Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
KDM4A	9682	broad.mit.edu	37	1	44160187	44160187	+	Intron	DEL	A	-	-	rs71897447		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44160187delA	uc001cjx.2	+						KDM4A_uc010oki.1_Intron	NM_014663	NP_055478			jumonji domain containing 2A						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
PRKAA2	5563	broad.mit.edu	37	1	57159326	57159326	+	Intron	DEL	A	-	-	rs72195100		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57159326delA	uc001cyk.3	+							NM_006252	NP_006243			AMP-activated protein kinase alpha 2 catalytic						carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6																		---	---	---	---
CELF3	11189	broad.mit.edu	37	1	151677297	151677298	+	Intron	DEL	GA	-	-	rs35738969	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151677297_151677298delGA	uc001eys.1	-						CELF3_uc010pdh.1_Intron|CELF3_uc001eyr.2_Intron|CELF3_uc009wmy.2_Intron|CELF3_uc009wmx.1_Intron	NM_007185	NP_009116			trinucleotide repeat containing 4						nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154728670	154728671	+	Intron	INS	-	GGA	GGA	rs138746046	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154728670_154728671insGGA	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
DNAJC27	51277	broad.mit.edu	37	2	25180474	25180475	+	Intron	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180474_25180475insA	uc002rft.1	-						DNAJC27_uc010ykn.1_Intron|DNAJC27_uc002rfu.1_Intron|DNAJC27_uc010eyg.1_Intron	NM_016544	NP_057628			DnaJ (Hsp40) homolog, subfamily C, member 27						protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1																		---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63666808	63666808	+	Intron	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63666808delA	uc002sch.2	-						C2orf86_uc002scf.2_5'Flank|C2orf86_uc010ypu.1_5'Flank|C2orf86_uc002scg.2_Intron|C2orf86_uc002sci.1_Intron|C2orf86_uc010fcr.1_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225664783	225664785	+	Intron	DEL	AAA	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225664783_225664785delAAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4715262	4715273	+	Intron	DEL	TTTGTTTGTTTG	-	-	rs112871347		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4715262_4715273delTTTGTTTGTTTG	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
ZNF589	51385	broad.mit.edu	37	3	48292886	48292887	+	Intron	INS	-	A	A	rs79635755		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48292886_48292887insA	uc003csl.3	+						ZNF589_uc010hjt.1_Intron|ZNF589_uc003csn.2_Intron|ZNF589_uc011bbg.1_Intron|ZNF589_uc003csm.2_Intron	NM_016089	NP_057173			zinc finger protein 589						regulation of transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
VPRBP	9730	broad.mit.edu	37	3	51471278	51471279	+	Intron	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51471278_51471279insA	uc003dbe.1	-							NM_014703	NP_055518			HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)														---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52950373	52950374	+	Intron	DEL	TT	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52950373_52950374delTT	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159			Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
C3orf63	23272	broad.mit.edu	37	3	56661910	56661912	+	Intron	DEL	AAT	-	-	rs145293853		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56661910_56661912delAAT	uc003did.3	-						C3orf63_uc003dib.3_Intron|C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039			retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96706095	96706096	+	Intron	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706095_96706096insA	uc010how.1	+						EPHA6_uc003drp.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125466896	125466896	+	IGR	DEL	A	-	-	rs111791733		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125466896delA								OSBPL11 (152515 upstream) : MIR548I1 (42351 downstream)																																			---	---	---	---
TBL1XR1	79718	broad.mit.edu	37	3	176767668	176767671	+	Intron	DEL	TTAC	-	-	rs35503291		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176767668_176767671delTTAC	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941			transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)															---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6172202	6172204	+	Intron	DEL	CCC	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6172202_6172204delCCC	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321			janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
UBA6	55236	broad.mit.edu	37	4	68547445	68547445	+	Intron	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68547445delA	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697			ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0																		---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77439725	77439728	+	Intron	DEL	TGCT	-	-	rs71659329		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77439725_77439728delTGCT	uc011cbx.1	+							NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
IRX4	50805	broad.mit.edu	37	5	1879109	1879110	+	Intron	INS	-	T	T	rs71767063		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1879109_1879110insT	uc003jcz.2	-						IRX4_uc011cmf.1_Intron	NM_016358	NP_057442			iroquois homeobox 4						heart development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(108;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	6422674	6422678	+	IGR	DEL	GGAAG	-	-	rs70965994		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6422674_6422678delGGAAG								MED10 (44035 upstream) : UBE2QL1 (26058 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11237134	11237135	+	Intron	INS	-	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11237134_11237135insT	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	50571606	50571607	+	IGR	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50571606_50571607insA								PARP8 (433437 upstream) : ISL1 (107351 downstream)																																			---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127680393	127680393	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127680393delT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990			fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
SLC23A1	9963	broad.mit.edu	37	5	138719137	138719138	+	5'Flank	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138719137_138719138insA	uc003leh.2	-						SLC23A1_uc003leg.2_5'Flank	NM_005847	NP_005838			solute carrier family 23 (nucleobase						brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)													---	---	---	---
HMHB1	57824	broad.mit.edu	37	5	143200035	143200035	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143200035delT	uc003lnj.2	+							NM_021182	NP_067005			minor histocompatibility antigen HB-1												0		Acute lymphoblastic leukemia(2;0.0236)|all_hematologic(2;0.041)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)															---	---	---	---
TCERG1	10915	broad.mit.edu	37	5	145850069	145850070	+	Intron	INS	-	TAT	TAT	rs149948888	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145850069_145850070insTAT	uc003lob.2	+						TCERG1_uc003loc.2_Intron|TCERG1_uc011dbt.1_Intron	NM_006706	NP_006697			transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SPINK5	11005	broad.mit.edu	37	5	147445109	147445110	+	Intron	DEL	CA	-	-	rs3036741		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147445109_147445110delCA	uc003lox.2	+						SPINK5_uc010jgq.1_Intron|SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837			serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
IRF4	3662	broad.mit.edu	37	6	396779	396795	+	Intron	DEL	CTCCTGCACTCCTTTAA	-	-	rs113172745		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:396779_396795delCTCCTGCACTCCTTTAA	uc003msz.3	+						IRF4_uc010jne.1_Intron|IRF4_uc003mta.3_Intron|IRF4_uc003mtb.3_Intron|IRF4_uc003mtc.1_5'Flank	NM_002460	NP_002451			interferon regulatory factor 4						interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)				T	IGH@	MM 								---	---	---	---
BTN2A1	11120	broad.mit.edu	37	6	26460170	26460171	+	Intron	INS	-	CACAGGGAGATTCCACAGGGA	CACAGGGAGATTCCACAGGGA	rs142117310	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26460170_26460171insCACAGGGAGATTCCACAGGGA	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron	NM_007049	NP_008980			butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2																		---	---	---	---
SLC35B2	347734	broad.mit.edu	37	6	44224749	44224750	+	Intron	INS	-	CT	CT	rs141759671	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44224749_44224750insCT	uc003oxd.2	-						SLC35B2_uc011dvt.1_Intron|SLC35B2_uc011dvu.1_Intron	NM_178148	NP_835361			solute carrier family 35, member B2						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
CD2AP	23607	broad.mit.edu	37	6	47567025	47567027	+	Intron	DEL	TTC	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47567025_47567027delTTC	uc003oyw.2	+							NM_012120	NP_036252			CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)															---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	70990435	70990436	+	Intron	INS	-	C	C	rs149151375	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70990435_70990436insC	uc003pfg.3	-						COL9A1_uc003pfe.3_5'Flank|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842			alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4																		---	---	---	---
STK31	56164	broad.mit.edu	37	7	23940354	23940355	+	Intron	INS	-	CCTT	CCTT	rs72083241		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23940354_23940355insCCTT	uc003swv.1	+											SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
NPC1L1	29881	broad.mit.edu	37	7	44558601	44558602	+	Intron	DEL	TC	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44558601_44558602delTC	uc003tlb.2	-						NPC1L1_uc003tlc.2_Intron|NPC1L1_uc011kbw.1_Intron|NPC1L1_uc003tla.2_Intron	NM_013389	NP_037521			Niemann-Pick C1-like protein 1 isoform 1						cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	143816457	143816457	+	IGR	DEL	T	-	-	rs67586979		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143816457delT								OR2A2 (8827 upstream) : OR2A14 (9749 downstream)																																			---	---	---	---
KCNH2	3757	broad.mit.edu	37	7	150649386	150649387	+	Intron	INS	-	TCTTTCTC	TCTTTCTC	rs142675575	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150649386_150649387insTCTTTCTC	uc003wic.2	-						KCNH2_uc003wib.2_Intron|KCNH2_uc011kux.1_Intron|KCNH2_uc003wid.2_Intron|KCNH2_uc003wie.2_Intron	NM_000238	NP_000229			voltage-gated potassium channel, subfamily H,						blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)													---	---	---	---
SH2D4A	63898	broad.mit.edu	37	8	19218625	19218626	+	Intron	INS	-	T	T	rs72575532		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19218625_19218626insT	uc003wzb.2	+						SH2D4A_uc011kym.1_Intron|SH2D4A_uc003wzc.2_Intron	NM_022071	NP_071354			SH2 domain containing 4A							cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)														---	---	---	---
WRN	7486	broad.mit.edu	37	8	30978058	30978058	+	Intron	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30978058delA	uc003xio.3	+						WRN_uc010lvk.2_Intron	NM_000553	NP_000544			Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)				Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	75334729	75334744	+	IGR	DEL	TCCTTCCTTCCTTCCT	-	-	rs67444628		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75334729_75334744delTCCTTCCTTCCTTCCT								GDAP1 (55396 upstream) : MIR2052 (283184 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8436535	8436535	+	Intron	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8436535delA	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
FANCC	2176	broad.mit.edu	37	9	98009494	98009495	+	Intron	INS	-	GT	GT	rs71498956		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98009494_98009495insGT	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127			Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)						D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
PALM2-AKAP2	445815	broad.mit.edu	37	9	112787105	112787106	+	Intron	INS	-	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112787105_112787106insT	uc004bei.2	+						PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron	NM_001136562	NP_001130034			A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6																		---	---	---	---
NR6A1	2649	broad.mit.edu	37	9	127288844	127288844	+	Intron	DEL	A	-	-	rs111378093		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127288844delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591			nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
NCS1	23413	broad.mit.edu	37	9	132985258	132985259	+	Intron	DEL	GC	-	-	rs145828712	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985258_132985259delGC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101			frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0																		---	---	---	---
EXD3	54932	broad.mit.edu	37	9	140249972	140249973	+	Intron	INS	-	G	G	rs150608455		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140249972_140249973insG	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron|EXD3_uc004cmq.1_Intron|EXD3_uc010ncg.1_Intron	NM_017820	NP_060290			exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0																		---	---	---	---
FBXO18	84893	broad.mit.edu	37	10	5945295	5945295	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5945295delT	uc001iis.2	+						FBXO18_uc001iir.2_Intron|FBXO18_uc009xig.2_Intron|FBXO18_uc001iit.2_Intron	NM_178150	NP_835363			F-box only protein, helicase, 18 isoform 2						DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	21741095	21741095	+	IGR	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21741095delA								NEBL (277979 upstream) : C10orf114 (42327 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24810992	24810992	+	Intron	DEL	C	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24810992delC	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Intron|KIAA1217_uc001irz.2_Intron|KIAA1217_uc001irx.2_Intron|KIAA1217_uc001iry.2_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53387639	53387639	+	Intron	DEL	C	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53387639delC	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)																	---	---	---	---
CYP26C1	340665	broad.mit.edu	37	10	94826082	94826088	+	Intron	DEL	CCTGCCG	-	-	rs61863115	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94826082_94826088delCCTGCCG	uc010qns.1	+						CYP26C1_uc009xud.2_Intron	NM_183374	NP_899230			cytochrome P450, family 26, subfamily C,						anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)																---	---	---	---
PI4K2A	55361	broad.mit.edu	37	10	99402609	99402622	+	Intron	DEL	TTTCTTTCTTTCTT	-	-	rs72182783		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99402609_99402622delTTTCTTTCTTTCTT	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron	NM_018425	NP_060895			phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	99823423	99823430	+	IGR	DEL	TCTTTCTT	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99823423_99823430delTCTTTCTT								CRTAC1 (32838 upstream) : C10orf28 (70951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	107463324	107463325	+	IGR	INS	-	GAAGGGAG	GAAGGGAG	rs151336493	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107463324_107463325insGAAGGGAG								SORCS3 (438331 upstream) : SORCS1 (870097 downstream)																																			---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22025423	22025423	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22025423delT	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682			ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66957859	66957860	+	Intron	INS	-	TT	TT	rs146009716	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66957859_66957860insTT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
MRPL42	28977	broad.mit.edu	37	12	93873153	93873154	+	Intron	INS	-	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93873153_93873154insT	uc001tcr.2	+						MRPL42_uc001tcq.2_Intron|MRPL42_uc001tcs.2_Intron|MRPL42_uc001tct.2_Intron	NM_172177	NP_751917			mitochondrial ribosomal protein L42 isoform a						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2																		---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123028597	123028598	+	Intron	INS	-	A	A	rs34718872		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123028597_123028598insA	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523			Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
GTF3A	2971	broad.mit.edu	37	13	27998075	27998076	+	5'Flank	DEL	TT	-	-	rs35458689		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27998075_27998076delTT	uc001ure.2	+						GTF3A_uc001urf.2_5'Flank|GTF3A_uc001urg.2_5'Flank	NM_002097	NP_002088			transcription factor IIIA						regulation of transcription, DNA-dependent|rRNA transcription|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding|RNA binding|zinc ion binding				0		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.11)|OV - Ovarian serous cystadenocarcinoma(117;0.158)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79423336	79423340	+	IGR	DEL	TTTTT	-	-	rs71203096		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79423336_79423340delTTTTT								RNF219 (188636 upstream) : RBM26 (470760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	21366464	21366466	+	IGR	DEL	ATG	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21366464_21366466delATG								NF1P1 (231839 upstream) : LOC646214 (566048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	45123755	45123756	+	IGR	INS	-	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45123755_45123756insC								TRIM69 (63730 upstream) : C15orf43 (125147 downstream)																																			---	---	---	---
AAGAB	79719	broad.mit.edu	37	15	67494984	67494985	+	3'UTR	INS	-	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67494984_67494985insA	uc002aqk.3	-	10					AAGAB_uc002aql.2_3'UTR|AAGAB_uc010uju.1_3'UTR	NM_024666	NP_078942			alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0																		---	---	---	---
RSL1D1	26156	broad.mit.edu	37	16	11933384	11933385	+	Intron	DEL	AA	-	-	rs72237705		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11933384_11933385delAA	uc002dbp.1	-						RSL1D1_uc010buv.1_Intron|RSL1D1_uc010uyw.1_Intron	NM_015659	NP_056474			ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0																		---	---	---	---
IL4R	3566	broad.mit.edu	37	16	27367406	27367406	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367406delT	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409			interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2																		---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69059675	69059675	+	Intron	DEL	T	-	-	rs112403015		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059675delT	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70708094	70708111	+	Intron	DEL	AGTCTCAACAGCTATAGT	-	-	rs67662127		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70708094_70708111delAGTCTCAACAGCTATAGT	uc002ezj.2	-							NM_138383	NP_612392			metastasis suppressor 1-like						filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	74419892	74419892	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74419892delT	uc010vmt.1	+											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	17286669	17286669	+	IGR	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17286669delA								NT5M (35694 upstream) : MED9 (93631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	18988444	18988444	+	IGR	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988444delA								GRAP (38108 upstream) : GRAPL (42338 downstream)																																			---	---	---	---
HOXB7	3217	broad.mit.edu	37	17	46685076	46685077	+	3'UTR	INS	-	T	T	rs140410823	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46685076_46685077insT	uc002inv.2	-	2					HOXB6_uc002ins.1_5'Flank|HOXB6_uc010dbh.1_5'Flank	NM_004502	NP_004493			homeobox B7							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54534405	54534405	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54534405delT	uc002iun.1	+							NM_153228	NP_694960			ankyrin-repeat and fibronectin type III domain											large_intestine(1)|ovary(1)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61417821	61417822	+	Intron	INS	-	G	G	rs149241724	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61417821_61417822insG	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78674336	78674341	+	Intron	DEL	TGATGA	-	-	rs147716922	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674336_78674341delTGATGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3741106	3741106	+	Intron	DEL	C	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3741106delC	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
NRTN	4902	broad.mit.edu	37	19	5824421	5824422	+	Intron	DEL	GT	-	-	rs141994814		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5824421_5824422delGT	uc002mde.2	+							NM_004558	NP_004549			neurturin preproprotein						axon guidance|MAPKKK cascade|neural crest cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region	growth factor activity				0																		---	---	---	---
SLC25A41	284427	broad.mit.edu	37	19	6432329	6432330	+	Intron	INS	-	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6432329_6432330insT	uc010dus.2	-						SLC25A41_uc010dut.2_Intron	NM_173637	NP_775908			solute carrier family 25, member 41						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0																		---	---	---	---
PDE4A	5141	broad.mit.edu	37	19	10544889	10544890	+	Intron	INS	-	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10544889_10544890insT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777			phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)													---	---	---	---
ELOF1	84337	broad.mit.edu	37	19	11664398	11664403	+	3'UTR	DEL	ACACAC	-	-	rs66953353		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11664398_11664403delACACAC	uc002mse.1	-	4					ELOF1_uc002msd.1_3'UTR	NM_032377	NP_115753			elongation factor 1 homolog (ELF1, S.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding				0																		---	---	---	---
JAG1	182	broad.mit.edu	37	20	10620700	10620700	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10620700delT	uc002wnw.2	-							NM_000214	NP_000205			jagged 1 precursor						angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9														Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	20	37268788	37268789	+	IGR	INS	-	TCTTCC	TCTTCC	rs11475716		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37268788_37268789insTCTTCC								ADIG (51684 upstream) : SLC32A1 (84316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39340502	39340502	+	IGR	DEL	C	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39340502delC								MAFB (22626 upstream) : TOP1 (316960 downstream)																																			---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45220862	45220863	+	Intron	INS	-	CATA	CATA	rs142792823	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45220862_45220863insCATA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	9865569	9865570	+	IGR	INS	-	A	A	rs77497487	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9865569_9865570insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24474307	24474308	+	IGR	DEL	AA	-	-	rs72441902		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24474307_24474308delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
AGPAT3	56894	broad.mit.edu	37	21	45351804	45351805	+	Intron	DEL	GT	-	-	rs140261142		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45351804_45351805delGT	uc002zdv.2	+						AGPAT3_uc002zdw.2_Intron	NM_020132	NP_064517			1-acylglycerol-3-phosphate O-acyltransferase 3						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)														---	---	---	---
KRTAP10-9	386676	broad.mit.edu	37	21	46048132	46048132	+	3'UTR	DEL	C	-	-	rs67739305		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46048132delC	uc002zfp.3	+	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198690	NP_941963			keratin associated protein 10-9							keratin filament					0																		---	---	---	---
PVALB	5816	broad.mit.edu	37	22	37212087	37212088	+	Intron	DEL	TT	-	-	rs111360103		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37212087_37212088delTT	uc010gwz.2	-						PVALB_uc003apx.2_Intron	NM_002854	NP_002845			parvalbumin								calcium ion binding			skin(1)	1																		---	---	---	---
TTLL1	25809	broad.mit.edu	37	22	43465398	43465398	+	Intron	DEL	A	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43465398delA	uc003bdi.2	-						TTLL1_uc010gzh.2_Intron|TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395			tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)														---	---	---	---
CRLF2	64109	broad.mit.edu	37	X	1331309	1331310	+	Intron	INS	-	AG	AG			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1331309_1331310insAG	uc004cpm.1	-											Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)						Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								---	---	---	---
TAF1	6872	broad.mit.edu	37	X	70643256	70643256	+	Intron	DEL	T	-	-			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70643256delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron|TAF1_uc004dzw.1_Intron	NM_138923	NP_620278			TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7725165	7725165	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7725165C>T	uc001aoi.2	+	9	2765	c.2558C>T	c.(2557-2559)TCG>TTG	p.S853L		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	853					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
ZNF643	65243	broad.mit.edu	37	1	40928715	40928715	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40928715T>A	uc001cfn.1	+	5	1356	c.1059T>A	c.(1057-1059)CAT>CAA	p.H353Q	ZNF643_uc001cfl.1_Missense_Mutation_p.H251Q|ZNF643_uc001cfm.1_Missense_Mutation_p.H219Q	NM_023070	NP_075558	Q9UJL9	ZN643_HUMAN	zinc finger protein 643	353	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.25e-18)															---	---	---	---
C1orf168	199920	broad.mit.edu	37	1	57258418	57258418	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57258418G>C	uc001cym.3	-	2	474	c.68C>G	c.(67-69)CCT>CGT	p.P23R	C1orf168_uc009vzu.1_RNA|C1orf168_uc009vzv.1_Missense_Mutation_p.P23R	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	23										ovary(3)|skin(2)	5																		---	---	---	---
WDR78	79819	broad.mit.edu	37	1	67306240	67306240	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67306240G>A	uc001dcx.2	-	9	1462	c.1406C>T	c.(1405-1407)CCC>CTC	p.P469L	WDR78_uc001dcy.2_Missense_Mutation_p.P469L|WDR78_uc009waw.2_Missense_Mutation_p.P215L|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	469										ovary(2)	2																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82372880	82372880	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82372880C>T	uc001dit.3	+	4	433	c.252C>T	c.(250-252)TGC>TGT	p.C84C	LPHN2_uc001dis.2_Silent_p.C84C|LPHN2_uc001diu.2_Silent_p.C84C|LPHN2_uc001div.2_Silent_p.C84C|LPHN2_uc009wcd.2_Silent_p.C84C	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	84	Extracellular (Potential).|SUEL-type lectin.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
SLC44A3	126969	broad.mit.edu	37	1	95357932	95357932	+	Silent	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95357932T>C	uc001dqv.3	+	14	1823	c.1716T>C	c.(1714-1716)GCT>GCC	p.A572A	SLC44A3_uc001dqx.3_Silent_p.A571A|SLC44A3_uc010otq.1_Silent_p.A504A|SLC44A3_uc010otr.1_Silent_p.A536A|SLC44A3_uc001dqw.3_Silent_p.A524A|SLC44A3_uc010ots.1_Silent_p.A492A|SLC44A3_uc009wds.2_Silent_p.A475A|SLC44A3_uc010ott.1_Silent_p.A491A	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	572	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)													---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98039509	98039509	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98039509T>A	uc001drv.2	-	11	1283	c.1146A>T	c.(1144-1146)GAA>GAT	p.E382D		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	382					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
CELSR2	1952	broad.mit.edu	37	1	109806965	109806965	+	Missense_Mutation	SNP	G	A	A	rs142723500		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109806965G>A	uc001dxa.3	+	10	5328	c.5267G>A	c.(5266-5268)CGT>CAT	p.R1756H		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1756	Extracellular (Potential).|Laminin G-like 2.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)												OREG0013632	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
OVGP1	5016	broad.mit.edu	37	1	111957318	111957318	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111957318C>T	uc001eba.2	-	11	1861	c.1805G>A	c.(1804-1806)GGC>GAC	p.G602D	OVGP1_uc001eaz.2_Missense_Mutation_p.G564D|OVGP1_uc010owb.1_Missense_Mutation_p.G250D	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	602					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)														---	---	---	---
MOV10	4343	broad.mit.edu	37	1	113239107	113239107	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113239107C>T	uc001eck.2	+	13	2202	c.1932C>T	c.(1930-1932)ATC>ATT	p.I644I	MOV10_uc001ecl.2_Intron|MOV10_uc001ecn.2_Silent_p.I644I|MOV10_uc001ecm.2_Silent_p.I584I|MOV10_uc009wgj.1_3'UTR	NM_001130079	NP_001123551	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	644					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)														---	---	---	---
FMO5	2330	broad.mit.edu	37	1	146658693	146658693	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146658693A>G	uc001epi.2	-	9	1777	c.1388T>C	c.(1387-1389)TTA>TCA	p.L463S	FMO5_uc001eph.3_Intron|FMO5_uc001epj.2_3'UTR	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1	463						integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)																	---	---	---	---
CHRNB2	1141	broad.mit.edu	37	1	154542319	154542319	+	Intron	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154542319G>A	uc001ffg.2	+							NM_000748	NP_000739			neuronal nicotinic acetylcholine receptor beta 2						B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)													---	---	---	---
BCAN	63827	broad.mit.edu	37	1	156617329	156617329	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156617329G>T	uc001fpp.2	+	4	832	c.496G>T	c.(496-498)GCC>TCC	p.A166S	BCAN_uc001fpo.2_Missense_Mutation_p.A166S	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	166	Link 1.				cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158585084	158585084	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158585084C>G	uc001fst.1	-	48	6909	c.6710G>C	c.(6709-6711)GGA>GCA	p.G2237A		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2237	Spectrin 21.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
OR10J5	127385	broad.mit.edu	37	1	159505686	159505686	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159505686T>G	uc010piw.1	-	1	112	c.112A>C	c.(112-114)ACT>CCT	p.T38P		NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)																	---	---	---	---
OLFML2B	25903	broad.mit.edu	37	1	161967674	161967674	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161967674G>T	uc001gbu.2	-	6	1839	c.1415C>A	c.(1414-1416)ACA>AAA	p.T472K	OLFML2B_uc010pkq.1_Missense_Mutation_p.T473K	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	472										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)															---	---	---	---
SLC19A2	10560	broad.mit.edu	37	1	169446719	169446719	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169446719A>C	uc001gge.3	-	2	685	c.481T>G	c.(481-483)TGT>GGT	p.C161G	SLC19A2_uc001ggf.3_Intron	NM_006996	NP_008927	O60779	S19A2_HUMAN	solute carrier family 19, member 2	161	Cytoplasmic (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|folic acid transporter activity|reduced folate carrier activity|thiamine uptake transmembrane transporter activity				0	all_hematologic(923;0.208)																	---	---	---	---
FMO2	2327	broad.mit.edu	37	1	171174749	171174749	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171174749C>A	uc001ghk.1	+	7	1276	c.1159C>A	c.(1159-1161)CGT>AGT	p.R387S	FMO2_uc010pmd.1_Missense_Mutation_p.R167S	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	387					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
FMO1	2326	broad.mit.edu	37	1	171251385	171251385	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171251385C>T	uc009wvz.2	+	7	1232	c.1096C>T	c.(1096-1098)CTG>TTG	p.L366L	FMO1_uc010pme.1_Silent_p.L303L|FMO1_uc001ghl.2_Silent_p.L366L|FMO1_uc001ghm.2_Silent_p.L366L|FMO1_uc001ghn.2_Silent_p.L366L	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	366					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185959498	185959498	+	Silent	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185959498A>G	uc001grq.1	+	22	3529	c.3300A>G	c.(3298-3300)CCA>CCG	p.P1100P	HMCN1_uc001grr.1_Silent_p.P441P	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	1100	Ig-like C2-type 8.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
MARK1	4139	broad.mit.edu	37	1	220825398	220825398	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220825398C>T	uc001hmn.3	+	15	2239	c.1642C>T	c.(1642-1644)CGA>TGA	p.R548*	MARK1_uc009xdw.2_Nonsense_Mutation_p.R548*|MARK1_uc010pun.1_Nonsense_Mutation_p.R548*|MARK1_uc001hmm.3_Nonsense_Mutation_p.R526*	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	548					intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)														---	---	---	---
OR2G6	391211	broad.mit.edu	37	1	248685614	248685614	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685614C>G	uc001ien.1	+	1	667	c.667C>G	c.(667-669)CAA>GAA	p.Q223E		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
OR2T27	403239	broad.mit.edu	37	1	248813821	248813821	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248813821C>T	uc010pzo.1	-	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3200677	3200677	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3200677G>T	uc002qxj.2	-	6	821	c.628C>A	c.(628-630)CGT>AGT	p.R210S	TSSC1_uc002qxi.2_RNA	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	210	WD 2.						protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54891664	54891664	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54891664C>A	uc002rxu.2	+	33	6744	c.6495C>A	c.(6493-6495)AGC>AGA	p.S2165R	SPTBN1_uc010you.1_Missense_Mutation_p.S155R	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	2165					actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)															---	---	---	---
FER1L5	90342	broad.mit.edu	37	2	97361584	97361584	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97361584C>T	uc010fia.2	+	35	4081	c.4081C>T	c.(4081-4083)CTC>TTC	p.L1361F	FER1L5_uc002sws.3_Missense_Mutation_p.L79F|FER1L5_uc010fib.1_RNA|FER1L5_uc002swt.3_Missense_Mutation_p.L79F|FER1L5_uc010yus.1_Missense_Mutation_p.L78F	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1361						integral to membrane				ovary(1)	1																		---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	110053479	110053479	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110053479G>A	uc010ywt.1	+	7	1705	c.1705G>A	c.(1705-1707)GCC>ACC	p.A569T		NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	569							zinc ion binding			ovary(1)	1																		---	---	---	---
ZC3H6	376940	broad.mit.edu	37	2	113088706	113088706	+	Silent	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113088706C>G	uc002thq.1	+	12	2605	c.2211C>G	c.(2209-2211)CTC>CTG	p.L737L		NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6	737							nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141272221	141272221	+	Splice_Site	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141272221C>T	uc002tvj.1	-	51	9241	c.8269_splice	c.e51+1	p.G2757_splice		NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625336	141625336	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625336A>T	uc002tvj.1	-	27	5374	c.4402T>A	c.(4402-4404)TAC>AAC	p.Y1468N	LRP1B_uc010fnl.1_Missense_Mutation_p.Y650N	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1468	Extracellular (Potential).|LDL-receptor class B 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144245037	144245037	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144245037A>C	uc002tvm.3	+	9	950	c.799A>C	c.(799-801)ACT>CCT	p.T267P	ARHGAP15_uc002tvn.2_Missense_Mutation_p.T33P	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	267					regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145147197	145147197	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145147197C>A	uc002tvu.2	-	10	3946	c.3466G>T	c.(3466-3468)GGC>TGC	p.G1156C	ZEB2_uc002tvv.2_Missense_Mutation_p.G1150C|ZEB2_uc010zbm.1_Missense_Mutation_p.G1127C|ZEB2_uc010fnp.2_Intron	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	1156	Glu-rich (acidic).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166767978	166767978	+	Intron	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166767978A>G	uc002udk.2	-							NM_024753	NP_079029			tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196636411	196636411	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196636411C>T	uc002utj.3	-	61	11507	c.11406G>A	c.(11404-11406)TCG>TCA	p.S3802S	DNAH7_uc002uti.3_Silent_p.S285S	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3802					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
GTF3C3	9330	broad.mit.edu	37	2	197639881	197639881	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197639881G>C	uc002uts.2	-	13	1880	c.1790C>G	c.(1789-1791)TCA>TGA	p.S597*	GTF3C3_uc010zgu.1_Nonsense_Mutation_p.S568*	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	597						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7																		---	---	---	---
ALPP	250	broad.mit.edu	37	2	233243531	233243531	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233243531C>G	uc002vsq.2	+	1	184	c.19C>G	c.(19-21)CTG>GTG	p.L7V	ALPP_uc002vsr.2_5'Flank	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	7						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1394007	1394007	+	Splice_Site	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1394007G>C	uc003boz.2	+	12	1632	c.1365_splice	c.e12-1	p.R455_splice	CNTN6_uc011asj.1_Splice_Site_p.R383_splice|CNTN6_uc003bpa.2_Splice_Site_p.R455_splice	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1424781	1424781	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1424781T>G	uc003boz.2	+	18	2589	c.2322T>G	c.(2320-2322)TTT>TTG	p.F774L	CNTN6_uc011asj.1_Missense_Mutation_p.F702L|CNTN6_uc003bpa.2_Missense_Mutation_p.F774L	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	774	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
SLC25A38	54977	broad.mit.edu	37	3	39433101	39433101	+	Missense_Mutation	SNP	C	T	T	rs143865753		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39433101C>T	uc003cjo.2	+	4	847	c.446C>T	c.(445-447)ACG>ATG	p.T149M		NM_017875	NP_060345	Q96DW6	S2538_HUMAN	solute carrier family 25, member 38	149	Solcar 2.				erythrocyte differentiation|heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)														---	---	---	---
P4HTM	54681	broad.mit.edu	37	3	49027828	49027828	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49027828C>T	uc003cvg.2	+	1	488	c.139C>T	c.(139-141)CGT>TGT	p.R47C	P4HTM_uc003cvh.2_Missense_Mutation_p.R47C	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	47	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)													---	---	---	---
LAMB2	3913	broad.mit.edu	37	3	49160188	49160188	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49160188C>T	uc003cwe.2	-	27	4821	c.4522G>A	c.(4522-4524)GCC>ACC	p.A1508T	USP19_uc003cvz.3_5'Flank|USP19_uc011bcg.1_5'Flank|USP19_uc003cwb.2_5'Flank|USP19_uc003cwd.1_5'Flank|USP19_uc011bch.1_5'Flank|USP19_uc011bci.1_5'Flank	NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1508	Potential.|Domain I.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
TMEM115	11070	broad.mit.edu	37	3	50396054	50396054	+	Silent	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50396054C>G	uc003dan.1	-	1	886	c.441G>C	c.(439-441)GTG>GTC	p.V147V		NM_007024	NP_008955	Q12893	TM115_HUMAN	PL6 protein	147	Helical; (Potential).				negative regulation of cell proliferation	Golgi apparatus|integral to membrane|nucleus					0				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)														---	---	---	---
HTR1F	3355	broad.mit.edu	37	3	88040851	88040851	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88040851G>A	uc003dqr.2	+	2	1110	c.952G>A	c.(952-954)GTC>ATC	p.V318I		NM_000866	NP_000857	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F	318	Extracellular (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	serotonin binding|serotonin receptor activity			ovary(3)	3	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)													---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108380769	108380769	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108380769G>A	uc003dxd.2	+	20	2667	c.2245G>A	c.(2245-2247)GAA>AAA	p.E749K	DZIP3_uc003dxf.1_Missense_Mutation_p.E749K|DZIP3_uc011bhm.1_Missense_Mutation_p.E200K	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	749					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124527925	124527925	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124527925C>A	uc003eho.2	-	9	1504	c.1207G>T	c.(1207-1209)GAT>TAT	p.D403Y	ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor	403	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130381114	130381114	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130381114G>A	uc010htl.2	+	34	6495	c.6464G>A	c.(6463-6465)GGT>GAT	p.G2155D	COL6A6_uc003eni.3_Missense_Mutation_p.G254D	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	2155	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136342064	136342064	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136342064T>C	uc003era.1	-	3	348	c.56A>G	c.(55-57)CAT>CGT	p.H19R	STAG1_uc003erb.1_Missense_Mutation_p.H19R|STAG1_uc003erc.1_5'UTR|STAG1_uc010hua.1_5'UTR|STAG1_uc003ere.2_Missense_Mutation_p.H19R	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	19					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
ATP1B3	483	broad.mit.edu	37	3	141644421	141644421	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141644421A>G	uc003eug.1	+	7	892	c.718A>G	c.(718-720)AAC>GAC	p.N240D	ATP1B3_uc011bne.1_RNA|ATP1B3_uc003euh.1_Missense_Mutation_p.N226D|ATP1B3_uc003eui.1_RNA	NM_001679	NP_001670	P54709	AT1B3_HUMAN	Na+/K+ -ATPase beta 3 subunit	240	Extracellular (Potential).				ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity				0																		---	---	---	---
PHC3	80012	broad.mit.edu	37	3	169840471	169840471	+	Missense_Mutation	SNP	C	T	T	rs146149780	by1000genomes	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169840471C>T	uc010hws.1	-	9	1878	c.1814G>A	c.(1813-1815)CGG>CAG	p.R605Q	PHC3_uc003fgl.2_Missense_Mutation_p.R617Q|PHC3_uc011bpq.1_Missense_Mutation_p.R564Q	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	605	Pro-rich.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)															---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47033662	47033662	+	5'UTR	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47033662G>T	uc003gxh.2	+	1					GABRB1_uc011bze.1_5'UTR|GABRB1_uc011bzd.1_5'UTR|GABRB1_uc010igg.2_RNA	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
IL8	3576	broad.mit.edu	37	4	74607379	74607379	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74607379C>T	uc003hhe.2	+	2	286	c.185C>T	c.(184-186)GCC>GTC	p.A62V	IL8_uc011cbh.1_Missense_Mutation_p.A62V	NM_000584	NP_000575	P10145	IL8_HUMAN	interleukin 8 precursor	62					angiogenesis|calcium-mediated signaling|cell cycle arrest|cellular response to lipopolysaccharide|embryonic digestive tract development|G-protein coupled receptor protein signaling pathway|immune response|induction of positive chemotaxis|inflammatory response|negative regulation of cell proliferation|neutrophil activation|neutrophil chemotaxis|positive regulation of neutrophil chemotaxis|regulation of cell adhesion|regulation of retroviral genome replication	extracellular space|intracellular	chemokine activity|interleukin-8 receptor binding			ovary(2)	2	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)	Ketoprofen(DB01009)|Salbutamol(DB01001)|Simvastatin(DB00641)|Zileuton(DB00744)													---	---	---	---
G3BP2	9908	broad.mit.edu	37	4	76570710	76570710	+	Silent	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76570710T>C	uc003hir.2	-	12	1518	c.1353A>G	c.(1351-1353)GGA>GGG	p.G451G	G3BP2_uc003his.2_Silent_p.G451G|G3BP2_uc003hit.2_Silent_p.G418G	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding	451	Gly-rich.				cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)															---	---	---	---
NAAA	27163	broad.mit.edu	37	4	76836120	76836120	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76836120C>A	uc003hjb.2	-	10	1081	c.1017G>T	c.(1015-1017)ACG>ACT	p.T339T	NAAA_uc003hja.2_Intron	NM_014435	NP_055250	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase isoform 1	339					lipid metabolic process	lysosome	hydrolase activity			skin(1)	1																		---	---	---	---
PAQR3	152559	broad.mit.edu	37	4	79860320	79860320	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79860320C>T	uc003hlp.1	-	1	263	c.59G>A	c.(58-60)TGG>TAG	p.W20*	PAQR3_uc003hlm.2_RNA|PAQR3_uc003hln.2_RNA|PAQR3_uc003hlq.1_5'UTR	NM_001040202	NP_001035292	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	20	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	receptor activity				0																		---	---	---	---
NAA11	84779	broad.mit.edu	37	4	80246965	80246965	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80246965G>A	uc003hlt.3	-	1	207	c.67C>T	c.(67-69)CCT>TCT	p.P23S		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	alpha-N-acetyltransferase 1B	23	Interaction with NAA15 (By similarity).|N-acetyltransferase.					cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PRSS12	8492	broad.mit.edu	37	4	119252907	119252907	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119252907G>A	uc003ica.1	-	4	982	c.935C>T	c.(934-936)GCC>GTC	p.A312V		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	312	SRCR 2.					membrane	scavenger receptor activity			skin(1)	1																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11098707	11098707	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11098707A>C	uc003jfa.1	-	15	2762	c.2617T>G	c.(2617-2619)TTG>GTG	p.L873V	CTNND2_uc010itt.2_Missense_Mutation_p.L782V|CTNND2_uc011cmy.1_Missense_Mutation_p.L536V|CTNND2_uc011cmz.1_Missense_Mutation_p.L440V|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.L440V	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	873	ARM 7.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11098869	11098869	+	Intron	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11098869A>C	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
RXFP3	51289	broad.mit.edu	37	5	33937955	33937955	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937955G>A	uc003jic.1	+	1	1467	c.1110G>A	c.(1108-1110)GCG>GCA	p.A370A		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	370	Helical; Name=7; (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
LIFR	3977	broad.mit.edu	37	5	38510603	38510603	+	Silent	SNP	G	A	A	rs61748202	byFrequency	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38510603G>A	uc010ive.1	-	7	1286	c.954C>T	c.(952-954)ACC>ACT	p.T318T	LIFR_uc003jli.2_Silent_p.T318T	NM_001127671	NP_001121143	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor	318	Extracellular (Potential).				positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)							T	PLAG1	salivary adenoma								---	---	---	---
FGF10	2255	broad.mit.edu	37	5	44388771	44388771	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44388771A>C	uc003jog.1	-	1	14	c.14T>G	c.(13-15)ATA>AGA	p.I5R		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	5					actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)																	---	---	---	---
SNCAIP	9627	broad.mit.edu	37	5	121739511	121739511	+	Silent	SNP	G	A	A	rs149915358	byFrequency	TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121739511G>A	uc003ksw.1	+	3	287	c.81G>A	c.(79-81)ACG>ACA	p.T27T	SNCAIP_uc011cwl.1_5'UTR|SNCAIP_uc010jct.2_Silent_p.T27T|SNCAIP_uc003ksx.1_Silent_p.T74T|SNCAIP_uc003ksy.1_Missense_Mutation_p.R12Q|SNCAIP_uc003ksz.1_Missense_Mutation_p.R12Q|SNCAIP_uc010jcu.2_Missense_Mutation_p.R12Q|SNCAIP_uc011cwm.1_Missense_Mutation_p.R12Q|SNCAIP_uc003kta.1_Missense_Mutation_p.R10Q|SNCAIP_uc010jcv.1_RNA|SNCAIP_uc010jcw.1_Missense_Mutation_p.R12Q|SNCAIP_uc010jcx.1_Silent_p.T27T	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein	27					cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)														---	---	---	---
SLC22A4	6583	broad.mit.edu	37	5	131679535	131679535	+	3'UTR	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131679535A>G	uc003kwq.2	+	10					uc003kwr.3_Intron	NM_003059	NP_003050			solute carrier family 22 member 4						body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)													---	---	---	---
PCDHA3	56145	broad.mit.edu	37	5	140180983	140180983	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140180983G>A	uc003lhf.2	+	1	201	c.201G>A	c.(199-201)GCG>GCA	p.A67A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Silent_p.A67A	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	67	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA10	56106	broad.mit.edu	37	5	140794719	140794719	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794719C>T	uc003lkl.1	+	1	1977	c.1977C>T	c.(1975-1977)TCC>TCT	p.S659S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Silent_p.S659S|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	659	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGB7	56099	broad.mit.edu	37	5	140799123	140799123	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140799123C>T	uc003lkn.1	+	1	1842	c.1697C>T	c.(1696-1698)GCG>GTG	p.A566V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.A566V|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	566	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
TCERG1	10915	broad.mit.edu	37	5	145847970	145847970	+	Intron	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145847970A>T	uc003lob.2	+						TCERG1_uc003loc.2_Intron|TCERG1_uc011dbt.1_Intron	NM_006706	NP_006697			transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
TNIP1	10318	broad.mit.edu	37	5	150422226	150422226	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150422226C>A	uc003ltf.2	-	11	1598	c.1009G>T	c.(1009-1011)GAG>TAG	p.E337*	TNIP1_uc010jhl.2_RNA|TNIP1_uc010jhm.2_Nonsense_Mutation_p.E337*|TNIP1_uc010jhn.2_Nonsense_Mutation_p.E337*|TNIP1_uc011dco.1_Nonsense_Mutation_p.E337*|TNIP1_uc003lth.2_RNA|TNIP1_uc003lti.2_Nonsense_Mutation_p.E337*|TNIP1_uc003ltg.2_Nonsense_Mutation_p.E284*|TNIP1_uc003ltj.2_Nonsense_Mutation_p.E337*|TNIP1_uc010jho.1_RNA|TNIP1_uc010jhq.1_Nonsense_Mutation_p.E284*|TNIP1_uc010jhp.1_Nonsense_Mutation_p.E284*|TNIP1_uc010jhr.1_Nonsense_Mutation_p.E337*|TNIP1_uc003ltk.2_Nonsense_Mutation_p.E337*	NM_006058	NP_006049	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	337	Potential.|Interacts with Nef.				defense response|glycoprotein biosynthetic process|negative regulation of viral genome replication|translation	cytoplasm|nucleus	protein binding			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
SLC36A2	153201	broad.mit.edu	37	5	150723081	150723081	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150723081A>G	uc003lty.2	-	3	464	c.334T>C	c.(334-336)TTC>CTC	p.F112L	GM2A_uc011dcs.1_Intron|SLC36A2_uc003ltz.2_RNA|SLC36A2_uc003lua.2_5'UTR|SLC36A2_uc010jhv.2_Missense_Mutation_p.F112L|SLC36A2_uc011dct.1_Missense_Mutation_p.F112L	NM_181776	NP_861441	Q495M3	S36A2_HUMAN	solute carrier family 36, member 2	112	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	cytoplasm|integral to membrane|plasma membrane	glycine transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158204508	158204508	+	Silent	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158204508G>T	uc010jip.2	-	10	1251	c.949C>A	c.(949-951)CGG>AGG	p.R317R	EBF1_uc011ddw.1_Silent_p.R185R|EBF1_uc011ddx.1_Silent_p.R318R|EBF1_uc003lxl.3_Silent_p.R286R	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	317	IPT/TIG.				multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
SQSTM1	8878	broad.mit.edu	37	5	179263587	179263587	+	Silent	SNP	G	A	A	rs11548636		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179263587G>A	uc003mkw.3	+	8	1412	c.1317G>A	c.(1315-1317)CCG>CCA	p.P439P	SQSTM1_uc011dgr.1_Silent_p.P355P|SQSTM1_uc011dgs.1_Silent_p.P355P|SQSTM1_uc003mkv.3_Missense_Mutation_p.R356H|SQSTM1_uc003mkx.2_Silent_p.P355P	NM_003900	NP_003891	Q13501	SQSTM_HUMAN	sequestosome 1 isoform 1	439	Interaction with NTRK1 (By similarity).				anti-apoptosis|apoptosis|cell differentiation|endosome transport|induction of apoptosis by extracellular signals|intracellular signal transduction|macroautophagy|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein localization|regulation of I-kappaB kinase/NF-kappaB cascade|ubiquitin-dependent protein catabolic process	cytosol|late endosome|nucleoplasm	protein kinase C binding|receptor tyrosine kinase binding|SH2 domain binding|ubiquitin binding|zinc ion binding		SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											Paget_Disease_of_Bone				---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	292572	292572	+	Intron	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:292572C>T	uc003msx.2	+						DUSP22_uc011dhn.1_Intron	NM_020185	NP_064570			dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
DST	667	broad.mit.edu	37	6	56469646	56469646	+	Intron	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56469646A>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Silent_p.I2723I	NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
RIMS1	22999	broad.mit.edu	37	6	72955550	72955550	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72955550C>T	uc003pga.2	+	11	2191	c.2114C>T	c.(2113-2115)CCT>CTT	p.P705L	RIMS1_uc011dyb.1_Missense_Mutation_p.P331L|RIMS1_uc003pgc.2_Missense_Mutation_p.P331L|RIMS1_uc010kaq.2_Missense_Mutation_p.P179L|RIMS1_uc011dyc.1_Missense_Mutation_p.P179L|RIMS1_uc010kar.2_Missense_Mutation_p.P98L|RIMS1_uc011dyd.1_Missense_Mutation_p.P164L|RIMS1_uc003pgb.3_Missense_Mutation_p.P331L|RIMS1_uc010kas.1_Missense_Mutation_p.P164L	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	705					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)																---	---	---	---
C6orf186	728464	broad.mit.edu	37	6	110620262	110620262	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110620262T>C	uc010kdu.1	-	4	649	c.649A>G	c.(649-651)ATT>GTT	p.I217V	C6orf186_uc003pub.2_Missense_Mutation_p.I20V	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	217						extracellular region					0																		---	---	---	---
C6orf174	387104	broad.mit.edu	37	6	127775078	127775078	+	3'UTR	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127775078C>A	uc003qbd.2	-	8					C6orf174_uc003qbc.2_Nonsense_Mutation_p.E17*|C6orf174_uc003qbb.2_5'Flank|KIAA0408_uc011ebs.1_Nonsense_Mutation_p.E17*	NM_001012279	NP_001012279			hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)														---	---	---	---
PTPRK	5796	broad.mit.edu	37	6	128561255	128561255	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128561255C>A	uc003qbk.2	-	5	985	c.618G>T	c.(616-618)GTG>GTT	p.V206V	PTPRK_uc003qbj.2_Silent_p.V206V|PTPRK_uc010kfc.2_Silent_p.V206V|PTPRK_uc011ebu.1_Silent_p.V206V|PTPRK_uc003qbl.1_Silent_p.V76V|PTPRK_uc011ebv.1_Silent_p.V206V	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	206	Extracellular (Potential).|Ig-like C2-type.				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)														---	---	---	---
PEX3	8504	broad.mit.edu	37	6	143792193	143792193	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143792193G>T	uc003qjl.2	+	5	689	c.427G>T	c.(427-429)GAT>TAT	p.D143Y	PEX3_uc011edx.1_Missense_Mutation_p.D143Y	NM_003630	NP_003621	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	143	Cytoplasmic (Potential).				protein import into peroxisome membrane|transmembrane transport	integral to peroxisomal membrane	protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)														---	---	---	---
UST	10090	broad.mit.edu	37	6	149394999	149394999	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149394999C>T	uc003qmg.2	+	8	1264	c.968C>T	c.(967-969)ACG>ATG	p.T323M		NM_005715	NP_005706	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	323	Lumenal (Potential).				protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
KATNA1	11104	broad.mit.edu	37	6	149944303	149944303	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149944303T>C	uc003qmr.1	-	3	482	c.437A>G	c.(436-438)AAT>AGT	p.N146S	KATNA1_uc003qms.2_Missense_Mutation_p.N146S|KATNA1_uc003qmt.2_Missense_Mutation_p.N146S|KATNA1_uc011eed.1_Missense_Mutation_p.N146S	NM_007044	NP_008975	O75449	KTNA1_HUMAN	katanin p60 subunit A 1	146	Interaction with microtubule.				cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)														---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157527345	157527345	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157527345C>A	uc003qqn.2	+	20	5168	c.5016C>A	c.(5014-5016)TGC>TGA	p.C1672*	ARID1B_uc003qqo.2_Nonsense_Mutation_p.C1632*|ARID1B_uc003qqp.2_Nonsense_Mutation_p.C1619*	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1677					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
TAX1BP1	8887	broad.mit.edu	37	7	27832693	27832693	+	Silent	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27832693T>C	uc003szl.2	+	10	1430	c.1272T>C	c.(1270-1272)ACT>ACC	p.T424T	TAX1BP1_uc011jzo.1_Silent_p.T424T|TAX1BP1_uc003szk.2_Silent_p.T424T|TAX1BP1_uc011jzp.1_Silent_p.T267T	NM_006024	NP_006015	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I)	424	Potential.				anti-apoptosis|apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production	cytosol	identical protein binding|kinase binding|zinc ion binding			breast(1)	1			GBM - Glioblastoma multiforme(3;0.0823)															---	---	---	---
HERPUD2	64224	broad.mit.edu	37	7	35707045	35707045	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35707045C>A	uc003tet.2	-	4	1298	c.493G>T	c.(493-495)GGA>TGA	p.G165*	HERPUD2_uc003tes.3_Nonsense_Mutation_p.G165*	NM_022373	NP_071768	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	165					response to unfolded protein	integral to membrane				ovary(3)	3																		---	---	---	---
IKZF1	10320	broad.mit.edu	37	7	50468108	50468108	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50468108C>T	uc003tow.3	+	9	1511	c.1343C>T	c.(1342-1344)GCG>GTG	p.A448V	IKZF1_uc003tox.3_Missense_Mutation_p.A406V|IKZF1_uc003toy.3_Missense_Mutation_p.A406V|IKZF1_uc011kck.1_Missense_Mutation_p.A361V|IKZF1_uc003toz.3_Missense_Mutation_p.A418V|IKZF1_uc010kyx.2_Missense_Mutation_p.A188V|IKZF1_uc003tpa.3_Missense_Mutation_p.A190V	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	448					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)						D		ALL								---	---	---	---
CCDC132	55610	broad.mit.edu	37	7	92935138	92935138	+	Splice_Site	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92935138A>G	uc003umo.2	+	18	1581	c.1453_splice	c.e18-2	p.E485_splice	CCDC132_uc003umq.2_Splice_Site|CCDC132_uc003ump.2_Splice_Site_p.E455_splice|CCDC132_uc003umr.2_Splice_Site|CCDC132_uc011khz.1_Splice_Site_p.E205_splice	NM_017667	NP_060137			coiled-coil domain containing 132 isoform a												0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94059632	94059632	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94059632A>C	uc003ung.1	+	52	4499	c.4028A>C	c.(4027-4029)GAT>GCT	p.D1343A	COL1A2_uc011kib.1_Missense_Mutation_p.D195A	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1343	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94059634	94059634	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94059634A>T	uc003ung.1	+	52	4501	c.4030A>T	c.(4030-4032)ATT>TTT	p.I1344F	COL1A2_uc011kib.1_Missense_Mutation_p.I196F	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1344	Fibrillar collagen NC1.				axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
CTTNBP2	83992	broad.mit.edu	37	7	117431934	117431934	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117431934G>C	uc003vjf.2	-	4	1408	c.1316C>G	c.(1315-1317)CCA>CGA	p.P439R		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	439	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
ZNF800	168850	broad.mit.edu	37	7	127014104	127014104	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127014104T>G	uc003vlx.1	-	5	1549	c.1286A>C	c.(1285-1287)AAT>ACT	p.N429T	ZNF800_uc003vlw.1_Missense_Mutation_p.N332T|ZNF800_uc003vly.1_Missense_Mutation_p.N429T|ZNF800_uc010lla.2_Missense_Mutation_p.N429T	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	429					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136700630	136700630	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700630A>G	uc003vtf.1	+	4	1641	c.1018A>G	c.(1018-1020)ACT>GCT	p.T340A	CHRM2_uc003vtg.1_Missense_Mutation_p.T340A|CHRM2_uc003vtj.1_Missense_Mutation_p.T340A|CHRM2_uc003vtk.1_Missense_Mutation_p.T340A|CHRM2_uc003vtl.1_Missense_Mutation_p.T340A|CHRM2_uc003vtm.1_Missense_Mutation_p.T340A|CHRM2_uc003vti.1_Missense_Mutation_p.T340A|CHRM2_uc003vto.1_Missense_Mutation_p.T340A|CHRM2_uc003vtn.1_Missense_Mutation_p.T340A|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	340	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147869380	147869380	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147869380G>C	uc003weu.1	+	18	3336	c.2820G>C	c.(2818-2820)TTG>TTC	p.L940F		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	940	Laminin G-like 3.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
TMUB1	83590	broad.mit.edu	37	7	150779627	150779627	+	Silent	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150779627A>G	uc003wjb.2	-	1	139	c.24T>C	c.(22-24)GGT>GGC	p.G8G	FASTK_uc003wiw.1_5'Flank|FASTK_uc003wix.1_5'Flank|FASTK_uc003wiy.1_5'Flank|FASTK_uc003wiz.1_5'Flank|FASTK_uc003wja.1_5'Flank|TMUB1_uc003wjc.2_Silent_p.G8G|TMUB1_uc003wjd.2_Silent_p.G8G	NM_031434	NP_113622	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain	8						cytoplasm|integral to membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
ABCF2	10061	broad.mit.edu	37	7	150915696	150915696	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150915696G>T	uc003wjp.2	-	10	1289	c.1178C>A	c.(1177-1179)CCA>CAA	p.P393Q	ABCF2_uc003wjo.1_Missense_Mutation_p.P393Q	NM_007189	NP_009120	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F, member 2	393						ATP-binding cassette (ABC) transporter complex|mitochondrial envelope	ATP binding|ATPase activity|transporter activity			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
DEFB136	613210	broad.mit.edu	37	8	11831582	11831582	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11831582G>C	uc011kxm.1	-	2	101	c.101C>G	c.(100-102)ACT>AGT	p.T34S		NM_001033018	NP_001028190	Q30KP8	DB136_HUMAN	beta-defensin 136 precursor	34					defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)														---	---	---	---
ATP6V1B2	526	broad.mit.edu	37	8	20067922	20067922	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20067922C>T	uc003wzp.2	+	4	571	c.357C>T	c.(355-357)CTC>CTT	p.L119L		NM_001693	NP_001684	P21281	VATB2_HUMAN	vacuolar H+ATPase B2	119					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)														---	---	---	---
SCARA3	51435	broad.mit.edu	37	8	27528492	27528492	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27528492C>T	uc003xga.1	+	6	1586	c.1445C>T	c.(1444-1446)CCG>CTG	p.P482L	SCARA3_uc003xgb.1_Intron	NM_016240	NP_057324	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3 isoform 1	482	Collagen-like 1.|Extracellular (Potential).				response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)														---	---	---	---
C8orf41	80185	broad.mit.edu	37	8	33371050	33371050	+	5'Flank	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33371050G>A	uc003xjl.3	-						C8orf41_uc003xjk.3_5'Flank|C8orf41_uc010lvv.2_5'Flank|C8orf41_uc003xjm.3_5'Flank|C8orf41_uc003xjn.1_5'Flank	NM_025115	NP_079391			hypothetical protein LOC80185								binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)														---	---	---	---
SFRP1	6422	broad.mit.edu	37	8	41122917	41122917	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41122917G>C	uc003xnt.2	-	3	1016	c.714C>G	c.(712-714)ATC>ATG	p.I238M		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	238	NTR.				brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)															---	---	---	---
CSPP1	79848	broad.mit.edu	37	8	68084687	68084687	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68084687G>C	uc003xxi.2	+	25	2986	c.2955G>C	c.(2953-2955)ATG>ATC	p.M985I	CSPP1_uc003xxj.2_Missense_Mutation_p.M950I|CSPP1_uc003xxk.2_Missense_Mutation_p.M605I|CSPP1_uc010lyw.2_Missense_Mutation_p.M45I	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	985						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74516095	74516095	+	Missense_Mutation	SNP	C	T	T	rs142831475		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74516095C>T	uc003xzm.2	-	10	1131	c.895G>A	c.(895-897)GGA>AGA	p.G299R	STAU2_uc011lfg.1_Missense_Mutation_p.G127R|STAU2_uc003xzn.2_Missense_Mutation_p.G267R|STAU2_uc011lfh.1_Missense_Mutation_p.G195R|STAU2_uc003xzo.2_Missense_Mutation_p.G299R|STAU2_uc003xzp.2_Missense_Mutation_p.G267R|STAU2_uc011lfi.1_Missense_Mutation_p.G261R|STAU2_uc003xzq.2_Missense_Mutation_p.G79R|STAU2_uc010lzk.2_Missense_Mutation_p.G267R|STAU2_uc010lzl.1_Missense_Mutation_p.G127R	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e	299					transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88365898	88365898	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88365898T>C	uc003ydy.2	+	10	1235	c.1187T>C	c.(1186-1188)CTT>CCT	p.L396P		NM_173538	NP_775809	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	396	cNMP.									ovary(3)	3																		---	---	---	---
DCAF13	25879	broad.mit.edu	37	8	104427572	104427572	+	Silent	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104427572T>G	uc003yln.2	+	1	631	c.354T>G	c.(352-354)ACT>ACG	p.T118T	SLC25A32_uc003yll.2_5'Flank|SLC25A32_uc011lhr.1_5'Flank|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	Error:Variant_position_missing_in_Q9NV06_after_alignment					rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1																		---	---	---	---
TG	7038	broad.mit.edu	37	8	134146930	134146930	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134146930G>A	uc003ytw.2	+	48	8240	c.8199G>A	c.(8197-8199)AAG>AAA	p.K2733K	TG_uc010mdw.2_Silent_p.K1492K|TG_uc011ljb.1_Silent_p.K1102K|TG_uc011ljc.1_Silent_p.K866K	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2733					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139164785	139164785	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164785T>G	uc003yuy.2	-	13	2104	c.1933A>C	c.(1933-1935)AGT>CGT	p.S645R	FAM135B_uc003yux.2_Missense_Mutation_p.S546R|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.S207R|FAM135B_uc003yvb.2_Missense_Mutation_p.S207R	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	645										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
AK3	50808	broad.mit.edu	37	9	4741007	4741007	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4741007G>A	uc003ziq.1	-	1	221	c.81C>T	c.(79-81)ATC>ATT	p.I27I	AK3_uc011lma.1_Silent_p.I27I|AK3_uc003zir.1_Intron	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3	27					blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
GLDC	2731	broad.mit.edu	37	9	6610217	6610217	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6610217C>A	uc003zkc.2	-	4	803	c.610G>T	c.(610-612)GCA>TCA	p.A204S		NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	204					glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
CDKN2A	1029	broad.mit.edu	37	9	21971119	21971119	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971119C>T	uc003zpk.2	-	2	451	c.239G>A	c.(238-240)CGA>CAA	p.R80Q	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.P135P	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	80	ANK 3.		R -> P (in CMM2; loss of CDK4 binding).|R -> L (in a head and neck tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.R80*(85)|p.?(13)|p.R80Q(2)|p.T79fs*37(1)|p.L65fs*38(1)|p.R80fs*66(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)|p.R80?(1)|p.R80L(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)			17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			---	---	---	---
NOL6	65083	broad.mit.edu	37	9	33466322	33466322	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33466322G>A	uc003zsz.2	-	17	2294	c.2193C>T	c.(2191-2193)TAC>TAT	p.Y731Y	SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zsy.2_5'Flank|NOL6_uc003zta.2_Intron|NOL6_uc010mjv.2_Silent_p.Y728Y|NOL6_uc011lob.1_Silent_p.Y679Y|NOL6_uc003ztb.1_Silent_p.Y731Y	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform	731					rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)												OREG0019137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TLN1	7094	broad.mit.edu	37	9	35700205	35700205	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35700205T>C	uc003zxt.2	-	49	6997	c.6643A>G	c.(6643-6645)ATG>GTG	p.M2215V		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	2215					axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	91993768	91993768	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91993768C>T	uc004aqo.1	-	18	3012	c.2440G>A	c.(2440-2442)GGC>AGC	p.G814S	SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Missense_Mutation_p.G812S	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1	814	Cytoplasmic (Potential).				anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
MEGF9	1955	broad.mit.edu	37	9	123370282	123370282	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123370282C>G	uc004bkj.1	-	7	1205	c.1205G>C	c.(1204-1206)AGT>ACT	p.S402T	MEGF9_uc011lyb.1_Missense_Mutation_p.S357T	NM_001080497	NP_001073966	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	365	Laminin EGF-like 4.|Extracellular (Potential).					integral to membrane	calcium ion binding				0																		---	---	---	---
ARMC3	219681	broad.mit.edu	37	10	23321810	23321810	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23321810G>A	uc001irm.3	+	18	2350	c.2267G>A	c.(2266-2268)GGT>GAT	p.G756D	ARMC3_uc010qcv.1_Missense_Mutation_p.G749D|ARMC3_uc010qcw.1_Missense_Mutation_p.G493D	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	756							binding				0																		---	---	---	---
ENTPD7	57089	broad.mit.edu	37	10	101421366	101421366	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101421366C>G	uc001kqa.3	+	3	350	c.172C>G	c.(172-174)CGA>GGA	p.R58G	ENTPD7_uc009xwl.2_Missense_Mutation_p.R60G|SLC25A28_uc001kpy.2_5'Flank	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	58	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)														---	---	---	---
LDB1	8861	broad.mit.edu	37	10	103869394	103869394	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103869394C>A	uc009xwz.2	-	8	1038	c.695G>T	c.(694-696)CGG>CTG	p.R232L	LDB1_uc001kuk.3_Missense_Mutation_p.R196L|LDB1_uc001kul.3_Missense_Mutation_p.R196L	NM_001113407	NP_001106878	Q86U70	LDB1_HUMAN	LIM domain binding 1 isoform 1	232					histone H3-K4 acetylation|negative regulation of erythrocyte differentiation|negative regulation of transcription, DNA-dependent|positive regulation of hemoglobin biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription elongation, DNA-dependent|transcription, DNA-dependent|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery	nuclear chromatin|protein complex	LIM domain binding|protein homodimerization activity|transcription corepressor activity			large_intestine(1)	1		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)														---	---	---	---
ACTR1A	10121	broad.mit.edu	37	10	104241914	104241914	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104241914G>A	uc001kvv.2	-	8	877	c.769C>T	c.(769-771)CGG>TGG	p.R257W	ACTR1A_uc010qqn.1_Missense_Mutation_p.R183W|ACTR1A_uc010qqo.1_Missense_Mutation_p.R210W	NM_005736	NP_005727	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A,	257					G2/M transition of mitotic cell cycle|vesicle-mediated transport	centrosome|cytosol|dynactin complex	ATP binding			central_nervous_system(1)	1		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
PLEKHA1	59338	broad.mit.edu	37	10	124159876	124159876	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124159876G>C	uc001lge.1	+	4	339	c.216G>C	c.(214-216)AAG>AAC	p.K72N	PLEKHA1_uc001lgf.1_Missense_Mutation_p.K72N|PLEKHA1_uc001lgg.1_Missense_Mutation_p.K72N|PLEKHA1_uc001lgh.2_Missense_Mutation_p.K72N	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A	72	PH 1.				B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
GPR26	2849	broad.mit.edu	37	10	125434364	125434364	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125434364G>A	uc001lhh.2	+	2	752	c.699G>A	c.(697-699)AAG>AAA	p.K233K		NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	233	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)																---	---	---	---
ADAM8	101	broad.mit.edu	37	10	135085440	135085440	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135085440C>T	uc010qva.1	-	10	910	c.859G>A	c.(859-861)GTG>ATG	p.V287M	ADAM8_uc010quz.1_Missense_Mutation_p.V326M|ADAM8_uc009ybi.2_Missense_Mutation_p.V326M|ADAM8_uc010qvb.1_3'UTR			P78325	ADAM8_HUMAN	SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);	287					integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity	p.N287N(1)		large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)														---	---	---	---
QSER1	79832	broad.mit.edu	37	11	32975670	32975670	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32975670A>G	uc001mty.2	+	5	4325	c.4058A>G	c.(4057-4059)CAA>CGA	p.Q1353R	QSER1_uc001mtz.1_Missense_Mutation_p.Q1114R|QSER1_uc001mua.2_Missense_Mutation_p.Q858R	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1353										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)																	---	---	---	---
CAPRIN1	4076	broad.mit.edu	37	11	34107866	34107866	+	Silent	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34107866T>C	uc001mvh.1	+	11	1326	c.1137T>C	c.(1135-1137)GAT>GAC	p.D379D	CAPRIN1_uc001mvg.2_Silent_p.D379D|CAPRIN1_uc001mvi.2_Silent_p.D379D|CAPRIN1_uc001mvj.1_Silent_p.D298D	NM_005898	NP_005889	Q14444	CAPR1_HUMAN	membrane component chromosome 11 surface marker	379	G3BP1-binding.				negative regulation of translation|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis	cytoplasmic mRNA processing body|cytosol|dendrite|integral to plasma membrane|stress granule	protein binding|RNA binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)																---	---	---	---
ELF5	2001	broad.mit.edu	37	11	34502481	34502481	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34502481C>A	uc001mvo.1	-	6	769	c.539G>T	c.(538-540)CGA>CTA	p.R180L	ELF5_uc001mvp.1_Missense_Mutation_p.R170L|ELF5_uc009ykd.1_Missense_Mutation_p.R75L	NM_198381	NP_938195	Q9UKW6	ELF5_HUMAN	E74-like factor 5 ESE-2a	180	ETS.				cell proliferation|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)																---	---	---	---
HRASLS5	117245	broad.mit.edu	37	11	63233831	63233831	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63233831C>G	uc001nwy.2	-	5	672	c.498G>C	c.(496-498)GAG>GAC	p.E166D	HRASLS5_uc001nwz.2_Missense_Mutation_p.E156D|HRASLS5_uc010rmq.1_Missense_Mutation_p.E166D|HRASLS5_uc009yos.2_RNA	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5 isoform 1	166										ovary(1)	1																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64878815	64878815	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64878815G>A	uc001ocr.1	+	10	2145	c.2105G>A	c.(2104-2106)GGC>GAC	p.G702D	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.G578D	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	702					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
ARRB1	408	broad.mit.edu	37	11	74984017	74984017	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74984017C>A	uc001owe.1	-	12	1142	c.920G>T	c.(919-921)AGG>ATG	p.R307M	ARRB1_uc001owf.1_Missense_Mutation_p.R307M	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A	307					G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2																		---	---	---	---
PGR	5241	broad.mit.edu	37	11	100912766	100912766	+	Silent	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100912766G>C	uc001pgh.2	-	7	3299	c.2556C>G	c.(2554-2556)CTC>CTG	p.L852L	PGR_uc001pgg.2_Silent_p.L233L|PGR_uc001pgi.2_Silent_p.L750L|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	852	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)													---	---	---	---
OR8B12	219858	broad.mit.edu	37	11	124413458	124413458	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413458C>A	uc010sam.1	-	1	93	c.93G>T	c.(91-93)CTG>CTT	p.L31L		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)														---	---	---	---
CLEC2B	9976	broad.mit.edu	37	12	10005899	10005899	+	Nonstop_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10005899T>G	uc001qwn.2	-	5	1107	c.450A>C	c.(448-450)TAA>TAC	p.*150Y		NM_005127	NP_005118	Q92478	CLC2B_HUMAN	C-type lectin, superfamily member 2	150						integral to plasma membrane	sugar binding				0																		---	---	---	---
MRPS35	60488	broad.mit.edu	37	12	27869258	27869258	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27869258A>G	uc001rih.2	+	3	236	c.188A>G	c.(187-189)GAC>GGC	p.D63G	MRPS35_uc001rii.2_Missense_Mutation_p.D63G	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor	63					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)																	---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29670473	29670473	+	Silent	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29670473A>G	uc001rjb.2	-	14	2206	c.1732T>C	c.(1732-1734)TTG>CTG	p.L578L	TMTC1_uc001riz.2_Silent_p.L335L|TMTC1_uc001rja.2_Silent_p.L422L|TMTC1_uc001riy.2_Silent_p.L31L	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	686	TPR 7.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
YARS2	51067	broad.mit.edu	37	12	32908507	32908507	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32908507A>C	uc001rli.2	-	1	368	c.302T>G	c.(301-303)TTG>TGG	p.L101W		NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	101					tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40653377	40653377	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40653377T>G	uc001rmg.3	+	13	1635	c.1514T>G	c.(1513-1515)CTT>CGT	p.L505R	LRRK2_uc001rmh.1_Missense_Mutation_p.L127R	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	505					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
OR6C2	341416	broad.mit.edu	37	12	55845986	55845986	+	5'Flank	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55845986C>G	uc001sgz.1	+							NM_054105	NP_473446			olfactory receptor, family 6, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---
PRIM1	5557	broad.mit.edu	37	12	57135325	57135325	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57135325C>A	uc001smd.2	-	9	940	c.876G>T	c.(874-876)CTG>CTT	p.L292L		NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1	292					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0																		---	---	---	---
ACSS3	79611	broad.mit.edu	37	12	81627146	81627146	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81627146G>C	uc001szl.1	+	13	1706	c.1615G>C	c.(1615-1617)GAT>CAT	p.D539H	ACSS3_uc001szm.1_Missense_Mutation_p.D538H|ACSS3_uc001szn.1_Missense_Mutation_p.D221H	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	539						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
ACSS3	79611	broad.mit.edu	37	12	81627200	81627200	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81627200G>T	uc001szl.1	+	13	1760	c.1669G>T	c.(1669-1671)GAT>TAT	p.D557Y	ACSS3_uc001szm.1_Missense_Mutation_p.D556Y|ACSS3_uc001szn.1_Missense_Mutation_p.D239Y	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	557						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
ACSS3	79611	broad.mit.edu	37	12	81627237	81627237	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81627237G>T	uc001szl.1	+	13	1797	c.1706G>T	c.(1705-1707)GGC>GTC	p.G569V	ACSS3_uc001szm.1_Missense_Mutation_p.G568V|ACSS3_uc001szn.1_Missense_Mutation_p.G251V	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	569						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
ALDH1L2	160428	broad.mit.edu	37	12	105433501	105433501	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105433501T>G	uc001tlc.2	-	17	2162	c.2035A>C	c.(2035-2037)ATC>CTC	p.I679L	ALDH1L2_uc009zuo.2_Missense_Mutation_p.I134L|ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	679	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1																		---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124950804	124950804	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124950804G>A	uc010tba.1	-	5	737	c.620C>T	c.(619-621)CCG>CTG	p.P207L	NCOR2_uc010tay.1_Missense_Mutation_p.P207L|NCOR2_uc010taz.1_Missense_Mutation_p.P207L|NCOR2_uc010tbb.1_Missense_Mutation_p.P207L|NCOR2_uc010tbc.1_Missense_Mutation_p.P207L|NCOR2_uc001ugj.1_Missense_Mutation_p.P207L|NCOR2_uc001ugk.1_Missense_Mutation_p.P207L	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	207	Potential.				cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133254317	133254317	+	Intron	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133254317C>G	uc001uks.1	-						POLE_uc010tbq.1_Intron|POLE_uc009zyu.1_Intron	NM_006231	NP_006222			DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
ZNF10	7556	broad.mit.edu	37	12	133733085	133733085	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133733085C>T	uc009zzb.2	+	5	1700	c.1253C>T	c.(1252-1254)TCT>TTT	p.S418F	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.S418F	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	418	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)														---	---	---	---
PSPC1	55269	broad.mit.edu	37	13	20277329	20277329	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20277329G>A	uc001uml.2	-	9	1744	c.1558C>T	c.(1558-1560)CGT>TGT	p.R520C	PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1	520					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)														---	---	---	---
PABPC3	5042	broad.mit.edu	37	13	25671314	25671314	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25671314G>A	uc001upy.2	+	1	1039	c.978G>A	c.(976-978)ATG>ATA	p.M326I		NM_030979	NP_112241	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	326	RRM 4.				mRNA metabolic process	cytoplasm	nucleotide binding|poly(A) RNA binding			ovary(3)|skin(1)	4		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)														---	---	---	---
SLITRK1	114798	broad.mit.edu	37	13	84454325	84454325	+	Silent	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454325G>T	uc001vlk.2	-	1	2204	c.1318C>A	c.(1318-1320)CGG>AGG	p.R440R		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	440	LRR 9.|Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)														---	---	---	---
KDELC1	79070	broad.mit.edu	37	13	103445952	103445952	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103445952T>G	uc001vpq.3	-	3	977	c.593A>C	c.(592-594)AAG>ACG	p.K198T	KDELC1_uc001vpr.3_5'UTR	NM_024089	NP_076994	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1 precursor	198						endoplasmic reticulum lumen				ovary(1)	1	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)																	---	---	---	---
SLC10A2	6555	broad.mit.edu	37	13	103703793	103703793	+	Intron	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103703793A>G	uc001vpy.3	-							NM_000452	NP_000443			solute carrier family 10 (sodium/bile acid						bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)																	---	---	---	---
CARS2	79587	broad.mit.edu	37	13	111298372	111298372	+	Missense_Mutation	SNP	A	G	G	rs146878400		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111298372A>G	uc001vrd.2	-	12	1299	c.1259T>C	c.(1258-1260)GTT>GCT	p.V420A	CARS2_uc010tjm.1_RNA	NM_024537	NP_078813	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial	420					cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)													---	---	---	---
TOX4	9878	broad.mit.edu	37	14	21961177	21961177	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21961177C>G	uc001waz.2	+	7	1505	c.1402C>G	c.(1402-1404)CCA>GCA	p.P468A	TOX4_uc001way.2_Missense_Mutation_p.P338A|TOX4_uc001wba.2_RNA|TOX4_uc010tlu.1_Missense_Mutation_p.P445A|TOX4_uc010tlv.1_Missense_Mutation_p.P338A	NM_014828	NP_055643	O94842	TOX4_HUMAN	epidermal Langerhans cell protein LCP1	468	Gln/Pro-rich.					chromatin|nucleus|PTW/PP1 phosphatase complex	DNA binding|protein binding			ovary(1)	1	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)														---	---	---	---
G2E3	55632	broad.mit.edu	37	14	31085623	31085623	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31085623C>G	uc001wqk.2	+	15	2158	c.2004C>G	c.(2002-2004)AAC>AAG	p.N668K	G2E3_uc010tpf.1_Missense_Mutation_p.N622K|G2E3_uc001wql.1_Missense_Mutation_p.N180K	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	668	HECT.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28228581	28228581	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28228581T>G	uc001zbh.3	-	14	1523	c.1413A>C	c.(1411-1413)GAA>GAC	p.E471D	OCA2_uc010ayv.2_Missense_Mutation_p.E447D	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	471	Extracellular (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
B2M	567	broad.mit.edu	37	15	45003740	45003740	+	5'UTR	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45003740C>A	uc001zuc.2	+	1					B2M_uc010uek.1_5'UTR|B2M_uc010bdx.1_5'UTR	NM_004048	NP_004039			beta-2-microglobulin precursor						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding			ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)														---	---	---	---
CLN6	54982	broad.mit.edu	37	15	68504080	68504080	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68504080C>A	uc002arf.2	-	4	577	c.419G>T	c.(418-420)AGT>ATT	p.S140I	CLN6_uc010ujy.1_Intron|CLN6_uc010ujz.1_Missense_Mutation_p.S172I	NM_017882	NP_060352	Q9NWW5	CLN6_HUMAN	CLN6 protein	140					cell death|cholesterol metabolic process|ganglioside metabolic process|glycosaminoglycan metabolic process|lysosomal lumen acidification|positive regulation of proteolysis|protein catabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	protein homodimerization activity				0																		---	---	---	---
ADPGK	83440	broad.mit.edu	37	15	73052844	73052844	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73052844G>C	uc002avg.3	-	4	641	c.547C>G	c.(547-549)CCA>GCA	p.P183A	ADPGK_uc010ukw.1_Missense_Mutation_p.P125A|ADPGK_uc002avf.3_Missense_Mutation_p.P183A|ADPGK_uc002avi.3_Missense_Mutation_p.P61A|ADPGK_uc002avh.3_5'UTR	NM_031284	NP_112574	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	183	ADPK.				glycolysis	extracellular region	ADP-specific glucokinase activity|metal ion binding				0																		---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100821478	100821478	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100821478C>A	uc002bvv.1	-	4	824	c.745G>T	c.(745-747)GGG>TGG	p.G249W	ADAMTS17_uc002bvx.1_Missense_Mutation_p.G6W	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	249	Peptidase M12B.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
IFT140	9742	broad.mit.edu	37	16	1614069	1614069	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1614069C>T	uc002cmb.2	-	17	2358	c.1996G>A	c.(1996-1998)GTG>ATG	p.V666M	IFT140_uc002clz.2_Missense_Mutation_p.V317M	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	666										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)																---	---	---	---
DCUN1D3	123879	broad.mit.edu	37	16	20873428	20873428	+	Splice_Site	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20873428A>C	uc002dhz.2	-	2	572	c.431_splice	c.e2+1	p.R144_splice	ERI2_uc002dht.3_Intron	NM_173475	NP_775746			DCN1, defective in cullin neddylation 1, domain						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of apoptosis|response to gamma radiation|response to UV-C	perinuclear region of cytoplasm				ovary(2)	2				GBM - Glioblastoma multiforme(48;0.249)														---	---	---	---
KIF22	3835	broad.mit.edu	37	16	29802091	29802091	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29802091G>A	uc002dts.3	+	1	35	c.11G>A	c.(10-12)GGC>GAC	p.G4D	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_5'UTR|KIF22_uc010vdw.1_5'Flank	NM_007317	NP_015556	Q14807	KIF22_HUMAN	kinesin family member 22	4					blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding				0																		---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61747758	61747758	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61747758G>C	uc002eog.1	-	10	1893	c.1641C>G	c.(1639-1641)ATC>ATG	p.I547M		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	547	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61935315	61935315	+	Silent	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61935315A>C	uc002eog.1	-	3	567	c.315T>G	c.(313-315)GCT>GCG	p.A105A		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	105	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
ARRB2	409	broad.mit.edu	37	17	4623596	4623596	+	Splice_Site	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4623596T>G	uc002fyj.2	+	12	1229	c.1001_splice	c.e12+2	p.G334_splice	ARRB2_uc002fyk.2_Splice_Site_p.G319_splice|ARRB2_uc002fyl.2_Splice_Site_p.G334_splice|ARRB2_uc010vsg.1_Splice_Site_p.G355_splice|ARRB2_uc002fym.2_Splice_Site_p.G319_splice|ARRB2_uc002fyn.2_Splice_Site_p.G142_splice|ARRB2_uc010ckq.2_Splice_Site_p.G142_splice|ARRB2_uc002fyo.2_Splice_Site_p.G142_splice	NM_004313	NP_004304			arrestin, beta 2 isoform 1						cell chemotaxis|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|G-protein coupled receptor internalization|negative regulation of natural killer cell mediated cytotoxicity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway	coated pit|cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	angiotensin receptor binding|ubiquitin protein ligase binding				0																		---	---	---	---
USP6	9098	broad.mit.edu	37	17	5033938	5033938	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5033938C>A	uc002gau.1	+	11	2344	c.114C>A	c.(112-114)CCC>CCA	p.P38P	USP6_uc002gav.1_Silent_p.P38P|USP6_uc010ckz.1_5'UTR|USP6_uc002gaw.2_Silent_p.P38P	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	38					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5								T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578431	7578431	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578431G>A	uc002gim.2	-	5	693	c.499C>T	c.(499-501)CAG>TAG	p.Q167*	TP53_uc002gig.1_Nonsense_Mutation_p.Q167*|TP53_uc002gih.2_Nonsense_Mutation_p.Q167*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.Q35*|TP53_uc010cng.1_Nonsense_Mutation_p.Q35*|TP53_uc002gii.1_Nonsense_Mutation_p.Q35*|TP53_uc010cnh.1_Nonsense_Mutation_p.Q167*|TP53_uc010cni.1_Nonsense_Mutation_p.Q167*|TP53_uc002gij.2_Nonsense_Mutation_p.Q167*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.Q74*|TP53_uc002gio.2_Nonsense_Mutation_p.Q35*|TP53_uc010vug.1_Nonsense_Mutation_p.Q128*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	167	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		QH -> HD (in a sporadic cancer; somatic mutation).|Q -> K (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Q167*(19)|p.Q167fs*14(8)|p.0?(7)|p.Q167R(4)|p.Q167L(3)|p.Q167H(3)|p.Q167Q(3)|p.Q167fs*13(3)|p.Q167fs*3(3)|p.K164fs*3(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.Q167K(1)|p.Y163fs*1(1)|p.P151_V173del23(1)|p.Q167E(1)|p.Q167del(1)|p.Q167fs*12(1)|p.S149fs*72(1)|p.Q167_H168>HD(1)|p.Q167_H168>YL(1)|p.Q167fs*4(1)|p.Q165_M169delQSQHM(1)|p.A159_Q167delAMAIYKQSQ(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
FLCN	201163	broad.mit.edu	37	17	17127308	17127308	+	Silent	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17127308G>T	uc002gra.3	-	6	1050	c.546C>A	c.(544-546)CTC>CTA	p.L182L	PLD6_uc010cpn.2_Intron|FLCN_uc002grb.3_Silent_p.L182L	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	182					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3														Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19687073	19687073	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19687073G>A	uc002gwm.3	-	22	2906	c.2397C>T	c.(2395-2397)CCC>CCT	p.P799P	ULK2_uc002gwn.2_Silent_p.P799P	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	799					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
UTP6	55813	broad.mit.edu	37	17	30207692	30207692	+	Silent	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30207692T>C	uc002hgr.2	-	11	950	c.867A>G	c.(865-867)GAA>GAG	p.E289E	UTP6_uc002hgq.2_Silent_p.E105E|UTP6_uc010cst.2_Silent_p.E138E|UTP6_uc010wbw.1_Silent_p.E289E	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66	289					rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)																---	---	---	---
RAPGEFL1	51195	broad.mit.edu	37	17	38346698	38346698	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38346698T>C	uc010cwu.1	+	7	999	c.509T>C	c.(508-510)CTC>CCC	p.L170P	RAPGEFL1_uc010wfd.1_Missense_Mutation_p.L106P	NM_016339	NP_057423	Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor	376					G-protein coupled receptor protein signaling pathway|nervous system development|small GTPase mediated signal transduction	intracellular|membrane fraction	guanyl-nucleotide exchange factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
KRT33A	3883	broad.mit.edu	37	17	39506755	39506755	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39506755G>A	uc002hwk.1	-	1	302	c.265C>T	c.(265-267)CGG>TGG	p.R89W		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	89	Coil 1A.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
ABCC3	8714	broad.mit.edu	37	17	48735826	48735826	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48735826C>A	uc002isl.2	+	6	723	c.643C>A	c.(643-645)CTC>ATC	p.L215I	ABCC3_uc002isk.3_Missense_Mutation_p.L215I	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	215	Cytoplasmic (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)													---	---	---	---
PRPSAP1	5635	broad.mit.edu	37	17	74328423	74328423	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74328423G>A	uc010wta.1	-	4	830	c.384C>T	c.(382-384)TTC>TTT	p.F128F	PRPSAP1_uc010wtb.1_Silent_p.F25F	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	99					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1																		---	---	---	---
HEXDC	284004	broad.mit.edu	37	17	80391686	80391686	+	Silent	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80391686C>A	uc002kew.2	+	4	486	c.435C>A	c.(433-435)ATC>ATA	p.I145I	HEXDC_uc002kev.3_Silent_p.I145I|HEXDC_uc010diq.2_Silent_p.I145I|HEXDC_uc010wvm.1_RNA			Q8WVB3	HEXDC_HUMAN	SubName: Full=Hexosaminidase (Glycosyl hydrolase family 20, catalytic domain) containing, isoform CRA_c; SubName: Full=Hexosaminidase D;	145					carbohydrate metabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|cation binding			ovary(1)|skin(1)	2	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)															---	---	---	---
ROCK1	6093	broad.mit.edu	37	18	18539829	18539829	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18539829A>G	uc002kte.2	-	29	4425	c.3484T>C	c.(3484-3486)TCC>CCC	p.S1162P		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1162	PH.|Auto-inhibitory.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)																	---	---	---	---
ASXL3	80816	broad.mit.edu	37	18	31319396	31319396	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31319396G>A	uc010dmg.1	+	11	2083	c.2028G>A	c.(2026-2028)TTG>TTA	p.L676L	ASXL3_uc002kxq.2_Silent_p.L383L	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	676	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
SHC2	25759	broad.mit.edu	37	19	422149	422149	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:422149G>A	uc002loq.3	-	11	1617	c.1617C>T	c.(1615-1617)GGC>GGT	p.G539G	SHC2_uc002lop.3_Silent_p.G280G	NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)	539	SH2.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9007487	9007487	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9007487T>C	uc002mkp.2	-	43	39685	c.39481A>G	c.(39481-39483)ACC>GCC	p.T13161A	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13163	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
C3P1	388503	broad.mit.edu	37	19	10160750	10160750	+	Intron	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10160750G>A	uc010dwx.1	+							NR_027300				Synthetic construct DNA, clone: pF1KB7402, Homo sapiens LOC388503 gene, without stop codon, in Flexi system.												0																		---	---	---	---
ELAVL3	1995	broad.mit.edu	37	19	11565551	11565551	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565551G>A	uc002mry.1	-	7	1274	c.894C>T	c.(892-894)AGC>AGT	p.S298S	ELAVL3_uc002mrx.1_Silent_p.S291S	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	298	RRM 3.				cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
SLC1A6	6511	broad.mit.edu	37	19	15067316	15067316	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15067316G>T	uc002naa.1	-	6	1149	c.1141C>A	c.(1141-1143)CTC>ATC	p.L381I	SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Missense_Mutation_p.L317I	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	381	Helical; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
CCDC105	126402	broad.mit.edu	37	19	15121880	15121880	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15121880C>T	uc002nae.2	+	1	342	c.243C>T	c.(241-243)GGC>GGT	p.G81G	SLC1A6_uc010xod.1_5'Flank	NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	81					microtubule cytoskeleton organization	microtubule				ovary(1)	1																		---	---	---	---
EPHX3	79852	broad.mit.edu	37	19	15342603	15342603	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15342603C>T	uc002nap.2	-	2	522	c.313G>A	c.(313-315)GGC>AGC	p.G105S	EPHX3_uc002naq.2_Missense_Mutation_p.G105S	NM_024794	NP_079070	Q9H6B9	EPHX3_HUMAN	abhydrolase domain containing 9 precursor	105						extracellular region	hydrolase activity				0																		---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17091331	17091331	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17091331G>A	uc002nfb.2	-	14	1734	c.1702C>T	c.(1702-1704)CGT>TGT	p.R568C		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	521						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
ZNF257	113835	broad.mit.edu	37	19	22271975	22271975	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271975A>T	uc010ecx.2	+	4	1592	c.1423A>T	c.(1423-1425)ACT>TCT	p.T475S	ZNF257_uc010ecy.2_Missense_Mutation_p.T443S	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	475	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF257	113835	broad.mit.edu	37	19	22272025	22272025	+	Silent	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22272025A>G	uc010ecx.2	+	4	1642	c.1473A>G	c.(1471-1473)GAA>GAG	p.E491E	ZNF257_uc010ecy.2_Silent_p.E459E	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	491	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF536	9745	broad.mit.edu	37	19	30935907	30935907	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30935907G>A	uc002nsu.1	+	2	1576	c.1438G>A	c.(1438-1440)GTC>ATC	p.V480I	ZNF536_uc010edd.1_Missense_Mutation_p.V480I	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	480					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)																	---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38946021	38946021	+	Intron	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38946021C>T	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41000878	41000878	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41000878G>A	uc002ony.2	+	6	748	c.662G>A	c.(661-663)CGG>CAG	p.R221Q	SPTBN4_uc002onx.2_Missense_Mutation_p.R221Q|SPTBN4_uc002onz.2_Missense_Mutation_p.R221Q	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	221	Actin-binding.|CH 2.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
SIGLEC7	27036	broad.mit.edu	37	19	51646068	51646068	+	Intron	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51646068C>T	uc002pvv.1	+						SIGLEC7_uc002pvw.1_Intron|SIGLEC7_uc010eoq.1_Intron|SIGLEC7_uc010eor.1_Intron	NM_014385	NP_055200			sialic acid binding Ig-like lectin 7 isoform 1						cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)														---	---	---	---
TGM3	7053	broad.mit.edu	37	20	2321089	2321089	+	Silent	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2321089C>T	uc002wfx.3	+	13	2041	c.1944C>T	c.(1942-1944)ACC>ACT	p.T648T		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	648					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)													---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34501210	34501210	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34501210A>G	uc002xek.1	+	11	1712	c.1601A>G	c.(1600-1602)AAG>AGG	p.K534R	PHF20_uc002xei.1_Missense_Mutation_p.K534R|PHF20_uc010gfo.1_Missense_Mutation_p.K534R|PHF20_uc002xej.1_Missense_Mutation_p.K418R|PHF20_uc002xem.1_RNA	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	534	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
MATN4	8785	broad.mit.edu	37	20	43926920	43926920	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43926920G>A	uc002xnn.2	-	7	1503	c.1316C>T	c.(1315-1317)GCG>GTG	p.A439V	MATN4_uc002xno.2_Missense_Mutation_p.A398V|MATN4_uc002xnp.2_Missense_Mutation_p.A357V|MATN4_uc010zwr.1_Missense_Mutation_p.A387V|MATN4_uc002xnr.1_Missense_Mutation_p.A439V	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	480	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50139845	50139845	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50139845G>A	uc002xwd.2	-	2	1155	c.935C>T	c.(934-936)ACG>ATG	p.T312M	NFATC2_uc002xwc.2_Missense_Mutation_p.T312M|NFATC2_uc010zyv.1_Missense_Mutation_p.T93M|NFATC2_uc010zyw.1_Missense_Mutation_p.T93M|NFATC2_uc010zyx.1_Missense_Mutation_p.T292M|NFATC2_uc010zyy.1_Missense_Mutation_p.T93M|NFATC2_uc010zyz.1_Missense_Mutation_p.T93M|NFATC2_uc002xwe.2_Missense_Mutation_p.T292M	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	312					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
ZNF217	7764	broad.mit.edu	37	20	52193274	52193274	+	Silent	SNP	T	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52193274T>G	uc002xwq.3	-	3	2300	c.2029A>C	c.(2029-2031)AGG>CGG	p.R677R	ZNF217_uc010gij.1_Silent_p.R669R	NM_006526	NP_006517	O75362	ZN217_HUMAN	zinc finger protein 217	677					negative regulation of transcription, DNA-dependent	histone deacetylase complex	protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|lung(1)|breast(1)	6	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)															---	---	---	---
RAE1	8480	broad.mit.edu	37	20	55949675	55949675	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55949675G>A	uc002xyg.2	+	11	1179	c.838G>A	c.(838-840)GCG>ACG	p.A280T	RAE1_uc010gis.1_Missense_Mutation_p.A233T|RAE1_uc010git.1_Missense_Mutation_p.A280T|RAE1_uc002xyh.2_Missense_Mutation_p.A280T|RAE1_uc002xyi.2_Missense_Mutation_p.A280T	NM_003610	NP_003601	P78406	RAE1L_HUMAN	RAE1 (RNA export 1, S.pombe) homolog	280	WD 4.				carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)															---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60887023	60887023	+	Silent	SNP	G	A	A	rs139135120		TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60887023G>A	uc002ycq.2	-	70	9655	c.9588C>T	c.(9586-9588)TTC>TTT	p.F3196F		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3196	Laminin G-like 3.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62191686	62191686	+	Intron	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62191686G>A	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412			PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10906954	10906954	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906954A>C	uc002yip.1	-	24	1975	c.1607T>G	c.(1606-1608)CTT>CGT	p.L536R	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.L518R|TPTE_uc002yir.1_Missense_Mutation_p.L498R|TPTE_uc010gkv.1_Missense_Mutation_p.L398R	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	536	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
DONSON	29980	broad.mit.edu	37	21	34957049	34957049	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34957049C>G	uc002ysk.2	-	4	699	c.632G>C	c.(631-633)CGT>CCT	p.R211P	DONSON_uc002ysn.1_Missense_Mutation_p.R94P|DONSON_uc002ysi.1_Intron|DONSON_uc002ysj.2_5'UTR|DONSON_uc002ysl.2_5'UTR|DONSON_uc010gme.2_Missense_Mutation_p.R184P|DONSON_uc002ysm.2_Missense_Mutation_p.R211P	NM_017613	NP_060083	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	211					multicellular organismal development	nucleus				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22937246	22937246	+	Intron	SNP	C	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22937246C>T	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																OREG0026367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ELFN2	114794	broad.mit.edu	37	22	37769783	37769783	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37769783G>A	uc003asq.3	-	3	2578	c.1792C>T	c.(1792-1794)CGG>TGG	p.R598W		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	598	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)																	---	---	---	---
KCNJ4	3761	broad.mit.edu	37	22	38823394	38823394	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38823394G>A	uc003avs.1	-	2	841	c.744C>T	c.(742-744)ATC>ATT	p.I248I	KCNJ4_uc003avt.1_Silent_p.I248I	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	248	Cytoplasmic (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)																	---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	43926804	43926804	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43926804A>T	uc003bdy.1	-	31	4489	c.4274T>A	c.(4273-4275)CTG>CAG	p.L1425Q	EFCAB6_uc003bdz.1_Missense_Mutation_p.L1273Q|EFCAB6_uc010gzi.1_Missense_Mutation_p.L1273Q	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	1425	Interaction with AR.|Interaction with PARK7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
CERK	64781	broad.mit.edu	37	22	47116796	47116796	+	Intron	SNP	C	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47116796C>G	uc003bia.2	-							NM_022766	NP_073603			ceramide kinase						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)														---	---	---	---
P2RY8	286530	broad.mit.edu	37	X	1585028	1585028	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585028C>A	uc004cpz.2	-	2	672	c.424G>T	c.(424-426)GCC>TCC	p.A142S		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	142	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)						T	CRLF2	B-ALL|Downs associated ALL								---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12736052	12736052	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12736052G>C	uc004cuz.1	+	16	3613	c.3107G>C	c.(3106-3108)GGG>GCG	p.G1036A	FRMPD4_uc011mij.1_Missense_Mutation_p.G1028A	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1036					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
FANCB	2187	broad.mit.edu	37	X	14883234	14883234	+	Silent	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14883234G>A	uc004cwg.1	-	3	667	c.399C>T	c.(397-399)GGC>GGT	p.G133G	FANCB_uc004cwh.1_Silent_p.G133G	NM_001018113	NP_001018123	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	133					DNA repair	nucleoplasm				lung(1)	1	Hepatocellular(33;0.183)												Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
NHS	4810	broad.mit.edu	37	X	17745707	17745707	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17745707G>A	uc004cxx.2	+	6	3756	c.3418G>A	c.(3418-3420)GAT>AAT	p.D1140N	NHS_uc011mix.1_Missense_Mutation_p.D1161N|NHS_uc004cxy.2_Missense_Mutation_p.D984N|NHS_uc004cxz.2_Missense_Mutation_p.D963N|NHS_uc004cya.2_Missense_Mutation_p.D863N	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1140						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)																	---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29417401	29417401	+	Silent	SNP	A	C	C			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29417401A>C	uc004dby.2	+	5	1187	c.679A>C	c.(679-681)AGA>CGA	p.R227R		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	227	Ig-like C2-type 2.|Extracellular (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
MAOA	4128	broad.mit.edu	37	X	43603732	43603732	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43603732A>T	uc004dfy.2	+	15	1737	c.1556A>T	c.(1555-1557)TAC>TTC	p.Y519F	MAOA_uc011mkw.1_Missense_Mutation_p.Y386F	NM_000240	NP_000231	P21397	AOFA_HUMAN	monoamine oxidase A	519	Mitochondrial intermembrane.				behavior|neurotransmitter biosynthetic process|neurotransmitter catabolic process|neurotransmitter secretion|xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	primary amine oxidase activity|protein binding			breast(2)|ovary(1)	3					Almotriptan(DB00918)|Carbidopa(DB00190)|Clonazepam(DB01068)|Dopamine(DB00988)|Fluvoxamine(DB00176)|Ginkgo biloba(DB01381)|Imipramine(DB00458)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Linezolid(DB00601)|Lorazepam(DB00186)|Moclobemide(DB01171)|Nicotine(DB00184)|Norepinephrine(DB00368)|Phenelzine(DB00780)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Rasagiline(DB01367)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)													---	---	---	---
PABPC5	140886	broad.mit.edu	37	X	90690690	90690690	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90690690C>A	uc004efg.2	+	2	554	c.114C>A	c.(112-114)TTC>TTA	p.F38L	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	38	RRM 1.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
PABPC5	140886	broad.mit.edu	37	X	90690691	90690691	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4366-01	TCGA-BR-4366-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90690691A>G	uc004efg.2	+	2	555	c.115A>G	c.(115-117)AGG>GGG	p.R39G	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	39	RRM 1.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
