	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	4511554	4511557	+	IGR	DEL	ATAT	-	-	rs6052621		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4511554_4511557delATAT								ADRA1D (281895 upstream) : PRNP (155240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7238211	7238212	+	IGR	INS	-	AT	AT	rs147751622		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7238211_7238212insAT								BMP2 (477301 upstream) : HAO1 (625419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7268451	7268452	+	IGR	INS	-	TCTA	TCTA	rs143579552	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7268451_7268452insTCTA								BMP2 (507541 upstream) : HAO1 (595179 downstream)																																			---	---	---	---
PLCB4	5332	broad.mit.edu	37	20	9120359	9120360	+	Intron	INS	-	T	T	rs139762773	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9120359_9120360insT	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949			phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14926846	14926846	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14926846delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15231454	15231454	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15231454delC	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16238541	16238542	+	IGR	INS	-	A	A	rs112937423		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16238541_16238542insA								MACROD2 (204702 upstream) : KIF16B (14207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	18961597	18961598	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18961597_18961598delTG								C20orf79 (166564 upstream) : SLC24A3 (231692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	19780882	19780883	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19780882_19780883insT	uc002wrm.1	+											Homo sapiens cDNA clone IMAGE:4615254.																														---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20276655	20276659	+	Intron	DEL	CTCCT	-	-	rs7265628		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20276655_20276659delCTCCT	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20317995	20318002	+	Intron	DEL	TGGGTGGA	-	-	rs111753471		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20317995_20318002delTGGGTGGA	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	21004339	21004340	+	IGR	DEL	TC	-	-	rs6132379		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21004339_21004340delTC								RALGAPA2 (311073 upstream) : PLK1S1 (102284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21039774	21039775	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21039774_21039775insT								RALGAPA2 (346508 upstream) : PLK1S1 (66849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22610845	22610846	+	IGR	DEL	AC	-	-	rs72413200		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22610845_22610846delAC								FOXA2 (44744 upstream) : SSTR4 (405211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23002542	23002543	+	Intron	INS	-	A	A	rs76057247		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23002542_23002543insA	uc002wsq.1	-											Homo sapiens cDNA clone IMAGE:5271939.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	24072957	24072958	+	IGR	DEL	AA	-	-	rs71977535		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24072957_24072958delAA								GGTLC1 (103541 upstream) : TMEM90B (376877 downstream)																																			---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25840178	25840183	+	Intron	DEL	ACACAC	-	-	rs112976205		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25840178_25840183delACACAC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25912775	25912775	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25912775delT								FAM182B (63989 upstream) : LOC100134868 (77660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25968504	25968505	+	IGR	DEL	TT	-	-	rs6107123		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25968504_25968505delTT								FAM182B (119718 upstream) : LOC100134868 (21930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26110807	26110807	+	IGR	DEL	G	-	-	rs113689621		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26110807delG								C20orf191 (16130 upstream) : MIR663 (78015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26316731	26316731	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26316731delC								MIR663 (127817 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29431750	29431750	+	IGR	DEL	G	-	-	rs112192023		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29431750delG								None (None upstream) : FRG1B (180129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29467168	29467169	+	IGR	INS	-	T	T	rs144277611	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29467168_29467169insT								None (None upstream) : FRG1B (144710 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29634402	29634402	+	Intron	DEL	T	-	-	rs67656346		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29634402delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
C20orf112	140688	broad.mit.edu	37	20	31094775	31094775	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31094775delG	uc002wxw.1	-											Homo sapiens cDNA FLJ31724 fis, clone NT2RI2006703, moderately similar to Homo sapiens nolp mRNA.												0																		---	---	---	---
C20orf186	149954	broad.mit.edu	37	20	31666871	31666872	+	5'Flank	INS	-	A	A	rs146680314	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31666871_31666872insA	uc010zue.1	+							NM_182519	NP_872325			antimicrobial peptide RY2G5 precursor							cytoplasm|extracellular region	lipid binding				0																		---	---	---	---
C20orf114	92747	broad.mit.edu	37	20	31896258	31896259	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31896258_31896259delAC	uc002wyw.1	+							NM_033197	NP_149974			LPLUNC1 protein precursor							extracellular space	lipid binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32484993	32484994	+	IGR	DEL	TT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32484993_32484994delTT								CHMP4B (42824 upstream) : RALY (96738 downstream)																																			---	---	---	---
FER1L4	80307	broad.mit.edu	37	20	34185344	34185345	+	Intron	INS	-	C	C	rs140205487	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34185344_34185345insC	uc002xcy.3	-							NR_024377				Homo sapiens clone PP3795 unknown mRNA.												0																		---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35735335	35735335	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35735335delT	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	35903298	35903298	+	IGR	DEL	A	-	-	rs5841258		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35903298delA								GHRH (13060 upstream) : MANBAL (14753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37276019	37276022	+	IGR	DEL	GTTG	-	-	rs143374768		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37276019_37276022delGTTG								ADIG (58915 upstream) : SLC32A1 (77083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38656212	38656213	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38656212_38656213delGT								LOC339568 (802821 upstream) : MAFB (658306 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41457659	41457660	+	Intron	INS	-	A	A	rs144041897	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41457659_41457660insA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42178371	42178372	+	3'UTR	DEL	TG	-	-	rs72174034		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42178371_42178372delTG	uc002xkn.1	+	15					SGK2_uc002xkq.1_Intron	NM_032107	NP_115479			l(3)mbt-like isoform II						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42327946	42327946	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42327946delA	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457			MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42559542	42559542	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42559542delT	uc010ggo.2	+						TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron	NM_001098797	NP_001092267			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
STK4	6789	broad.mit.edu	37	20	43638085	43638085	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43638085delT	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron	NM_006282	NP_006273			serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
NCOA5	57727	broad.mit.edu	37	20	44689693	44689694	+	3'UTR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44689693_44689694insA	uc002xrd.2	-	7					NCOA5_uc002xrc.2_3'UTR|NCOA5_uc002xre.2_3'UTR	NM_020967	NP_066018			nuclear receptor coactivator 5						regulation of transcription, DNA-dependent|transcription, DNA-dependent|translation	nucleus	aminoacyl-tRNA ligase activity|ATP binding			central_nervous_system(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45271787	45271787	+	Intron	DEL	A	-	-	rs111851386		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45271787delA	uc002xsf.1	-						SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron|SLC13A3_uc002xsi.3_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45303241	45303242	+	Intron	INS	-	GT	GT	rs142752461	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45303241_45303242insGT	uc002xsg.1	-						SLC13A3_uc010gho.1_Intron	NM_001011554	NP_001011554			solute carrier family 13 member 3 isoform b							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45985077	45985078	+	5'Flank	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45985077_45985078insA	uc002xta.1	-						ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xth.2_Intron|uc002xti.1_5'Flank	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
PREX1	57580	broad.mit.edu	37	20	47321066	47321067	+	Intron	INS	-	TTCC	TTCC	rs138503207	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47321066_47321067insTTCC	uc002xtw.1	-							NM_020820	NP_065871			phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)															---	---	---	---
DDX27	55661	broad.mit.edu	37	20	47838272	47838273	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47838272_47838273insA	uc002xuh.2	+							NM_017895	NP_060365			DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47953082	47953083	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47953082_47953083insT								C20orf199 (47289 upstream) : KCNB1 (35422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48965415	48965416	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48965415_48965416insT								CEBPB (156203 upstream) : PTPN1 (161475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49022788	49022799	+	IGR	DEL	TGGATGGATGGA	-	-	rs113162677		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49022788_49022799delTGGATGGATGGA								CEBPB (213576 upstream) : PTPN1 (104092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49068578	49068579	+	IGR	INS	-	AGAA	AGAA	rs138368750	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068578_49068579insAGAA								CEBPB (259366 upstream) : PTPN1 (58312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49069903	49069904	+	IGR	INS	-	CA	CA	rs139250206	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49069903_49069904insCA								CEBPB (260691 upstream) : PTPN1 (56987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49379289	49379290	+	IGR	DEL	AC	-	-	rs11468973		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49379289_49379290delAC								PARD6B (9012 upstream) : BCAS4 (32177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52366187	52366188	+	IGR	INS	-	A	A	rs74179232		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52366187_52366188insA								ZNF217 (155386 upstream) : SUMO1P1 (124854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52528313	52528313	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52528313delA								SUMO1P1 (36065 upstream) : BCAS1 (31766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56470244	56470246	+	IGR	DEL	TAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56470244_56470246delTAT								PMEPA1 (183703 upstream) : C20orf85 (255737 downstream)																																			---	---	---	---
PHACTR3	116154	broad.mit.edu	37	20	58169393	58169393	+	Intron	DEL	T	-	-	rs142513828		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58169393delT	uc002yat.2	+							NM_183244	NP_899067			phosphatase and actin regulator 3 isoform 2							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	59473770	59473771	+	IGR	INS	-	T	T	rs11482753		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59473770_59473771insT								MIR646 (590145 upstream) : CDH4 (353788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59805938	59805938	+	IGR	DEL	A	-	-	rs74311941		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59805938delA								MIR646 (922313 upstream) : CDH4 (21621 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60124511	60124511	+	Intron	DEL	T	-	-	rs72398678		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60124511delT	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CHRNA4	1137	broad.mit.edu	37	20	61988524	61988524	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61988524delT	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_Intron|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735			cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)													---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62811299	62811300	+	Intron	INS	-	ACAC	ACAC	rs138617125	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62811299_62811300insACAC	uc002yii.2	+						MYT1_uc002yih.2_Intron	NM_004535	NP_004526			myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9415562	9415562	+	IGR	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9415562delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9878690	9878691	+	IGR	DEL	GT	-	-	rs75951230	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9878690_9878691delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC100132288	100132288	broad.mit.edu	37	21	9917226	9917227	+	Intron	DEL	AG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9917226_9917227delAG	uc002zka.1	-							NM_001033515	NP_001028687			hypothetical protein LOC100132288												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	10462688	10462688	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10462688delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10522307	10522307	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10522307delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10774767	10774781	+	IGR	DEL	GAATGGAATGGAATT	-	-	rs145814519		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10774767_10774781delGAATGGAATGGAATT								None (None upstream) : TPTE (131962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10782298	10782312	+	IGR	DEL	TGGAATGGAATTGAA	-	-	rs111968915		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10782298_10782312delTGGAATGGAATTGAA								None (None upstream) : TPTE (124431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10794504	10794508	+	IGR	DEL	GTGAA	-	-	rs78718800		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10794504_10794508delGTGAA								None (None upstream) : TPTE (112235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10832663	10832667	+	IGR	DEL	TACCC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10832663_10832667delTACCC								None (None upstream) : TPTE (74076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10835011	10835012	+	IGR	INS	-	AATGG	AATGG	rs142758185		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10835011_10835012insAATGG								None (None upstream) : TPTE (71731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10841905	10841914	+	IGR	DEL	GGAATGGAAT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841905_10841914delGGAATGGAAT								None (None upstream) : TPTE (64829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10855527	10855528	+	IGR	INS	-	GAATG	GAATG	rs150774792		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10855527_10855528insGAATG								None (None upstream) : TPTE (51215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10894837	10894838	+	IGR	INS	-	TTC	TTC	rs149040382	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894837_10894838insTTC								None (None upstream) : TPTE (11905 downstream)																																			---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10984603	10984605	+	Intron	DEL	CTC	-	-	rs71277400		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10984603_10984605delCTC	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10985298	10985299	+	Intron	INS	-	GA	GA	rs138216602	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10985298_10985299insGA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11050605	11050606	+	Intron	INS	-	A	A	rs150695624		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11050605_11050606insA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11123354	11123354	+	IGR	DEL	G	-	-	rs142871531		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11123354delG								BAGE (24417 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11144771	11144772	+	IGR	DEL	TC	-	-	rs55756166		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11144771_11144772delTC								BAGE (45834 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11155113	11155113	+	IGR	DEL	A	-	-	rs149249762		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11155113delA								BAGE (56176 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11178962	11178965	+	IGR	DEL	AAAG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11178962_11178965delAAAG								BAGE (80025 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14356733	14356733	+	IGR	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14356733delA								None (None upstream) : C21orf99 (53754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14383819	14383819	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14383819delC								None (None upstream) : C21orf99 (26668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18859751	18859754	+	IGR	DEL	GTGT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18859751_18859754delGTGT								C21orf34 (877657 upstream) : CXADR (25576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	20416234	20416235	+	IGR	INS	-	ACAC	ACAC	rs28480669		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20416234_20416235insACAC								TMPRSS15 (640264 upstream) : None (None downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22633710	22633710	+	Intron	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22633710delT	uc002yld.1	+						NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	27752188	27752188	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27752188delT								APP (208742 upstream) : CYYR1 (86341 downstream)																																			---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32782411	32782412	+	Intron	INS	-	GA	GA	rs142051374	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32782411_32782412insGA	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244			T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
C21orf59	56683	broad.mit.edu	37	21	33958517	33958518	+	Intron	DEL	GT	-	-	rs115338885	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33958517_33958518delGT	uc002ypy.1	-						TCP10L_uc002ypw.3_5'Flank|C21orf59_uc002ypx.1_Intron|C21orf59_uc002ypz.1_Intron	NM_021254	NP_067077			hypothetical protein LOC56683							cytosol|nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	34575542	34575545	+	IGR	DEL	ACAC	-	-	rs10539770		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34575542_34575545delACAC								C21orf54 (33001 upstream) : IFNAR2 (26686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	35529137	35529137	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35529137delT								MRPS6 (13803 upstream) : C21orf82 (23841 downstream)																																			---	---	---	---
ERG	2078	broad.mit.edu	37	21	39982451	39982452	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39982451_39982452delGT	uc010gnw.2	-						ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627			ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	42525479	42525480	+	IGR	INS	-	AG	AG	rs148242192	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42525479_42525480insAG								C21orf130 (5488 upstream) : BACE2 (14248 downstream)																																			---	---	---	---
SLC37A1	54020	broad.mit.edu	37	21	43975717	43975718	+	Intron	INS	-	CAAT	CAAT	rs146794297	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43975717_43975718insCAAT	uc002zbi.2	+						SLC37A1_uc002zbj.2_Intron	NM_018964	NP_061837			solute carrier family 37 member 1						carbohydrate transport|transmembrane transport	integral to membrane					0																		---	---	---	---
PKNOX1	5316	broad.mit.edu	37	21	44438157	44438158	+	Intron	INS	-	AAAA	AAAA	rs60175567		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44438157_44438158insAAAA	uc002zcq.1	+						PKNOX1_uc002zcp.1_Intron|PKNOX1_uc011aex.1_Intron|PKNOX1_uc002zcr.2_3'UTR	NM_004571	NP_004562			PBX/knotted 1 homeobox 1								sequence-specific DNA binding			large_intestine(2)	2																		---	---	---	---
CBS	875	broad.mit.edu	37	21	44497976	44497977	+	5'Flank	DEL	CA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44497976_44497977delCA	uc002zcu.2	-						CBS_uc002zct.2_5'Flank|CBS_uc002zcw.3_5'Flank|CBS_uc002zcv.2_5'Flank	NM_000071	NP_000062			cystathionine-beta-synthase						cysteine biosynthetic process from serine|cysteine biosynthetic process via cystathionine|homocysteine catabolic process|hydrogen sulfide biosynthetic process|L-cysteine catabolic process|L-serine catabolic process	cytosol|nucleolus	cystathionine beta-synthase activity|heme binding|protein homodimerization activity|pyridoxal phosphate binding|ubiquitin protein ligase binding				0					L-Cysteine(DB00151)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|S-Adenosylmethionine(DB00118)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	44712375	44712376	+	IGR	INS	-	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44712375_44712376insG								CRYAA (119462 upstream) : SIK1 (122022 downstream)																																			---	---	---	---
TRPM2	7226	broad.mit.edu	37	21	45839549	45839551	+	Intron	DEL	TGA	-	-	rs149049149		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839549_45839551delTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298			transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	46731814	46731815	+	IGR	INS	-	CATT	CATT	rs143853410	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46731814_46731815insCATT								LOC642852 (14546 upstream) : COL18A1 (93282 downstream)																																			---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47217358	47217359	+	Intron	INS	-	AT	AT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47217358_47217359insAT	uc010gqb.2	+							NM_020528	NP_065389			poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	47510929	47510934	+	IGR	DEL	TGGTGA	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47510929_47510934delTGGTGA								COL6A1 (85966 upstream) : COL6A2 (7099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16905493	16905494	+	IGR	INS	-	T	T	rs111631654		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16905493_16905494insT								OR11H1 (455689 upstream) : CCT8L2 (166154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16943297	16943298	+	IGR	INS	-	A	A	rs146766102		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16943297_16943298insA								OR11H1 (493493 upstream) : CCT8L2 (128350 downstream)																																			---	---	---	---
psiTPTE22	387590	broad.mit.edu	37	22	17131430	17131432	+	Intron	DEL	CAC	-	-	rs142037179		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17131430_17131432delCAC	uc002zls.1	+						psiTPTE22_uc002zlt.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0																		---	---	---	---
BCL2L13	23786	broad.mit.edu	37	22	18205142	18205143	+	Intron	DEL	GG	-	-	rs113458410		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18205142_18205143delGG	uc002zmw.2	+						BCL2L13_uc002zmx.2_Intron|BCL2L13_uc002zmy.2_Intron|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_Intron|BCL2L13_uc002zmz.2_Intron|BCL2L13_uc002zna.2_Intron	NM_015367	NP_056182			BCL2-like 13 (apoptosis facilitator)						induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)														---	---	---	---
TXNRD2	10587	broad.mit.edu	37	22	19917781	19917781	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19917781delG	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_Intron|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_Intron	NM_006440	NP_006431			thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)																	---	---	---	---
RTN4R	65078	broad.mit.edu	37	22	20239263	20239268	+	Intron	DEL	ATCACT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20239263_20239268delATCACT	uc002zrv.2	-						MIR1286_hsa-mir-1286|MI0006348_5'Flank	NM_023004	NP_075380			reticulon 4 receptor precursor						axonogenesis|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	anchored to membrane|cell surface|endoplasmic reticulum|plasma membrane	protein binding|receptor activity				0	Colorectal(54;0.0993)																	---	---	---	---
MAPK1	5594	broad.mit.edu	37	22	22138638	22138649	+	Intron	DEL	AAGAAAGAAAGG	-	-	rs72381351		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22138638_22138649delAAGAAAGAAAGG	uc002zvn.2	-						MAPK1_uc002zvo.2_Intron|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736			mitogen-activated protein kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)													---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22818332	22818332	+	Intron	DEL	G	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22818332delG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ZDHHC8P1	150244	broad.mit.edu	37	22	23732828	23732829	+	RNA	INS	-	AG	AG	rs149527441	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23732828_23732829insAG	uc002zxa.3	-	6		c.2511_2512insCT			ZDHHC8P1_uc002zxb.3_RNA|ZDHHC8P1_uc002zwz.3_RNA	NR_003950				Homo sapiens cDNA FLJ31568 fis, clone NT2RI2001595.												0																		---	---	---	---
GGT1	2678	broad.mit.edu	37	22	24993648	24993648	+	Intron	DEL	A	-	-	rs78365377		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24993648delA	uc003aan.1	+							NM_013430	NP_038347			gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26278324	26278325	+	Intron	INS	-	A	A	rs143244891		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26278324_26278325insA	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997			myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26413051	26413054	+	Intron	DEL	CTCC	-	-	rs144669857		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26413051_26413054delCTCC	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997			myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26709538	26709539	+	Intron	DEL	AC	-	-	rs68081834		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26709538_26709539delAC	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27486237	27486238	+	IGR	DEL	TG	-	-	rs60743703		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27486237_27486238delTG								MIAT (371288 upstream) : MN1 (658028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	29818815	29818818	+	IGR	DEL	CTCT	-	-	rs4034937		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29818815_29818818delCTCT								AP1B1 (34246 upstream) : RFPL1S (14188 downstream)																																			---	---	---	---
RFPL1	5988	broad.mit.edu	37	22	29833942	29833943	+	5'Flank	INS	-	TT	TT	rs71324760		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29833942_29833943insTT	uc003afn.2	+						RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306			ret finger protein-like 1								zinc ion binding				0																		---	---	---	---
ASCC2	84164	broad.mit.edu	37	22	30187073	30187074	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30187073_30187074insA	uc003agr.2	-						ASCC2_uc003ags.2_Intron|ASCC2_uc003agt.2_Intron|ASCC2_uc011akr.1_Intron	NM_032204	NP_115580			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)															---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30371053	30371053	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30371053delA	uc003agv.3	+						MTMR3_uc003agu.3_Intron|MTMR3_uc003agw.3_Intron	NM_021090	NP_066576			myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)															---	---	---	---
Unknown	0	broad.mit.edu	37	22	30428734	30428734	+	IGR	DEL	C	-	-	rs68066267		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30428734delC								MTMR3 (1879 upstream) : HORMAD2 (47719 downstream)																																			---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32252190	32252191	+	Intron	DEL	AC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32252190_32252191delAC	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc011alw.1_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477			DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	35916184	35916184	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35916184delT								MCM5 (95690 upstream) : RASD2 (21168 downstream)																																			---	---	---	---
APOL2	23780	broad.mit.edu	37	22	36635292	36635292	+	Intron	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36635292delC	uc003aoz.2	-						APOL2_uc011amm.1_Intron|APOL2_uc003apa.2_Intron|uc003apb.1_5'Flank	NM_030882	NP_112092			apolipoprotein L2						acute-phase response|cholesterol metabolic process|lipid transport|lipoprotein metabolic process|maternal process involved in female pregnancy|multicellular organismal development	endoplasmic reticulum membrane|extracellular region	high-density lipoprotein particle binding|lipid binding|receptor binding				0																		---	---	---	---
TAB1	10454	broad.mit.edu	37	22	39795601	39795603	+	5'Flank	DEL	AAC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39795601_39795603delAAC	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_5'Flank|TAB1_uc003axu.1_5'Flank	NM_006116	NP_006107			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1																		---	---	---	---
TAB1	10454	broad.mit.edu	37	22	39807112	39807113	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39807112_39807113insA	uc003axt.2	+						TAB1_uc003axr.2_Intron|TAB1_uc011aok.1_Intron|TAB1_uc003axu.1_Intron	NM_006116	NP_006107			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	41040841	41040842	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41040841_41040842delTG								MKL1 (8151 upstream) : MCHR1 (34340 downstream)																																			---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41333337	41333337	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41333337delA	uc011aoy.1	+							NM_022098				X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41334658	41334659	+	Intron	INS	-	TA	TA			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41334658_41334659insTA	uc011aoy.1	+							NM_022098				X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
TOB2	10766	broad.mit.edu	37	22	41839262	41839263	+	Intron	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41839262_41839263delGT	uc003azz.1	-							NM_016272	NP_057356			transducer of ERBB2, 2						female gamete generation|negative regulation of cell proliferation	cytoplasm|nucleus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	42878907	42878908	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42878907_42878908insT								NFAM1 (50506 upstream) : SERHL (17677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	43257782	43257783	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43257782_43257783insT								ARFGAP3 (4374 upstream) : PACSIN2 (9156 downstream)																																			---	---	---	---
MPPED1	758	broad.mit.edu	37	22	43859701	43859702	+	Intron	INS	-	TTTCTTTCTTTCTTTCTTTCTTTC	TTTCTTTCTTTCTTTCTTTCTTTC	rs695374		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43859701_43859702insTTTCTTTCTTTCTTTCTTTCTTTC	uc011apv.1	+						MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Intron|MPPED1_uc011apz.1_Intron	NM_001044370	NP_001037835			metallophosphoesterase domain containing 1								hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)																---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	44014023	44014024	+	Intron	INS	-	AGGA	AGGA	rs6147637		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44014023_44014024insAGGA	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzj.1_Intron	NM_022785	NP_073622			CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
PHF21B	112885	broad.mit.edu	37	22	45280004	45280015	+	Intron	DEL	ATGATCACCATT	-	-	rs60606161		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45280004_45280015delATGATCACCATT	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron	NM_138415	NP_612424			PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	45518842	45518843	+	IGR	INS	-	A	A	rs137972692	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45518842_45518843insA								PHF21B (113033 upstream) : NUP50 (40883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	47698351	47698352	+	IGR	INS	-	CATC	CATC	rs143540507	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47698351_47698352insCATC								TBC1D22A (128629 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	47698539	47698540	+	IGR	INS	-	ATCC	ATCC	rs150435197	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47698539_47698540insATCC								TBC1D22A (128817 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	47871737	47871738	+	Intron	INS	-	CA	CA	rs137989121	by1000genomes	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47871737_47871738insCA	uc003bih.2	-											Homo sapiens, clone IMAGE:5180210, mRNA.																														---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	49131936	49131937	+	Intron	INS	-	C	C	rs67932621		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49131936_49131937insC	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	49379438	49379439	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49379438_49379439insA								FAM19A5 (231696 upstream) : C22orf34 (428737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49535165	49535166	+	IGR	DEL	TG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49535165_49535166delTG								FAM19A5 (387423 upstream) : C22orf34 (273010 downstream)																																			---	---	---	---
C22orf34	348645	broad.mit.edu	37	22	49850026	49850027	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49850026_49850027insT	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0																		---	---	---	---
C22orf34	348645	broad.mit.edu	37	22	50003639	50003640	+	Intron	INS	-	TTAA	TTAA	rs111966165		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50003639_50003640insTTAA	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0																		---	---	---	---
BRD1	23774	broad.mit.edu	37	22	50216071	50216071	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50216071delA	uc003biv.2	-						BRD1_uc011arf.1_Intron|BRD1_uc011arg.1_Intron|BRD1_uc011arh.1_Intron|BRD1_uc003biu.3_Intron	NM_014577	NP_055392			bromodomain containing protein 1						histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	50777238	50777239	+	IGR	DEL	GG	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50777238_50777239delGG								FAM116B (11749 upstream) : SAPS2 (4521 downstream)																																			---	---	---	---
SHOX	6473	broad.mit.edu	37	X	611841	611842	+	Intron	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:611841_611842insT	uc004cpi.2	+							NM_006883	NP_006874			short stature homeobox isoform SHOXb						skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	24708959	24708960	+	IGR	DEL	GT	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24708959_24708960delGT								PCYT1B (17980 upstream) : POLA1 (3096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	54868437	54868437	+	IGR	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54868437delT								MAGED2 (25992 upstream) : TRO (78812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61767308	61767309	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61767308_61767309insT								None (None upstream) : SPIN4 (799799 downstream)																																			---	---	---	---
XIST	7503	broad.mit.edu	37	X	73067240	73067240	+	RNA	DEL	T	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73067240delT	uc004ebm.1	-	1		c.5349delA				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	90558965	90558966	+	IGR	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90558965_90558966insA								None (None upstream) : PABPC5 (130631 downstream)																																			---	---	---	---
HTR2C	3358	broad.mit.edu	37	X	113961447	113961448	+	Intron	INS	-	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113961447_113961448insA	uc004epu.1	+						HTR2C_uc010nqc.1_Intron|HTR2C_uc004epv.1_Intron	NM_000868	NP_000859			5-hydroxytryptamine (serotonin) receptor 2C						cGMP biosynthetic process|ERK1 and ERK2 cascade|feeding behavior|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	cytoplasm|integral to membrane|nucleus|plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|protein binding|serotonin binding|serotonin receptor activity			ovary(3)	3					Chlorprothixene(DB01239)|Clozapine(DB00363)|Dexfenfluramine(DB01191)|Fenfluramine(DB00574)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Tramadol(DB00193)|Ziprasidone(DB00246)													---	---	---	---
AFF2	2334	broad.mit.edu	37	X	147663172	147663173	+	Intron	INS	-	GT	GT	rs74897979		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147663172_147663173insGT	uc004fcp.2	+						AFF2_uc004fco.2_Intron|AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron	NM_002025	NP_002016			fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
MECP2	4204	broad.mit.edu	37	X	153309631	153309631	+	Intron	DEL	A	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153309631delA	uc004fjv.2	-						MECP2_uc004fjw.2_Intron	NM_004992	NP_004983			methyl CpG binding protein 2 isoform 1						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
TSPY1	7258	broad.mit.edu	37	Y	9340762	9340763	+	Intron	DEL	CC	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9340762_9340763delCC	uc010nwp.1	+											RecName: Full=Testis-specific Y-encoded protein 1; AltName: Full=Cancer/testis antigen 78;          Short=CT78;						cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9981809	9981809	+	IGR	DEL	C	-	-			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9981809delC								TTTY22 (330955 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10070804	10070805	+	IGR	INS	-	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10070804_10070805insC								TTTY22 (419950 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13270122	13270122	+	IGR	DEL	T	-	-	rs75692746		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13270122delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13445282	13445283	+	IGR	INS	-	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13445282_13445283insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13643024	13643025	+	IGR	INS	-	GAT	GAT			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13643024_13643025insGAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58969443	58969452	+	IGR	DEL	ACACACACAC	-	-	rs75095670		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58969443_58969452delACACACACAC								None (None upstream) : None (None downstream)																																			---	---	---	---
PDPN	10630	broad.mit.edu	37	1	13940872	13940872	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13940872G>A	uc001avd.2	+	5	725	c.676G>A	c.(676-678)GTT>ATT	p.V226I	PDPN_uc001avc.2_Missense_Mutation_p.V226I|PDPN_uc009vob.2_Missense_Mutation_p.V108I|PDPN_uc009voc.2_Missense_Mutation_p.V108I|PDPN_uc001ave.2_Missense_Mutation_p.V108I|PDPN_uc001avf.2_Missense_Mutation_p.V108I	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated	150	Helical; (Potential).				cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)														---	---	---	---
KIAA0090	23065	broad.mit.edu	37	1	19559146	19559146	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19559146G>T	uc001bbo.2	-	15	1797	c.1754C>A	c.(1753-1755)CCA>CAA	p.P585Q	KIAA0090_uc001bbp.2_Missense_Mutation_p.P584Q|KIAA0090_uc001bbq.2_Missense_Mutation_p.P584Q|KIAA0090_uc001bbr.2_Missense_Mutation_p.P563Q	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	585	Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
LEPRE1	64175	broad.mit.edu	37	1	43228097	43228097	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43228097C>T	uc001chv.2	-	2	628	c.515G>A	c.(514-516)GGC>GAC	p.G172D	LEPRE1_uc001chw.2_Missense_Mutation_p.G172D|LEPRE1_uc001chx.3_Missense_Mutation_p.G172D|LEPRE1_uc001chy.3_Missense_Mutation_p.G172D	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	172	TPR 2.				negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
TIE1	7075	broad.mit.edu	37	1	43783269	43783269	+	Silent	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43783269G>T	uc001ciu.2	+	16	2734	c.2655G>T	c.(2653-2655)GCG>GCT	p.A885A	TIE1_uc010oke.1_Silent_p.A840A|TIE1_uc009vwq.2_Silent_p.A841A|TIE1_uc010okg.1_Silent_p.A530A	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	885	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
BEST4	266675	broad.mit.edu	37	1	45250412	45250412	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45250412G>A	uc001cmm.2	-	8	1086	c.1037C>T	c.(1036-1038)CCC>CTC	p.P346L		NM_153274	NP_695006	Q8NFU0	BEST4_HUMAN	bestrophin 4	346	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
ST6GALNAC5	81849	broad.mit.edu	37	1	77510220	77510220	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77510220G>A	uc001dhi.2	+	3	768	c.593G>A	c.(592-594)CGG>CAG	p.R198Q	ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	NM_030965	NP_112227	Q9BVH7	SIA7E_HUMAN	sialyltransferase 7E	198	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2																		---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216348749	216348749	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216348749T>A	uc001hku.1	-	21	4859	c.4472A>T	c.(4471-4473)GAA>GTA	p.E1491V	USH2A_uc001hkv.2_Missense_Mutation_p.E1491V	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1491	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
SH3YL1	26751	broad.mit.edu	37	2	224859	224859	+	Intron	SNP	T	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224859T>C	uc002qvx.2	-						SH3YL1_uc002qvy.2_Intron|SH3YL1_uc002qvz.2_Intron|SH3YL1_uc002qwa.2_Intron|SH3YL1_uc010ewe.2_Intron|SH3YL1_uc002qvu.2_Intron|SH3YL1_uc002qvv.2_Intron|SH3YL1_uc002qvw.2_Intron	NM_015677	NP_056492			SH3 domain containing, Ysc84-like 1 isoform 1											ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.034)		all cancers(51;0.000647)|Epithelial(75;0.0043)|OV - Ovarian serous cystadenocarcinoma(76;0.00871)|GBM - Glioblastoma multiforme(21;0.148)														---	---	---	---
B3GNT7	93010	broad.mit.edu	37	2	232263406	232263406	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232263406G>A	uc002vrs.2	+	2	1156	c.976G>A	c.(976-978)GAC>AAC	p.D326N		NM_145236	NP_660279	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal	326	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48621022	48621022	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48621022G>A	uc003ctz.2	-	40	4369	c.4368C>T	c.(4366-4368)GGC>GGT	p.G1456G		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1456	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
DRD3	1814	broad.mit.edu	37	3	113858530	113858530	+	Silent	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113858530G>T	uc003ebd.2	-	6	963	c.540C>A	c.(538-540)GTC>GTA	p.V180V	DRD3_uc010hqn.1_Silent_p.V180V|DRD3_uc003ebb.1_Silent_p.V180V|DRD3_uc003ebc.1_Silent_p.V180V	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	180	Extracellular.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---
SEMA5B	54437	broad.mit.edu	37	3	122680090	122680090	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122680090C>T	uc003efz.1	-	2	325	c.21G>A	c.(19-21)CCG>CCA	p.P7P	SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Silent_p.P7P|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	7	Extracellular (Potential).				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)														---	---	---	---
ZBTB38	253461	broad.mit.edu	37	3	141161551	141161551	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141161551C>T	uc003etw.2	+	8	1303	c.321C>T	c.(319-321)CTC>CTT	p.L107L	ZBTB38_uc010hun.2_Silent_p.L104L|ZBTB38_uc010huo.2_Silent_p.L107L|ZBTB38_uc003ety.2_Silent_p.L107L|ZBTB38_uc010hup.2_Silent_p.L108L	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	107					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155250824	155250824	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155250824G>A	uc003inw.2	-	11	2404	c.2404C>T	c.(2404-2406)CGG>TGG	p.R802W	DCHS2_uc003inx.2_Missense_Mutation_p.R1257W	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	802	Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
RXFP1	59350	broad.mit.edu	37	4	159560437	159560437	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159560437A>G	uc003ipz.2	+	14	1151	c.1069A>G	c.(1069-1071)AAT>GAT	p.N357D	RXFP1_uc010iqj.1_Missense_Mutation_p.N186D|RXFP1_uc011cja.1_Missense_Mutation_p.N252D|RXFP1_uc010iqo.2_Missense_Mutation_p.N309D|RXFP1_uc011cjb.1_Missense_Mutation_p.N255D|RXFP1_uc010iqk.2_Missense_Mutation_p.N225D|RXFP1_uc011cjc.1_Missense_Mutation_p.N276D|RXFP1_uc011cjd.1_Missense_Mutation_p.N276D|RXFP1_uc010iql.2_Missense_Mutation_p.N201D|RXFP1_uc011cje.1_Missense_Mutation_p.N384D|RXFP1_uc010iqm.2_Missense_Mutation_p.N324D|RXFP1_uc011cjf.1_Missense_Mutation_p.N226D|RXFP1_uc010iqn.2_Missense_Mutation_p.N302D	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	357	Extracellular (Potential).|LRR 9.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)														---	---	---	---
BDP1	55814	broad.mit.edu	37	5	70759924	70759924	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70759924G>A	uc003kbp.1	+	4	902	c.639G>A	c.(637-639)TCG>TCA	p.S213S	BDP1_uc003kbn.1_Silent_p.S213S|BDP1_uc003kbo.2_Silent_p.S213S	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	213	Interaction with ZBTB43.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)														---	---	---	---
ACOT12	134526	broad.mit.edu	37	5	80631636	80631636	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80631636G>A	uc003khl.3	-	12	1268	c.1213C>T	c.(1213-1215)CGT>TGT	p.R405C	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	405	START.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)														---	---	---	---
HSD17B4	3295	broad.mit.edu	37	5	118861675	118861675	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118861675A>G	uc003ksj.2	+	19	1760	c.1637A>G	c.(1636-1638)CAG>CGG	p.Q546R	HSD17B4_uc011cwg.1_Missense_Mutation_p.Q522R|HSD17B4_uc011cwh.1_Missense_Mutation_p.Q528R|HSD17B4_uc011cwi.1_Missense_Mutation_p.Q571R|HSD17B4_uc003ksk.3_Missense_Mutation_p.Q399R|HSD17B4_uc011cwj.1_Missense_Mutation_p.Q399R|HSD17B4_uc010jcn.1_Missense_Mutation_p.Q284R|HSD17B4_uc010jco.1_Missense_Mutation_p.S15G	NM_000414	NP_000405	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	546	MaoC-like.|Enoyl-CoA hydratase 2.				bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3-hydroxyacyl-CoA dehydrogenase activity|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity|estradiol 17-beta-dehydrogenase activity|isomerase activity|long-chain-enoyl-CoA hydratase activity|protein binding|sterol binding|sterol transporter activity			ovary(1)|pancreas(1)	2		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)	NADH(DB00157)													---	---	---	---
PCDHGA7	56108	broad.mit.edu	37	5	140764604	140764604	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140764604C>T	uc003lka.1	+	1	2138	c.2138C>T	c.(2137-2139)GCG>GTG	p.A713V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGB4_uc003lkc.1_5'Flank|PCDHGA7_uc003ljz.1_Missense_Mutation_p.A713V|PCDHGB4_uc011dav.1_5'Flank	NM_018920	NP_061743	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7 isoform 1	713	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
HAVCR2	84868	broad.mit.edu	37	5	156535959	156535959	+	Silent	SNP	C	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156535959C>A	uc003lwk.1	-	1	180	c.36G>T	c.(34-36)CTG>CTT	p.L12L	HAVCR2_uc003lwl.2_Silent_p.L12L	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	T cell immunoglobulin mucin 3 precursor	12						integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
MGAT1	4245	broad.mit.edu	37	5	180218811	180218811	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180218811C>A	uc003mmg.3	-	2	1656	c.1161G>T	c.(1159-1161)CAG>CAT	p.Q387H	MGAT1_uc010jlf.2_Missense_Mutation_p.Q387H|MGAT1_uc010jlg.2_Missense_Mutation_p.Q387H|MGAT1_uc003mmh.3_Missense_Mutation_p.Q387H|MGAT1_uc010jlh.2_Missense_Mutation_p.Q387H|MGAT1_uc003mmi.3_Missense_Mutation_p.Q387H	NM_002406	NP_002397	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein	387	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
HSPA1L	3305	broad.mit.edu	37	6	31779057	31779057	+	Silent	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31779057A>G	uc003nxh.2	-	2	876	c.693T>C	c.(691-693)GGT>GGC	p.G231G	HSPA1L_uc010jte.2_Silent_p.G231G	NM_005527	NP_005518	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	231					response to unfolded protein		ATP binding			ovary(3)|pleura(1)|kidney(1)|skin(1)	6																		---	---	---	---
KIFC1	3833	broad.mit.edu	37	6	33372771	33372771	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33372771T>G	uc003oef.3	+	7	1349	c.899T>G	c.(898-900)CTG>CGG	p.L300R	KIFC1_uc011drf.1_Missense_Mutation_p.L292R	NM_002263	NP_002254	Q9BW19	KIFC1_HUMAN	kinesin family member C1	300	Potential.				blood coagulation|cell division|microtubule-based movement|mitotic sister chromatid segregation	early endosome|microtubule|microtubule associated complex|microtubule organizing center|nucleus|spindle	ATP binding|microtubule motor activity				0																		---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	73102406	73102406	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73102406A>G	uc003pga.2	+	31	4589	c.4512A>G	c.(4510-4512)ATA>ATG	p.I1504M	RIMS1_uc011dyb.1_Missense_Mutation_p.I901M|RIMS1_uc003pgc.2_Missense_Mutation_p.I953M|RIMS1_uc010kaq.2_Missense_Mutation_p.I824M|RIMS1_uc011dyc.1_Missense_Mutation_p.I629M|RIMS1_uc010kar.2_Missense_Mutation_p.I572M|RIMS1_uc011dyd.1_Missense_Mutation_p.I638M|RIMS1_uc003pgf.2_Missense_Mutation_p.I504M|RIMS1_uc003pgg.2_Missense_Mutation_p.I400M|RIMS1_uc003pgi.2_Missense_Mutation_p.I320M|RIMS1_uc003pgh.2_Missense_Mutation_p.I371M|RIMS1_uc003pgd.2_Missense_Mutation_p.I570M|RIMS1_uc003pge.2_Missense_Mutation_p.I544M|RIMS1_uc011dye.1_Missense_Mutation_p.I310M|RIMS1_uc011dyf.1_Missense_Mutation_p.I128M|RIMS1_uc011dyg.1_Missense_Mutation_p.I31M	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1504					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121412103	121412103	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121412103G>A	uc003pyo.1	-	31	3618	c.3550C>T	c.(3550-3552)CTT>TTT	p.L1184F		NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	1184	Rab-GAP TBC.				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152631075	152631075	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152631075G>A	uc010kiw.2	-	90	17699	c.17097C>T	c.(17095-17097)CCC>CCT	p.P5699P	SYNE1_uc010kiv.2_Silent_p.P223P|SYNE1_uc003qos.3_Silent_p.P223P|SYNE1_uc003qot.3_Silent_p.P5628P|SYNE1_uc003qou.3_Silent_p.P5699P	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5699	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
LPA	4018	broad.mit.edu	37	6	161015130	161015130	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161015130G>A	uc003qtl.2	-	23	3609	c.3489C>T	c.(3487-3489)CCC>CCT	p.P1163P		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3671	Kringle 33.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33380547	33380547	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33380547G>A	uc003tdn.1	+	11	1750	c.1237G>A	c.(1237-1239)GTT>ATT	p.V413I	BBS9_uc003tdo.1_Missense_Mutation_p.V413I|BBS9_uc003tdp.1_Missense_Mutation_p.V413I|BBS9_uc003tdq.1_Missense_Mutation_p.V413I|BBS9_uc010kwn.1_RNA|BBS9_uc011kao.1_Missense_Mutation_p.V291I	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	413					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
DLC1	10395	broad.mit.edu	37	8	12958040	12958040	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12958040G>C	uc003wwm.2	-	9	2250	c.1806C>G	c.(1804-1806)AGC>AGG	p.S602R	DLC1_uc003wwk.1_Missense_Mutation_p.S165R|DLC1_uc003wwl.1_Missense_Mutation_p.S199R|DLC1_uc011kxx.1_Missense_Mutation_p.S91R	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	602					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
C8orf58	541565	broad.mit.edu	37	8	22458519	22458519	+	Silent	SNP	C	T	T	rs138371466		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22458519C>T	uc003xce.2	+	2	277	c.165C>T	c.(163-165)GTC>GTT	p.V55V	C8orf58_uc011kzl.1_Silent_p.V55V|C8orf58_uc003xcf.2_Silent_p.V55V	NM_001013842	NP_001013864	Q8NAV2	CH058_HUMAN	hypothetical protein LOC541565	55										skin(1)	1		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
ENTPD4	9583	broad.mit.edu	37	8	23305223	23305223	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23305223G>A	uc003xdl.2	-	4	546	c.382C>T	c.(382-384)CGA>TGA	p.R128*	ENTPD4_uc011kzu.1_Nonsense_Mutation_p.R128*|ENTPD4_uc003xdm.2_Nonsense_Mutation_p.R128*|ENTPD4_uc011kzv.1_Nonsense_Mutation_p.R128*|ENTPD4_uc011kzw.1_Nonsense_Mutation_p.R94*	NM_004901	NP_004892	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	128	Lumenal (Potential).				UDP catabolic process	autophagic vacuole membrane|cytoplasmic vesicle|integral to Golgi membrane	uridine-diphosphatase activity			ovary(1)|kidney(1)	2		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)														---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	28999695	28999695	+	Silent	SNP	T	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28999695T>C	uc003xhh.3	-	19	2372	c.2313A>G	c.(2311-2313)AAA>AAG	p.K771K		NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	771	Potential.				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
AP3M2	10947	broad.mit.edu	37	8	42012282	42012282	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42012282G>A	uc003xop.2	+	3	368	c.77G>A	c.(76-78)CGT>CAT	p.R26H	AP3M2_uc003xoo.2_Missense_Mutation_p.R26H|AP3M2_uc010lxe.2_RNA|AP3M2_uc003xoq.1_5'UTR|AP3M2_uc003xor.1_Missense_Mutation_p.R26H	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	26					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)															---	---	---	---
TOP1MT	116447	broad.mit.edu	37	8	144400005	144400005	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144400005C>T	uc003yxz.2	-	10	1237	c.1218G>A	c.(1216-1218)ACG>ACA	p.T406T	TOP1MT_uc011lkd.1_Silent_p.T308T|TOP1MT_uc011lke.1_Silent_p.T308T|TOP1MT_uc010mfb.2_Silent_p.T308T|TOP1MT_uc011lkf.1_Silent_p.T201T	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor	406					DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)													---	---	---	---
AK3	50808	broad.mit.edu	37	9	4712977	4712977	+	Nonstop_Mutation	SNP	C	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4712977C>G	uc003ziq.1	-	5	823	c.683G>C	c.(682-684)TGA>TCA	p.*228S	AK3_uc003zip.1_RNA|AK3_uc011lma.1_Nonstop_Mutation_p.*188S|AK3_uc003zir.1_Nonstop_Mutation_p.*158S	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3	228					blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
CER1	9350	broad.mit.edu	37	9	14720137	14720137	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14720137A>G	uc003zlj.2	-	2	800	c.755T>C	c.(754-756)ATC>ACC	p.I252T		NM_005454	NP_005445	O95813	CER1_HUMAN	cerberus 1 precursor	252					BMP signaling pathway	extracellular space	cytokine activity				0				GBM - Glioblastoma multiforme(50;3.16e-06)														---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	118950313	118950313	+	Silent	SNP	G	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118950313G>C	uc004bjn.2	+	2	1677	c.1296G>C	c.(1294-1296)CTG>CTC	p.L432L	PAPPA_uc011lxp.1_Silent_p.L225L|PAPPA_uc011lxq.1_Silent_p.L225L	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	432	Metalloprotease.				cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
SPTAN1	6709	broad.mit.edu	37	9	131339474	131339474	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131339474C>T	uc004bvl.3	+	7	965	c.852C>T	c.(850-852)GGC>GGT	p.G284G	SPTAN1_uc011mbg.1_Silent_p.G284G|SPTAN1_uc011mbh.1_Silent_p.G296G|SPTAN1_uc004bvm.3_Silent_p.G284G|SPTAN1_uc004bvn.3_Silent_p.G284G	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	284	Spectrin 4.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10																		---	---	---	---
GPSM1	26086	broad.mit.edu	37	9	139250955	139250955	+	Missense_Mutation	SNP	C	A	A	rs112449667		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139250955C>A	uc004chd.2	+	13	1994	c.1774C>A	c.(1774-1776)CCC>ACC	p.P592T	GPSM1_uc011mdu.1_Missense_Mutation_p.P83T|GPSM1_uc004che.2_Missense_Mutation_p.P83T	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.	592					cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)														---	---	---	---
FAS	355	broad.mit.edu	37	10	90774152	90774152	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90774152T>A	uc001kfr.2	+	9	1299	c.953T>A	c.(952-954)ATT>AAT	p.I318N	FAS_uc010qna.1_RNA|FAS_uc001kfs.2_3'UTR|FAS_uc001kft.2_Missense_Mutation_p.I297N|FAS_uc010qnb.1_RNA|FAS_uc010qnc.1_RNA|FAS_uc001kfw.2_3'UTR|FAS_uc010qnd.1_RNA|FAS_uc010qne.1_RNA|FAS_uc009xtp.2_RNA	NM_000043	NP_000034	P25445	TNR6_HUMAN	tumor necrosis factor receptor superfamily,	318	Cytoplasmic (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)										Autoimmune_Lymphoproliferative_syndrome_type_I				---	---	---	---
NDUFV1	4723	broad.mit.edu	37	11	67377114	67377114	+	Intron	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67377114G>T	uc001omj.2	+						NDUFV1_uc010rpv.1_Intron|NDUFV1_uc001oml.2_Intron|NDUFV1_uc001omk.3_Intron|NDUFV1_uc009yrz.1_Intron|NDUFV1_uc010rpw.1_5'Flank	NM_007103	NP_009034			NADH dehydrogenase ubiquinone flavoprotein 1						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)													---	---	---	---
KCNA5	3741	broad.mit.edu	37	12	5154556	5154556	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5154556C>T	uc001qni.2	+	1	1472	c.1243C>T	c.(1243-1245)CGC>TGC	p.R415C		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	415	Helical; Voltage-sensor; Name=Segment S4; (Potential).					Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4																		---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40740652	40740652	+	Silent	SNP	T	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40740652T>G	uc001rmg.3	+	42	6328	c.6207T>G	c.(6205-6207)ACT>ACG	p.T2069T	LRRK2_uc009zjw.2_Silent_p.T907T|LRRK2_uc001rmi.2_Silent_p.T902T	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2069	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
NEDD1	121441	broad.mit.edu	37	12	97345236	97345236	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97345236A>T	uc001teu.3	+	15	2177	c.1838A>T	c.(1837-1839)AAT>ATT	p.N613I	NEDD1_uc001tev.3_Missense_Mutation_p.N613I|NEDD1_uc010svc.1_Missense_Mutation_p.N524I|NEDD1_uc001tew.2_Missense_Mutation_p.N620I|NEDD1_uc001tex.2_Missense_Mutation_p.N524I	NM_152905	NP_690869	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally	613					cell division|G2/M transition of mitotic cell cycle|mitosis	cytosol					0																		---	---	---	---
SLC5A8	160728	broad.mit.edu	37	12	101603454	101603454	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101603454G>A	uc001thz.3	-	1	563	c.173C>T	c.(172-174)GCG>GTG	p.A58V		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	58	Helical; (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0																		---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119954427	119954427	+	Splice_Site	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119954427G>T	uc001txe.2	+	8	1349	c.884_splice	c.e8-1	p.N295_splice	uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126137113	126137113	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126137113C>T	uc001uhe.1	+	8	2034	c.2026C>T	c.(2026-2028)CGA>TGA	p.R676*	TMEM132B_uc001uhf.1_Nonsense_Mutation_p.R188*	NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	676	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
ANKRD10	55608	broad.mit.edu	37	13	111532325	111532325	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111532325C>G	uc001vrn.2	-	6	1057	c.922G>C	c.(922-924)GGA>CGA	p.G308R	ANKRD10_uc001vrm.2_Missense_Mutation_p.G45R|ANKRD10_uc001vrl.2_RNA	NM_017664	NP_060134	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	308										central_nervous_system(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)															---	---	---	---
OR4K17	390436	broad.mit.edu	37	14	20586246	20586246	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20586246G>A	uc001vwo.1	+	1	681	c.681G>A	c.(679-681)CAG>CAA	p.Q227Q		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)														---	---	---	---
BRMS1L	84312	broad.mit.edu	37	14	36302313	36302313	+	Splice_Site	SNP	T	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36302313T>C	uc001wtl.2	+	3	487	c.361_splice	c.e3+2	p.G121_splice	BRMS1L_uc010tpx.1_Splice_Site_p.G73_splice	NM_032352	NP_115728			breast cancer metastasis-suppressor 1-like						regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				skin(1)	1	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)														---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28096604	28096604	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28096604G>C	uc001zbh.3	-	22	2372	c.2262C>G	c.(2260-2262)AAC>AAG	p.N754K	OCA2_uc010ayv.2_Missense_Mutation_p.N730K	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	754	Cytoplasmic (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
DUOX2	50506	broad.mit.edu	37	15	45388106	45388106	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45388106G>A	uc010bea.2	-	30	4203	c.4000C>T	c.(4000-4002)CGG>TGG	p.R1334W	DUOX2_uc001zun.2_Missense_Mutation_p.R1334W	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1334	Cytoplasmic (Potential).|FAD-binding FR-type.				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)														---	---	---	---
PML	5371	broad.mit.edu	37	15	74336765	74336765	+	Silent	SNP	C	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74336765C>A	uc002awv.2	+	9	2205	c.2065C>A	c.(2065-2067)CGG>AGG	p.R689R	PML_uc002awu.2_Silent_p.R641R|PML_uc010ule.1_Silent_p.R250R	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	689					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5								T	RARA|PAX5	APL|ALL								---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84442350	84442350	+	Silent	SNP	C	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84442350C>A	uc002bjz.3	+	4	489	c.265C>A	c.(265-267)CGG>AGG	p.R89R	ADAMTSL3_uc002bjy.1_Silent_p.R89R|ADAMTSL3_uc010bmt.1_Silent_p.R89R|ADAMTSL3_uc010bmu.1_Silent_p.R89R	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	89	TSP type-1 1.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
TPSD1	23430	broad.mit.edu	37	16	1306825	1306825	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1306825G>C	uc002clb.1	+	3	291	c.282G>C	c.(280-282)AGG>AGC	p.R94S	TPSD1_uc010brm.1_Silent_p.P23P	NM_012217	NP_036349	Q9BZJ3	TRYD_HUMAN	tryptase delta 1 precursor	94	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)																---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61687977	61687977	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61687977C>T	uc002eog.1	-	12	2187	c.1935G>A	c.(1933-1935)CGG>CGA	p.R645R		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	645	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
CDH1	999	broad.mit.edu	37	16	68842728	68842728	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68842728A>G	uc002ewg.1	+	5	788	c.664A>G	c.(664-666)AGA>GGA	p.R222G	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.R222G	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	222	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
CDH1	999	broad.mit.edu	37	16	68856129	68856129	+	Splice_Site	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68856129G>T	uc002ewg.1	+	12	2060	c.1936_splice	c.e12+1	p.T646_splice	CDH1_uc010vlj.1_Splice_Site|CDH1_uc010cfg.1_Splice_Site_p.T585_splice	NM_004360	NP_004351			cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)				Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				---	---	---	---
ADAMTS18	170692	broad.mit.edu	37	16	77393318	77393318	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77393318A>C	uc002ffc.3	-	8	1638	c.1219T>G	c.(1219-1221)TTT>GTT	p.F407V	ADAMTS18_uc010chc.1_5'UTR|ADAMTS18_uc002ffe.1_Missense_Mutation_p.F103V|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	407	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18																		---	---	---	---
IMP5	162540	broad.mit.edu	37	17	43923421	43923421	+	Silent	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43923421G>T	uc010wka.1	+	1	1149	c.1149G>T	c.(1147-1149)CTG>CTT	p.L383L	LOC100128977_uc010wjz.1_Intron	NM_175882	NP_787078	Q8IUH8	IMP5_HUMAN	intramembrane protease 5 precursor	383	Helical; (Potential).					integral to membrane	aspartic-type endopeptidase activity			pancreas(2)	2	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.148)														---	---	---	---
TRIM25	7706	broad.mit.edu	37	17	54981760	54981760	+	Silent	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54981760C>T	uc002iut.2	-	3	843	c.783G>A	c.(781-783)AGG>AGA	p.R261R	TRIM25_uc010dcj.2_Silent_p.R53R	NM_005082	NP_005073	Q14258	TRI25_HUMAN	tripartite motif-containing 25	261	Interaction with influenza A virus NS1.|Potential.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|response to virus	cell junction|cytosol|nucleus	sequence-specific DNA binding transcription factor activity|ubiquitin-protein ligase activity|zinc ion binding			lung(1)|breast(1)|skin(1)	3	Breast(9;6.15e-08)																	---	---	---	---
KCNH6	81033	broad.mit.edu	37	17	61611421	61611421	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61611421G>A	uc002jay.2	+	5	930	c.850G>A	c.(850-852)GAT>AAT	p.D284N	KCNH6_uc002jax.1_Missense_Mutation_p.D284N|KCNH6_uc010wpl.1_Missense_Mutation_p.D161N|KCNH6_uc010wpm.1_Missense_Mutation_p.D284N|KCNH6_uc002jaz.1_Missense_Mutation_p.D284N	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	284	Extracellular (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)													---	---	---	---
SMAD4	4089	broad.mit.edu	37	18	48591918	48591918	+	Missense_Mutation	SNP	C	T	T	rs80338963		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48591918C>T	uc010xdp.1	+	9	1619	c.1081C>T	c.(1081-1083)CGC>TGC	p.R361C	SMAD4_uc002lfb.3_Missense_Mutation_p.R206C	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	361	MH2.		R -> H (in a colorectal cancer sample; somatic mutation).|R -> C (in JPS).		BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.R361C(6)|p.R361H(3)|p.?(2)|p.R361S(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)										Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9048771	9048771	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048771A>G	uc002mkp.2	-	5	33064	c.32860T>C	c.(32860-32862)TTT>CTT	p.F10954L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10956	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9089753	9089753	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9089753A>G	uc002mkp.2	-	1	2266	c.2062T>C	c.(2062-2064)TCA>CCA	p.S688P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	688	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ADCK4	79934	broad.mit.edu	37	19	41201882	41201882	+	Intron	SNP	G	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41201882G>T	uc002oor.2	-						ADCK4_uc002oop.1_Intron|ADCK4_uc002ooq.1_Intron	NM_024876	NP_079152			aarF domain containing kinase 4 isoform a							integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)															---	---	---	---
NAPSA	9476	broad.mit.edu	37	19	50864332	50864332	+	Silent	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50864332G>A	uc002prx.2	-	5	587	c.534C>T	c.(532-534)TTC>TTT	p.F178F	NR1H2_uc002prv.3_Intron	NM_004851	NP_004842	O96009	NAPSA_HUMAN	napsin A preproprotein	178					proteolysis	extracellular region	aspartic-type endopeptidase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)														---	---	---	---
MYBPC2	4606	broad.mit.edu	37	19	50967665	50967665	+	Silent	SNP	C	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50967665C>A	uc002psf.2	+	27	3342	c.3291C>A	c.(3289-3291)ACC>ACA	p.T1097T		NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	1097	Ig-like C2-type 7.				cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)														---	---	---	---
LILRA4	23547	broad.mit.edu	37	19	54848675	54848675	+	Silent	SNP	G	A	A	rs142322002	byFrequency	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54848675G>A	uc002qfj.2	-	5	1005	c.948C>T	c.(946-948)ATC>ATT	p.I316I	LILRA4_uc002qfi.2_Silent_p.I250I	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	316	Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)														---	---	---	---
USP29	57663	broad.mit.edu	37	19	57641825	57641825	+	Silent	SNP	C	T	T	rs35663514		TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57641825C>T	uc002qny.2	+	4	2138	c.1782C>T	c.(1780-1782)CCC>CCT	p.P594P		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	594					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
FAM65C	140876	broad.mit.edu	37	20	49224917	49224917	+	Intron	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49224917G>A	uc002xvm.2	-						FAM65C_uc010zyt.1_Intron|FAM65C_uc010zyu.1_Intron|FAM65C_uc002xvn.1_Intron	NM_080829	NP_543019			hypothetical protein LOC140876											ovary(2)	2																		---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62196078	62196078	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62196078C>T	uc002yfm.2	-	9	4989	c.4097G>A	c.(4096-4098)TGC>TAC	p.C1366Y	PRIC285_uc002yfl.1_Missense_Mutation_p.C797Y	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	1366					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
CDC45	8318	broad.mit.edu	37	22	19492984	19492984	+	Silent	SNP	A	G	G			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19492984A>G	uc002zpr.2	+	10	880	c.804A>G	c.(802-804)ACA>ACG	p.T268T	CDC45_uc011agz.1_Silent_p.T263T|CDC45_uc011aha.1_Silent_p.T300T|CDC45_uc002zps.2_Silent_p.T268T|CDC45_uc002zpt.2_Silent_p.T222T	NM_003504	NP_003495	O75419	CDC45_HUMAN	CDC45-like	268					DNA replication checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	centrosome|nucleoplasm	protein binding			lung(1)	1																		---	---	---	---
CRELD2	79174	broad.mit.edu	37	22	50316016	50316016	+	Intron	SNP	G	A	A			TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50316016G>A	uc003bja.2	+						CRELD2_uc003biz.3_Intron|CRELD2_uc010haj.2_Intron|CRELD2_uc010hal.2_Missense_Mutation_p.A222T|CRELD2_uc010hak.2_Intron|CRELD2_uc010ham.2_Intron	NM_024324	NP_077300			cysteine-rich with EGF-like domains 2 isoform b							endoplasmic reticulum|extracellular region	calcium ion binding				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
L1CAM	3897	broad.mit.edu	37	X	153129907	153129907	+	Silent	SNP	C	T	T	rs142563956	byFrequency	TCGA-BR-4279-01	TCGA-BR-4279-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153129907C>T	uc004fjb.2	-	24	3300	c.3192G>A	c.(3190-3192)TCG>TCA	p.S1064S	L1CAM_uc004fjc.2_Silent_p.S1064S|L1CAM_uc010nuo.2_Silent_p.S1059S	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	1064	Fibronectin type-III 5.|Extracellular (Potential).				axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
