Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
DNAJC16	23341	broad.mit.edu	37	1	15891040	15891041	+	Intron	INS	-	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15891040_15891041insT	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron|DNAJC16_uc001awu.2_Intron	NM_015291	NP_056106			DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)														---	---	---	---
FBLIM1	54751	broad.mit.edu	37	1	16103362	16103362	+	Intron	DEL	A	-	-	rs36071270		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16103362delA	uc001axd.1	+						FBLIM1_uc001axe.1_Intron|FBLIM1_uc001axf.2_Intron|FBLIM1_uc001axh.1_Intron|FBLIM1_uc001axi.1_Intron	NM_017556	NP_060026			filamin-binding LIM protein-1 isoform a						cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	26282101	26282102	+	IGR	INS	-	AAGG	AAGG	rs10653543		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26282101_26282102insAAGG								STMN1 (48733 upstream) : PAFAH2 (4158 downstream)																																			---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174210530	174210531	+	Intron	INS	-	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174210530_174210531insT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234439746	234439749	+	Intron	DEL	TCCT	-	-	rs67328305		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234439746_234439749delTCCT	uc001hwa.1	+						SLC35F3_uc001hvy.1_Intron	NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																																			---	---	---	---
NCAPH	23397	broad.mit.edu	37	2	97017424	97017424	+	Intron	DEL	C	-	-	rs772153		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97017424delC	uc002svz.1	+						NCAPH_uc010fhu.1_Intron|NCAPH_uc010fhv.1_Intron|NCAPH_uc010yum.1_Intron|NCAPH_uc010fhw.1_Intron|NCAPH_uc010yun.1_Intron|NCAPH_uc002swa.1_Intron	NM_015341	NP_056156			non-SMC condensin I complex, subunit H						cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)																---	---	---	---
TMEM87B	84910	broad.mit.edu	37	2	112870703	112870706	+	Intron	DEL	TACT	-	-	rs142414944		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112870703_112870706delTACT	uc002thm.2	+							NM_032824	NP_116213			transmembrane protein 87B precursor							integral to membrane					0																		---	---	---	---
DFNB59	494513	broad.mit.edu	37	2	179322311	179322312	+	Intron	INS	-	GGTCCCTCCCACC	GGTCCCTCCCACC	rs143243913	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179322311_179322312insGGTCCCTCCCACC	uc002umi.3	+						DFNB59_uc002umj.3_Intron	NM_001042702	NP_001036167			deafness, autosomal recessive 59						sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	206981155	206981155	+	RNA	DEL	C	-	-	rs71410864		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206981155delC	uc002vbc.1	-	1		c.1134delG								Homo sapiens cDNA FLJ35491 fis, clone SMINT2008625, moderately similar to GLYCINE CLEAVAGE SYSTEM H PROTEIN PRECURSOR.																														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41841867	41841869	+	Intron	DEL	ATG	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41841867_41841869delATG	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
C3orf79	152118	broad.mit.edu	37	3	153220371	153220371	+	3'UTR	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153220371delA	uc003ezt.2	+	3						NM_001101337	NP_001094807			chromosome 3 open reading frame 79												0																		---	---	---	---
C3orf55	152078	broad.mit.edu	37	3	157295937	157295938	+	Intron	INS	-	T	T	rs112996272		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157295937_157295938insT	uc003fbp.3	+						C3orf55_uc003fbo.2_Intron|C3orf55_uc011bot.1_Intron|C3orf55_uc010hvv.2_Intron	NM_001130002	NP_001123474			hypothetical protein LOC152078 isoform 1												0			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)															---	---	---	---
ATP13A5	344905	broad.mit.edu	37	3	193069205	193069207	+	Intron	DEL	GAG	-	-	rs138530610		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193069205_193069207delGAG	uc011bsq.1	-							NM_198505	NP_940907			ATPase type 13A5						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	66084344	66084344	+	IGR	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66084344delA								TECRL (809166 upstream) : EPHA5 (100938 downstream)																																			---	---	---	---
ADH5	128	broad.mit.edu	37	4	100009952	100009953	+	5'Flank	INS	-	GG	GG	rs145470085	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100009952_100009953insGG	uc003hui.2	-						ADH5_uc003huk.1_5'Flank|uc003hum.1_5'Flank|uc003hul.1_5'Flank	NM_000671	NP_000662			class III alcohol dehydrogenase, chi subunit						ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	2681739	2681740	+	IGR	INS	-	AAGG	AAGG	rs139363319	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2681739_2681740insAAGG								IRX4 (798859 upstream) : IRX2 (64541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	180708776	180708777	+	IGR	INS	-	G	G	rs140221514		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180708776_180708777insG								TRIM52 (20657 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	857803	857804	+	IGR	INS	-	ATCC	ATCC			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:857803_857804insATCC								EXOC2 (164694 upstream) : LOC285768 (103438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	101557327	101557330	+	IGR	DEL	CTTT	-	-	rs147020004	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101557327_101557330delCTTT								ASCC3 (228103 upstream) : GRIK2 (289575 downstream)																																			---	---	---	---
MOXD1	26002	broad.mit.edu	37	6	132705422	132705422	+	Intron	DEL	T	-	-	rs68134926		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132705422delT	uc003qdf.2	-							NM_015529	NP_056344			monooxygenase, DBH-like 1 isoform 2						catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	148619804	148619811	+	IGR	DEL	AGGAAGGA	-	-	rs144377160	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148619804_148619811delAGGAAGGA								SAMD5 (728647 upstream) : SASH1 (43918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1320766	1320771	+	IGR	DEL	AGCAGC	-	-	rs66672762		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1320766_1320771delAGCAGC								UNCX (44154 upstream) : MICALL2 (153225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	31404676	31404676	+	IGR	DEL	A	-	-	rs35317967		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31404676delA								NEUROD6 (24138 upstream) : CCDC129 (149009 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77807188	77807188	+	Intron	DEL	A	-	-	rs113984102		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77807188delA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
PEX1	5189	broad.mit.edu	37	7	92136560	92136560	+	Intron	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92136560delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457			peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)															---	---	---	---
TECPR1	25851	broad.mit.edu	37	7	97862098	97862098	+	Intron	DEL	A	-	-	rs139511001		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97862098delA	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210			tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	101967482	101967482	+	IGR	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101967482delA								SH2B2 (5305 upstream) : SPDYE6 (18711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	102022901	102022902	+	Intron	INS	-	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102022901_102022902insA	uc003uzd.1	+						uc003uze.1_Intron|PRKRIP1_uc003uzf.2_Intron|PRKRIP1_uc003uzg.2_Intron|PRKRIP1_uc011kkq.1_Intron	NM_001003686	NP_001003686			SubName: Full=Putative uncharacterized protein PMS2L3;																														---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913			carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
PODXL	5420	broad.mit.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	-	-	rs11277659		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131241030_131241035delGGCGAC	uc003vqw.3	-	1	342_347	c.84_89delGTCGCC	c.(82-90)CCGTCGCCC>CCC	p.28_30PSP>P	PODXL_uc003vqx.3_In_Frame_Del_p.28_30PSP>P	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	28_30	Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)																	---	---	---	---
ZDHHC2	51201	broad.mit.edu	37	8	17067346	17067347	+	Intron	DEL	AG	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17067346_17067347delAG	uc003wxe.2	+							NM_016353	NP_057437			zinc finger, DHHC-type containing 2							integral to membrane	acyltransferase activity|zinc ion binding				0				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26290434	26290435	+	IGR	INS	-	A	A	rs114412722		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26290434_26290435insA								BNIP3L (19790 upstream) : PNMA2 (71761 downstream)																																			---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38092287	38092288	+	Intron	INS	-	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38092287_38092288insT	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029			DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	61231937	61231940	+	IGR	DEL	GAAG	-	-	rs13276801	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61231937_61231940delGAAG								CA8 (37983 upstream) : RAB2A (197619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80796047	80796050	+	IGR	DEL	TCTC	-	-	rs67217941	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80796047_80796050delTCTC								HEY1 (115949 upstream) : MRPS28 (35046 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114031440	114031441	+	Intron	INS	-	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114031440_114031441insA	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133492918	133492918	+	5'UTR	DEL	C	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133492918delC	uc003ytj.2	-	1					KCNQ3_uc010mdt.2_5'UTR	NM_004519	NP_004510			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
CREB3	10488	broad.mit.edu	37	9	35736206	35736207	+	Intron	INS	-	T	T	rs111550329		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35736206_35736207insT	uc003zxv.2	+						CREB3_uc010mla.2_Intron	NM_006368	NP_006359			cAMP responsive element binding protein 3						chemotaxis|induction of positive chemotaxis|interspecies interaction between organisms|negative regulation of cell cycle|positive regulation of calcium ion transport|positive regulation of cell migration|positive regulation of transcription, DNA-dependent|reactivation of latent virus|regulation of cell proliferation	cytosol|endoplasmic reticulum|endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|integral to membrane|nucleus|nucleus	cAMP response element binding protein binding|CCR1 chemokine receptor binding|DNA binding|protein dimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity				0	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)	GBM - Glioblastoma multiforme(74;0.0285)												OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78790207	78790208	+	Intron	INS	-	GAATA	GAATA	rs10124596		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790207_78790208insGAATA	uc004ajz.2	+						PCSK5_uc004ajy.2_Frame_Shift_Ins_p.R688fs|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	27620447	27620448	+	IGR	INS	-	TT	TT	rs142562667	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27620447_27620448insTT								LOC387646 (79212 upstream) : PTCHD3 (66669 downstream)																																			---	---	---	---
ADK	132	broad.mit.edu	37	10	76131925	76131926	+	Intron	DEL	AG	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76131925_76131926delAG	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
ALDH18A1	5832	broad.mit.edu	37	10	97380692	97380692	+	Intron	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97380692delA	uc001kkz.2	-						ALDH18A1_uc001kky.2_Intron|ALDH18A1_uc010qog.1_Intron|ALDH18A1_uc010qoh.1_Intron	NM_002860	NP_002851			pyrroline-5-carboxylate synthetase isoform 1						proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	98510681	98510681	+	IGR	DEL	A	-	-	rs3179754		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98510681delA								PIK3AP1 (30402 upstream) : MIR607 (77745 downstream)																																			---	---	---	---
SFRP5	6425	broad.mit.edu	37	10	99531565	99531567	+	In_Frame_Del	DEL	CCC	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99531565_99531567delCCC	uc001kor.3	-	1	190_192	c.24_26delGGG	c.(22-27)GGGGGC>GGC	p.8_9GG>G		NM_003015	NP_003006	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5 precursor	8_9					apoptosis|brain development|cell differentiation|embryo development|establishment or maintenance of cell polarity|gonad development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of protein kinase B signaling cascade|negative regulation of sequence-specific DNA binding transcription factor activity|vasculature development|visual perception	cytoplasm|extracellular space|plasma membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)														---	---	---	---
SMC3	9126	broad.mit.edu	37	10	112328618	112328621	+	Intron	DEL	AAAC	-	-	rs112392893		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112328618_112328621delAAAC	uc001kze.2	+							NM_005445	NP_005436			structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3733640	3733641	+	Intron	INS	-	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3733640_3733641insA	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_3'UTR|NUP98_uc001lyk.1_3'UTR	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	11	64211760	64211763	+	IGR	DEL	TTCC	-	-	rs7943485	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64211760_64211763delTTCC								RPS6KA4 (72074 upstream) : SLC22A11 (111335 downstream)																																			---	---	---	---
CCDC83	220047	broad.mit.edu	37	11	85606308	85606308	+	Intron	DEL	T	-	-	rs11357574		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85606308delT	uc001pbh.1	+						CCDC83_uc001pbg.1_Intron|CCDC83_uc001pbi.1_Intron|CCDC83_uc001pbj.1_Intron	NM_173556	NP_775827			coiled-coil domain containing 83											skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)																---	---	---	---
MMP12	4321	broad.mit.edu	37	11	102737945	102737945	+	Intron	DEL	A	-	-	rs28381681		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102737945delA	uc001phk.2	-							NM_002426	NP_002417			matrix metalloproteinase 12 preproprotein						positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21242745	21242746	+	Intron	INS	-	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242745_21242746insT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron					SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
ANKRD13A	88455	broad.mit.edu	37	12	110473900	110473902	+	Intron	DEL	TGT	-	-	rs113289184		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110473900_110473902delTGT	uc001tpx.2	+						ANKRD13A_uc010sxw.1_Intron|ANKRD13A_uc001tpy.2_Intron|ANKRD13A_uc001tpz.2_Intron|ANKRD13A_uc001tqa.2_Intron	NM_033121	NP_149112			ankyrin repeat domain 13												0																		---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110821801	110821804	+	Intron	DEL	AAGA	-	-	rs3832902		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110821801_110821804delAAGA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836			alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
Unknown	0	broad.mit.edu	37	14	97532376	97532395	+	IGR	DEL	TTCCTTCCTTCCTTCCTTCC	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97532376_97532395delTTCCTTCCTTCCTTCCTTCC								VRK1 (184426 upstream) : C14orf64 (859552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98311208	98311211	+	IGR	DEL	GAAG	-	-	rs111619571	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98311208_98311211delGAAG								VRK1 (963258 upstream) : C14orf64 (80736 downstream)																																			---	---	---	---
BEGAIN	57596	broad.mit.edu	37	14	101013118	101013121	+	Intron	DEL	CACA	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101013118_101013121delCACA	uc010txa.1	-						BEGAIN_uc001yhp.2_Splice_Site|BEGAIN_uc001yhq.2_Intron	NM_001159531	NP_001153003			brain-enriched guanylate kinase-associated							cytoplasm|membrane	protein binding				0		Melanoma(154;0.212)																---	---	---	---
KIAA0284	283638	broad.mit.edu	37	14	105344200	105344203	+	Intron	DEL	CCCG	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105344200_105344203delCCCG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_5'Flank	NM_001112726	NP_001106197			hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	28913367	28913367	+	Intron	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28913367delT	uc010azc.2	+						uc010uao.1_Intron					Homo sapiens I.M.A.G.E. clone 321824, mRNA sequence.																														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33923503	33923503	+	Intron	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33923503delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
TMOD2	29767	broad.mit.edu	37	15	52074692	52074703	+	Intron	DEL	ACACTCAGAGGT	-	-	rs3838853		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52074692_52074703delACACTCAGAGGT	uc002abk.2	+						TMOD2_uc002abl.3_Intron|TMOD2_uc010bfb.2_Intron	NM_014548	NP_055363			neuronal tropomodulin isoform a						nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)														---	---	---	---
SIN3A	25942	broad.mit.edu	37	15	75722399	75722399	+	Intron	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75722399delT	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron|SIN3A_uc002bak.3_Intron	NM_015477	NP_056292			transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32490434	32490434	+	IGR	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32490434delT								HERC2P4 (326560 upstream) : TP53TG3B (194407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32989896	32989897	+	IGR	DEL	TA	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32989896_32989897delTA								SLC6A10P (93433 upstream) : MIR1826 (975611 downstream)																																			---	---	---	---
ABCC12	94160	broad.mit.edu	37	16	48167439	48167439	+	Intron	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167439delA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229			ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)																---	---	---	---
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451453	7451454	+	5'Flank	INS	-	GTCC	GTCC			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451453_7451454insGTCC	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086			TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)																---	---	---	---
C17orf76	388341	broad.mit.edu	37	17	16359634	16359636	+	Intron	DEL	AGA	-	-	rs62076299		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16359634_16359636delAGA	uc010cph.1	-						C17orf76_uc002gqh.2_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron	NM_001113567	NP_001107039			hypothetical protein LOC388341 isoform 1												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	20488023	20488025	+	IGR	DEL	CTC	-	-	rs76850913		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20488023_20488025delCTC								LGALS9B (117175 upstream) : CCDC144NL (278685 downstream)																																			---	---	---	---
UBE2Z	65264	broad.mit.edu	37	17	47000129	47000129	+	Intron	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47000129delA	uc002ioi.2	+							NM_023079	NP_075567			ubiquitin-conjugating enzyme E2Z						apoptosis	cytoplasm|nucleus	ATP binding|ubiquitin-protein ligase activity				0																		---	---	---	---
KIAA1012	22878	broad.mit.edu	37	18	29429382	29429382	+	Intron	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29429382delA	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron	NM_014939	NP_055754			hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0																		---	---	---	---
C18orf34	374864	broad.mit.edu	37	18	30913034	30913034	+	Intron	DEL	A	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30913034delA	uc002kxn.2	-						C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Intron	NM_001105528	NP_001098998			hypothetical protein LOC374864 isoform 1											ovary(1)	1																		---	---	---	---
ATP8B1	5205	broad.mit.edu	37	18	55328853	55328858	+	Intron	DEL	GTGTGC	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55328853_55328858delGTGTGC	uc002lgw.2	-						uc002lgu.1_Intron|uc002lgv.1_Intron	NM_005603	NP_005594			ATPase, class I, type 8B, member 1						ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)												Byler_disease				---	---	---	---
C19orf10	56005	broad.mit.edu	37	19	4668862	4668862	+	Intron	DEL	T	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668862delT	uc002may.2	-							NM_019107	NP_061980			hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)														---	---	---	---
EPS15L1	58513	broad.mit.edu	37	19	16513372	16513373	+	Intron	DEL	AC	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16513372_16513373delAC	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpe.1_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron|EPS15L1_uc002neb.1_Intron|EPS15L1_uc002nec.1_Intron	NM_021235	NP_067058			epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5																		---	---	---	---
C19orf2	8725	broad.mit.edu	37	19	30502335	30502336	+	Intron	INS	-	T	T	rs113291705		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30502335_30502336insT	uc002nsr.2	+						C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_Intron|C19orf2_uc002nst.2_Intron	NM_003796	NP_003787			RPB5-mediating protein isoform a						protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
SUV420H2	84787	broad.mit.edu	37	19	55854541	55854542	+	Intron	INS	-	GCCCCTGCCCCT	GCCCCTGCCCCT	rs139540072	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55854541_55854542insGCCCCTGCCCCT	uc002qkj.3	+						SUV420H2_uc010esx.1_3'UTR|SUV420H2_uc002qkk.1_3'UTR|SUV420H2_uc002qkl.2_Intron	NM_032701	NP_116090			suppressor of variegation 4-20 homolog 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding				0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)														---	---	---	---
FKBP1A	2280	broad.mit.edu	37	20	1332941	1332942	+	Intron	INS	-	T	T	rs35712372		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1332941_1332942insT	uc010gac.2	-						uc002wew.2_Intron|uc002wex.2_Intron					Homo sapiens FKBP12-Exip2 mRNA for FK506 binding protein12, complete cds.						'de novo' protein folding|beta-amyloid formation|fibril organization|heart trabecula formation|negative regulation of protein phosphatase type 2B activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein binding|positive regulation of protein ubiquitination|protein maturation by protein folding|protein refolding|regulation of activin receptor signaling pathway|regulation of immune response|regulation of ryanodine-sensitive calcium-release channel activity|SMAD protein complex assembly|T cell activation|ventricular cardiac muscle tissue morphogenesis	axon|cytosol|sarcoplasmic reticulum membrane|terminal cisterna	activin binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity|signal transducer activity|SMAD binding|type I transforming growth factor beta receptor binding				0					Pimecrolimus(DB00337)|Sirolimus(DB00877)|Tacrolimus(DB00864)													---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45220862	45220863	+	Intron	INS	-	CATA	CATA	rs142792823	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45220862_45220863insCATA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58455613	58455614	+	Intron	INS	-	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58455613_58455614insA	uc002yaz.2	-							NM_014258	NP_055073			synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	39994293	39994294	+	Intron	INS	-	GCCCT	GCCCT	rs148307297	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39994293_39994294insGCCCT	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3247360	3247361	+	Intron	INS	-	GAAG	GAAG			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3247360_3247361insGAAG	uc004crg.3	-							NM_015419	NP_056234			adlican precursor							extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
EGFL6	25975	broad.mit.edu	37	X	13618385	13618386	+	Intron	INS	-	TTCT	TTCT	rs71913558		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13618385_13618386insTTCT	uc004cvi.2	+						EGFL6_uc004cvj.2_Intron|EGFL6_uc011mik.1_Intron	NM_015507	NP_056322			epidermal growth factor-like protein 6						cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2																		---	---	---	---
CUL4B	8450	broad.mit.edu	37	X	119677351	119677352	+	Intron	DEL	AC	-	-			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119677351_119677352delAC	uc004esw.2	-						CUL4B_uc010nqq.2_Intron|CUL4B_uc004esv.2_Intron	NM_003588	NP_003579			cullin 4B isoform 1						cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
UBE4B	10277	broad.mit.edu	37	1	10179613	10179613	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10179613C>T	uc001aqs.3	+	9	2094	c.1381C>T	c.(1381-1383)CGC>TGC	p.R461C	UBE4B_uc001aqr.3_Missense_Mutation_p.R332C|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_5'UTR	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	461					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)														---	---	---	---
RPS6KA1	6195	broad.mit.edu	37	1	26888152	26888152	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26888152G>C	uc001bmr.1	+	17	1751	c.1588G>C	c.(1588-1590)GGG>CGG	p.G530R	RPS6KA1_uc010ofe.1_Missense_Mutation_p.G438R|RPS6KA1_uc010off.1_Missense_Mutation_p.G514R|RPS6KA1_uc001bms.1_Missense_Mutation_p.G539R|RPS6KA1_uc009vsl.1_Missense_Mutation_p.G373R	NM_002953	NP_002944	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	530	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)														---	---	---	---
ERMAP	114625	broad.mit.edu	37	1	43296183	43296183	+	Missense_Mutation	SNP	C	T	T	rs142166292	byFrequency	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43296183C>T	uc001cic.1	+	3	334	c.64C>T	c.(64-66)CGG>TGG	p.R22W	ERMAP_uc010ojw.1_Missense_Mutation_p.R83W|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Missense_Mutation_p.R22W|ERMAP_uc001cif.1_5'UTR	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein	22						integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
ZNF691	51058	broad.mit.edu	37	1	43317331	43317331	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43317331C>T	uc001cih.2	+	2	834	c.783C>T	c.(781-783)AGC>AGT	p.S261S	ZNF691_uc001cig.2_Silent_p.S234S|ZNF691_uc009vwm.2_Silent_p.S254S	NM_015911	NP_056995	Q5VV52	ZN691_HUMAN	zinc finger protein 691	265	C2H2-type 6.					nucleus	DNA binding|zinc ion binding			ovary(2)	2	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
TIE1	7075	broad.mit.edu	37	1	43778103	43778103	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43778103C>T	uc001ciu.2	+	12	1837	c.1758C>T	c.(1756-1758)GAC>GAT	p.D586D	TIE1_uc010okd.1_Silent_p.D586D|TIE1_uc010oke.1_Silent_p.D541D|TIE1_uc009vwq.2_Silent_p.D542D|TIE1_uc010okf.1_Silent_p.D231D|TIE1_uc010okg.1_Silent_p.D231D	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	586	Fibronectin type-III 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---
SPATA6	54558	broad.mit.edu	37	1	48865100	48865100	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48865100G>A	uc001crr.1	-	7	868	c.703C>T	c.(703-705)CGG>TGG	p.R235W	SPATA6_uc001crs.1_Missense_Mutation_p.R235W|SPATA6_uc010omv.1_Missense_Mutation_p.R221W|SPATA6_uc001crt.2_Missense_Mutation_p.R127W	NM_019073	NP_061946	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6 precursor	235					cell differentiation|multicellular organismal development|spermatogenesis	extracellular region				ovary(1)	1																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58521806	58521806	+	Intron	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58521806T>C	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58521858	58521858	+	Intron	SNP	A	G	G	rs3990964		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58521858A>G	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
C1orf141	400757	broad.mit.edu	37	1	67558906	67558906	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67558906C>A	uc001ddl.1	-	7	1096	c.985G>T	c.(985-987)GTG>TTG	p.V329L	C1orf141_uc001ddm.1_Missense_Mutation_p.V329L|C1orf141_uc001ddn.1_RNA	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN	hypothetical protein LOC400757	329										ovary(1)	1																		---	---	---	---
LPPR5	163404	broad.mit.edu	37	1	99470147	99470147	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99470147C>T	uc001dsb.2	-	1	303	c.81G>A	c.(79-81)GCG>GCA	p.A27A	uc001dsd.1_RNA|LPPR5_uc001dsc.2_Silent_p.A27A	NM_001037317	NP_001032394	Q32ZL2	LPPR5_HUMAN	phosphatidic acid phosphatase type 2d isoform 1	27	Helical; (Potential).					integral to membrane	hydrolase activity				0																		---	---	---	---
SLC16A4	9122	broad.mit.edu	37	1	110925531	110925531	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110925531G>A	uc001dzo.1	-	3	327	c.145C>T	c.(145-147)CAA>TAA	p.Q49*	SLC16A4_uc009wfs.1_Nonsense_Mutation_p.Q49*|SLC16A4_uc001dzp.1_Nonsense_Mutation_p.Q49*|SLC16A4_uc010ovy.1_Intron|SLC16A4_uc001dzq.1_Intron|SLC16A4_uc010ovz.1_Intron	NM_004696	NP_004687	O15374	MOT5_HUMAN	solute carrier family 16, member 4	49	Extracellular (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity			ovary(3)	3		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)													---	---	---	---
CHIA	27159	broad.mit.edu	37	1	111860734	111860734	+	Intron	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111860734G>A	uc001eas.2	+						CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615			acidic chitinase isoform c						apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)														---	---	---	---
ATP1A4	480	broad.mit.edu	37	1	160143992	160143992	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160143992G>A	uc001fve.3	+	14	2562	c.2083G>A	c.(2083-2085)GTG>ATG	p.V695M	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.V198M	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	695	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
TNN	63923	broad.mit.edu	37	1	175046955	175046955	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046955G>A	uc001gkl.1	+	2	514	c.401G>A	c.(400-402)GGA>GAA	p.G134E	TNN_uc010pmx.1_Missense_Mutation_p.G134E	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	134					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
CFH	3075	broad.mit.edu	37	1	196642259	196642259	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196642259A>C	uc001gtj.3	+	2	450	c.210A>C	c.(208-210)GAA>GAC	p.E70D	CFH_uc001gti.3_Missense_Mutation_p.E70D|CFH_uc009wyw.2_Missense_Mutation_p.E70D|CFH_uc009wyx.2_Missense_Mutation_p.E70D	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	70	Sushi 1.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6																		---	---	---	---
LHX9	56956	broad.mit.edu	37	1	197890498	197890498	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197890498C>T	uc001guk.1	+	3	879	c.442C>T	c.(442-444)CGC>TGC	p.R148C	LHX9_uc001gui.1_Missense_Mutation_p.R139C|LHX9_uc001guj.1_Missense_Mutation_p.R154C	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	148	LIM zinc-binding 2.				motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1																		---	---	---	---
ELK4	2005	broad.mit.edu	37	1	205588102	205588102	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205588102C>A	uc001hcy.1	-	4	2430	c.1180G>T	c.(1180-1182)GCT>TCT	p.A394S		NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	394						cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)					T	SLC45A3	prostate								---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210761322	210761322	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210761322T>C	uc009xcx.2	+	10	1290	c.1124T>C	c.(1123-1125)GTG>GCG	p.V375A	HHAT_uc010psq.1_Missense_Mutation_p.V238A|HHAT_uc001hhz.3_Missense_Mutation_p.V375A|HHAT_uc010psr.1_Missense_Mutation_p.V376A|HHAT_uc010pss.1_Missense_Mutation_p.V330A|HHAT_uc009xcy.2_Missense_Mutation_p.V310A|HHAT_uc010pst.1_Missense_Mutation_p.V312A|HHAT_uc010psu.1_Missense_Mutation_p.V310A|HHAT_uc001hia.3_Missense_Mutation_p.V65A	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	375	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218614600	218614600	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218614600G>A	uc001hlm.2	+	7	1794	c.1141G>A	c.(1141-1143)GTG>ATG	p.V381M	TGFB2_uc001hln.2_Missense_Mutation_p.V409M|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2	381					activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
ACTN2	88	broad.mit.edu	37	1	236894596	236894596	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236894596A>G	uc001hyf.2	+	7	883	c.679A>G	c.(679-681)AAA>GAA	p.K227E	ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Missense_Mutation_p.K227E|ACTN2_uc010pxu.1_Missense_Mutation_p.K12E	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	227	CH 2.|Actin-binding.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237580427	237580427	+	Intron	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237580427A>C	uc001hyl.1	+							NM_001035	NP_001026			cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240371079	240371079	+	Silent	SNP	T	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371079T>G	uc010pyd.1	+	5	3192	c.2967T>G	c.(2965-2967)CCT>CCG	p.P989P	FMN2_uc010pye.1_Silent_p.P993P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	989	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
POMC	5443	broad.mit.edu	37	2	25387531	25387531	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25387531G>A	uc002rfy.1	-	3	374	c.111C>T	c.(109-111)CTC>CTT	p.L37L	POMC_uc002rfz.1_Silent_p.L37L|POMC_uc002rga.1_Silent_p.L37L	NM_001035256	NP_001030333	P01189	COLI_HUMAN	proopiomelanocortin preproprotein	37					cell-cell signaling|cellular nitrogen compound metabolic process|cellular pigmentation|generation of precursor metabolites and energy|hormone biosynthetic process|negative regulation of tumor necrosis factor production|neuropeptide signaling pathway|peptide hormone processing|positive regulation of transcription from RNA polymerase II promoter|regulation of appetite|regulation of blood pressure	extracellular space|stored secretory granule	hormone activity|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Hydrocortisone(DB00741)|Loperamide(DB00836)|Trilostane(DB01108)													---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50850746	50850746	+	Silent	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50850746T>C	uc010fbq.2	-	6	2416	c.939A>G	c.(937-939)GAA>GAG	p.E313E	NRXN1_uc002rxb.3_5'UTR|NRXN1_uc002rxe.3_Silent_p.E280E|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
EMX1	2016	broad.mit.edu	37	2	73151516	73151516	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73151516C>T	uc002sin.1	+	2	977	c.599C>T	c.(598-600)TCG>TTG	p.S200L	EMX1_uc002sim.1_Silent_p.L152L	NM_004097	NP_004088	Q04741	EMX1_HUMAN	empty spiracles homolog 1	167	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
CCDC142	84865	broad.mit.edu	37	2	74701728	74701728	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74701728C>T	uc002slr.2	-	9	2591	c.2198G>A	c.(2197-2199)CGA>CAA	p.R733Q	MRPL53_uc002sln.2_5'Flank|CCDC142_uc002slo.2_Intron|CCDC142_uc002slq.2_Missense_Mutation_p.R726Q|CCDC142_uc002slp.2_3'UTR	NM_032779	NP_116168	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	733										central_nervous_system(1)	1																		---	---	---	---
RNF103	7844	broad.mit.edu	37	2	86849918	86849918	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86849918C>T	uc002srn.2	-	1	1061	c.92G>A	c.(91-93)GGC>GAC	p.G31D	VPS24_uc010ytl.1_Intron|RNF103_uc002srp.2_Missense_Mutation_p.G31D	NM_005667	NP_005658	O00237	RN103_HUMAN	ring finger protein 103	31					central nervous system development|ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87017446	87017446	+	Intron	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87017446C>T	uc002srs.3	+						CD8A_uc002srv.2_Intron|CD8A_uc010ytn.1_Intron|CD8A_uc002srt.2_Intron|CD8A_uc002sru.2_Intron					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100170900	100170900	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100170900C>T	uc002tag.2	-	23	3668	c.3432G>A	c.(3430-3432)CCG>CCA	p.P1144P	AFF3_uc002taf.2_Silent_p.P1169P	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	1144					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
FBLN7	129804	broad.mit.edu	37	2	112944852	112944852	+	Silent	SNP	C	T	T	rs147018646	byFrequency	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112944852C>T	uc002tho.1	+	8	1360	c.1089C>T	c.(1087-1089)CCC>CCT	p.P363P	FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Silent_p.P317P|FBLN7_uc010fkj.1_Silent_p.P229P	NM_153214	NP_694946	Q53RD9	FBLN7_HUMAN	fibulin 7 isoform 1	363					cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166245404	166245404	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166245404C>T	uc002udc.2	+	27	5378	c.5088C>T	c.(5086-5088)AAC>AAT	p.N1696N	SCN2A_uc002udd.2_Silent_p.N1696N|SCN2A_uc002ude.2_Silent_p.N1696N	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1696	IV.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168102549	168102549	+	Silent	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168102549C>A	uc002udx.2	+	8	4665	c.4647C>A	c.(4645-4647)GGC>GGA	p.G1549G	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.G1374G|XIRP2_uc010fpq.2_Silent_p.G1327G|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1374					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
ABCB11	8647	broad.mit.edu	37	2	169792824	169792824	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169792824G>A	uc002ueo.1	-	22	2856	c.2730C>T	c.(2728-2730)TTC>TTT	p.F910F	ABCB11_uc010zda.1_Silent_p.F352F|ABCB11_uc010zdb.1_Silent_p.F386F	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	910	ABC transmembrane type-1 2.|Helical; (Potential).				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)													---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170030521	170030521	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170030521C>T	uc002ues.2	-	56	11135	c.10922G>A	c.(10921-10923)CGG>CAG	p.R3641Q		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3641	LDL-receptor class A 29.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
TLK1	9874	broad.mit.edu	37	2	171850340	171850340	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171850340C>T	uc002ugn.2	-	21	2723	c.2251G>A	c.(2251-2253)GGG>AGG	p.G751R	TLK1_uc002ugo.2_Missense_Mutation_p.G772R|TLK1_uc002ugp.2_Missense_Mutation_p.G703R|TLK1_uc010zdn.1_Missense_Mutation_p.G655R	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1	751					cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179471823	179471823	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179471823G>A	uc010zfg.1	-	227	46026	c.45802C>T	c.(45802-45804)CGT>TGT	p.R15268C	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R8963C|TTN_uc010zfi.1_Missense_Mutation_p.R8896C|TTN_uc010zfj.1_Missense_Mutation_p.R8771C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16195							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
COL5A2	1290	broad.mit.edu	37	2	189899824	189899824	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189899824G>A	uc002uqk.2	-	53	4446	c.4171C>T	c.(4171-4173)CGC>TGC	p.R1391C	COL5A2_uc010frx.2_Missense_Mutation_p.R967C	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1391	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)															---	---	---	---
CRYGC	1420	broad.mit.edu	37	2	208992950	208992950	+	Missense_Mutation	SNP	G	A	A	rs28931604		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208992950G>A	uc002vco.3	-	3	540	c.502C>T	c.(502-504)CGG>TGG	p.R168W		NM_020989	NP_066269	P07315	CRGC_HUMAN	crystallin, gamma C	168	Beta/gamma crystallin 'Greek key' 4.				visual perception	cytoplasm|nucleus	protein binding|structural constituent of eye lens				0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)														---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215891537	215891537	+	Intron	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215891537G>A	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099			ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
EPHA4	2043	broad.mit.edu	37	2	222428898	222428898	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222428898A>G	uc002vmq.2	-	3	418	c.376T>C	c.(376-378)TAC>CAC	p.Y126H	EPHA4_uc002vmr.2_Missense_Mutation_p.Y126H|EPHA4_uc010zlm.1_Missense_Mutation_p.Y67H|EPHA4_uc010zln.1_Missense_Mutation_p.Y126H	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	126	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)														---	---	---	---
SLC6A1	6529	broad.mit.edu	37	3	11070542	11070542	+	Intron	SNP	G	A	A	rs145991530	by1000genomes	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11070542G>A	uc010hdq.2	+							NM_003042	NP_003033			solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)|skin(1)	2		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Cocaine(DB00907)|Tiagabine(DB00906)													---	---	---	---
NME6	10201	broad.mit.edu	37	3	48339990	48339990	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48339990C>T	uc003csp.3	-	2	68	c.17G>A	c.(16-18)CGA>CAA	p.R6Q	NME6_uc003cso.2_Missense_Mutation_p.R14Q|NME6_uc011bbh.1_Missense_Mutation_p.R6Q|NME6_uc010hju.2_Intron|NME6_uc011bbi.1_Missense_Mutation_p.R6Q	NM_005793	NP_005784	O75414	NDK6_HUMAN	nucleoside diphosphate kinase type 6	6					anti-apoptosis|apoptosis|CTP biosynthetic process|GTP biosynthetic process|negative regulation of cell growth|negative regulation of mitosis|UTP biosynthetic process	mitochondrion	ATP binding|metal ion binding|nucleoside diphosphate kinase activity				0				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48618351	48618351	+	Silent	SNP	C	T	T	rs111360822	byFrequency	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48618351C>T	uc003ctz.2	-	53	4945	c.4944G>A	c.(4942-4944)CCG>CCA	p.P1648P	MIR711_hsa-mir-711|MI0012488_5'Flank	NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1648	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
PRKCD	5580	broad.mit.edu	37	3	53219936	53219936	+	Intron	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53219936C>T	uc003dgl.2	+						PRKCD_uc003dgm.2_Intron	NM_006254	NP_006245			protein kinase C, delta						activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)														---	---	---	---
PRICKLE2	166336	broad.mit.edu	37	3	64132808	64132808	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64132808G>A	uc003dmf.2	-	7	1944	c.1358C>T	c.(1357-1359)TCG>TTG	p.S453L		NM_198859	NP_942559	Q7Z3G6	PRIC2_HUMAN	prickle-like 2	453						cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)														---	---	---	---
SEC61A1	29927	broad.mit.edu	37	3	127779501	127779501	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127779501C>T	uc003ekb.2	+	7	797	c.613C>T	c.(613-615)CGA>TGA	p.R205*	SEC61A1_uc003ekc.2_Nonsense_Mutation_p.R152*|SEC61A1_uc003ekd.2_Nonsense_Mutation_p.R85*	NM_013336	NP_037468	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit	205	Lumenal (Potential).				protein targeting to ER	integral to endoplasmic reticulum membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|protein binding|ribosome binding			ovary(1)	1																		---	---	---	---
ZIC1	7545	broad.mit.edu	37	3	147128283	147128283	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128283C>T	uc003ewe.2	+	1	1103	c.384C>T	c.(382-384)TTC>TTT	p.F128F		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	128					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	G	G	rs121913279		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952085A>G	uc003fjk.2	+	21	3297	c.3140A>G	c.(3139-3141)CAT>CGT	p.H1047R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
DRD5	1816	broad.mit.edu	37	4	9783809	9783809	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9783809C>G	uc003gmb.3	+	1	552	c.156C>G	c.(154-156)ATC>ATG	p.I52M		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	52	Helical; Name=1; (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)													---	---	---	---
POLR2B	5431	broad.mit.edu	37	4	57877199	57877199	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57877199A>T	uc003hcl.1	+	13	1776	c.1733A>T	c.(1732-1734)AAA>ATA	p.K578I	POLR2B_uc011cae.1_Missense_Mutation_p.K571I|POLR2B_uc011caf.1_Missense_Mutation_p.K503I|POLR2B_uc003hcm.1_Missense_Mutation_p.K71I	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B	578					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---
PITX2	5308	broad.mit.edu	37	4	111539829	111539829	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111539829G>A	uc003iad.2	-	5	988	c.406C>T	c.(406-408)CGT>TGT	p.R136C	PITX2_uc003iac.2_Missense_Mutation_p.R143C|PITX2_uc003iae.2_Missense_Mutation_p.R90C|PITX2_uc010iml.2_Missense_Mutation_p.R7C|PITX2_uc003iaf.2_Missense_Mutation_p.R136C	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	136	Homeobox.		R -> C (in RIEG1).		determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)														---	---	---	---
PCDH10	57575	broad.mit.edu	37	4	134072207	134072207	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072207G>A	uc003iha.2	+	1	1738	c.912G>A	c.(910-912)TCG>TCA	p.S304S	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.S304S	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	304	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)														---	---	---	---
PCDH10	57575	broad.mit.edu	37	4	134072448	134072448	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072448C>T	uc003iha.2	+	1	1979	c.1153C>T	c.(1153-1155)CGC>TGC	p.R385C	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.R385C	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	385	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)														---	---	---	---
PCDH18	54510	broad.mit.edu	37	4	138442509	138442509	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138442509C>A	uc003ihe.3	-	4	3469	c.3082G>T	c.(3082-3084)GAG>TAG	p.E1028*	PCDH18_uc003ihf.3_Nonsense_Mutation_p.E1020*|PCDH18_uc011cgz.1_Nonsense_Mutation_p.E239*|PCDH18_uc003ihg.3_Nonsense_Mutation_p.E807*|PCDH18_uc011cha.1_Nonsense_Mutation_p.E208*	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	1028	Interaction with DAB1 (By similarity).|Cytoplasmic (Potential).				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)																	---	---	---	---
RNF150	57484	broad.mit.edu	37	4	141888924	141888924	+	Silent	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141888924T>C	uc003iio.1	-	2	1242	c.588A>G	c.(586-588)GGA>GGG	p.G196G	RNF150_uc010iok.1_Silent_p.G196G|RNF150_uc003iip.1_Silent_p.G196G	NM_020724	NP_065775	Q9ULK6	RN150_HUMAN	ring finger protein 150 precursor	196	Extracellular (Potential).					integral to membrane	zinc ion binding			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
FBXW7	55294	broad.mit.edu	37	4	153247167	153247167	+	Nonsense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247167A>C	uc003ims.2	-	10	1784	c.1635T>G	c.(1633-1635)TAT>TAG	p.Y545*	FBXW7_uc011cii.1_Nonsense_Mutation_p.Y545*|FBXW7_uc003imt.2_Nonsense_Mutation_p.Y545*|FBXW7_uc011cih.1_Nonsense_Mutation_p.Y369*|FBXW7_uc003imq.2_Nonsense_Mutation_p.Y465*|FBXW7_uc003imr.2_Nonsense_Mutation_p.Y427*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	545	WD 5.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.Y545C(1)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)						Mis|N|D|F		colorectal|endometrial|T-ALL								---	---	---	---
NPY2R	4887	broad.mit.edu	37	4	156135406	156135406	+	Silent	SNP	G	A	A	rs148709959	byFrequency	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156135406G>A	uc003ioq.2	+	2	810	c.315G>A	c.(313-315)CCG>CCA	p.P105P	NPY2R_uc003ior.2_Silent_p.P105P	NM_000910	NP_000901	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	105	Helical; Name=2; (Potential).				cardiac left ventricle morphogenesis|inhibition of adenylate cyclase activity by G-protein signaling pathway|locomotory behavior|outflow tract morphogenesis	integral to plasma membrane	calcium channel regulator activity			lung(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0854)																---	---	---	---
TRIML2	205860	broad.mit.edu	37	4	189026019	189026019	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189026019T>C	uc003izl.2	-	2	143	c.107A>G	c.(106-108)GAT>GGT	p.D36G	TRIML2_uc011cle.1_Missense_Mutation_p.D86G|TRIML2_uc011clf.1_Missense_Mutation_p.D86G	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	36	Potential.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)														---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33577248	33577248	+	Silent	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33577248A>G	uc003jia.1	-	19	3046	c.2883T>C	c.(2881-2883)GGT>GGC	p.G961G	ADAMTS12_uc010iuq.1_Silent_p.G876G	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	961	TSP type-1 4.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
SLC1A3	6507	broad.mit.edu	37	5	36684095	36684095	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36684095G>T	uc003jkj.3	+	9	1895	c.1419G>T	c.(1417-1419)TGG>TGT	p.W473C	SLC1A3_uc011cox.1_Missense_Mutation_p.W366C|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	473					D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)													---	---	---	---
HCN1	348980	broad.mit.edu	37	5	45262221	45262221	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262221C>T	uc003jok.2	-	8	2500	c.2475G>A	c.(2473-2475)ACG>ACA	p.T825T		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	825	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---
MAP1B	4131	broad.mit.edu	37	5	71493006	71493006	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71493006G>A	uc003kbw.3	+	5	4065	c.3824G>A	c.(3823-3825)CGT>CAT	p.R1275H	MAP1B_uc010iyw.1_Missense_Mutation_p.R1292H|MAP1B_uc010iyx.1_Missense_Mutation_p.R1149H|MAP1B_uc010iyy.1_Missense_Mutation_p.R1149H	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1275						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)														---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71756781	71756781	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71756781G>A	uc003kce.1	-	2	729	c.543C>T	c.(541-543)CAC>CAT	p.H181H		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	181					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
PCDHA1	56147	broad.mit.edu	37	5	140168105	140168105	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140168105G>A	uc003lhb.2	+	1	2230	c.2230G>A	c.(2230-2232)GCG>ACG	p.A744T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.A744T	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	744	Cytoplasmic (Potential).|5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA5	56110	broad.mit.edu	37	5	140744135	140744135	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140744135C>T	uc003lju.1	+	1	238	c.238C>T	c.(238-240)CGA>TGA	p.R80*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Nonsense_Mutation_p.R80*	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	80	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA6	56109	broad.mit.edu	37	5	140754857	140754857	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140754857C>T	uc003ljy.1	+	1	1207	c.1207C>T	c.(1207-1209)CGA>TGA	p.R403*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Nonsense_Mutation_p.R403*	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	403	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
FAM71B	153745	broad.mit.edu	37	5	156590250	156590250	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156590250G>T	uc003lwn.2	-	2	1126	c.1026C>A	c.(1024-1026)AGC>AGA	p.S342R		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	342						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169494638	169494638	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169494638T>C	uc003maf.2	+	45	4672	c.4592T>C	c.(4591-4593)CTG>CCG	p.L1531P	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.L1023P|DOCK2_uc003mah.2_Missense_Mutation_p.L87P	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1531	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169504824	169504824	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169504824C>A	uc003maf.2	+	48	5057	c.4977C>A	c.(4975-4977)AGC>AGA	p.S1659R	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.S1151R|DOCK2_uc003mah.2_Missense_Mutation_p.S215R	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1659					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
CPEB4	80315	broad.mit.edu	37	5	173378844	173378844	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173378844G>T	uc003mcs.3	+	8	3089	c.1683G>T	c.(1681-1683)TGG>TGT	p.W561C	CPEB4_uc010jju.1_Missense_Mutation_p.W536C|CPEB4_uc010jjv.2_Missense_Mutation_p.W544C|CPEB4_uc011dfg.1_Missense_Mutation_p.W536C|CPEB4_uc003mct.3_Missense_Mutation_p.W171C|CPEB4_uc003mcu.3_Missense_Mutation_p.W154C	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	561	RRM 1.						nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)															---	---	---	---
ZFP2	80108	broad.mit.edu	37	5	178359618	178359618	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178359618A>G	uc003mjn.1	+	5	1813	c.1304A>G	c.(1303-1305)GAG>GGG	p.E435G	ZFP2_uc010jky.2_Missense_Mutation_p.E435G|ZFP2_uc010jkx.1_Missense_Mutation_p.E435G	NM_030613	NP_085116	Q6ZN57	ZFP2_HUMAN	zinc finger protein 2 homolog	435					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)														---	---	---	---
TBC1D9B	23061	broad.mit.edu	37	5	179315209	179315209	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179315209C>T	uc003mlh.2	-	7	1185	c.1148G>A	c.(1147-1149)CGT>CAT	p.R383H	TBC1D9B_uc003mli.2_Missense_Mutation_p.R383H|TBC1D9B_uc003mlj.2_Missense_Mutation_p.R383H	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	383						integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
CFB	629	broad.mit.edu	37	6	31910835	31910835	+	5'Flank	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31910835A>G	uc003nyj.3	+						C2_uc003nyc.2_Missense_Mutation_p.Q227R|C2_uc011doo.1_Missense_Mutation_p.Q194R|C2_uc011dop.1_Missense_Mutation_p.Q226R|C2_uc003nyf.2_Missense_Mutation_p.Q440R|C2_uc010jtk.2_Missense_Mutation_p.Q308R|C2_uc011doq.1_Missense_Mutation_p.Q411R|C2_uc003nyg.2_Missense_Mutation_p.Q217R|CFB_uc011dor.1_Missense_Mutation_p.Q287R|C2_uc003nyh.1_Missense_Mutation_p.Q91R|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank	NM_001710	NP_001701			complement factor B preproprotein						complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1																		---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162394349	162394349	+	Missense_Mutation	SNP	G	A	A	rs137853054		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162394349G>A	uc003qtx.3	-	6	853	c.719C>T	c.(718-720)ACG>ATG	p.T240M	PARK2_uc003qtv.3_RNA|PARK2_uc010kkd.2_Missense_Mutation_p.T49M|PARK2_uc003qtw.3_Missense_Mutation_p.T49M|PARK2_uc003qty.3_Missense_Mutation_p.T212M|PARK2_uc003qtz.3_Missense_Mutation_p.T91M|PARK2_uc010kke.1_Missense_Mutation_p.T240M	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	240	RING-type 1; atypical.		T -> M (in PARK; late onset).|T -> R (in PARK2; impairs the ability to ubiquitinate SNCAIP and BCL2; loss of UBE2L3 binding; severely compromises the mitochondrial localization).		aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding	p.T240M(1)		upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	168927051	168927051	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168927051G>C	uc003qws.1	+	3	302	c.282G>C	c.(280-282)AGG>AGC	p.R94S	SMOC2_uc003qwr.1_Missense_Mutation_p.R94S	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	94	Thyroglobulin type-1 1.				signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43351573	43351573	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43351573C>T	uc003tid.1	+	4	844	c.239C>T	c.(238-240)ACG>ATG	p.T80M	HECW1_uc011kbi.1_Missense_Mutation_p.T80M|HECW1_uc003tie.1_Missense_Mutation_p.T112M	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	80					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82584626	82584626	+	Silent	SNP	T	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82584626T>C	uc003uhx.2	-	5	5932	c.5643A>G	c.(5641-5643)CAA>CAG	p.Q1881Q	PCLO_uc003uhv.2_Silent_p.Q1881Q	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1812					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98522858	98522858	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98522858G>A	uc003upp.2	+	22	3156	c.2947G>A	c.(2947-2949)GCA>ACA	p.A983T	TRRAP_uc011kis.1_Missense_Mutation_p.A983T|TRRAP_uc003upr.2_Missense_Mutation_p.A675T	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	983					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
LRCH4	4034	broad.mit.edu	37	7	100172852	100172852	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100172852G>A	uc003uvj.2	-	18	1983	c.1930C>T	c.(1930-1932)CGG>TGG	p.R644W	uc003uvh.2_5'Flank|LRCH4_uc010lgz.2_RNA|LRCH4_uc003uvi.2_RNA|LRCH4_uc011kjw.1_3'UTR	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)	644	CH.				nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
RELN	5649	broad.mit.edu	37	7	103234860	103234860	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103234860C>T	uc003vca.2	-	26	3779	c.3619G>A	c.(3619-3621)GAG>AAG	p.E1207K	RELN_uc010liz.2_Missense_Mutation_p.E1207K	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1207					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
PIK3CG	5294	broad.mit.edu	37	7	106545598	106545598	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106545598C>T	uc003vdv.3	+	11	3160	c.3075C>T	c.(3073-3075)AAC>AAT	p.N1025N	PIK3CG_uc003vdu.2_Silent_p.N1025N|PIK3CG_uc003vdw.2_Silent_p.N1025N	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	1025	PI3K/PI4K.				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38																		---	---	---	---
ASB15	142685	broad.mit.edu	37	7	123269255	123269255	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123269255G>T	uc003vku.1	+	10	1499	c.1207G>T	c.(1207-1209)GGA>TGA	p.G403*	ASB15_uc003vkw.1_Nonsense_Mutation_p.G403*	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	403	ANK 8.				intracellular signal transduction					skin(2)|lung(1)	3																		---	---	---	---
MIR490	574443	broad.mit.edu	37	7	136587920	136587920	+	RNA	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136587920C>A	hsa-mir-490|MI0003125	+			c.7C>A			CHRM2_uc003vtf.1_Intron|CHRM2_uc003vtg.1_Intron|CHRM2_uc003vtj.1_Intron|CHRM2_uc003vtk.1_Intron|CHRM2_uc003vtl.1_Intron|CHRM2_uc003vtm.1_Intron|CHRM2_uc003vti.1_Intron|CHRM2_uc003vto.1_Intron|CHRM2_uc003vtn.1_Intron|uc003vtp.1_Intron																	0																		---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136699991	136699991	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136699991A>G	uc003vtf.1	+	4	1002	c.379A>G	c.(379-381)AAA>GAA	p.K127E	CHRM2_uc003vtg.1_Missense_Mutation_p.K127E|CHRM2_uc003vtj.1_Missense_Mutation_p.K127E|CHRM2_uc003vtk.1_Missense_Mutation_p.K127E|CHRM2_uc003vtl.1_Missense_Mutation_p.K127E|CHRM2_uc003vtm.1_Missense_Mutation_p.K127E|CHRM2_uc003vti.1_Missense_Mutation_p.K127E|CHRM2_uc003vto.1_Missense_Mutation_p.K127E|CHRM2_uc003vtn.1_Missense_Mutation_p.K127E|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	127	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	142378617	142378617	+	Intron	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142378617C>A	uc011krp.1	+						uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc011ksg.1_Intron|uc003waa.1_Silent_p.I3I					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																														---	---	---	---
XPO7	23039	broad.mit.edu	37	8	21827733	21827733	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21827733C>T	uc003xaa.3	+	4	440	c.338C>T	c.(337-339)GCC>GTC	p.A113V	XPO7_uc010lti.2_Missense_Mutation_p.A113V|XPO7_uc010ltj.1_RNA|XPO7_uc010ltk.2_Missense_Mutation_p.A114V	NM_015024	NP_055839	Q9UIA9	XPO7_HUMAN	exportin 7 isoform b	113					mRNA transport|protein export from nucleus|transmembrane transport	cytoplasm|nuclear pore	nuclear export signal receptor activity|protein transporter activity			ovary(1)|kidney(1)|breast(1)|central_nervous_system(1)|pancreas(1)	5				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)														---	---	---	---
TEX15	56154	broad.mit.edu	37	8	30699870	30699870	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30699870C>A	uc003xil.2	-	1	6664	c.6664G>T	c.(6664-6666)GAT>TAT	p.D2222Y		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2222										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)														---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	39080734	39080734	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39080734G>A	uc003xmt.3	+	14	1747	c.1502G>A	c.(1501-1503)CGT>CAT	p.R501H	ADAM32_uc011lch.1_Missense_Mutation_p.R402H|ADAM32_uc003xmu.3_Missense_Mutation_p.R395H|ADAM32_uc003xmv.2_Missense_Mutation_p.V23I	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	501	Extracellular (Potential).|Cys-rich.				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55540977	55540977	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55540977A>C	uc003xsd.1	+	4	4683	c.4535A>C	c.(4534-4536)AAG>ACG	p.K1512T	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1512					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61778367	61778367	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61778367G>A	uc003xue.2	+	38	9346	c.8869G>A	c.(8869-8871)GAT>AAT	p.D2957N		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2957					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69002885	69002885	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69002885A>T	uc003xxv.1	+	20	2212	c.2185A>T	c.(2185-2187)AAA>TAA	p.K729*	PREX2_uc003xxu.1_Nonsense_Mutation_p.K729*|PREX2_uc011lez.1_Nonsense_Mutation_p.K664*	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	729	PDZ 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
ZNF704	619279	broad.mit.edu	37	8	81553607	81553607	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81553607G>A	uc003yby.1	-	9	1465	c.1233C>T	c.(1231-1233)CTC>CTT	p.L411L		NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	411						intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)															---	---	---	---
RPL30	6156	broad.mit.edu	37	8	99054331	99054331	+	Intron	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99054331A>G	uc003yif.2	-						RPL30_uc010mbk.1_Intron|SNORA72_uc003yig.1_RNA	NM_000989	NP_000980			ribosomal protein L30						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104955138	104955138	+	Silent	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104955138A>G	uc003yls.2	+	12	2260	c.2019A>G	c.(2017-2019)CCA>CCG	p.P673P	RIMS2_uc003ylp.2_Silent_p.P895P|RIMS2_uc003ylw.2_Silent_p.P687P|RIMS2_uc003ylq.2_Silent_p.P687P|RIMS2_uc003ylr.2_Silent_p.P734P|RIMS2_uc003ylt.2_Silent_p.P280P	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	957					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131129220	131129220	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131129220C>T	uc003yta.1	-	20	1930	c.1902G>A	c.(1900-1902)ACG>ACA	p.T634T	ASAP1_uc003ysz.1_Silent_p.T445T|ASAP1_uc011liw.1_Silent_p.T627T	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	634					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
C8orf31	286122	broad.mit.edu	37	8	144126205	144126205	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144126205C>T	uc003yxp.1	+	4	678	c.326C>T	c.(325-327)GCG>GTG	p.A109V	C8orf31_uc003yxq.1_RNA|C8orf31_uc003yxr.1_RNA	NM_173687	NP_775958	Q8N9H6	CH031_HUMAN	hypothetical protein LOC286122	109										ovary(1)	1	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
GRHPR	9380	broad.mit.edu	37	9	37422818	37422818	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37422818C>T	uc003zzu.1	+	1	112	c.71C>T	c.(70-72)GCC>GTC	p.A24V	GRHPR_uc010mlu.2_Intron|GRHPR_uc010mlv.1_Intron|GRHPR_uc003zzt.1_Intron	NM_012203	NP_036335	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	24					cellular nitrogen compound metabolic process|excretion|glyoxylate metabolic process	peroxisomal matrix	glycerate dehydrogenase activity|glyoxylate reductase (NADP) activity|hydroxypyruvate reductase activity|NAD binding|protein binding				0				GBM - Glioblastoma multiforme(29;0.00687)														---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119858332	119858332	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119858332G>A	uc004bjs.1	-	5	1368	c.1267C>T	c.(1267-1269)CGC>TGC	p.R423C	ASTN2_uc004bjr.1_Missense_Mutation_p.R423C|ASTN2_uc004bjt.1_Missense_Mutation_p.R372C	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	423	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
GPR21	2844	broad.mit.edu	37	9	125797698	125797698	+	Missense_Mutation	SNP	G	A	A	rs142528272		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125797698G>A	uc011lzk.1	+	1	853	c.853G>A	c.(853-855)GCA>ACA	p.A285T	RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzh.1_Intron|RABGAP1_uc011lzj.1_Intron|GPR21_uc011lzi.1_RNA	NM_005294	NP_005285	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	285	Helical; Name=7; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1																		---	---	---	---
LAMC3	10319	broad.mit.edu	37	9	133936523	133936523	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133936523C>A	uc004caa.1	+	13	2358	c.2260C>A	c.(2260-2262)CCC>ACC	p.P754T		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	754	Laminin EGF-like 6.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)														---	---	---	---
RALGDS	5900	broad.mit.edu	37	9	135978249	135978249	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135978249C>T	uc004cco.2	-	13	1850	c.1830G>A	c.(1828-1830)TCG>TCA	p.S610S	RALGDS_uc004ccn.2_5'Flank|RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Silent_p.S598S|RALGDS_uc004ccr.2_Silent_p.S609S|RALGDS_uc011mcv.1_Silent_p.S581S|RALGDS_uc004ccs.2_Silent_p.S555S|RALGDS_uc011mcw.1_Silent_p.S681S|RALGDS_uc004ccv.1_Silent_p.S379S|RALGDS_uc004ccu.1_Silent_p.S379S	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	610	Ras-GEF.				nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)				T	CIITA	PMBL|Hodgkin Lymphona|						OREG0019581	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137734065	137734065	+	Silent	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137734065C>A	uc004cfe.2	+	66	5815	c.5433C>A	c.(5431-5433)CCC>CCA	p.P1811P	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1811	Fibrillar collagen NC1.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
FAM166A	401565	broad.mit.edu	37	9	140139643	140139643	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140139643G>A	uc004cmi.1	-	4	605	c.550C>T	c.(550-552)CCA>TCA	p.P184S		NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565	184										ovary(1)	1																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16911646	16911646	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911646C>T	uc001ioo.2	-	59	9495	c.9443G>A	c.(9442-9444)CGG>CAG	p.R3148Q	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.R504Q	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3148	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
OGDHL	55753	broad.mit.edu	37	10	50953852	50953852	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50953852C>T	uc001jie.2	-	11	1610	c.1468G>A	c.(1468-1470)GTG>ATG	p.V490M	OGDHL_uc009xog.2_Missense_Mutation_p.V517M|OGDHL_uc010qgt.1_Missense_Mutation_p.V433M|OGDHL_uc010qgu.1_Missense_Mutation_p.V281M|OGDHL_uc009xoh.2_Missense_Mutation_p.V281M	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	490					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1																		---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	96066442	96066442	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96066442C>T	uc001kjk.2	+	26	6515	c.5881C>T	c.(5881-5883)CGA>TGA	p.R1961*	PLCE1_uc010qnx.1_Nonsense_Mutation_p.R1945*|PLCE1_uc001kjm.2_Nonsense_Mutation_p.R1653*|PLCE1_uc001kjp.2_Nonsense_Mutation_p.R319*	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1961					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
UBTD1	80019	broad.mit.edu	37	10	99330046	99330046	+	Silent	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99330046G>T	uc001knv.1	+	3	643	c.450G>T	c.(448-450)CCG>CCT	p.P150P	ANKRD2_uc001knw.2_5'Flank|ANKRD2_uc009xvu.2_5'Flank	NM_024954	NP_079230	Q9HAC8	UBTD1_HUMAN	ubiquitin domain containing 1	150	Ubiquitin-like.										0		Colorectal(252;0.162)		Epithelial(162;3.04e-10)|all cancers(201;2.86e-08)														---	---	---	---
ENTPD7	57089	broad.mit.edu	37	10	101464232	101464232	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101464232G>A	uc001kqa.3	+	13	1785	c.1607G>A	c.(1606-1608)CGA>CAA	p.R536Q	ENTPD7_uc009xwl.2_Missense_Mutation_p.R538Q	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	536	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)														---	---	---	---
CYP17A1	1586	broad.mit.edu	37	10	104597032	104597032	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104597032C>A	uc001kwg.2	-	1	259	c.87G>T	c.(85-87)AAG>AAT	p.K29N		NM_000102	NP_000093	P05093	CP17A_HUMAN	cytochrome P450, family 17	29					androgen biosynthetic process|glucocorticoid biosynthetic process|sex differentiation|xenobiotic metabolic process	endoplasmic reticulum membrane	electron carrier activity|heme binding|oxygen binding|steroid 17-alpha-monooxygenase activity				0		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	NADH(DB00157)|Progesterone(DB00396)													---	---	---	---
TECTB	6975	broad.mit.edu	37	10	114059304	114059304	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114059304G>A	uc001kzr.1	+	8	889	c.889G>A	c.(889-891)GTG>ATG	p.V297M		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	297						anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)														---	---	---	---
ZDHHC6	64429	broad.mit.edu	37	10	114200363	114200363	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114200363C>G	uc001kzv.2	-	5	1034	c.610G>C	c.(610-612)GCT>CCT	p.A204P	ZDHHC6_uc001kzw.2_Missense_Mutation_p.A200P|ZDHHC6_uc009xya.1_Missense_Mutation_p.A204P	NM_022494	NP_071939	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	204						integral to membrane	acyltransferase activity|zinc ion binding				0		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)														---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114911653	114911653	+	Intron	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114911653G>T	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron|TCF7L2_uc010qrv.1_Intron|TCF7L2_uc010qrw.1_Intron|TCF7L2_uc010qrx.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
DKK3	27122	broad.mit.edu	37	11	11987447	11987447	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11987447G>A	uc001mju.2	-	6	796	c.739C>T	c.(739-741)CGG>TGG	p.R247W	DKK3_uc010rcf.1_Missense_Mutation_p.R219W|DKK3_uc001mjv.2_Missense_Mutation_p.R247W|DKK3_uc001mjw.2_Missense_Mutation_p.R247W|DKK3_uc010rcg.1_Missense_Mutation_p.R247W	NM_001018057	NP_001018067	Q9UBP4	DKK3_HUMAN	dickkopf homolog 3 precursor	247	DKK-type Cys-2.				adrenal gland development|anatomical structure morphogenesis|negative regulation of aldosterone biosynthetic process|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cortisol biosynthetic process|negative regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	extracellular space				breast(1)	1				Epithelial(150;0.000502)														---	---	---	---
PTPRJ	5795	broad.mit.edu	37	11	48171647	48171647	+	Splice_Site	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48171647G>T	uc001ngp.3	+	18	3406	c.3051_splice	c.e18-1	p.K1017_splice		NM_002843	NP_002834			protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8																		---	---	---	---
OR4A5	81318	broad.mit.edu	37	11	51411489	51411489	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411489A>C	uc001nhi.1	-	1	907	c.907T>G	c.(907-909)TTA>GTA	p.L303V		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)																---	---	---	---
OR4A5	81318	broad.mit.edu	37	11	51411502	51411502	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51411502G>A	uc001nhi.1	-	1	894	c.894C>T	c.(892-894)CTC>CTT	p.L298L		NM_001005272	NP_001005272	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A,	298	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(304;0.236)																---	---	---	---
OR5D16	390144	broad.mit.edu	37	11	55606944	55606944	+	Silent	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606944C>A	uc010rio.1	+	1	717	c.717C>A	c.(715-717)GTC>GTA	p.V239V		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	239	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)																---	---	---	---
SDHAF2	54949	broad.mit.edu	37	11	61197662	61197662	+	Intron	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61197662G>A	uc001nrt.2	+						CPSF7_uc001nro.2_5'Flank|CPSF7_uc001nrp.2_5'Flank|CPSF7_uc001nrq.2_5'Flank|CPSF7_uc001nrr.2_5'Flank|CPSF7_uc001nrs.1_5'Flank|CPSF7_uc009ynp.2_5'Flank	NM_017841	NP_060311			succinate dehydrogenase complex assembly factor						mitochondrial electron transport, succinate to ubiquinone|protein-FAD linkage	mitochondrion	protein binding			ovary(2)	2														Familial_Paragangliomas				---	---	---	---
KLC2	64837	broad.mit.edu	37	11	66029349	66029349	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66029349G>A	uc010rov.1	+	3	608	c.365G>A	c.(364-366)CGC>CAC	p.R122H	KLC2_uc010row.1_Missense_Mutation_p.R122H|KLC2_uc009yra.2_Missense_Mutation_p.R122H|KLC2_uc001ohb.2_Missense_Mutation_p.R122H|KLC2_uc010rox.1_Intron|KLC2_uc001ohc.2_Missense_Mutation_p.R122H|KLC2_uc001ohd.2_Intron|KLC2_uc001ohe.1_5'UTR	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	122	Potential.				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0																		---	---	---	---
CTSF	8722	broad.mit.edu	37	11	66333303	66333303	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66333303C>T	uc001oip.2	-	7	1053	c.963G>A	c.(961-963)CAG>CAA	p.Q321Q		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	321					proteolysis	lysosome	cysteine-type endopeptidase activity				0																		---	---	---	---
NUMA1	4926	broad.mit.edu	37	11	71715113	71715113	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71715113G>A	uc001orl.1	-	26	6328	c.6156C>T	c.(6154-6156)ATC>ATT	p.I2052I	IL18BP_uc009ysu.1_Intron|NUMA1_uc001orj.2_Silent_p.I234I|NUMA1_uc009ysw.1_Silent_p.I1619I|NUMA1_uc001ork.1_Silent_p.I916I|NUMA1_uc001orm.1_Silent_p.I2038I	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	2052					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8								T	RARA	APL								---	---	---	---
INPPL1	3636	broad.mit.edu	37	11	71949087	71949087	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71949087C>A	uc001osf.2	+	27	3701	c.3554C>A	c.(3553-3555)GCT>GAT	p.A1185D	INPPL1_uc001osg.2_Missense_Mutation_p.A943D	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1185					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4																OREG0021191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PDE2A	5138	broad.mit.edu	37	11	72295734	72295734	+	Silent	SNP	C	T	T	rs150054293	byFrequency	TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72295734C>T	uc010rrc.1	-	18	1641	c.1398G>A	c.(1396-1398)GCG>GCA	p.A466A	PDE2A_uc001oso.2_Silent_p.A445A|PDE2A_uc010rra.1_Silent_p.A459A|PDE2A_uc001osn.2_Silent_p.A210A|PDE2A_uc010rrb.1_Silent_p.A457A|PDE2A_uc010rrd.1_Silent_p.A351A	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	466	GAF 2.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)													---	---	---	---
BUD13	84811	broad.mit.edu	37	11	116631555	116631555	+	Missense_Mutation	SNP	G	A	A	rs149005278		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116631555G>A	uc001ppn.2	-	5	1184	c.1150C>T	c.(1150-1152)CGG>TGG	p.R384W	BUD13_uc001ppo.2_Missense_Mutation_p.R250W|BUD13_uc009yzc.2_Missense_Mutation_p.R384W	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1	384										large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)														---	---	---	---
CXCR5	643	broad.mit.edu	37	11	118764855	118764855	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118764855G>A	uc001pue.3	+	2	712	c.602G>A	c.(601-603)CGT>CAT	p.R201H	CXCR5_uc001puf.2_Missense_Mutation_p.R156H	NM_001716	NP_001707	P32302	CXCR5_HUMAN	Burkitt lymphoma receptor 1 isoform 1	201	Extracellular (Potential).				B cell activation|cellular component movement	integral to plasma membrane	C-X-C chemokine receptor activity			breast(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)														---	---	---	---
FKBP4	2288	broad.mit.edu	37	12	2912353	2912353	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2912353G>A	uc001qkz.2	+	10	1507	c.1309G>A	c.(1309-1311)GAC>AAC	p.D437N		NM_002014	NP_002005	Q02790	FKBP4_HUMAN	FK506 binding protein 52	437					negative regulation of microtubule polymerization or depolymerization|negative regulation of neuron projection development|protein folding	axonal growth cone|cytosol|membrane|microtubule|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity|protein binding, bridging				0			OV - Ovarian serous cystadenocarcinoma(31;0.00105)		Dimethyl sulfoxide(DB01093)													---	---	---	---
PLEKHG6	55200	broad.mit.edu	37	12	6436922	6436922	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6436922G>C	uc001qnr.2	+	15	2321	c.2173G>C	c.(2173-2175)GCT>CCT	p.A725P	PLEKHG6_uc010sew.1_Missense_Mutation_p.A725P|PLEKHG6_uc010sex.1_Missense_Mutation_p.A693P	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G	725					regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2																		---	---	---	---
KIAA1467	57613	broad.mit.edu	37	12	13215850	13215850	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13215850C>A	uc001rbi.2	+	5	816	c.793C>A	c.(793-795)CCA>ACA	p.P265T	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	265						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)														---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29665041	29665041	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29665041C>T	uc001rjb.2	-	17	2593	c.2119G>A	c.(2119-2121)GCT>ACT	p.A707T	TMTC1_uc001riz.2_Missense_Mutation_p.A464T|TMTC1_uc001rja.2_Missense_Mutation_p.A551T|TMTC1_uc001riy.2_Missense_Mutation_p.A160T	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	815	TPR 9.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	31311939	31311939	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31311939C>T	uc010sjy.1	-	5	491	c.491G>A	c.(490-492)CGA>CAA	p.R164Q						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																														---	---	---	---
SP1	6667	broad.mit.edu	37	12	53775997	53775997	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53775997G>A	uc001scw.2	+	3	363	c.266G>A	c.(265-267)GGA>GAA	p.G89E	SP1_uc010sog.1_Missense_Mutation_p.G82E	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	89	Ser/Thr-rich.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)														---	---	---	---
MMP19	4327	broad.mit.edu	37	12	56233273	56233273	+	Intron	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56233273G>A	uc001sib.2	-						MMP19_uc001sia.2_Intron|MMP19_uc001sid.2_Intron|MMP19_uc010spw.1_Intron	NM_002429	NP_002420			matrix metalloproteinase 19 isoform rasi-1						angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
MIP	4284	broad.mit.edu	37	12	56845179	56845179	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56845179C>T	uc001slh.2	-	4	709	c.677G>A	c.(676-678)CGG>CAG	p.R226Q	TIMELESS_uc001slf.2_5'Flank|TIMELESS_uc001slg.2_5'Flank	NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	226	Cytoplasmic (By similarity).				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1																		---	---	---	---
NAB2	4665	broad.mit.edu	37	12	57487217	57487217	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57487217C>T	uc001smz.2	+	6	1682	c.1304C>T	c.(1303-1305)CCG>CTG	p.P435L		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	435					cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
NUP107	57122	broad.mit.edu	37	12	69128509	69128509	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69128509G>A	uc001suf.2	+	25	2399	c.2284G>A	c.(2284-2286)GAG>AAG	p.E762K	NUP107_uc001sug.2_Missense_Mutation_p.E521K|NUP107_uc010stj.1_Missense_Mutation_p.E733K	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	762					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70071027	70071027	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70071027C>T	uc001svg.2	-	6	874	c.647G>A	c.(646-648)CGA>CAA	p.R216Q	BEST3_uc001svd.1_Missense_Mutation_p.R216Q|BEST3_uc001sve.1_RNA|BEST3_uc001svf.2_Missense_Mutation_p.R54Q|BEST3_uc010stm.1_Missense_Mutation_p.R110Q|BEST3_uc001svh.2_Missense_Mutation_p.R54Q	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	216	Extracellular (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	72667143	72667143	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72667143C>T	uc001sxa.2	+	1	615	c.585C>T	c.(583-585)GCC>GCT	p.A195A	LOC283392_uc010stv.1_5'UTR	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	195	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TBX5	6910	broad.mit.edu	37	12	114837435	114837435	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114837435C>T	uc001tvo.2	-	4	740	c.245G>A	c.(244-246)CGG>CAG	p.R82Q	TBX5_uc001tvp.2_Missense_Mutation_p.R82Q|TBX5_uc001tvq.2_Missense_Mutation_p.R32Q|TBX5_uc010syv.1_Missense_Mutation_p.R82Q	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	82	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124382427	124382427	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124382427C>T	uc001uft.3	+	54	9062	c.9037C>T	c.(9037-9039)CGC>TGC	p.R3013C		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3013	AAA 4 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
TPTE2	93492	broad.mit.edu	37	13	19997247	19997247	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19997247A>C	uc001umd.2	-	21	1735	c.1524T>G	c.(1522-1524)ATT>ATG	p.I508M	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.I397M|TPTE2_uc001ume.2_Missense_Mutation_p.I431M|TPTE2_uc009zzm.2_Missense_Mutation_p.I179M|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Missense_Mutation_p.I179M	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	508	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)														---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39262883	39262883	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39262883T>G	uc001uwv.2	+	1	1711	c.1402T>G	c.(1402-1404)TTG>GTG	p.L468V		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	468	Extracellular (Potential).|CSPG 2.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
POU4F1	5457	broad.mit.edu	37	13	79175950	79175950	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79175950G>T	uc001vkv.2	-	2	1094	c.860C>A	c.(859-861)GCC>GAC	p.A287D	uc001vku.1_Intron	NM_006237	NP_006228	Q01851	PO4F1_HUMAN	POU domain, class 4, transcription factor 1	287	POU-specific.				axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)														---	---	---	---
SLITRK6	84189	broad.mit.edu	37	13	86369596	86369596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86369596G>A	uc001vll.1	-	2	1507	c.1048C>T	c.(1048-1050)CGC>TGC	p.R350C	SLITRK6_uc010afe.1_Missense_Mutation_p.R115C	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	350	Extracellular (Potential).|LRRNT 2.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)														---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92797214	92797214	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92797214A>C	uc010tif.1	+	7	1899	c.1533A>C	c.(1531-1533)GAA>GAC	p.E511D		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	511						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
OR4M1	441670	broad.mit.edu	37	14	20249146	20249146	+	Missense_Mutation	SNP	T	C	C	rs148618328		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249146T>C	uc010tku.1	+	1	665	c.665T>C	c.(664-666)CTG>CCG	p.L222P		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
SLC22A17	51310	broad.mit.edu	37	14	23818627	23818627	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23818627C>T	uc001wjl.2	-	3	436	c.380G>A	c.(379-381)CGT>CAT	p.R127H	SLC22A17_uc010akk.2_5'UTR|SLC22A17_uc001wjn.2_RNA|SLC22A17_uc001wjm.2_Missense_Mutation_p.R127H|SLC22A17_uc010akl.1_Missense_Mutation_p.R127H	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	127					siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)														---	---	---	---
JPH4	84502	broad.mit.edu	37	14	24040633	24040633	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24040633G>A	uc001wkq.2	-	6	2225	c.1307C>T	c.(1306-1308)ACG>ATG	p.T436M	JPH4_uc010tnr.1_Missense_Mutation_p.T101M|JPH4_uc001wkr.2_Missense_Mutation_p.T436M	NM_032452	NP_115828	Q96JJ6	JPH4_HUMAN	junctophilin 4	436	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane				ovary(1)|pancreas(1)	2	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)														---	---	---	---
NKX2-1	7080	broad.mit.edu	37	14	36987176	36987176	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36987176G>A	uc001wtt.2	-	2	764	c.423C>T	c.(421-423)GGC>GGT	p.G141G	SFTA3_uc001wts.2_Intron|NKX2-1_uc001wtu.2_Silent_p.G171G|NKX2-1_uc001wtv.2_Silent_p.G141G|uc001wtw.1_5'Flank	NM_003317	NP_003308	P43699	NKX21_HUMAN	thyroid transcription factor 1 isoform 2	141					epithelial tube branching involved in lung morphogenesis|globus pallidus development|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|thyroid gland development		protein binding|transcription regulatory region DNA binding			skin(1)	1	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)				A		NSCLC								---	---	---	---
PTGER2	5732	broad.mit.edu	37	14	52781961	52781961	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52781961G>A	uc001wzr.2	+	1	946	c.695G>A	c.(694-696)AGC>AAC	p.S232N		NM_000956	NP_000947	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	232	Cytoplasmic (Potential).					integral to plasma membrane	prostaglandin E receptor activity			lung(1)|breast(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Iloprost(DB01088)													---	---	---	---
TIMM9	26520	broad.mit.edu	37	14	58875881	58875881	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58875881G>A	uc010aph.2	-	4	356	c.141C>T	c.(139-141)ACC>ACT	p.T47T	TIMM9_uc001xds.2_Silent_p.T47T|TIMM9_uc010api.2_Silent_p.T47T	NM_012460	NP_036592	Q9Y5J7	TIM9_HUMAN	translocase of inner mitochondrial membrane 9	47	Twin CX3C motif.				protein import into mitochondrial inner membrane|sensory perception of sound|transmembrane transport	mitochondrial inner membrane presequence translocase complex|mitochondrial intermembrane space protein transporter complex	zinc ion binding				0																		---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94674856	94674856	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94674856C>T	uc001ycs.1	+	3	401	c.247C>T	c.(247-249)CGA>TGA	p.R83*	PPP4R4_uc001ycr.2_Nonsense_Mutation_p.R83*	NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	83						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
OR4M2	390538	broad.mit.edu	37	15	22368885	22368885	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22368885T>G	uc010tzu.1	+	1	310	c.310T>G	c.(310-312)TTA>GTA	p.L104V	LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
MKRN3	7681	broad.mit.edu	37	15	23812297	23812297	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23812297G>T	uc001ywh.3	+	1	1844	c.1368G>T	c.(1366-1368)ATG>ATT	p.M456I	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Intron	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	456						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)														---	---	---	---
APBA2	321	broad.mit.edu	37	15	29346159	29346159	+	Silent	SNP	T	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346159T>A	uc001zck.2	+	3	279	c.72T>A	c.(70-72)CCT>CCA	p.P24P	APBA2_uc010azj.2_Silent_p.P24P|APBA2_uc010uat.1_Silent_p.P24P|APBA2_uc001zcl.2_Silent_p.P24P|APBA2_uc010uas.1_Silent_p.P24P	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	24					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33936554	33936554	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33936554G>A	uc001zhi.2	+	28	3669	c.3599G>A	c.(3598-3600)CGC>CAC	p.R1200H	RYR3_uc010bar.2_Missense_Mutation_p.R1200H	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1200	B30.2/SPRY 2.|Cytoplasmic (By similarity).|4 X approximate repeats.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54592538	54592538	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54592538G>A	uc002ack.2	+	11	4235	c.4235G>A	c.(4234-4236)CGT>CAT	p.R1412H	UNC13C_uc002acl.2_Missense_Mutation_p.R242H	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1412					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
FOXB1	27023	broad.mit.edu	37	15	60297453	60297453	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60297453C>T	uc002agj.1	+	2	770	c.291C>T	c.(289-291)TTC>TTT	p.F97F	FOXB1_uc010bgh.1_Intron	NM_012182	NP_036314	Q99853	FOXB1_HUMAN	forkhead box B1	97	Fork-head.				axon target recognition|cell migration in diencephalon|epithelial cell differentiation involved in mammary gland alveolus development|floor plate development|hypothalamus cell migration|inferior colliculus development|lactation|mammillothalamic axonal tract development|negative regulation of neuron apoptosis|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|telencephalon cell migration|visual learning	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ARID3B	10620	broad.mit.edu	37	15	74836809	74836809	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74836809C>T	uc002aye.2	+	2	733	c.532C>T	c.(532-534)CTG>TTG	p.L178L	ARID3B_uc002ayc.2_Silent_p.L178L|ARID3B_uc002ayd.2_Silent_p.L178L	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B	178					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
FSD2	123722	broad.mit.edu	37	15	83440851	83440851	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83440851T>G	uc002bjd.2	-	7	1408	c.1241A>C	c.(1240-1242)GAC>GCC	p.D414A	FSD2_uc010uol.1_Missense_Mutation_p.D414A|FSD2_uc010uom.1_Missense_Mutation_p.D414A	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing	414	Fibronectin type-III 1.									central_nervous_system(1)	1																		---	---	---	---
BTBD1	53339	broad.mit.edu	37	15	83735774	83735774	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83735774G>C	uc002bjn.2	-	1	333	c.130C>G	c.(130-132)CCT>GCT	p.P44A	BTBD1_uc002bjo.2_Missense_Mutation_p.P44A	NM_025238	NP_079514	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1 isoform 1	44						cytoplasmic mRNA processing body|protein complex	protein binding			ovary(1)|central_nervous_system(1)	2				all cancers(203;0.000186)														---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100692874	100692874	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100692874G>A	uc002bvv.1	-	10	1495	c.1416C>T	c.(1414-1416)GCC>GCT	p.A472A	ADAMTS17_uc002bvx.1_Silent_p.A229A	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	472	Disintegrin.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	33647321	33647321	+	IGR	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33647321G>A								SLC6A10P (750858 upstream) : MIR1826 (318187 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11687773	11687773	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11687773C>T	uc002gne.2	+	41	8046	c.7978C>T	c.(7978-7980)CAG>TAG	p.Q2660*	DNAH9_uc010coo.2_Nonsense_Mutation_p.Q1954*	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2660	AAA 3 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
TOM1L2	146691	broad.mit.edu	37	17	17797056	17797056	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17797056G>A	uc002grz.3	-	4	442	c.285C>T	c.(283-285)ATC>ATT	p.I95I	TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Silent_p.I95I|TOM1L2_uc010cpr.2_Silent_p.I95I|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Silent_p.I95I|TOM1L2_uc010vxb.1_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	95	VHS.				intracellular protein transport	intracellular					0	all_neural(463;0.228)																	---	---	---	---
NUFIP2	57532	broad.mit.edu	37	17	27620876	27620876	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27620876C>T	uc002hdy.3	-	1	291	c.202G>A	c.(202-204)GCC>ACC	p.A68T	NUFIP2_uc002hdx.3_Missense_Mutation_p.A68T	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	68						nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)															---	---	---	---
NF1	4763	broad.mit.edu	37	17	29533378	29533378	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29533378C>T	uc002hgg.2	+	12	1714	c.1381C>T	c.(1381-1383)CGA>TGA	p.R461*	NF1_uc002hge.1_Nonsense_Mutation_p.R461*|NF1_uc002hgf.1_Nonsense_Mutation_p.R461*|NF1_uc002hgh.2_Nonsense_Mutation_p.R461*|NF1_uc010csn.1_Nonsense_Mutation_p.R321*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	461					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.R461*(2)|p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)				D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			---	---	---	---
NF1	4763	broad.mit.edu	37	17	29685544	29685544	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29685544C>T	uc002hgg.2	+	55	8350	c.8017C>T	c.(8017-8019)CAA>TAA	p.Q2673*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q2652*|NF1_uc010cso.2_Nonsense_Mutation_p.Q861*|NF1_uc010wbt.1_Nonsense_Mutation_p.Q151*|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2673					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)				D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			---	---	---	---
GGNBP2	79893	broad.mit.edu	37	17	34923606	34923606	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34923606G>A	uc002hnb.2	+	6	881	c.632G>A	c.(631-633)CGA>CAA	p.R211Q	GGNBP2_uc002hna.2_Missense_Mutation_p.R211Q	NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	211					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)														---	---	---	---
MRM1	79922	broad.mit.edu	37	17	34964453	34964453	+	Silent	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34964453A>G	uc002hne.2	+	4	1103	c.888A>G	c.(886-888)GCA>GCG	p.A296A	MRM1_uc002hnf.2_Silent_p.A101A	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog	296					RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)														---	---	---	---
SCN4A	6329	broad.mit.edu	37	17	62020179	62020179	+	Intron	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62020179C>T	uc002jds.1	-							NM_000334	NP_000325			voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)													---	---	---	---
ICAM2	3384	broad.mit.edu	37	17	62081258	62081258	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62081258A>G	uc002jdu.3	-	3	627	c.395T>C	c.(394-396)ATT>ACT	p.I132T	C17orf72_uc002jdt.3_3'UTR|C17orf72_uc010wpu.1_3'UTR|C17orf72_uc010wpv.1_3'UTR|C17orf72_uc010wpw.1_3'UTR|ICAM2_uc002jdw.3_Missense_Mutation_p.I132T|ICAM2_uc010ded.2_Missense_Mutation_p.I132T|ICAM2_uc002jdx.3_Missense_Mutation_p.I132T|ICAM2_uc002jdv.3_Missense_Mutation_p.I132T	NM_000873	NP_000864	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor	132	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1																		---	---	---	---
SEC14L1	6397	broad.mit.edu	37	17	75209494	75209494	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75209494C>T	uc002jto.2	+	16	2229	c.1962C>T	c.(1960-1962)GAC>GAT	p.D654D	SEC14L1_uc010dhc.2_Silent_p.D654D|SEC14L1_uc010wth.1_Silent_p.D654D|SEC14L1_uc002jtm.2_Silent_p.D654D|SEC14L1_uc010wti.1_Silent_p.D620D|SEC14L1_uc010wtj.1_Missense_Mutation_p.R143C|SEC14L1_uc002jtr.2_Silent_p.D48D	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	654	GOLD.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2																		---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43204733	43204733	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43204733C>T	uc010dnj.2	+	3	425	c.104C>T	c.(103-105)CCG>CTG	p.P35L	SLC14A2_uc002lbb.2_Missense_Mutation_p.P35L|SLC14A2_uc002lbe.2_Missense_Mutation_p.P35L	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	35						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SMAD2	4087	broad.mit.edu	37	18	45368211	45368211	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45368211G>C	uc002lcy.2	-	11	1639	c.1391C>G	c.(1390-1392)TCA>TGA	p.S464*	SMAD2_uc002lcz.2_Nonsense_Mutation_p.S464*|SMAD2_uc010xdc.1_Nonsense_Mutation_p.S434*	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	464	MH2.			S->A: Loss of phosphorylation by TGFBR1; when associated with A-465 and A-467.	anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding	p.R462fs*>4(1)		large_intestine(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
SERPINB12	89777	broad.mit.edu	37	18	61232706	61232706	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61232706C>T	uc010xen.1	+	6	674	c.674C>T	c.(673-675)ACG>ATG	p.T225M	SERPINB12_uc010xeo.1_Missense_Mutation_p.T245M	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	225					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0																		---	---	---	---
AZU1	566	broad.mit.edu	37	19	829667	829667	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:829667C>T	uc002lpz.1	+	3	337	c.321C>T	c.(319-321)TAC>TAT	p.Y107Y		NM_001700	NP_001691	P20160	CAP7_HUMAN	azurocidin 1 preproprotein	107	Peptidase S1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cellular extravasation|defense response to Gram-negative bacterium|glial cell migration|induction of positive chemotaxis|inflammatory response|macrophage chemotaxis|microglial cell activation|monocyte activation|positive regulation of cell adhesion|positive regulation of fractalkine biosynthetic process|positive regulation of interleukin-1 beta biosynthetic process|positive regulation of MHC class II biosynthetic process|positive regulation of phagocytosis|positive regulation of tumor necrosis factor biosynthetic process|proteolysis|regulation of vascular permeability	azurophil granule|extracellular region	heparin binding|serine-type endopeptidase activity|toxin binding			pancreas(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZBTB7A	51341	broad.mit.edu	37	19	4048234	4048234	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4048234T>G	uc002lzh.2	-	3	1346	c.1271A>C	c.(1270-1272)AAG>ACG	p.K424T	ZBTB7A_uc002lzi.2_Missense_Mutation_p.K424T	NM_015898	NP_056982	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	424	C2H2-type 2.				cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ADAMTS10	81794	broad.mit.edu	37	19	8654436	8654436	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8654436G>A	uc002mkj.1	-	17	2208	c.1934C>T	c.(1933-1935)GCG>GTG	p.A645V	ADAMTS10_uc002mki.1_Missense_Mutation_p.A132V|ADAMTS10_uc002mkk.1_Missense_Mutation_p.A277V	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	645	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9068980	9068980	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068980C>T	uc002mkp.2	-	3	18670	c.18466G>A	c.(18466-18468)GCC>ACC	p.A6156T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6158	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ZNF317	57693	broad.mit.edu	37	19	9272049	9272049	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9272049C>T	uc002mku.2	+	7	2003	c.1728C>T	c.(1726-1728)CAC>CAT	p.H576H	ZNF317_uc002mkv.2_Silent_p.H435H|ZNF317_uc002mkw.2_Silent_p.H544H|ZNF317_uc002mkx.2_Silent_p.H491H|ZNF317_uc002mky.2_Silent_p.H459H	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	576	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
EIF3G	8666	broad.mit.edu	37	19	10226419	10226419	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10226419G>A	uc002mnd.2	-	9	845	c.781C>T	c.(781-783)CCT>TCT	p.P261S		NM_003755	NP_003746	O75821	EIF3G_HUMAN	eukaryotic translation initiation factor 3,	261	RRM.					cytosol|eukaryotic translation initiation factor 3 complex|nucleus|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)															---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13323247	13323247	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13323247G>A	uc010dze.2	-	42	6379	c.6143C>T	c.(6142-6144)CCG>CTG	p.P2048L	CACNA1A_uc010xnd.1_Missense_Mutation_p.P753L|CACNA1A_uc002mwx.3_Missense_Mutation_p.P753L|CACNA1A_uc010dzc.2_Missense_Mutation_p.P1573L|CACNA1A_uc002mwy.3_Missense_Mutation_p.P2047L|CACNA1A_uc002mwv.3_Missense_Mutation_p.P564L	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	2048	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
HIPK4	147746	broad.mit.edu	37	19	40890034	40890034	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40890034C>T	uc002onp.2	-	2	763	c.478G>A	c.(478-480)GGA>AGA	p.G160R		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	160	Protein kinase.					cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)															---	---	---	---
GPR4	2828	broad.mit.edu	37	19	46095082	46095082	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46095082C>T	uc002pcm.2	-	2	988	c.43G>A	c.(43-45)GTG>ATG	p.V15M	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	15	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)														---	---	---	---
SLC17A7	57030	broad.mit.edu	37	19	49939974	49939974	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49939974C>T	uc002pnp.2	-	2	319	c.147G>A	c.(145-147)CCG>CCA	p.P49P	SLC17A7_uc002pnq.1_5'UTR	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	49	Cytoplasmic (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)														---	---	---	---
SIGLEC5	8778	broad.mit.edu	37	19	52115642	52115642	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52115642C>T	uc002pxe.2	-	9	1637	c.1498G>A	c.(1498-1500)GGA>AGA	p.G500R		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	500	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)														---	---	---	---
LILRA2	11027	broad.mit.edu	37	19	55098716	55098716	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55098716G>A	uc002qgg.3	+	8	1444	c.1355G>A	c.(1354-1356)CGC>CAC	p.R452H	LILRA2_uc010ern.2_3'UTR|LILRA2_uc002qgf.2_Missense_Mutation_p.R435H|LILRA2_uc010ero.2_Missense_Mutation_p.R423H|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	452	Helical; (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)														---	---	---	---
NLRP4	147945	broad.mit.edu	37	19	56369488	56369488	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56369488C>T	uc002qmd.3	+	3	1151	c.729C>T	c.(727-729)CCC>CCT	p.P243P	NLRP4_uc002qmf.2_Silent_p.P168P|NLRP4_uc010etf.2_Silent_p.P74P	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	243	NACHT.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)														---	---	---	---
C20orf72	92667	broad.mit.edu	37	20	17956474	17956474	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17956474G>A	uc002wqh.2	+	3	741	c.659G>A	c.(658-660)CGA>CAA	p.R220Q	C20orf72_uc010gco.2_Intron|C20orf72_uc010gcp.2_RNA	NM_052865	NP_443097	Q9BQP7	CT072_HUMAN	hypothetical protein LOC92667	220											0																		---	---	---	---
SAMHD1	25939	broad.mit.edu	37	20	35555600	35555600	+	Silent	SNP	C	T	T	rs144587056		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35555600C>T	uc002xgh.1	-	6	811	c.681G>A	c.(679-681)CCG>CCA	p.P227P		NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	227	HD.				defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
KCNB1	3745	broad.mit.edu	37	20	47991216	47991216	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47991216C>T	uc002xur.1	-	2	1045	c.881G>A	c.(880-882)CGC>CAC	p.R294H	KCNB1_uc002xus.1_Missense_Mutation_p.R294H	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related	294					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity	p.R294R(1)		pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)															---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58467645	58467645	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58467645C>T	uc002yaz.2	-	22	2044	c.1905G>A	c.(1903-1905)TCG>TCA	p.S635S		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	635					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60887486	60887486	+	Silent	SNP	G	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60887486G>A	uc002ycq.2	-	68	9397	c.9330C>T	c.(9328-9330)GGC>GGT	p.G3110G		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	3110	Laminin G-like 2.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
BIRC7	79444	broad.mit.edu	37	20	61870941	61870941	+	Missense_Mutation	SNP	G	A	A	rs142521563		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61870941G>A	uc002yej.2	+	6	1054	c.881G>A	c.(880-882)CGC>CAC	p.R294H	BIRC7_uc010gkc.1_3'UTR|BIRC7_uc002yei.2_Missense_Mutation_p.R276H	NM_139317	NP_647478	Q96CA5	BIRC7_HUMAN	livin inhibitor of apoptosis isoform alpha	294					activation of JUN kinase activity|anti-apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytoplasm|nucleus	enzyme binding|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3	all_cancers(38;2.72e-09)																	---	---	---	---
PTK6	5753	broad.mit.edu	37	20	62164956	62164956	+	Silent	SNP	G	A	A	rs61736391		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62164956G>A	uc002yfg.2	-	4	658	c.618C>T	c.(616-618)TTC>TTT	p.F206F	PTK6_uc011aay.1_Silent_p.F105F|PTK6_uc011aaz.1_5'Flank	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	206	Protein kinase.					cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)															---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62193017	62193017	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62193017C>T	uc002yfm.2	-	13	7665	c.6773G>A	c.(6772-6774)CGT>CAT	p.R2258H	PRIC285_uc002yfl.1_Missense_Mutation_p.R1689H	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	2258					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
MRPL39	54148	broad.mit.edu	37	21	26972169	26972169	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26972169C>T	uc002ylo.2	-	5	544	c.530G>A	c.(529-531)GGT>GAT	p.G177D	MRPL39_uc002yln.2_Missense_Mutation_p.G177D	NM_017446	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39 isoform a	177						mitochondrial ribosome	nucleotide binding				0																		---	---	---	---
KRTAP11-1	337880	broad.mit.edu	37	21	32253626	32253626	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32253626C>T	uc002yov.2	-	1	249	c.218G>A	c.(217-219)CGA>CAA	p.R73Q		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	73						keratin filament	structural molecule activity			pancreas(1)	1																		---	---	---	---
BRWD1	54014	broad.mit.edu	37	21	40559053	40559053	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40559053C>T	uc002yxk.1	-	42	7001	c.6862G>A	c.(6862-6864)GAT>AAT	p.D2288N	BRWD1_uc010goc.1_Missense_Mutation_p.D931N	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	2288					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)																---	---	---	---
KRTAP10-8	386681	broad.mit.edu	37	21	46032554	46032554	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46032554C>T	uc002zfo.1	+	1	559	c.537C>T	c.(535-537)GTC>GTT	p.V179V	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198695	NP_941968	P60410	KR108_HUMAN	keratin associated protein 10-8	179	19 X 5 AA repeats of C-C-X(3).|13.					keratin filament				large_intestine(1)|breast(1)	2																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26706696	26706696	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26706696C>T	uc003acb.2	+	7	1731	c.1575C>T	c.(1573-1575)ACC>ACT	p.T525T	SEZ6L_uc003acc.2_Silent_p.T525T|SEZ6L_uc011akc.1_Silent_p.T525T|SEZ6L_uc003acd.2_Silent_p.T525T|SEZ6L_uc011akd.1_Silent_p.T525T|SEZ6L_uc003ace.2_Silent_p.T525T|SEZ6L_uc003acf.1_Silent_p.T298T|SEZ6L_uc010gvc.1_Silent_p.T298T	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	525	CUB 2.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
SLC5A1	6523	broad.mit.edu	37	22	32479091	32479091	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32479091C>T	uc003amc.2	+	7	846	c.614C>T	c.(613-615)ACC>ATC	p.T205I	SLC5A1_uc011alz.1_Missense_Mutation_p.T78I	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	205	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1																		---	---	---	---
BPIL2	254240	broad.mit.edu	37	22	32831745	32831745	+	Silent	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32831745C>T	uc003amn.2	-	8	870	c.870G>A	c.(868-870)GCG>GCA	p.A290A	BPIL2_uc010gwo.2_Silent_p.A104A|BPIL2_uc011amb.1_Silent_p.A14A	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	290						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2																		---	---	---	---
TBC1D22A	25771	broad.mit.edu	37	22	47274544	47274544	+	Intron	SNP	A	C	C			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47274544A>C	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161			TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)														---	---	---	---
CDKL5	6792	broad.mit.edu	37	X	18671592	18671592	+	Silent	SNP	G	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18671592G>T	uc004cym.2	+	21	3274	c.3021G>T	c.(3019-3021)CTG>CTT	p.L1007L	CDKL5_uc004cyn.2_Silent_p.L1007L|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	1007					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)																	---	---	---	---
MAGEB6	158809	broad.mit.edu	37	X	26212639	26212639	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26212639C>T	uc004dbr.2	+	2	825	c.676C>T	c.(676-678)CGC>TGC	p.R226C	MAGEB6_uc010ngc.1_Missense_Mutation_p.R6C	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	226	MAGE.									ovary(3)	3																		---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47775487	47775487	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47775487C>A	uc010nhy.1	+	6	1810	c.1442C>A	c.(1441-1443)TCT>TAT	p.S481Y		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	481	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---
DOCK11	139818	broad.mit.edu	37	X	117748655	117748655	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117748655C>T	uc004eqp.2	+	29	3160	c.3097C>T	c.(3097-3099)CGC>TGC	p.R1033C	DOCK11_uc004eqq.2_Missense_Mutation_p.R799C	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1033					blood coagulation	cytosol	GTP binding			ovary(3)	3																		---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130419221	130419221	+	Missense_Mutation	SNP	C	T	T	rs149790689		TCGA-BR-4371-01	TCGA-BR-4371-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130419221C>T	uc004ewd.2	-	5	837	c.599G>A	c.(598-600)CGC>CAC	p.R200H	IGSF1_uc004ewe.3_Missense_Mutation_p.R189H|IGSF1_uc004ewf.2_Missense_Mutation_p.R180H|IGSF1_uc004ewg.2_Missense_Mutation_p.R200H	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	200	Ig-like C2-type 2.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
