Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
GATAD2B	57459	broad.mit.edu	37	1	153800932	153800939	+	Intron	DEL	ACACACAC	-	-	rs71677766		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153800932_153800939delACACACAC	uc001fdb.3	-							NM_020699	NP_065750			GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
DTL	51514	broad.mit.edu	37	1	212224845	212224845	+	Intron	DEL	A	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212224845delA	uc009xdc.2	+						DTL_uc010ptb.1_Intron|DTL_uc001hiz.3_Intron	NM_016448	NP_057532			denticleless homolog						DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
ZNF678	339500	broad.mit.edu	37	1	227882636	227882639	+	Intron	DEL	CTTT	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227882636_227882639delCTTT	uc009xeu.1	+											Homo sapiens cDNA: FLJ22822 fis, clone KAIA3968.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			pancreas(1)	1		Prostate(94;0.0885)																---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241876639	241876640	+	Intron	INS	-	AGGG	AGGG	rs149445295	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241876639_241876640insAGGG	uc001hze.1	+						WDR64_uc001hzf.1_Intron					RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
FAM179A	165186	broad.mit.edu	37	2	29247344	29247344	+	Intron	DEL	G	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29247344delG	uc010ezl.2	+						FAM179A_uc010ymm.1_Intron|FAM179A_uc002rmr.3_Intron	NM_199280	NP_954974			hypothetical protein LOC165186								binding			ovary(3)|skin(1)	4																		---	---	---	---
C2orf3	6936	broad.mit.edu	37	2	75900438	75900439	+	Intron	INS	-	A	A	rs75112825		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75900438_75900439insA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194			hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TCF7L1	83439	broad.mit.edu	37	2	85529267	85529268	+	Intron	INS	-	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85529267_85529268insA	uc002soy.2	+							NM_031283	NP_112573			HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
GLI2	2736	broad.mit.edu	37	2	121531480	121531483	+	Intron	DEL	TCCT	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121531480_121531483delTCCT	uc010yyu.1	+						GLI2_uc002tmp.1_Intron					SubName: Full=cDNA FLJ60878, highly similar to Homo sapiens GLI-Kruppel family member GLI2, mRNA;						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																												OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	193594161	193594172	+	IGR	DEL	AGGCAGGCAGGC	-	-	rs11689603		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193594161_193594172delAGGCAGGCAGGC								TMEFF2 (534517 upstream) : PCGEM1 (20399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	208519446	208519447	+	IGR	INS	-	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208519446_208519447insC								FAM119A (29381 upstream) : CCNYL1 (56817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	134161393	134161394	+	IGR	DEL	GT	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134161393_134161394delGT								AMOTL2 (67134 upstream) : ANAPC13 (35153 downstream)																																			---	---	---	---
HTT	3064	broad.mit.edu	37	4	3184203	3184203	+	Intron	DEL	T	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3184203delT	uc011bvq.1	+							NM_002111	NP_002102			huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)														---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103826510	103826511	+	Intron	DEL	CA	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103826510_103826511delCA	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357			hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	70422906	70422906	+	Intron	DEL	T	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70422906delT	uc010iyn.2	-											Homo sapiens cDNA FLJ78390 complete cds.																														---	---	---	---
IRF1	3659	broad.mit.edu	37	5	131821520	131821521	+	Intron	INS	-	AC	AC	rs142244361	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131821520_131821521insAC	uc003kxa.2	-						C5orf56_uc010jds.1_Intron|IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron	NM_002198	NP_002189			interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)														---	---	---	---
FTSJD2	23070	broad.mit.edu	37	6	37420622	37420622	+	Intron	DEL	T	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37420622delT	uc003ons.2	+						FTSJD2_uc010jwu.2_Intron	NM_015050	NP_055865			FtsJ methyltransferase domain containing 2						mRNA capping	cytoplasm|nucleus	mRNA (nucleoside-2'-O-)-methyltransferase activity|nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
DPY19L1	23333	broad.mit.edu	37	7	34979749	34979749	+	Intron	DEL	T	-	-	rs72287078		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34979749delT	uc003tem.3	-						DPY19L1_uc003tel.1_5'Flank	NM_015283	NP_056098			dpy-19-like 1							integral to membrane					0																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40228031	40228032	+	Intron	INS	-	C	C	rs72318342		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40228031_40228032insC	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	125460585	125460585	+	IGR	DEL	G	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125460585delG								POT1 (890548 upstream) : GRM8 (618067 downstream)																																			---	---	---	---
FAM71F1	84691	broad.mit.edu	37	7	128366695	128366696	+	Intron	INS	-	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128366695_128366696insT	uc003vno.1	+						FAM71F1_uc003vnm.1_Intron|FAM71F1_uc003vnn.1_Intron|FAM71F1_uc010llp.1_Intron|FAM71F1_uc003vnp.1_Intron	NM_032599	NP_115988			testes development-related NYD-SP18											skin(1)	1																		---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913			carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	42538849	42538852	+	IGR	DEL	GGAA	-	-	rs111589288		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42538849_42538852delGGAA								C8orf40 (130710 upstream) : CHRNB3 (13710 downstream)																																			---	---	---	---
ROD1	9991	broad.mit.edu	37	9	114994280	114994282	+	Intron	DEL	AGA	-	-	rs3983403		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994280_114994282delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147			ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
WDR38	401551	broad.mit.edu	37	9	127616793	127616794	+	Intron	DEL	AC	-	-	rs145755574		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127616793_127616794delAC	uc004box.2	+						WDR38_uc011lzn.1_Intron|WDR38_uc011lzo.1_Intron|WDR38_uc011lzp.1_Intron	NM_001045476	NP_001038941			WD repeat domain 38												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	119607595	119607596	+	IGR	INS	-	GAAGGAA	GAAGGAA	rs72080307		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119607595_119607596insGAAGGAA								EMX2 (298539 upstream) : RAB11FIP2 (156833 downstream)																																			---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135097212	135097213	+	Intron	INS	-	CGCCCTGCCTCGCCCCT	CGCCCTGCCTCGCCCCT	rs147704556	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097212_135097213insCGCCCTGCCTCGCCCCT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
NDUFS3	4722	broad.mit.edu	37	11	47602712	47602712	+	Intron	DEL	T	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602712delT	uc001nga.2	+						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_3'UTR	NM_004551	NP_004542			NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)													---	---	---	---
CHKA	1119	broad.mit.edu	37	11	67829386	67829387	+	Intron	INS	-	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67829386_67829387insA	uc001onj.2	-						CHKA_uc001onk.2_Intron|uc001onl.1_5'Flank	NM_001277	NP_001268			choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)													---	---	---	---
MLL	4297	broad.mit.edu	37	11	118353037	118353038	+	Intron	INS	-	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118353037_118353038insT	uc001pta.2	+						MLL_uc001ptb.2_Intron|MLL_uc001pte.1_Intron|MLL_uc009zab.1_Intron	NM_005933	NP_005924			myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)				T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66957859	66957860	+	Intron	INS	-	TT	TT	rs146009716	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66957859_66957860insTT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	119145296	119145298	+	IGR	DEL	CAA	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145296_119145298delCAA								SUDS3 (289457 upstream) : SRRM4 (274098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87295754	87295755	+	IGR	INS	-	ACAC	ACAC	rs148862277	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87295754_87295755insACAC								SLITRK6 (922271 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22409518	22409523	+	Intron	DEL	TCTCTC	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22409518_22409523delTCTCTC	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010ajb.1_Intron|uc001wck.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	92292862	92292867	+	IGR	DEL	TGGAGA	-	-	rs145621440		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92292862_92292867delTGGAGA								SV2B (454214 upstream) : SLCO3A1 (104071 downstream)																																			---	---	---	---
ZC3H7A	29066	broad.mit.edu	37	16	11875140	11875149	+	Intron	DEL	AAAATAAAAT	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11875140_11875149delAAAATAAAAT	uc002dbk.2	-						ZC3H7A_uc002dbl.2_Intron|ZC3H7A_uc002dbm.1_Intron	NM_014153	NP_054872			zinc finger CCCH-type containing 7A							nucleus	nucleic acid binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	71061896	71061896	+	Intron	DEL	T	-	-	rs142337199		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71061896delT	uc002ezr.2	-						HYDIN_uc010cfz.1_Intron|HYDIN_uc002ezv.2_Intron	NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	46791088	46791088	+	IGR	DEL	G	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46791088delG								MIR196A1 (81167 upstream) : PRAC (8004 downstream)																																			---	---	---	---
ACSBG2	81616	broad.mit.edu	37	19	6190824	6190825	+	Intron	DEL	AC	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6190824_6190825delAC	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron|uc002mej.1_RNA	NM_030924	NP_112186			bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13445408	13445411	+	Intron	DEL	TGTG	-	-	rs138143360		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445408_13445411delTGTG	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
NANOS3	342977	broad.mit.edu	37	19	13986003	13986003	+	5'Flank	DEL	T	-	-	rs77913995		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13986003delT	uc002mxj.3	+							NM_001098622	NP_001092092			nanos homolog 3						anti-apoptosis|germ cell development|multicellular organismal development|oogenesis|regulation of cell cycle|regulation of translation|spermatogenesis	cytoplasmic mRNA processing body|nucleus|stress granule	RNA binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(19;2e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60532402	60532403	+	IGR	DEL	AG	-	-	rs71195424		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60532402_60532403delAG								MIR1257 (3684 upstream) : TAF4 (17452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9768800	9768801	+	Intron	INS	-	TATGT	TATGT			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9768800_9768801insTATGT	uc011abu.1	+											Homo sapiens, clone IMAGE:4720764, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	25855682	25855683	+	Intron	INS	-	GTGT	GTGT	rs138963277	by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25855682_25855683insGTGT	uc003abt.2	+						uc003abu.2_Intron|uc003abv.2_Intron					Homo sapiens cDNA clone IMAGE:3542716, partial cds.																														---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26605954	26605957	+	Intron	DEL	AGGG	-	-	rs5752279		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26605954_26605957delAGGG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
IL3RA	3563	broad.mit.edu	37	X	1467584	1467585	+	Intron	DEL	TT	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467584_1467585delTT	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174			interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)													---	---	---	---
APOO	79135	broad.mit.edu	37	X	23854743	23854743	+	Intron	DEL	T	-	-	rs137891693		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23854743delT	uc004dax.2	-						APOO_uc004daw.2_Intron|APOO_uc004day.3_Intron	NM_024122	NP_077027			apolipoprotein O precursor						lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	68004998	68004998	+	IGR	DEL	A	-	-			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68004998delA								STARD8 (59321 upstream) : EFNB1 (43842 downstream)																																			---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14106452	14106452	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14106452C>T	uc001avi.2	+	8	3018	c.2162C>T	c.(2161-2163)GCT>GTT	p.A721V	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.A721V|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.A478V|PRDM2_uc001avk.2_Missense_Mutation_p.A520V|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	721						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---
MAN1C1	57134	broad.mit.edu	37	1	26085078	26085078	+	Intron	SNP	T	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26085078T>C	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron	NM_020379	NP_065112			mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)														---	---	---	---
NCDN	23154	broad.mit.edu	37	1	36026841	36026841	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36026841G>T	uc001bza.2	+	4	1216	c.1089G>T	c.(1087-1089)CAG>CAT	p.Q363H	NCDN_uc001bzb.2_Missense_Mutation_p.Q363H|NCDN_uc001bzc.2_Missense_Mutation_p.Q346H	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	363					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
POMGNT1	55624	broad.mit.edu	37	1	46662506	46662506	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46662506C>T	uc001cpe.2	-	4	415	c.251G>A	c.(250-252)CGC>CAC	p.R84H	POMGNT1_uc010olx.1_Missense_Mutation_p.R62H|POMGNT1_uc010oly.1_RNA|POMGNT1_uc010olz.1_5'UTR|POMGNT1_uc001cpg.2_Missense_Mutation_p.R84H|POMGNT1_uc001cpf.2_5'UTR|POMGNT1_uc001cpj.2_Missense_Mutation_p.R84H	NM_017739	NP_060209	Q8WZA1	PMGT1_HUMAN	O-linked mannose	84	Lumenal (Potential).				protein N-linked glycosylation|protein O-linked glycosylation	Golgi membrane|integral to membrane|microsome	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
CYP4Z1	199974	broad.mit.edu	37	1	47571866	47571866	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47571866G>A	uc001cqu.1	+	9	1137	c.1134G>A	c.(1132-1134)CCG>CCA	p.P378P		NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1	378	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1																		---	---	---	---
RAB3B	5865	broad.mit.edu	37	1	52403033	52403033	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52403033C>T	uc001cth.2	-	3	405	c.280G>A	c.(280-282)GGG>AGG	p.G94R		NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	94					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
RABGGTB	5876	broad.mit.edu	37	1	76251962	76251962	+	Intron	SNP	A	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76251962A>C	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|SNORD45C_uc001dgz.2_5'Flank|RABGGTB_uc001dha.1_5'Flank|SNORD45A_uc009wbu.1_5'Flank	NM_004582	NP_004573			RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1																		---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79403635	79403635	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79403635G>A	uc001diq.3	-	6	773	c.617C>T	c.(616-618)ACA>ATA	p.T206I		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	206	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85816210	85816210	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85816210G>A	uc001dlb.2	-	4	646	c.485C>T	c.(484-486)GCA>GTA	p.A162V	DDAH1_uc001dlc.2_Missense_Mutation_p.A59V|uc001dla.1_Intron|DDAH1_uc010osb.1_Missense_Mutation_p.A62V|DDAH1_uc009wco.2_Missense_Mutation_p.A59V	NM_012137	NP_036269	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1	162					arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
ACP6	51205	broad.mit.edu	37	1	147126329	147126329	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147126329C>T	uc001epr.2	-	6	1224	c.760G>A	c.(760-762)GAC>AAC	p.D254N	ACP6_uc009wjj.1_Missense_Mutation_p.D211N	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor	254					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)																	---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152080886	152080886	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152080886G>T	uc001ezp.2	-	2	4807	c.4807C>A	c.(4807-4809)CAG>AAG	p.Q1603K	TCHH_uc009wne.1_Missense_Mutation_p.Q1603K	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1603	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
OR10X1	128367	broad.mit.edu	37	1	158549352	158549352	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158549352C>T	uc010pin.1	-	1	338	c.338G>A	c.(337-339)TGT>TAT	p.C113Y		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	113	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240370959	240370959	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370959C>T	uc010pyd.1	+	5	3072	c.2847C>T	c.(2845-2847)CCC>CCT	p.P949P	FMN2_uc010pye.1_Silent_p.P953P	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	949	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1658234	1658234	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1658234G>A	uc002qxa.2	-	15	1948	c.1884C>T	c.(1882-1884)ATC>ATT	p.I628I	PXDN_uc002qxb.1_Silent_p.I628I	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	628					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
RAD51AP2	729475	broad.mit.edu	37	2	17692134	17692134	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17692134C>A	uc002rcl.1	-	3	3441	c.3417G>T	c.(3415-3417)AGG>AGT	p.R1139S	RAD51AP2_uc010exn.1_Missense_Mutation_p.R1130S	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	1139	Interaction with RAD51.									ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---
PLEKHB2	55041	broad.mit.edu	37	2	131904310	131904310	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131904310G>A	uc002tsg.3	+	8	1193	c.633G>A	c.(631-633)ACG>ACA	p.T211T	PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Silent_p.T210T|PLEKHB2_uc002tsf.3_Silent_p.T219T|PLEKHB2_uc010zao.1_Silent_p.T161T|PLEKHB2_uc010zap.1_Missense_Mutation_p.R175Q|PLEKHB2_uc010zaq.1_Missense_Mutation_p.R167Q|PLEKHB2_uc002tsi.3_Silent_p.T252T	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B	211						membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)														---	---	---	---
PKP4	8502	broad.mit.edu	37	2	159488462	159488462	+	Intron	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159488462C>T	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002tzz.1_Intron|PKP4_uc002uaa.2_Intron	NM_003628	NP_003619			plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7															HNSCC(62;0.18)			---	---	---	---
KCNH7	90134	broad.mit.edu	37	2	163291723	163291723	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163291723C>T	uc002uch.1	-	8	2151	c.1939G>A	c.(1939-1941)GTC>ATC	p.V647I	KCNH7_uc002uci.2_Missense_Mutation_p.V640I	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	647	Helical; Name=Segment S6; (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)													---	---	---	---
TTN	7273	broad.mit.edu	37	2	179621093	179621093	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179621093C>A	uc010zfh.1	-	44	10821	c.10597G>T	c.(10597-10599)GAG>TAG	p.E3533*	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ZSWIM2	151112	broad.mit.edu	37	2	187712478	187712478	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187712478C>T	uc002upu.1	-	2	250	c.210G>A	c.(208-210)CCG>CCA	p.P70P		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	70	SWIM-type.				apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)															---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211515168	211515168	+	Intron	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211515168G>T	uc002vee.3	+						CPS1_uc010fur.2_Intron|CPS1_uc010fus.2_Intron	NM_001875	NP_001866			carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
NPHP3	27031	broad.mit.edu	37	3	132419279	132419279	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132419279G>T	uc003epe.1	-	11	1719	c.1642C>A	c.(1642-1644)CAG>AAG	p.Q548K	NPHP3_uc003epd.1_5'UTR|NPHP3_uc003epf.1_Missense_Mutation_p.Q303K	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	548					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133109037	133109037	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133109037G>T	uc003eph.2	+	5	1738	c.1464G>T	c.(1462-1464)ACG>ACT	p.T488T	TMEM108_uc003epi.2_Silent_p.T488T|TMEM108_uc003epk.2_Silent_p.T18T|TMEM108_uc003epm.2_Silent_p.T439T	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	488	Helical; (Potential).					integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
BFSP2	8419	broad.mit.edu	37	3	133119296	133119296	+	Silent	SNP	C	T	T	rs34163197	byFrequency;by1000genomes	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133119296C>T	uc003epn.1	+	1	507	c.369C>T	c.(367-369)CAC>CAT	p.H123H		NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin	123	Potential.|Rod.				response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0																		---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155200264	155200264	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155200264G>A	uc011bok.1	-	23	3852	c.3575C>T	c.(3574-3576)CCG>CTG	p.P1192L	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.P1154L	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1192					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
FAM53A	152877	broad.mit.edu	37	4	1656729	1656729	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1656729G>T	uc011bve.1	-	4	1056	c.858C>A	c.(856-858)TCC>TCA	p.S286S	FAM53A_uc010ibw.2_Silent_p.S286S	NM_001013622	NP_001013644	Q6NSI3	FA53A_HUMAN	dorsal neural-tube nuclear protein	286						nucleus					0		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)															---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8233730	8233730	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8233730G>C	uc003gkv.3	+	13	3079	c.2978G>C	c.(2977-2979)TGC>TCC	p.C993S	SH3TC1_uc003gkw.3_Missense_Mutation_p.C917S|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	993							binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
BOD1L	259282	broad.mit.edu	37	4	13605310	13605310	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13605310C>T	uc003gmz.1	-	10	3331	c.3214G>A	c.(3214-3216)GAA>AAA	p.E1072K	BOD1L_uc010idr.1_Missense_Mutation_p.E409K	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1072							DNA binding			ovary(5)|breast(1)	6																		---	---	---	---
YTHDC1	91746	broad.mit.edu	37	4	69203372	69203372	+	Missense_Mutation	SNP	T	C	C	rs141403045		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69203372T>C	uc003hdx.2	-	3	730	c.377A>G	c.(376-378)TAT>TGT	p.Y126C	YTHDC1_uc003hdy.2_Missense_Mutation_p.Y126C	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	126										upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
NSUN2	54888	broad.mit.edu	37	5	6604799	6604799	+	Splice_Site	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6604799C>A	uc003jdu.2	-	16	1803	c.1738_splice	c.e16-1	p.V580_splice	NSUN2_uc003jds.2_Missense_Mutation_p.Q25H|NSUN2_uc003jdt.2_Splice_Site_p.V344_splice|NSUN2_uc011cmk.1_Splice_Site_p.V545_splice|NSUN2_uc003jdv.2_Splice_Site_p.V344_splice	NM_017755	NP_060225			NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1																		---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15936930	15936930	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15936930G>A	uc003jfn.1	+	4	1592	c.1111G>A	c.(1111-1113)GTG>ATG	p.V371M		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	371	LRR 8.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58270677	58270677	+	Silent	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58270677C>A	uc003jsa.2	-	15	2416	c.2244G>T	c.(2242-2244)ACG>ACT	p.T748T	PDE4D_uc003jrx.2_Silent_p.T612T|PDE4D_uc003jry.2_Silent_p.T446T|PDE4D_uc003jrz.2_Silent_p.T684T|PDE4D_uc003jsb.2_Silent_p.T687T|PDE4D_uc003jrt.2_Silent_p.T446T|PDE4D_uc003jru.2_Silent_p.T524T|PDE4D_uc003jrv.2_Silent_p.T618T|PDE4D_uc003jrw.2_Silent_p.T626T|PDE4D_uc003jrs.2_Silent_p.T457T	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1	748					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PCDHGB7	56099	broad.mit.edu	37	5	140799679	140799679	+	Silent	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140799679C>A	uc003lkn.1	+	1	2398	c.2253C>A	c.(2251-2253)GCC>GCA	p.A751A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Silent_p.A751A|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	751	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
B3GALT4	8705	broad.mit.edu	37	6	33245475	33245475	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33245475G>T	uc003odr.2	+	1	559	c.279G>T	c.(277-279)TCG>TCT	p.S93S		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	93	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
B3GALT4	8705	broad.mit.edu	37	6	33245480	33245480	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33245480G>T	uc003odr.2	+	1	564	c.284G>T	c.(283-285)GGC>GTC	p.G95V		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	95	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
B3GALT4	8705	broad.mit.edu	37	6	33245481	33245481	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33245481C>T	uc003odr.2	+	1	565	c.285C>T	c.(283-285)GGC>GGT	p.G95G		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	95	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
MCM3	4172	broad.mit.edu	37	6	52141985	52141985	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52141985C>A	uc003pan.1	-	8	1155	c.1045G>T	c.(1045-1047)GTT>TTT	p.V349F	MCM3_uc011dwu.1_Missense_Mutation_p.V303F	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	349	ATP (Potential).|MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)																	---	---	---	---
BAI3	577	broad.mit.edu	37	6	69759194	69759194	+	Silent	SNP	C	G	G	rs146898809		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69759194C>G	uc003pev.3	+	15	2737	c.2289C>G	c.(2287-2289)GGC>GGG	p.G763G	BAI3_uc010kak.2_Silent_p.G763G	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	763	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
KIAA0776	23376	broad.mit.edu	37	6	96973222	96973222	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96973222T>G	uc003por.2	+	4	350	c.302T>G	c.(301-303)ATT>AGT	p.I101S	KIAA0776_uc010kck.2_RNA	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376	101	Required for E3 UFM1-protein ligase activity.				negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144811224	144811224	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144811224C>T	uc003qkt.2	+	30	4244	c.4152C>T	c.(4150-4152)ATC>ATT	p.I1384I		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1384	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152806029	152806029	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152806029C>T	uc010kiw.2	-	13	1728	c.1126G>A	c.(1126-1128)GGT>AGT	p.G376S	SYNE1_uc003qot.3_Missense_Mutation_p.G383S|SYNE1_uc003qou.3_Missense_Mutation_p.G376S|SYNE1_uc010kjb.1_Missense_Mutation_p.G359S|SYNE1_uc003qpa.1_Missense_Mutation_p.G376S|SYNE1_uc003qox.1_5'Flank	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	376	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
EIF2AK1	27102	broad.mit.edu	37	7	6066541	6066541	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6066541C>A	uc003spp.2	-	14	1728	c.1582G>T	c.(1582-1584)GGA>TGA	p.G528*	EIF2AK1_uc003spq.2_Nonsense_Mutation_p.G527*|EIF2AK1_uc011jwm.1_Nonsense_Mutation_p.G404*	NM_014413	NP_055228	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha	528	Protein kinase.				negative regulation of hemoglobin biosynthetic process|negative regulation of translational initiation by iron|protein autophosphorylation|response to external stimulus|response to stress	cytoplasm	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|heme binding|protein homodimerization activity			upper_aerodigestive_tract(1)|stomach(1)|lung(1)|central_nervous_system(1)	4		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)														---	---	---	---
ETV1	2115	broad.mit.edu	37	7	13971233	13971233	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13971233G>A	uc011jxq.1	-	9	1435	c.696C>T	c.(694-696)CAC>CAT	p.H232H	ETV1_uc011jxn.1_Silent_p.H192H|ETV1_uc011jxo.1_Silent_p.H129H|ETV1_uc011jxp.1_Silent_p.H174H|ETV1_uc003ssw.3_Silent_p.H232H|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Silent_p.H214H|ETV1_uc011jxs.1_Silent_p.H214H|ETV1_uc010ktv.2_Silent_p.H101H	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	232					transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35								T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								---	---	---	---
SNX13	23161	broad.mit.edu	37	7	17836453	17836453	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17836453G>A	uc003stw.1	-	25	2869	c.2656C>T	c.(2656-2658)CCA>TCA	p.P886S	SNX13_uc003stv.2_Missense_Mutation_p.P875S|SNX13_uc010kuc.2_Missense_Mutation_p.P672S|SNX13_uc010kub.2_Missense_Mutation_p.P281S			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;	886					cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)																	---	---	---	---
PION	54103	broad.mit.edu	37	7	76990192	76990192	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76990192G>T	uc003ugf.2	-	14	1055	c.976C>A	c.(976-978)CTT>ATT	p.L326I	PION_uc003ugg.1_Missense_Mutation_p.L111I	NM_017439	NP_059135	A4D1B5	GSAP_HUMAN	pigeon homolog	326					beta-amyloid formation|regulation of proteolysis	trans-Golgi network	beta-amyloid binding			central_nervous_system(1)	1																		---	---	---	---
LMOD2	442721	broad.mit.edu	37	7	123302140	123302140	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123302140A>G	uc003vky.2	+	2	657	c.500A>G	c.(499-501)AAA>AGA	p.K167R		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	167						cytoskeleton	actin binding|tropomyosin binding				0																		---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151927301	151927301	+	Intron	SNP	A	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927301A>G	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158443585	158443585	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158443585C>A	uc003wnv.1	-	24	3159	c.3014G>T	c.(3013-3015)CGG>CTG	p.R1005L	NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Missense_Mutation_p.R1005L|NCAPG2_uc011kwe.1_Missense_Mutation_p.R1005L|NCAPG2_uc011kwc.1_Intron|NCAPG2_uc011kwd.1_Missense_Mutation_p.R448L	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	1005					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25747380	25747380	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25747380C>T	uc003xes.1	-	8	656	c.639G>A	c.(637-639)GTG>GTA	p.V213V	PPP2R2A_uc003xek.2_Intron|EBF2_uc010lug.1_5'Flank	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2	213					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27311731	27311731	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27311731G>T	uc003xfn.1	+	34	3464	c.2656G>T	c.(2656-2658)GAG>TAG	p.E886*	PTK2B_uc003xfo.1_Nonsense_Mutation_p.E886*|PTK2B_uc003xfp.1_Nonsense_Mutation_p.E886*|PTK2B_uc003xfq.1_Nonsense_Mutation_p.E844*	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	886	Focal adhesion targeting (FAT).|Interaction with TGFB1I1 (By similarity).				apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68138292	68138292	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68138292C>T	uc003xxo.1	-	28	4433	c.4043G>A	c.(4042-4044)CGC>CAC	p.R1348H	ARFGEF1_uc003xxl.1_Missense_Mutation_p.R802H|ARFGEF1_uc003xxn.1_Missense_Mutation_p.R331H	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1348					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
DPY19L4	286148	broad.mit.edu	37	8	95738552	95738552	+	Intron	SNP	T	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95738552T>G	uc003ygx.2	+							NM_181787	NP_861452			dpy-19-like 4							integral to membrane				ovary(2)	2	Breast(36;3.85e-06)																	---	---	---	---
UBR5	51366	broad.mit.edu	37	8	103326142	103326142	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103326142G>A	uc003ykr.1	-	16	1930	c.1897C>T	c.(1897-1899)CGA>TGA	p.R633*	UBR5_uc003yks.1_Nonsense_Mutation_p.R633*	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	633					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)															---	---	---	---
ARC	23237	broad.mit.edu	37	8	143694676	143694676	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143694676C>T	uc003ywn.1	-	1	1158	c.957G>A	c.(955-957)GAG>GAA	p.E319E		NM_015193	NP_056008	Q7LC44	ARC_HUMAN	activity-regulated cytoskeleton-associated	319					endocytosis	acrosomal vesicle|cell junction|dendritic spine|endosome|postsynaptic density|postsynaptic membrane				breast(1)	1	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)																---	---	---	---
SCRIB	23513	broad.mit.edu	37	8	144874395	144874395	+	Silent	SNP	T	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874395T>C	uc003yzp.1	-	32	4516	c.4509A>G	c.(4507-4509)GCA>GCG	p.A1503A	SCRIB_uc003yzn.1_Silent_p.A236A|SCRIB_uc003yzo.1_Silent_p.A1503A	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1503					activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)															---	---	---	---
TYRP1	7306	broad.mit.edu	37	9	12698440	12698440	+	Intron	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12698440C>T	uc003zkv.3	+							NM_000550	NP_000541			tyrosinase-related protein 1 precursor						melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)										Oculocutaneous_Albinism				---	---	---	---
TBC1D2	55357	broad.mit.edu	37	9	100975430	100975430	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100975430C>T	uc011lvb.1	-	7	1625	c.1445G>A	c.(1444-1446)TGG>TAG	p.W482*	TBC1D2_uc004ayp.2_Nonsense_Mutation_p.W22*|TBC1D2_uc004ayq.2_Nonsense_Mutation_p.W482*|TBC1D2_uc004ayr.2_Nonsense_Mutation_p.W264*|TBC1D2_uc004ayo.3_Nonsense_Mutation_p.W482*	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	482						cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)														---	---	---	---
PHF19	26147	broad.mit.edu	37	9	123620499	123620499	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123620499C>T	uc004bks.1	-	15	1719	c.1466G>A	c.(1465-1467)CGG>CAG	p.R489Q	PHF19_uc011lyf.1_Missense_Mutation_p.R280Q|PHF19_uc004bkr.2_RNA	NM_015651	NP_056466	Q5T6S3	PHF19_HUMAN	PHD finger protein 19 isoform a	489					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
CCNY	219771	broad.mit.edu	37	10	35855040	35855040	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35855040G>A	uc001iyw.3	+	9	1016	c.836G>A	c.(835-837)CGT>CAT	p.R279H	CCNY_uc001iyu.3_Missense_Mutation_p.R225H|CCNY_uc001iyv.3_Missense_Mutation_p.R225H|CCNY_uc001iyx.3_Missense_Mutation_p.R225H|CCNY_uc009xmb.2_Missense_Mutation_p.R254H|CCNY_uc010qet.1_Missense_Mutation_p.R146H	NM_145012	NP_659449	Q8ND76	CCNY_HUMAN	cyclin Y isoform 1	279					cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0																		---	---	---	---
FRMPD2	143162	broad.mit.edu	37	10	49440213	49440213	+	Silent	SNP	C	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49440213C>G	uc001jgi.2	-	10	1220	c.1113G>C	c.(1111-1113)GTG>GTC	p.V371V	FRMPD2_uc001jgh.2_Silent_p.V340V|FRMPD2_uc001jgj.2_Silent_p.V349V	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	371	FERM.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)														---	---	---	---
SUPV3L1	6832	broad.mit.edu	37	10	70947479	70947479	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70947479G>A	uc001jpe.1	+	4	594	c.539G>A	c.(538-540)CGT>CAT	p.R180H	SUPV3L1_uc010qjd.1_Missense_Mutation_p.R49H	NM_003171	NP_003162	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 precursor	180					DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2																		---	---	---	---
PRF1	5551	broad.mit.edu	37	10	72358370	72358370	+	Silent	SNP	C	A	A	rs145589960		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72358370C>A	uc009xqg.2	-	3	1268	c.1107G>T	c.(1105-1107)ACG>ACT	p.T369T	PRF1_uc001jrf.3_Silent_p.T369T	NM_001083116	NP_001076585	P14222	PERF_HUMAN	perforin 1 precursor	369	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3								M			various leukaemia|lymphoma	Type 2 familial hemophagocytic lymphohistiocytosis		Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
KIAA0913	23053	broad.mit.edu	37	10	75558958	75558958	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75558958C>T	uc009xrl.2	+	21	4392	c.4360C>T	c.(4360-4362)CGG>TGG	p.R1454W	KIAA0913_uc001jve.2_Missense_Mutation_p.R1459W|KIAA0913_uc001jvf.2_Intron|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.R889W|KIAA0913_uc010qkr.1_Missense_Mutation_p.R877W|KIAA0913_uc001jvj.2_Missense_Mutation_p.R877W|KIAA0913_uc009xrn.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	1454							zinc ion binding			breast(1)	1	Prostate(51;0.0112)																	---	---	---	---
ABCC2	1244	broad.mit.edu	37	10	101578698	101578698	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101578698G>A	uc001kqf.2	+	18	2562	c.2423G>A	c.(2422-2424)GGC>GAC	p.G808D		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	808	Cytoplasmic (By similarity).|ABC transporter 1.					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
KCNIP2	30819	broad.mit.edu	37	10	103587910	103587910	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103587910C>G	uc001kub.2	-	7	947	c.595G>C	c.(595-597)GAG>CAG	p.E199Q	KCNIP2_uc010qqg.1_Missense_Mutation_p.E143Q|KCNIP2_uc001ktx.2_RNA|KCNIP2_uc001kty.2_Missense_Mutation_p.E97Q|KCNIP2_uc001ktz.2_Missense_Mutation_p.E154Q|KCNIP2_uc009xwu.2_Missense_Mutation_p.E149Q|KCNIP2_uc009xwv.2_Missense_Mutation_p.E145Q|KCNIP2_uc001kuc.2_Missense_Mutation_p.E214Q|KCNIP2_uc001kue.2_Missense_Mutation_p.E181Q|KCNIP2_uc001kud.2_Missense_Mutation_p.E156Q|KCNIP2_uc001kuf.2_Missense_Mutation_p.E149Q|KCNIP2_uc001kua.2_Missense_Mutation_p.E130Q|KCNIP2_uc009xww.2_RNA|KCNIP2_uc010qqh.1_Missense_Mutation_p.E154Q|KCNIP2_uc010qqi.1_Intron	NM_173191	NP_775283	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2 isoform 2	199	EF-hand 3.|1 (By similarity).				clustering of voltage-gated potassium channels|detection of calcium ion|muscle contraction|regulation of heart contraction|signal transduction|synaptic transmission	cytoplasm|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|calcium ion binding|ER retention sequence binding|identical protein binding|protein N-terminus binding				0		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)														---	---	---	---
OR5T2	219464	broad.mit.edu	37	11	56000398	56000398	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56000398G>T	uc010rjc.1	-	1	264	c.264C>A	c.(262-264)GTC>GTA	p.V88V		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	88	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
OR5M9	390162	broad.mit.edu	37	11	56230205	56230205	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56230205G>A	uc010rjj.1	-	1	673	c.673C>T	c.(673-675)CGC>TGC	p.R225C		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	225	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)																	---	---	---	---
RIN1	9610	broad.mit.edu	37	11	66101044	66101044	+	Silent	SNP	G	A	A	rs150535039		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66101044G>A	uc001ohn.1	-	8	1804	c.1677C>T	c.(1675-1677)GCC>GCT	p.A559A	RIN1_uc010roy.1_Silent_p.A190A|RIN1_uc009yrd.1_Silent_p.A252A|RIN1_uc010roz.1_Silent_p.A454A|RIN1_uc010rpa.1_Silent_p.A393A	NM_004292	NP_004283	Q13671	RIN1_HUMAN	ras inhibitor RIN1	559	VPS9.|Ras and 14-3-3 protein binding region.				endocytosis|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase activator activity|protein binding			lung(2)|breast(1)	3																		---	---	---	---
PITPNM1	9600	broad.mit.edu	37	11	67262681	67262681	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67262681C>A	uc001olx.2	-	16	2687	c.2498G>T	c.(2497-2499)TGG>TTG	p.W833L	PITPNM1_uc001olw.2_Missense_Mutation_p.W115L|PITPNM1_uc001oly.2_Missense_Mutation_p.W833L|PITPNM1_uc001olz.2_Missense_Mutation_p.W832L	NM_004910	NP_004901	O00562	PITM1_HUMAN	phosphatidylinositol transfer protein,	833	DDHD.				brain development|lipid metabolic process|phototransduction|protein transport	cleavage furrow|endoplasmic reticulum membrane|Golgi cisterna membrane|lipid particle|membrane fraction|midbody	metal ion binding|phosphatidylinositol transporter activity			lung(2)|central_nervous_system(1)	3																		---	---	---	---
RDX	5962	broad.mit.edu	37	11	110128524	110128524	+	Silent	SNP	A	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110128524A>G	uc001pku.2	-	7	976	c.666T>C	c.(664-666)GCT>GCC	p.A222A	RDX_uc009yxx.1_RNA|RDX_uc009yxy.2_Silent_p.A222A|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc010rwe.1_Silent_p.A86A	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin	222	FERM.				actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)														---	---	---	---
DRD2	1813	broad.mit.edu	37	11	113287731	113287731	+	Intron	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113287731C>T	uc001pnz.2	-						DRD2_uc010rwv.1_Intron|DRD2_uc001poa.3_Intron|DRD2_uc001pob.3_Intron|DRD2_uc009yyr.1_Intron	NM_000795	NP_000786			dopamine receptor D2 isoform long						activation of phospholipase C activity by dopamine receptor signaling pathway|adenohypophysis development|adult walking behavior|arachidonic acid secretion|axonogenesis|behavioral response to cocaine|behavioral response to ethanol|branching morphogenesis of a nerve|cerebral cortex GABAergic interneuron migration|circadian regulation of gene expression|elevation of cytosolic calcium ion concentration involved in G-protein signaling coupled to IP3 second messenger|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|intracellular protein kinase cascade|negative regulation of blood pressure|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of dopamine receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|negative regulation of synaptic transmission, glutamatergic|neurological system process involved in regulation of systemic arterial blood pressure|peristalsis|phosphatidylinositol metabolic process|positive regulation of dopamine uptake|positive regulation of growth hormone secretion|positive regulation of neuroblast proliferation|prepulse inhibition|protein localization|regulation of heart rate|regulation of long-term neuronal synaptic plasticity|regulation of potassium ion transport|regulation of sodium ion transport|regulation of synaptic transmission, GABAergic|release of sequestered calcium ion into cytosol|response to amphetamine|response to drug|response to histamine|response to morphine|sensory perception of smell|synapse assembly|temperature homeostasis|visual learning	integral to plasma membrane	dopamine D2 receptor activity|dopamine receptor activity, coupled via Gi/Go|drug binding|potassium channel regulator activity|protein binding			pancreas(1)|skin(1)	2		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acetophenazine(DB01063)|Amantadine(DB00915)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Carphenazine(DB01038)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Domperidone(DB01184)|Droperidol(DB00450)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Levodopa(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Mesoridazine(DB00933)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Sulpiride(DB00391)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Ziprasidone(DB00246)|Zuclopenthixol(DB01624)													---	---	---	---
GRAMD1B	57476	broad.mit.edu	37	11	123484314	123484314	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123484314G>A	uc001pyx.2	+	15	2075	c.1746G>A	c.(1744-1746)CCG>CCA	p.P582P	GRAMD1B_uc001pyw.2_Silent_p.P589P|GRAMD1B_uc010rzw.1_Silent_p.P542P|GRAMD1B_uc010rzx.1_Silent_p.P542P|GRAMD1B_uc001pyy.2_Silent_p.P273P	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	582						integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)														---	---	---	---
FMNL3	91010	broad.mit.edu	37	12	50048693	50048693	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50048693C>A	uc001ruv.1	-	10	1194	c.960G>T	c.(958-960)ATG>ATT	p.M320I	FMNL3_uc001ruw.1_Missense_Mutation_p.M269I|FMNL3_uc001rut.1_5'Flank|FMNL3_uc001ruu.1_Missense_Mutation_p.M170I	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	320	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4																		---	---	---	---
GALNT9	50614	broad.mit.edu	37	12	132688177	132688177	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132688177T>C	uc001ukc.3	-	7	1252	c.1136A>G	c.(1135-1137)GAG>GGG	p.E379G	GALNT9_uc009zyr.2_Missense_Mutation_p.E153G|GALNT9_uc001ukb.2_Missense_Mutation_p.E236G|GALNT9_uc001uka.2_Missense_Mutation_p.E13G	NM_001122636	NP_001116108	Q9HCQ5	GALT9_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	379	Catalytic subdomain B.|Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)														---	---	---	---
DZIP1	22873	broad.mit.edu	37	13	96237063	96237063	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96237063C>T	uc001vmk.2	-	22	3303	c.2451G>A	c.(2449-2451)GCG>GCA	p.A817A	DZIP1_uc001vmi.2_Silent_p.A65A|DZIP1_uc001vmj.2_Silent_p.A293A|DZIP1_uc001vml.2_Silent_p.A798A|DZIP1_uc001vmm.2_5'Flank	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	817					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)															---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75230504	75230504	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75230504G>A	uc001xqj.3	+	1	436	c.312G>A	c.(310-312)CCG>CCA	p.P104P		NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	104	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
BDKRB2	624	broad.mit.edu	37	14	96707546	96707546	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96707546C>T	uc010avm.1	+	3	1077	c.881C>T	c.(880-882)ACG>ATG	p.T294M	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Missense_Mutation_p.T267M|BDKRB2_uc001yfg.2_Missense_Mutation_p.T294M	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	294	Extracellular (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)														---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102461565	102461565	+	Silent	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102461565C>A	uc001yks.2	+	15	3656	c.3492C>A	c.(3490-3492)TCC>TCA	p.S1164S		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1164	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
HERC2	8924	broad.mit.edu	37	15	28413655	28413655	+	Silent	SNP	G	T	T	rs150517241		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28413655G>T	uc001zbj.2	-	67	10417	c.10311C>A	c.(10309-10311)TCC>TCA	p.S3437S		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3437					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)														---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44943678	44943678	+	Intron	SNP	G	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44943678G>C	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zua.1_Intron	NM_025137	NP_079413			spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
IGDCC3	9543	broad.mit.edu	37	15	65622666	65622666	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65622666C>T	uc002aos.2	-	11	2075	c.1823G>A	c.(1822-1824)CGC>CAC	p.R608H	IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	608	Extracellular (Potential).|Fibronectin type-III 2.									ovary(3)	3																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71633649	71633649	+	Intron	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633649G>A	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79277400	79277400	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79277400G>T	uc002beq.2	-	24	3786	c.3411C>A	c.(3409-3411)AAC>AAA	p.N1137K	RASGRF1_uc002bep.2_Missense_Mutation_p.N1121K|RASGRF1_uc010blm.1_Missense_Mutation_p.N1046K|RASGRF1_uc002ber.3_Missense_Mutation_p.N1121K|RASGRF1_uc002beo.2_Missense_Mutation_p.N353K	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	1139	Ras-GEF.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
MAPK8IP3	23162	broad.mit.edu	37	16	1816772	1816772	+	Silent	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1816772C>A	uc002cmk.2	+	24	3105	c.2985C>A	c.(2983-2985)TCC>TCA	p.S995S	MAPK8IP3_uc002cml.2_Silent_p.S989S|MAPK8IP3_uc010uvl.1_Silent_p.S996S	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	995					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
ABCA3	21	broad.mit.edu	37	16	2326679	2326679	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2326679C>T	uc002cpy.1	-	33	5823	c.5111G>A	c.(5110-5112)CGA>CAA	p.R1704Q	ABCA3_uc010bsk.1_Missense_Mutation_p.R1646Q	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	1704					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---
SEPT12	124404	broad.mit.edu	37	16	4829736	4829736	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4829736C>A	uc002cxq.2	-	8	919	c.778G>T	c.(778-780)GGG>TGG	p.G260W	SEPT12_uc002cxr.2_Missense_Mutation_p.G214W|SEPT12_uc010bty.2_RNA	NM_144605	NP_653206	Q8IYM1	SEP12_HUMAN	septin 12 isoform 2	260					cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1																		---	---	---	---
ZP2	7783	broad.mit.edu	37	16	21212743	21212743	+	Silent	SNP	C	T	T	rs141607027		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21212743C>T	uc002dii.2	-	14	1641	c.1641G>A	c.(1639-1641)GCG>GCA	p.A547A	ZP2_uc010bwn.1_Silent_p.A577A	NM_003460	NP_003451	Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 preproprotein	547	Extracellular (Potential).|ZP.				binding of sperm to zona pellucida|intracellular protein transport	endoplasmic reticulum|Golgi apparatus|integral to membrane|multivesicular body|plasma membrane|proteinaceous extracellular matrix|stored secretory granule	acrosin binding|coreceptor activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(48;0.0573)														---	---	---	---
ZNF423	23090	broad.mit.edu	37	16	49671894	49671894	+	Missense_Mutation	SNP	G	A	A	rs112570445	byFrequency	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49671894G>A	uc002efs.2	-	5	1467	c.1169C>T	c.(1168-1170)CCG>CTG	p.P390L	ZNF423_uc010vgn.1_Missense_Mutation_p.P273L	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	390					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)																---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61761057	61761057	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61761057C>T	uc002eog.1	-	9	1729	c.1477G>A	c.(1477-1479)GCC>ACC	p.A493T	CDH8_uc002eoh.2_Missense_Mutation_p.A262T	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	493	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
ATPAF2	91647	broad.mit.edu	37	17	17929670	17929670	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17929670G>A	uc002gse.1	-	4	538	c.385C>T	c.(385-387)CGG>TGG	p.R129W	ATPAF2_uc002gsd.1_RNA|ATPAF2_uc002gsf.1_RNA|ATPAF2_uc010cps.1_RNA	NM_145691	NP_663729	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly	129					proton-transporting ATP synthase complex assembly	mitochondrion|nuclear speck	protein binding				0	all_neural(463;0.228)																	---	---	---	---
CCL2	6347	broad.mit.edu	37	17	32583747	32583747	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32583747G>A	uc002hhy.2	+	3	274	c.201G>A	c.(199-201)AAG>AAA	p.K67K		NM_002982	NP_002973	P13500	CCL2_HUMAN	small inducible cytokine A2 precursor	67				Missing: 90% reduction in activity.|Missing: 83% reduction in activity.	angiogenesis|anti-apoptosis|apoptotic cell clearance|astrocyte cell migration|cell adhesion|cellular response to interferon-gamma|cellular response to interleukin-1|cellular response to lipopolysaccharide|cellular response to tumor necrosis factor|G-protein signaling, coupled to cyclic nucleotide second messenger|helper T cell extravasation|humoral immune response|inflammatory response|JAK-STAT cascade|macrophage chemotaxis|monocyte chemotaxis|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of T cell activation|viral genome replication	extracellular space	CCR2 chemokine receptor binding|chemokine activity|protein kinase activity|signal transducer activity			pancreas(1)	1	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Atorvastatin(DB01076)|Danazol(DB01406)|Mimosine(DB01055)|Simvastatin(DB00641)													---	---	---	---
TMEM132E	124842	broad.mit.edu	37	17	32964438	32964438	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32964438G>A	uc002hif.2	+	10	2470	c.2142G>A	c.(2140-2142)ACG>ACA	p.T714T		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	714	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)														---	---	---	---
JUP	3728	broad.mit.edu	37	17	39913965	39913965	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39913965C>T	uc002hxq.2	-	11	2122	c.1845G>A	c.(1843-1845)AAG>AAA	p.K615K	JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Silent_p.K615K|JUP_uc002hxs.2_Silent_p.K615K	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	615					adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)														---	---	---	---
ITGB4	3691	broad.mit.edu	37	17	73746878	73746878	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73746878G>A	uc002jpg.2	+	29	3779	c.3592G>A	c.(3592-3594)GCC>ACC	p.A1198T	ITGB4_uc002jph.2_Missense_Mutation_p.A1198T|ITGB4_uc002jpi.3_Missense_Mutation_p.A1198T|ITGB4_uc002jpj.2_Missense_Mutation_p.A1198T	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	1198	Fibronectin type-III 1.|Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
EVPL	2125	broad.mit.edu	37	17	74003651	74003651	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74003651C>T	uc002jqi.2	-	22	5863	c.5635G>A	c.(5635-5637)GTG>ATG	p.V1879M	EVPL_uc010wss.1_Missense_Mutation_p.V1901M|EVPL_uc010wst.1_Missense_Mutation_p.V1349M	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1879	Globular 2.|Plectin 4.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
RIOK3	8780	broad.mit.edu	37	18	21044563	21044563	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21044563G>T	uc002kui.3	+	5	1131	c.514G>T	c.(514-516)GGG>TGG	p.G172W	RIOK3_uc010dls.2_Missense_Mutation_p.G172W|RIOK3_uc010xas.1_Missense_Mutation_p.G156W|RIOK3_uc010xat.1_5'Flank	NM_003831	NP_003822	O14730	RIOK3_HUMAN	sudD suppressor of bimD6 homolog	172					chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
DSC1	1823	broad.mit.edu	37	18	28720071	28720071	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28720071G>T	uc002kwn.2	-	10	1716	c.1454C>A	c.(1453-1455)CCA>CAA	p.P485Q	DSC1_uc002kwm.2_Missense_Mutation_p.P485Q	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	485	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)															---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9061233	9061233	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9061233G>A	uc002mkp.2	-	3	26417	c.26213C>T	c.(26212-26214)ACT>ATT	p.T8738I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8740	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
PSG8	440533	broad.mit.edu	37	19	43259285	43259285	+	Silent	SNP	C	A	A	rs143503302		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43259285C>A	uc002ouo.2	-	4	941	c.843G>T	c.(841-843)CCG>CCT	p.P281P	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_Intron|PSG8_uc002oui.2_Silent_p.P120P|PSG8_uc002ouh.2_Silent_p.P281P|PSG8_uc010ein.2_Silent_p.P159P|PSG8_uc002ouj.3_Silent_p.P63P|PSG8_uc002ouk.3_Silent_p.P120P|PSG8_uc002oul.3_Silent_p.P281P|PSG8_uc002oum.3_Silent_p.P188P|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Silent_p.P188P	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	281	Ig-like C2-type 2.					extracellular region					0		Prostate(69;0.00899)																---	---	---	---
HRC	3270	broad.mit.edu	37	19	49657205	49657205	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49657205G>T	uc002pmv.2	-	1	1477	c.1290C>A	c.(1288-1290)GTC>GTA	p.V430V		NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein	430					muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)														---	---	---	---
ZNF613	79898	broad.mit.edu	37	19	52443546	52443546	+	Silent	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52443546C>A	uc002pxz.1	+	4	523	c.100C>A	c.(100-102)CGA>AGA	p.R34R	ZNF613_uc002pya.1_5'UTR	NM_001031721	NP_001026891	Q6PF04	ZN613_HUMAN	zinc finger protein 613 isoform 1	34	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)														---	---	---	---
DDRGK1	65992	broad.mit.edu	37	20	3183866	3183866	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3183866G>A	uc002wic.2	-	2	310	c.288C>T	c.(286-288)GTC>GTT	p.V96V	DDRGK1_uc010gaw.2_RNA|DDRGK1_uc010gax.1_Silent_p.V96V	NM_023935	NP_076424	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1 precursor	96						endoplasmic reticulum	protein binding				0																		---	---	---	---
C20orf165	128497	broad.mit.edu	37	20	44515356	44515356	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44515356C>T	uc002xqf.2	-	2	493	c.484G>A	c.(484-486)GCT>ACT	p.A162T		NM_080608	NP_542175	Q9BR10	CT165_HUMAN	chromosome 20 open reading frame 165	162	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
PRDM15	63977	broad.mit.edu	37	21	43222905	43222905	+	Silent	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43222905G>A	uc002yzq.1	-	30	4119	c.4008C>T	c.(4006-4008)GAC>GAT	p.D1336D	PRDM15_uc002yzo.2_Silent_p.D1007D|PRDM15_uc002yzp.2_Silent_p.D1027D|PRDM15_uc002yzr.1_Silent_p.D1027D	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1336					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
SUSD2	56241	broad.mit.edu	37	22	24583360	24583360	+	Silent	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24583360C>T	uc002zzn.1	+	11	1877	c.1833C>T	c.(1831-1833)AGC>AGT	p.S611S		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	611	VWFD.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25016462	25016462	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016462G>A	uc003aan.1	+	8	1037	c.550G>A	c.(550-552)GTC>ATC	p.V184I	GGT1_uc003aas.1_Missense_Mutation_p.V184I|GGT1_uc003aat.1_Missense_Mutation_p.V184I|GGT1_uc003aau.1_Missense_Mutation_p.V184I|GGT1_uc003aav.1_Missense_Mutation_p.V184I|GGT1_uc003aaw.1_Missense_Mutation_p.V184I|GGT1_uc003aax.1_Missense_Mutation_p.V184I	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	184	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
OSM	5008	broad.mit.edu	37	22	30660134	30660134	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30660134G>A	uc003ahb.2	-	3	549	c.497C>T	c.(496-498)ACG>ATG	p.T166M		NM_020530	NP_065391	P13725	ONCM_HUMAN	oncostatin M precursor	166					cell proliferation|immune response|negative regulation of cell proliferation|negative regulation of hormone secretion|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of MAPKKK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of growth	extracellular space|oncostatin-M receptor complex	cytokine activity|growth factor activity|oncostatin-M receptor binding			skin(1)	1			Epithelial(10;0.206)															---	---	---	---
SREBF2	6721	broad.mit.edu	37	22	42290847	42290847	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42290847C>A	uc003bbi.2	+	13	2570	c.2401C>A	c.(2401-2403)CAG>AAG	p.Q801K	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|SREBF2_uc003bbj.2_RNA	NM_004599	NP_004590	Q12772	SRBP2_HUMAN	sterol regulatory element-binding transcription	801	Cytoplasmic (Potential).				cholesterol metabolic process	ER to Golgi transport vesicle membrane|Golgi membrane|nucleus|SREBP-SCAP-Insig complex	protein C-terminus binding			breast(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
ASB11	140456	broad.mit.edu	37	X	15333563	15333563	+	Silent	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15333563G>T	uc004cwp.1	-	1	165	c.165C>A	c.(163-165)ATC>ATA	p.I55I	ASB11_uc004cwo.1_5'Flank|ASB11_uc010nes.1_RNA|ASB11_uc010net.1_Silent_p.I55I	NM_080873	NP_543149	Q8WXH4	ASB11_HUMAN	ankyrin repeat and SOCS box-containing protein	55					intracellular signal transduction					breast(2)|skin(1)	3	Hepatocellular(33;0.183)																	---	---	---	---
FAM48B2	170067	broad.mit.edu	37	X	24331961	24331961	+	5'Flank	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24331961G>A	uc011mjw.1	-							NM_001136233	NP_001129705			family with sequence similarity 48, member B2												0																		---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29301180	29301180	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29301180G>T	uc004dby.2	+	3	716	c.208G>T	c.(208-210)GCT>TCT	p.A70S		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	70	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
GK	2710	broad.mit.edu	37	X	30737594	30737594	+	Silent	SNP	G	A	A	rs139652893	byFrequency	TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30737594G>A	uc004dch.3	+	15	1292	c.1113G>A	c.(1111-1113)TCG>TCA	p.S371S	GK_uc010ngj.2_Silent_p.S365S|GK_uc004dci.3_Silent_p.S365S|GK_uc011mjz.1_Silent_p.S166S|GK_uc011mka.1_Silent_p.S208S|GK_uc010ngk.2_Silent_p.S160S	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	371					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1																		---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41026765	41026765	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41026765A>G	uc004dfb.2	+	17	2992	c.2359A>G	c.(2359-2361)AGC>GGC	p.S787G	USP9X_uc004dfc.2_Missense_Mutation_p.S787G	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	787					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
KLF8	11279	broad.mit.edu	37	X	56291686	56291686	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56291686T>C	uc004dur.2	+	3	1101	c.155T>C	c.(154-156)CTG>CCG	p.L52P	KLF8_uc010nkg.2_Missense_Mutation_p.L47P|KLF8_uc011mop.1_Missense_Mutation_p.L52P|KLF8_uc010nkh.2_RNA	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1	52					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
VSIG4	11326	broad.mit.edu	37	X	65252402	65252402	+	Missense_Mutation	SNP	G	A	A	rs150666044		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65252402G>A	uc004dwh.2	-	3	729	c.602C>T	c.(601-603)GCG>GTG	p.A201V	VSIG4_uc004dwi.2_Intron|VSIG4_uc010nkq.1_Missense_Mutation_p.A201V|VSIG4_uc004dwj.2_Missense_Mutation_p.A201V|VSIG4_uc011moy.1_Intron|VSIG4_uc004dwk.2_Missense_Mutation_p.A201V|VSIG4_uc004dwl.2_Missense_Mutation_p.A97V	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	201	Ig-like 2.|Extracellular (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0																		---	---	---	---
NXF5	55998	broad.mit.edu	37	X	101096663	101096663	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101096663C>T	uc011mrk.1	-	5	583	c.223G>A	c.(223-225)GAT>AAT	p.D75N	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	75	RRM.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1																		---	---	---	---
MAMLD1	10046	broad.mit.edu	37	X	149639290	149639290	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149639290G>A	uc004fee.1	+	3	1521	c.1445G>A	c.(1444-1446)AGC>AAC	p.S482N	MAMLD1_uc011mxt.1_Missense_Mutation_p.S444N|MAMLD1_uc011mxu.1_Missense_Mutation_p.S457N|MAMLD1_uc011mxv.1_Missense_Mutation_p.S457N|MAMLD1_uc011mxw.1_Missense_Mutation_p.S409N	NM_005491	NP_005482	Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	482					male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
CNGA2	1260	broad.mit.edu	37	X	150912076	150912076	+	Silent	SNP	C	T	T	rs141471697		TCGA-BR-4375-01	TCGA-BR-4375-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150912076C>T	uc004fey.1	+	7	1325	c.1101C>T	c.(1099-1101)ATC>ATT	p.I367I		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	367	Helical; Name=H5; (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
