Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CDK11B	984	broad.mit.edu	37	1	1588535	1588536	+	Intron	INS	-	TAA	TAA	rs138141689	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1588535_1588536insTAA	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|uc001ahc.1_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
KIAA0562	9731	broad.mit.edu	37	1	3752869	3752871	+	Intron	DEL	AAA	-	-	rs36013028		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3752869_3752871delAAA	uc001aky.2	-						KIAA0562_uc010nzm.1_Intron|KIAA0562_uc001akz.2_Intron	NM_014704	NP_055519			glycine-, glutamate-,							centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)														---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12429285	12429286	+	Intron	DEL	TG	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12429285_12429286delTG	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
EIF4G3	8672	broad.mit.edu	37	1	21299378	21299378	+	Intron	DEL	A	-	-	rs76449388		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21299378delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751			eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)														---	---	---	---
PTAFR	5724	broad.mit.edu	37	1	28477695	28477695	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28477695delT	uc001bpl.2	-						PTAFR_uc001bpm.3_Intron|PTAFR_uc009vte.2_Intron	NM_000952	NP_000943			platelet-activating factor receptor						chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156530966	156530966	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156530966delT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
ATP1A2	477	broad.mit.edu	37	1	160104068	160104069	+	Intron	DEL	CA	-	-	rs78882308	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160104068_160104069delCA	uc001fvc.2	+						ATP1A2_uc001fvb.2_Intron|ATP1A2_uc001fvd.2_Intron	NM_000702	NP_000693			Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	168427175	168427176	+	IGR	INS	-	CTTTCTTT	CTTTCTTT	rs141776154	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168427175_168427176insCTTTCTTT								MIR557 (82316 upstream) : XCL2 (82829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	199743953	199743964	+	IGR	DEL	AAGGAAGGAAGG	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199743953_199743964delAAGGAAGGAAGG								MIR181A1 (915671 upstream) : NR5A2 (252806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231223736	231223737	+	IGR	INS	-	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231223736_231223737insG								FAM89A (47741 upstream) : TRIM67 (74937 downstream)																																			---	---	---	---
TBCE	6905	broad.mit.edu	37	1	235601867	235601868	+	Intron	INS	-	AAA	AAA	rs71576472		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235601867_235601868insAAA	uc001hwz.1	+						TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_003193	NP_003184			beta-tubulin cofactor E						'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)															---	---	---	---
USP34	9736	broad.mit.edu	37	2	61527959	61527959	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61527959delA	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
ATOH8	84913	broad.mit.edu	37	2	85990944	85990945	+	Intron	INS	-	GT	GT	rs138097885	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85990944_85990945insGT	uc002sqn.2	+						ATOH8_uc002sqm.3_Intron	NM_032827	NP_116216			atonal homolog 8						cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
SULT1C3	442038	broad.mit.edu	37	2	108875465	108875486	+	Intron	DEL	AAACTTGGTCAGGTGATGTTAT	-	-	rs72322214	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108875465_108875486delAAACTTGGTCAGGTGATGTTAT	uc010ywo.1	+							NM_001008743	NP_001008743			sulfotransferase family, cytosolic, 1C, member							cytoplasm	alcohol sulfotransferase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	111392074	111392075	+	IGR	INS	-	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111392074_111392075insT								LOC151009 (249961 upstream) : BUB1 (3336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143300247	143300254	+	IGR	DEL	GGAAGGAA	-	-	rs66761750	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143300247_143300254delGGAAGGAA								LRP1B (410977 upstream) : KYNU (334941 downstream)																																			---	---	---	---
ATIC	471	broad.mit.edu	37	2	216211202	216211202	+	Intron	DEL	T	-	-	rs112969952		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216211202delT	uc002vex.3	+						ATIC_uc010zjo.1_Intron|ATIC_uc002vey.3_Intron	NM_004044	NP_004035			5-aminoimidazole-4-carboxamide ribonucleotide						IMP biosynthetic process|purine base metabolic process	cytosol	IMP cyclohydrolase activity|phosphoribosylaminoimidazolecarboxamide formyltransferase activity|protein homodimerization activity		ATIC/ALK(24)	haematopoietic_and_lymphoid_tissue(22)|ovary(2)|lung(2)|soft_tissue(2)|skin(1)	29		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Tetrahydrofolic acid(DB00116)			T	ALK	ALCL								---	---	---	---
FN1	2335	broad.mit.edu	37	2	216238395	216238408	+	Intron	DEL	TTTTTTTTTTTTTT	-	-	rs138180789		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216238395_216238408delTTTTTTTTTTTTTT	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Intron|FN1_uc010zjp.1_Intron|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_Intron|FN1_uc010fvb.1_Intron|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Intron	NM_212482	NP_997647			fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
ILDR1	286676	broad.mit.edu	37	3	121720858	121720866	+	Intron	DEL	GTGCCTATA	-	-	rs74268689		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121720858_121720866delGTGCCTATA	uc003ees.2	-						ILDR1_uc003eeq.2_Intron|ILDR1_uc003eer.2_Intron|ILDR1_uc010hrg.2_Intron	NM_175924	NP_787120			immunoglobulin-like domain containing receptor							cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)														---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131436727	131436728	+	Intron	DEL	TT	-	-	rs112269419		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131436727_131436728delTT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133221071	133221072	+	IGR	INS	-	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133221071_133221072insA								BFSP2 (27015 upstream) : CDV3 (71362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145468475	145468476	+	IGR	DEL	GA	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145468475_145468476delGA								None (None upstream) : PLOD2 (318752 downstream)																																			---	---	---	---
CHIC2	26511	broad.mit.edu	37	4	54876121	54876122	+	3'UTR	INS	-	A	A	rs145864126	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54876121_54876122insA	uc003haj.1	-	6					PDGFRA_uc003haa.2_Intron	NM_012110	NP_036242			cysteine-rich hydrophobic domain 2							plasma membrane	protein binding			central_nervous_system(1)	1	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)					T	ETV6	AML								---	---	---	---
MANBA	4126	broad.mit.edu	37	4	103556367	103556368	+	Intron	INS	-	T	T	rs143140380	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103556367_103556368insT	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899			mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)														---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	87232931	87232934	+	IGR	DEL	CTTC	-	-	rs72449897		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87232931_87232934delCTTC								CCNH (524095 upstream) : TMEM161B (258090 downstream)																																			---	---	---	---
ADAM19	8728	broad.mit.edu	37	5	156926776	156926777	+	Intron	DEL	TA	-	-	rs12522418		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156926776_156926777delTA	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc003lwy.2_Intron|ADAM19_uc011ddr.1_Intron	NM_033274	NP_150377			ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	29049194	29049197	+	IGR	DEL	TTCC	-	-	rs111521915		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29049194_29049197delTTCC								OR2W1 (36242 upstream) : OR2B3 (4789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	34184021	34184022	+	IGR	INS	-	TCCT	TCCT			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34184021_34184022insTCCT								GRM4 (70152 upstream) : HMGA1 (20555 downstream)																																			---	---	---	---
UBR2	23304	broad.mit.edu	37	6	42652345	42652345	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42652345delA	uc011dur.1	+						UBR2_uc011dus.1_Intron|UBR2_uc003osh.2_Intron|UBR2_uc011dut.1_Intron|UBR2_uc011duu.1_5'Flank	NM_015255	NP_056070			ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	86411938	86411945	+	IGR	DEL	CCTCCCTC	-	-	rs60835761	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86411938_86411945delCCTCCCTC								SNHG5 (23487 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148148559	148148559	+	IGR	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148148559delA								SAMD5 (257402 upstream) : SASH1 (515170 downstream)																																			---	---	---	---
LFNG	3955	broad.mit.edu	37	7	2566966	2566967	+	3'UTR	INS	-	TGTGCA	TGTGCA	rs150935549	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2566966_2566967insTGTGCA	uc003smf.2	+	8					LFNG_uc003smg.2_Intron	NM_001040167	NP_001035257			lunatic fringe isoform a						organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)														---	---	---	---
MLXIPL	51085	broad.mit.edu	37	7	73038473	73038473	+	Intron	DEL	C	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73038473delC	uc003tyn.1	-						MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569			Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
XKR5	389610	broad.mit.edu	37	8	6673270	6673270	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6673270delA	uc003wqp.2	-						XKR5_uc003wqq.2_Intron|XKR5_uc003wqr.1_Intron	NM_207411	NP_997294			XK-related protein 5a							integral to membrane					0			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)												OREG0018511	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	8	10400991	10400991	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10400991delT	uc010lru.2	-						PRSS55_uc003wtb.2_Intron					Homo sapiens cDNA, FLJ97155.																														---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88068112	88068119	+	Intron	DEL	TTCCTTCC	-	-	rs55762292		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88068112_88068119delTTCCTTCC	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	400029	400031	+	Intron	DEL	CAT	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400029_400031delCAT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
RCL1	10171	broad.mit.edu	37	9	4834471	4834471	+	Intron	DEL	C	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4834471delC	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763			RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)														---	---	---	---
CIZ1	25792	broad.mit.edu	37	9	130950396	130950397	+	Intron	INS	-	A	A	rs34796767		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130950396_130950397insA	uc004btt.2	-						CIZ1_uc004btr.2_Intron|CIZ1_uc004bts.2_Intron|CIZ1_uc011maq.1_Intron|CIZ1_uc004btu.2_Intron|CIZ1_uc011mar.1_Intron|CIZ1_uc011mas.1_Intron|CIZ1_uc004btw.2_Intron|CIZ1_uc004btv.2_Intron|CIZ1_uc004btx.2_Intron	NM_001131016	NP_001124488			CDKN1A interacting zinc finger protein 1 isoform							nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
LCN10	414332	broad.mit.edu	37	9	139635199	139635200	+	Intron	INS	-	TCCTGGG	TCCTGGG	rs145287279	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139635199_139635200insTCCTGGG	uc010nbq.2	-						LCN10_uc004civ.2_Intron|LCN10_uc011med.1_Intron|LCN10_uc011mee.1_Intron|LCN10_uc011mef.1_Intron|LCN10_uc004ciw.2_Intron					SubName: Full=LCN10 protein;						transport	extracellular region	binding			large_intestine(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53387680	53387680	+	Intron	DEL	C	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53387680delC	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63662463	63662464	+	Intron	DEL	TG	-	-	rs79319706		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63662463_63662464delTG	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
JMJD1C	221037	broad.mit.edu	37	10	65145854	65145855	+	Intron	DEL	AC	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65145854_65145855delAC	uc001jmn.2	-						JMJD1C_uc001jmr.1_Intron	NM_032776	NP_116165			jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)																	---	---	---	---
DNA2	1763	broad.mit.edu	37	10	70209749	70209749	+	Intron	DEL	G	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70209749delG	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918			DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	77474593	77474594	+	IGR	INS	-	TCCC	TCCC			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77474593_77474594insTCCC								MIR606 (162282 upstream) : C10orf11 (67925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	115745808	115745808	+	IGR	DEL	G	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115745808delG								NHLRC2 (77356 upstream) : ADRB1 (57998 downstream)																																			---	---	---	---
SPON1	10418	broad.mit.edu	37	11	14212191	14212191	+	Intron	DEL	T	-	-	rs142174904		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14212191delT	uc001mle.2	+							NM_006108	NP_006099			spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70221330	70221330	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70221330delT	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron|PPFIA1_uc001opr.2_Intron|PPFIA1_uc001ops.2_Intron|uc001opt.1_RNA	NM_003626	NP_003617			PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	125400738	125400739	+	IGR	DEL	TG	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125400738_125400739delTG								FEZ1 (34615 upstream) : EI24 (38559 downstream)																																			---	---	---	---
APOBEC1	339	broad.mit.edu	37	12	7802404	7802404	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7802404delT	uc001qtb.2	-						APOBEC1_uc001qtc.2_Intron|APOBEC1_uc010sgf.1_Intron	NM_001644	NP_001635			apolipoprotein B mRNA editing enzyme						cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0																		---	---	---	---
YARS2	51067	broad.mit.edu	37	12	32904006	32904006	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32904006delT	uc001rli.2	-							NM_001040436	NP_001035526			tyrosyl-tRNA synthetase 2, mitochondrial						tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)													---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64816642	64816646	+	Intron	DEL	CACTG	-	-	rs151118213		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64816642_64816646delCACTG	uc001ssb.2	+							NM_007235	NP_009166			tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
NAP1L1	4673	broad.mit.edu	37	12	76462515	76462516	+	Intron	INS	-	AC	AC	rs35120003		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76462515_76462516insAC	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946			nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)																---	---	---	---
KSR2	283455	broad.mit.edu	37	12	117965106	117965107	+	Intron	DEL	AG	-	-	rs68177299		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965106_117965107delAG	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
PRKAB1	5564	broad.mit.edu	37	12	120110460	120110461	+	Intron	DEL	AG	-	-	rs150497180		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120110460_120110461delAG	uc009zwu.2	+						PRKAB1_uc001txg.2_Intron	NM_006253	NP_006244			AMP-activated protein kinase beta 1						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol					0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Adenosine monophosphate(DB00131)|Metformin(DB00331)													---	---	---	---
KIAA0564	23078	broad.mit.edu	37	13	42501677	42501678	+	Intron	INS	-	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42501677_42501678insA	uc001uyj.2	-						KIAA0564_uc001uyk.2_Intron	NM_015058	NP_055873			hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	83420518	83420521	+	IGR	DEL	AGGA	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83420518_83420521delAGGA								None (None upstream) : None (None downstream)																																			---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47669737	47669738	+	Intron	INS	-	TTT	TTT	rs10639284		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47669737_47669738insTTT	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65249536	65249536	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65249536delA	uc001xht.2	-						SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron|SPTB_uc001xhu.2_Intron|SPTB_uc010aqi.2_5'Flank	NM_000347	NP_000338			spectrin beta isoform b						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
ZFYVE26	23503	broad.mit.edu	37	14	68228781	68228781	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68228781delA	uc001xka.2	-						ZFYVE26_uc010tsz.1_Intron|ZFYVE26_uc001xkb.2_5'Flank|ZFYVE26_uc001xkc.3_Intron	NM_015346	NP_056161			zinc finger, FYVE domain containing 26						cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)														---	---	---	---
ABCC12	94160	broad.mit.edu	37	16	48167438	48167439	+	Intron	INS	-	A	A	rs74992783		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48167438_48167439insA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron|ABCC12_uc002efe.1_Intron	NM_033226	NP_150229			ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)																---	---	---	---
SLC6A2	6530	broad.mit.edu	37	16	55731636	55731636	+	Intron	DEL	A	-	-	rs35434599		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55731636delA	uc002eif.2	+						SLC6A2_uc010ccd.2_Intron|SLC6A2_uc002eig.2_Intron|SLC6A2_uc002eih.2_Intron|SLC6A2_uc002eii.2_Intron|SLC6A2_uc002eij.2_Intron	NM_001043	NP_001034			solute carrier family 6 member 2						synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)													---	---	---	---
DYNC1LI2	1783	broad.mit.edu	37	16	66757488	66757488	+	3'UTR	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66757488delT	uc002eqb.1	-	13					DYNC1LI2_uc010vis.1_3'UTR	NM_006141	NP_006132			dynein, cytoplasmic, light intermediate						transport	centrosome|cytoplasmic dynein complex|microtubule	ATP binding|motor activity			central_nervous_system(3)|skin(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)														---	---	---	---
AP1G1	164	broad.mit.edu	37	16	71779749	71779757	+	Intron	DEL	CATATATTT	-	-	rs11277696		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71779749_71779757delCATATATTT	uc010cgg.2	-						AP1G1_uc002fba.2_Intron|AP1G1_uc002fbb.2_Intron|AP1G1_uc002faz.2_Intron	NM_001128	NP_001119			adaptor-related protein complex 1, gamma 1						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)																---	---	---	---
HSBP1	3281	broad.mit.edu	37	16	83843055	83843057	+	Intron	DEL	TTC	-	-	rs72214538	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83843055_83843057delTTC	uc002fgy.1	+							NM_001537	NP_001528			heat shock factor binding protein 1						negative regulation of transcription from RNA polymerase II promoter	nucleus	transcription corepressor activity				0		all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)														---	---	---	---
TCF25	22980	broad.mit.edu	37	16	89949564	89949565	+	Intron	INS	-	A	A	rs142705330	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89949564_89949565insA	uc002fpb.2	+						TCF25_uc010vpp.1_Intron|TCF25_uc002fpc.2_5'Flank	NM_014972	NP_055787			NULP1						heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)														---	---	---	---
P2RX5	5026	broad.mit.edu	37	17	3594442	3594442	+	Intron	DEL	A	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3594442delA	uc002fwi.2	-						P2RX5_uc002fwd.2_Intron|P2RX5_uc002fwh.1_Intron|P2RX5_uc010vrx.1_Intron|P2RX5_uc002fwj.2_Intron|P2RX5_uc002fwk.2_Intron|P2RX5_uc002fwl.2_Intron|P2RX5_uc002fwm.1_Intron	NM_002561	NP_002552			purinergic receptor P2X5 isoform A						nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0																		---	---	---	---
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451453	7451454	+	5'Flank	INS	-	GTCC	GTCC			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451453_7451454insGTCC	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086			TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)																---	---	---	---
SUZ12	23512	broad.mit.edu	37	17	30322875	30322875	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30322875delT	uc002hgs.2	+						SUZ12_uc002hgt.2_Intron	NM_015355	NP_056170			joined to JAZF1						negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)						T	JAZF1	endometrial stromal tumours								---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56690560	56690561	+	Intron	INS	-	A	A	rs77849538		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56690560_56690561insA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
DNAH17	8632	broad.mit.edu	37	17	76566964	76566968	+	Intron	DEL	AAAAG	-	-	rs72225894	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76566964_76566968delAAAAG	uc002jvv.1	-											RecName: Full=Dynein heavy chain 17, axonemal; AltName: Full=Axonemal beta dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain 17; AltName: Full=Ciliary dynein heavy chain-like protein 1; AltName: Full=Axonemal dynein heavy chain-like protein 1; AltName: Full=Dynein light chain 2, axonemal;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)															---	---	---	---
RAB27B	5874	broad.mit.edu	37	18	52545126	52545135	+	Intron	DEL	AACTATAAAT	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52545126_52545135delAACTATAAAT	uc002lfr.2	+							NM_004163	NP_004154			RAB27B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus|plasma membrane	GTP binding|GTPase activity				0				Colorectal(16;0.0273)|READ - Rectum adenocarcinoma(59;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	77393498	77393518	+	IGR	DEL	TGATGGTGGTGGTGACGGTGA	-	-	rs78670059		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393498_77393518delTGATGGTGGTGGTGACGGTGA								NFATC1 (104176 upstream) : CTDP1 (46283 downstream)																																			---	---	---	---
PDE4A	5141	broad.mit.edu	37	19	10544890	10544890	+	Intron	DEL	T	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10544890delT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777			phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)													---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17008955	17008956	+	Intron	INS	-	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17008955_17008956insT	uc002nfb.2	-						CPAMD8_uc010xpj.1_5'Flank|CPAMD8_uc002nfd.1_Intron	NM_015692	NP_056507			C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17741883	17741886	+	Intron	DEL	TCCT	-	-	rs145348480		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17741883_17741886delTCCT	uc002nhd.2	-							NM_001080421	NP_001073890			unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
LIME1	54923	broad.mit.edu	37	20	62369426	62369427	+	Intron	INS	-	GGGGCG	GGGGCG	rs150938918	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62369426_62369427insGGGGCG	uc002ygp.3	+						ZGPAT_uc002ygn.3_Intron|LIME1_uc011abi.1_Intron|SLC2A4RG_uc002ygq.2_5'Flank|SLC2A4RG_uc002ygr.2_5'Flank	NM_017806	NP_060276			Lck interacting transmembrane adaptor 1							integral to membrane|plasma membrane					0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	11106331	11106332	+	IGR	DEL	AC	-	-	rs10439842		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11106331_11106332delAC								BAGE (7394 upstream) : None (None downstream)																																			---	---	---	---
GGT5	2687	broad.mit.edu	37	22	24640282	24640285	+	Intron	DEL	CACC	-	-	rs143008232	by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24640282_24640285delCACC	uc002zzo.3	-						GGT5_uc002zzp.3_Intron|GGT5_uc002zzr.3_Intron|GGT5_uc002zzq.3_Intron|GGT5_uc011ajm.1_Intron|GGT5_uc011ajn.1_Intron	NM_004121	NP_004112			gamma-glutamyltransferase 5 isoform b						glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	68161125	68161126	+	IGR	DEL	GT	-	-			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68161125_68161126delGT								EFNB1 (95096 upstream) : PJA1 (219456 downstream)																																			---	---	---	---
NCRNA00182	100302692	broad.mit.edu	37	X	73506653	73506654	+	Intron	INS	-	A	A	rs71700920		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73506653_73506654insA	uc010nlq.1	-						NCRNA00182_uc004ebr.1_Intron					Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0																		---	---	---	---
PANK4	55229	broad.mit.edu	37	1	2440357	2440357	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2440357C>T	uc001ajm.1	-	19	2260	c.2251G>A	c.(2251-2253)GCG>ACG	p.A751T	PANK4_uc010nza.1_Missense_Mutation_p.A712T	NM_018216	NP_060686	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	751					coenzyme A biosynthetic process	cytoplasm	ATP binding|pantothenate kinase activity			upper_aerodigestive_tract(1)|large_intestine(1)|ovary(1)	3	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)														---	---	---	---
MMEL1	79258	broad.mit.edu	37	1	2535575	2535575	+	Intron	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2535575G>A	uc001ajy.2	-						MMEL1_uc009vlg.1_Intron	NM_033467	NP_258428			membrane metallo-endopeptidase-like 1						proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)														---	---	---	---
SLC2A7	155184	broad.mit.edu	37	1	9078345	9078345	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9078345C>T	uc009vmo.1	-	5	526	c.526G>A	c.(526-528)GTC>ATC	p.V176I		NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7	176	Helical; (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27105581	27105581	+	Nonsense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27105581T>G	uc001bmv.1	+	20	5565	c.5192T>G	c.(5191-5193)TTA>TGA	p.L1731*	ARID1A_uc001bmu.1_Nonsense_Mutation_p.L1514*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.L577*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.L59*|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1731					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
POU3F1	5453	broad.mit.edu	37	1	38511580	38511580	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38511580G>A	uc001ccp.1	-	1	871	c.836C>T	c.(835-837)GCG>GTG	p.A279V		NM_002699	NP_002690	Q03052	PO3F1_HUMAN	POU domain, class 3, transcription factor 1	279	POU-specific.				positive regulation of transcription, DNA-dependent		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39758481	39758481	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39758481T>G	uc010ois.1	+	18	2178	c.1973T>G	c.(1972-1974)CTT>CGT	p.L658R	MACF1_uc001cda.1_Missense_Mutation_p.L566R	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	658					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
CCDC30	728621	broad.mit.edu	37	1	43021909	43021909	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43021909G>A	uc009vwk.1	+	5	618	c.508G>A	c.(508-510)GAG>AAG	p.E170K	CCDC30_uc001chm.2_5'UTR|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_RNA|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	170	Potential.										0																		---	---	---	---
IPO13	9670	broad.mit.edu	37	1	44429965	44429965	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44429965T>G	uc001ckx.2	+	15	3164	c.2369T>G	c.(2368-2370)GTT>GGT	p.V790G	IPO13_uc001cky.2_5'Flank	NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	790	HEAT 14.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)																---	---	---	---
C1orf141	400757	broad.mit.edu	37	1	67559000	67559000	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67559000T>C	uc001ddl.1	-	7	1002	c.891A>G	c.(889-891)CTA>CTG	p.L297L	C1orf141_uc001ddm.1_Silent_p.L297L|C1orf141_uc001ddn.1_RNA	NM_001013674	NP_001013696	Q5JVX7	CA141_HUMAN	hypothetical protein LOC400757	297										ovary(1)	1																		---	---	---	---
WDR63	126820	broad.mit.edu	37	1	85561609	85561609	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85561609T>G	uc001dkt.2	+						WDR63_uc009wcl.2_Intron	NM_145172	NP_660155			WD repeat domain 63											upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)														---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94543292	94543292	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94543292A>C	uc001dqh.2	-	11	1612	c.1508T>G	c.(1507-1509)TTT>TGT	p.F503C	ABCA4_uc010otn.1_Missense_Mutation_p.F503C	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	503	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103461539	103461539	+	Intron	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103461539C>T	uc001dul.2	-						COL11A1_uc001duk.2_Intron|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103467984	103467984	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103467984C>T	uc001dul.2	-	23	2415	c.2097G>A	c.(2095-2097)CAG>CAA	p.Q699Q	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Silent_p.Q711Q|COL11A1_uc001dun.2_Silent_p.Q660Q|COL11A1_uc009weh.2_Silent_p.Q583Q	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	699	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103548536	103548536	+	Intron	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103548536A>G	uc001dul.2	-						COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
FAM46C	54855	broad.mit.edu	37	1	118166122	118166122	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118166122T>C	uc001ehe.2	+	2	831	c.632T>C	c.(631-633)ATT>ACT	p.I211T		NM_017709	NP_060179	Q5VWP2	FA46C_HUMAN	hypothetical protein LOC54855	211											0	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)											Multiple Myeloma(3;1.13e-06)			---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118727698	118727698	+	Missense_Mutation	SNP	T	G	G	rs141500778	byFrequency	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118727698T>G	uc001ehk.2	-	1	151	c.83A>C	c.(82-84)AAT>ACT	p.N28T		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	28						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150915355	150915355	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150915355T>G	uc001evu.2	+	7	891	c.701T>G	c.(700-702)TTT>TGT	p.F234C	SETDB1_uc009wmf.2_Missense_Mutation_p.F234C|SETDB1_uc001evv.2_Missense_Mutation_p.F234C|SETDB1_uc001evw.3_Missense_Mutation_p.F234C|SETDB1_uc009wmg.1_Missense_Mutation_p.F234C	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	234					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
FCRL3	115352	broad.mit.edu	37	1	157668233	157668233	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157668233T>C	uc001frb.2	-	4	531	c.239A>G	c.(238-240)TAC>TGC	p.Y80C	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.Y80C|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'Flank|FCRL3_uc001frc.1_Missense_Mutation_p.Y80C	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	80	Ig-like C2-type 1.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)																	---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171510825	171510825	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171510825G>A	uc010pmg.1	+	16	4480	c.4214G>A	c.(4213-4215)CGA>CAA	p.R1405Q	BAT2L2_uc010pmh.1_Missense_Mutation_p.R382Q	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1405	Arg-rich.						protein C-terminus binding				0																		---	---	---	---
SNAP47	116841	broad.mit.edu	37	1	227935418	227935418	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227935418G>A	uc001hrf.2	+	2	530	c.116G>A	c.(115-117)CGC>CAC	p.R39H	SNAP47_uc001hqz.2_5'UTR|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_Missense_Mutation_p.R39H|SNAP47_uc001hre.2_Intron|SNAP47_uc001hrg.1_5'UTR	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	39						endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1																		---	---	---	---
KIAA1383	54627	broad.mit.edu	37	1	232942059	232942059	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232942059A>C	uc001hvh.2	+	1	1422	c.1290A>C	c.(1288-1290)GAA>GAC	p.E430D		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	288										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)																---	---	---	---
NID1	4811	broad.mit.edu	37	1	236176725	236176725	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236176725C>T	uc001hxo.2	-	11	2492	c.2390G>A	c.(2389-2391)GGC>GAC	p.G797D	NID1_uc009xgd.2_Intron|NID1_uc009xgc.2_5'Flank	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	797	EGF-like 4.				cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248458297	248458297	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458297T>G	uc010pzj.1	-	1	584	c.584A>C	c.(583-585)AAC>ACC	p.N195T		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	195	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71894551	71894551	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71894551G>A	uc002sie.2	+	47	5622	c.5246G>A	c.(5245-5247)CGT>CAT	p.R1749H	DYSF_uc010feg.2_Missense_Mutation_p.R1780H|DYSF_uc010feh.2_Missense_Mutation_p.R1756H|DYSF_uc002sig.3_Missense_Mutation_p.R1735H|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.R1770H|DYSF_uc010fef.2_Missense_Mutation_p.R1787H|DYSF_uc010fei.2_Missense_Mutation_p.R1766H|DYSF_uc010fek.2_Missense_Mutation_p.R1767H|DYSF_uc010fej.2_Missense_Mutation_p.R1757H|DYSF_uc010fel.2_Missense_Mutation_p.R1736H|DYSF_uc010feo.2_Missense_Mutation_p.R1781H|DYSF_uc010fem.2_Missense_Mutation_p.R1771H|DYSF_uc010fen.2_Missense_Mutation_p.R1788H|DYSF_uc002sif.2_Missense_Mutation_p.R1750H|DYSF_uc010yqy.1_Missense_Mutation_p.R630H|DYSF_uc010yqz.1_Missense_Mutation_p.R510H	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1749	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
HK2	3099	broad.mit.edu	37	2	75107589	75107589	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75107589A>G	uc002snd.2	+	10	3389	c.1463A>G	c.(1462-1464)AAG>AGG	p.K488R		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	488	Catalytic.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2																		---	---	---	---
IL1RL2	8808	broad.mit.edu	37	2	102805634	102805634	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102805634A>T	uc002tbs.2	+	3	283	c.157A>T	c.(157-159)AGT>TGT	p.S53C	IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	53	Extracellular (Potential).|Ig-like C2-type 1.				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2																		---	---	---	---
CCDC138	165055	broad.mit.edu	37	2	109411119	109411119	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109411119T>G	uc002ten.1	+	5	578	c.518T>G	c.(517-519)CTT>CGT	p.L173R	CCDC138_uc002teo.1_Missense_Mutation_p.L173R|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	173											0																		---	---	---	---
PCDP1	200373	broad.mit.edu	37	2	120397408	120397408	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120397408T>A	uc002tmb.2	+	22	2419	c.1327T>A	c.(1327-1329)TCC>ACC	p.S443T		NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	729						cilium	calmodulin binding				0	Colorectal(110;0.196)																	---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125204480	125204480	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125204480A>C	uc002tno.2	+	6	1248	c.884A>C	c.(883-885)AAG>ACG	p.K295T	CNTNAP5_uc010flu.2_Missense_Mutation_p.K295T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	295	Laminin G-like 1.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
TUBA3D	113457	broad.mit.edu	37	2	132237757	132237757	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132237757A>C	uc002tsu.3	+	4	598	c.491A>C	c.(490-492)AAG>ACG	p.K164T		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	164					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)														---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625278	141625278	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625278C>G	uc002tvj.1	-	27	5432	c.4460G>C	c.(4459-4461)TGG>TCG	p.W1487S	LRP1B_uc010fnl.1_Missense_Mutation_p.W669S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1487	Extracellular (Potential).|LDL-receptor class B 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
KIF5C	3800	broad.mit.edu	37	2	149837936	149837936	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149837936A>C	uc010zbu.1	+	14	1798	c.1430A>C	c.(1429-1431)AAT>ACT	p.N477T	KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Missense_Mutation_p.N29T	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	477					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179413760	179413760	+	Silent	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413760A>G	uc010zfg.1	-	288	85113	c.84889T>C	c.(84889-84891)TTA>CTA	p.L28297L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L21992L|TTN_uc010zfi.1_Silent_p.L21925L|TTN_uc010zfj.1_Silent_p.L21800L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29224							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182360648	182360648	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182360648A>C	uc002unu.2	+	14	2287	c.1524A>C	c.(1522-1524)GAA>GAC	p.E508D	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	508	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
ANKAR	150709	broad.mit.edu	37	2	190569780	190569780	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190569780T>G	uc002uqw.1	+	7	1527	c.1527T>G	c.(1525-1527)GCT>GCG	p.A509A	ANKAR_uc002uqu.2_RNA	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	580	ANK 2.					integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)															---	---	---	---
SDPR	8436	broad.mit.edu	37	2	192701186	192701186	+	Silent	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192701186A>G	uc002utb.2	-	2	1071	c.741T>C	c.(739-741)TCT>TCC	p.S247S		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	247	Potential.					caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)													---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197199241	197199241	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197199241C>T	uc002utm.1	-	4	585	c.402G>A	c.(400-402)CCG>CCA	p.P134P	HECW2_uc002utl.1_5'UTR	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	134					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	199011591	199011591	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199011591A>T	uc010fsp.2	+	6	3484	c.3193A>T	c.(3193-3195)AGT>TGT	p.S1065C	PLCL1_uc002uuv.3_Missense_Mutation_p.S986C	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	1065					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
MAP2	4133	broad.mit.edu	37	2	210570313	210570313	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210570313A>C	uc002vde.1	+	11	4842	c.4594A>C	c.(4594-4596)ACC>CCC	p.T1532P	MAP2_uc002vdd.1_Missense_Mutation_p.T233P|MAP2_uc002vdf.1_Missense_Mutation_p.T176P|MAP2_uc002vdg.1_Missense_Mutation_p.T176P|MAP2_uc002vdh.1_Missense_Mutation_p.T233P|MAP2_uc002vdi.1_Missense_Mutation_p.T1528P	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1532					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)													---	---	---	---
MYL1	4632	broad.mit.edu	37	2	211159079	211159079	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211159079T>G	uc002vec.2	-	4	497	c.368A>C	c.(367-369)AAC>ACC	p.N123T	MYL1_uc002veb.2_Missense_Mutation_p.N79T	NM_079420	NP_524144	P05976	MYL1_HUMAN	fast skeletal myosin alkali light chain 1	123					muscle filament sliding|muscle organ development	cytosol|muscle myosin complex|sarcomere	calcium ion binding|structural constituent of muscle			ovary(1)	1				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)														---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227877003	227877003	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227877003T>C	uc010zlt.1	-	44	4881	c.4227A>G	c.(4225-4227)GGA>GGG	p.G1409G		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1409	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
WNT7A	7476	broad.mit.edu	37	3	13896035	13896035	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13896035G>A	uc003bye.1	-	3	869	c.564C>T	c.(562-564)GGC>GGT	p.G188G		NM_004625	NP_004616	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family,	188					activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3																		---	---	---	---
C3orf20	84077	broad.mit.edu	37	3	14724370	14724370	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14724370T>C	uc003byy.2	+	3	554	c.150T>C	c.(148-150)ACT>ACC	p.T50T	C3orf20_uc003byz.2_Intron|C3orf20_uc003bza.2_Intron|C3orf20_uc003byx.1_Silent_p.T50T	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	50						cytoplasm|integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
CTNNB1	1499	broad.mit.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	T	T	rs121913400		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41266101C>T	uc010hia.1	+	4	254	c.98C>T	c.(97-99)TCT>TTT	p.S33F	CTNNB1_uc003ckp.2_Missense_Mutation_p.S33F|CTNNB1_uc003ckq.2_Missense_Mutation_p.S33F|CTNNB1_uc003ckr.2_Missense_Mutation_p.S33F|CTNNB1_uc011azf.1_Missense_Mutation_p.S26F|CTNNB1_uc011azg.1_Intron|uc010hib.1_RNA	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	33			S -> F (in PTR, MDB and hepatocellular carcinoma).|Missing (in hepatocellular carcinoma).|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes).|S -> L (in hepatocellular carcinoma).		adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding	p.S33C(131)|p.S33F(79)|p.A5_A80del(63)|p.S33Y(52)|p.S33P(37)|p.S33A(14)|p.H24_S47del(9)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.Q28_H134del(5)|p.S33L(4)|p.W25_I140del(4)|p.S33N(3)|p.S23_S33del(3)|p.V22_G38del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.W25_H36del(2)|p.Y30_S33del(2)|p.V22_S33del(2)|p.V22_L139>V(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.?(2)|p.L10_N141del(2)|p.D6_A43del(1)|p.E9_S47del(1)|p.Q28_Q61del(1)|p.S33T(1)|p.S33S(1)|p.A20_R151del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.D17_P128del(1)|p.H24_M131del(1)|p.L7_I140del(1)|p.K19_Y142>V(1)|p.A20_L148del(1)|p.V22_A80del(1)|p.W25_I35del(1)|p.V22_G80>NNNNN(1)|p.A5_I35del(1)|p.A20_Q143del(1)|p.A13_R151del(1)|p.S23_I140del(1)|p.M1_A87del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.S33_G34del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.D6_I140del(1)|p.Q28_I140del(1)|p.E9_A80del(1)|p.M14_S45del(1)|p.M8_G50del(1)|p.A5_G80>(1)|p.D32_H36>D(1)|p.S33_G34insGTS(1)|p.P16_K133del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.A5_R90del(1)|p.W25_A80del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.E9_I140del(1)|p.D32_S33insS(1)|p.S33_G34insS(1)|p.Y30_T40del(1)|p.S33_G34insGI(1)|p.M1_T42del(1)|p.A5_Q143>E(1)|p.A5_Q72del(1)|p.Y30_A80del(1)|p.D32fs*9(1)|p.D6_K133del(1)|p.A5_T42del(1)|p.A5_D144>D(1)|p.A5_T40del(1)|p.D17_A126del(1)|p.A5_E54del(1)|p.S23_I35del(1)|p.V22_S71>A(1)|p.V22_Y64del(1)|p.A20_Q72del(1)|p.A20_S111del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81584418	81584418	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81584418A>C	uc003dqg.2	-	15	2145	c.1862T>G	c.(1861-1863)CTT>CGT	p.L621R	GBE1_uc011bgm.1_Missense_Mutation_p.L580R	NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	621					glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
CRYBG3	131544	broad.mit.edu	37	3	97596885	97596885	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97596885A>C	uc003drx.2	+							NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0																		---	---	---	---
ABI3BP	25890	broad.mit.edu	37	3	100605148	100605148	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100605148G>A	uc003dun.2	-	5	587	c.502C>T	c.(502-504)CGA>TGA	p.R168*	ABI3BP_uc003duo.2_Nonsense_Mutation_p.R161*|ABI3BP_uc003dup.3_Nonsense_Mutation_p.R161*	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	168	Fibronectin type-III 1.					extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119084276	119084276	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119084276A>C	uc003ecj.3	+							NM_020754	NP_065805			Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
ALDH1L1	10840	broad.mit.edu	37	3	125850342	125850342	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125850342A>G	uc003eim.1	-	13	1698	c.1508T>C	c.(1507-1509)CTG>CCG	p.L503P	ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Missense_Mutation_p.L402P|ALDH1L1_uc003eio.2_Missense_Mutation_p.L205P	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	503	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)													---	---	---	---
NEK11	79858	broad.mit.edu	37	3	130992422	130992422	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130992422A>C	uc003eny.2	+						NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076			NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136170876	136170876	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136170876T>A	uc003era.1	-	14	1719	c.1427A>T	c.(1426-1428)GAG>GTG	p.E476V	STAG1_uc003erb.1_Missense_Mutation_p.E476V|STAG1_uc003erc.1_Missense_Mutation_p.E250V|STAG1_uc010hua.1_Missense_Mutation_p.E339V	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	476					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
TRIM42	287015	broad.mit.edu	37	3	140407265	140407265	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140407265A>G	uc003eto.1	+	3	1932	c.1741A>G	c.(1741-1743)AGC>GGC	p.S581G		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	581						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7																		---	---	---	---
CPB1	1360	broad.mit.edu	37	3	148545685	148545685	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148545685A>C	uc003ewl.2	+							NM_001871	NP_001862			pancreatic carboxypeptidase B1 preproprotein						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)															---	---	---	---
P2RY12	64805	broad.mit.edu	37	3	151056340	151056340	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151056340T>A	uc003eyw.1	-	2	510	c.294A>T	c.(292-294)CAA>CAT	p.Q98H	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY12_uc011boa.1_Missense_Mutation_p.Q98H|P2RY12_uc003eyx.1_Missense_Mutation_p.Q98H	NM_176876	NP_795345	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y12	98	Extracellular (Potential).				platelet activation	integral to membrane|plasma membrane	guanyl-nucleotide exchange factor activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Ticlopidine(DB00208)|Treprostinil(DB00374)													---	---	---	---
GHSR	2693	broad.mit.edu	37	3	172165990	172165990	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165990G>A	uc003fib.1	-	1	214	c.214C>T	c.(214-216)CGC>TGC	p.R72C	GHSR_uc011bpv.1_Missense_Mutation_p.R72C	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	72	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
HTT	3064	broad.mit.edu	37	4	3237942	3237942	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3237942T>G	uc011bvq.1	+	65	9003	c.8858T>G	c.(8857-8859)GTG>GGG	p.V2953G		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	2951					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)														---	---	---	---
LYAR	55646	broad.mit.edu	37	4	4275332	4275332	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4275332T>G	uc011bvy.1	-	8	1040	c.897A>C	c.(895-897)GAA>GAC	p.E299D	LYAR_uc011bvx.1_Missense_Mutation_p.E182D|LYAR_uc003ght.2_Missense_Mutation_p.E299D	NM_001145725	NP_001139197	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive homolog	299	Lys-rich.					nucleolus	metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20512764	20512764	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20512764A>C	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778			slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
YIPF7	285525	broad.mit.edu	37	4	44638025	44638025	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44638025T>C	uc010ifx.1	-	3	283	c.266A>G	c.(265-267)CAA>CGA	p.Q89R	YIPF7_uc010ify.1_Missense_Mutation_p.Q89R	NM_182592	NP_872398	Q8N8F6	YIPF7_HUMAN	Yip1 domain family, member 7	89						endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57189588	57189588	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57189588T>G	uc003hbk.2	+	9	3624	c.3233T>G	c.(3232-3234)CTT>CGT	p.L1078R	KIAA1211_uc010iha.2_Missense_Mutation_p.L1071R	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	1078										ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
AFP	174	broad.mit.edu	37	4	74310733	74310733	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74310733A>G	uc003hgz.1	+	7	784	c.737A>G	c.(736-738)AAG>AGG	p.K246R	AFP_uc003hha.1_Missense_Mutation_p.K246R|AFP_uc011cbg.1_Missense_Mutation_p.K20R	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	246	Albumin 2.				transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)											Alpha-Fetoprotein_Hereditary_Persistence_of				---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87701630	87701630	+	Intron	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87701630G>A	uc003hpz.2	+						PTPN13_uc003hpy.2_Intron|PTPN13_uc003hqa.2_Intron|PTPN13_uc003hqb.2_Intron|PTPN13_uc003hqc.1_Intron	NM_080683	NP_542414			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
ANK2	287	broad.mit.edu	37	4	114263039	114263039	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114263039T>G	uc003ibe.3	+	33	4189	c.4089T>G	c.(4087-4089)AAT>AAG	p.N1363K	ANK2_uc003ibd.3_Missense_Mutation_p.N1354K|ANK2_uc003ibf.3_Missense_Mutation_p.N1363K|ANK2_uc011cgc.1_Missense_Mutation_p.N539K|ANK2_uc003ibg.3_Missense_Mutation_p.N358K|ANK2_uc003ibh.3_Missense_Mutation_p.N37K|ANK2_uc011cgb.1_Missense_Mutation_p.N1378K	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1330					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
ANK2	287	broad.mit.edu	37	4	114294479	114294479	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114294479A>C	uc003ibe.3	+	45	11833	c.11733A>C	c.(11731-11733)GAA>GAC	p.E3911D	ANK2_uc003ibd.3_Missense_Mutation_p.E1817D|ANK2_uc003ibf.3_Missense_Mutation_p.E1826D|ANK2_uc011cgc.1_Missense_Mutation_p.E1002D|ANK2_uc003ibg.3_Missense_Mutation_p.E841D|ANK2_uc003ibh.3_Missense_Mutation_p.E531D|ANK2_uc011cgd.1_Missense_Mutation_p.E1213D|ANK2_uc010imr.2_5'UTR|ANK2_uc010ims.2_5'UTR	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3878					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---
TTC29	83894	broad.mit.edu	37	4	147830381	147830381	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147830381T>G	uc003ikw.3	-	5	424	c.197A>C	c.(196-198)AAG>ACG	p.K66T	TTC29_uc010ipc.2_RNA|TTC29_uc003ikx.3_Missense_Mutation_p.K92T|TTC29_uc010ipd.1_Missense_Mutation_p.K66T	NM_031956	NP_114162	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	66							binding				0	all_hematologic(180;0.151)																	---	---	---	---
DCLK2	166614	broad.mit.edu	37	4	151000236	151000236	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151000236G>A	uc003ilm.3	+	1	157	c.57G>A	c.(55-57)CCG>CCA	p.P19P	DCLK2_uc003iln.3_Silent_p.P19P|DCLK2_uc003ilo.3_Silent_p.P19P|DCLK2_uc003ilp.3_RNA	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a	19					intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)																	---	---	---	---
TIGD4	201798	broad.mit.edu	37	4	153691175	153691175	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153691175T>G	uc003imy.2	-	2	1764	c.982A>C	c.(982-984)ATC>CTC	p.I328L		NM_145720	NP_663772	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	328	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	chromatin binding|DNA binding			ovary(1)	1	all_hematologic(180;0.093)																	---	---	---	---
CCDC127	133957	broad.mit.edu	37	5	205977	205977	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:205977T>C	uc003jam.1	-	3	318	c.218A>G	c.(217-219)AAG>AGG	p.K73R		NM_145265	NP_660308	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127	73	Potential.										0			all cancers(22;0.0236)|Lung(60;0.113)															---	---	---	---
SLC6A3	6531	broad.mit.edu	37	5	1443068	1443068	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1443068T>G	uc003jck.2	-	2	366	c.245A>C	c.(244-246)AAC>ACC	p.N82T		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	82	Helical; Name=1; (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)													---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31508815	31508815	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31508815T>C	uc003jhg.2	-	9	1859	c.1500A>G	c.(1498-1500)GAA>GAG	p.E500E	RNASEN_uc003jhh.2_Silent_p.E463E|RNASEN_uc003jhi.2_Silent_p.E463E|RNASEN_uc010iui.1_Silent_p.E423E	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	500	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33588771	33588771	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33588771T>C	uc003jia.1	-	18	2961	c.2798A>G	c.(2797-2799)AAG>AGG	p.K933R	ADAMTS12_uc010iuq.1_Missense_Mutation_p.K848R	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	933	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
SLC1A3	6507	broad.mit.edu	37	5	36671196	36671196	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36671196A>G	uc003jkj.3	+	4	861	c.385A>G	c.(385-387)ACT>GCT	p.T129A	SLC1A3_uc011cox.1_Missense_Mutation_p.T22A|SLC1A3_uc010iuy.2_Missense_Mutation_p.T129A	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	129	Helical; (Potential).				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)													---	---	---	---
PARP8	79668	broad.mit.edu	37	5	50124142	50124142	+	Intron	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50124142T>C	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Intron|PARP8_uc003jop.2_Intron	NM_024615	NP_078891			poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)																---	---	---	---
SLC30A5	64924	broad.mit.edu	37	5	68413185	68413185	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68413185G>A	uc003jvh.2	+	11	1602	c.1401G>A	c.(1399-1401)CTG>CTA	p.L467L	SLC30A5_uc003jvj.2_RNA|SLC30A5_uc003jvk.2_Silent_p.L196L|SLC30A5_uc003jvi.2_Silent_p.L296L	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),	467	Helical; (Potential).				cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)														---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73153556	73153556	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73153556T>G	uc011csq.1	+	14	1877	c.1866T>G	c.(1864-1866)ACT>ACG	p.T622T	RGNEF_uc003kcx.2_Silent_p.T622T|RGNEF_uc010izf.2_Silent_p.T622T|RGNEF_uc011csr.1_Silent_p.T309T	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	622					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
BHMT	635	broad.mit.edu	37	5	78423617	78423617	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78423617A>T	uc003kfu.3	+	7	953	c.848A>T	c.(847-849)AAA>ATA	p.K283I	BHMT_uc011cti.1_Missense_Mutation_p.K130I	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	283	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)													---	---	---	---
EDIL3	10085	broad.mit.edu	37	5	83362405	83362405	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83362405C>T	uc003kio.1	-	7	1091	c.672G>A	c.(670-672)ATG>ATA	p.M224I	EDIL3_uc003kip.1_Missense_Mutation_p.M214I|EDIL3_uc011ctt.1_Missense_Mutation_p.M1I	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	224	F5/8 type C 1.				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---
GIN1	54826	broad.mit.edu	37	5	102440377	102440377	+	Silent	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102440377G>T	uc003koa.1	-	4	589	c.507C>A	c.(505-507)ACC>ACA	p.T169T	GIN1_uc003kob.1_Silent_p.T22T|GIN1_uc003koc.1_Silent_p.T169T	NM_017676	NP_060146	Q9NXP7	GIN1_HUMAN	zinc finger, H2C2 domain containing	169	Integrase catalytic.				DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)														---	---	---	---
PCDHGA6	56109	broad.mit.edu	37	5	140754955	140754955	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140754955A>C	uc003ljy.1	+	1	1305	c.1305A>C	c.(1303-1305)GAA>GAC	p.E435D	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.E435D	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	435	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PDE6A	5145	broad.mit.edu	37	5	149324200	149324200	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149324200G>T	uc003lrg.3	-	1	157	c.37C>A	c.(37-39)CTG>ATG	p.L13M		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	13					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158135056	158135056	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158135056C>A	uc010jip.2	-	15	1977	c.1675G>T	c.(1675-1677)GCA>TCA	p.A559S	EBF1_uc011ddw.1_Missense_Mutation_p.A427S|EBF1_uc011ddx.1_Missense_Mutation_p.A560S|EBF1_uc003lxl.3_Missense_Mutation_p.A528S	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	559					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7230015	7230015	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7230015C>A	uc003mxc.2	+	10	2073	c.1683C>A	c.(1681-1683)CAC>CAA	p.H561Q	RREB1_uc003mxb.2_Missense_Mutation_p.H561Q|RREB1_uc010jnx.2_Missense_Mutation_p.H561Q	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	561					multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16307033	16307033	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16307033A>G	uc003nbt.2	-	9	2946	c.1975T>C	c.(1975-1977)TCC>CCC	p.S659P	ATXN1_uc010jpi.2_Missense_Mutation_p.S659P|ATXN1_uc010jpj.1_RNA	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	659	Interaction with USP7.|RNA-binding.|AXH.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
GPX6	257202	broad.mit.edu	37	6	28472112	28472112	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28472112T>G	uc011dlj.1	-	6	673	c.623A>C	c.(622-624)AAG>ACG	p.K208T	GPX6_uc010jrg.1_RNA	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor	208					response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)													---	---	---	---
HLA-A	3105	broad.mit.edu	37	6	29911071	29911071	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911071G>T	uc003nol.2	+	3	370	c.370G>T	c.(370-372)GGC>TGC	p.G124C	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_RNA|HLA-A_uc010jrq.2_Missense_Mutation_p.G3C|HLA-A_uc003nok.2_Missense_Mutation_p.G3C|HLA-A_uc003non.2_Missense_Mutation_p.G124C|HLA-A_uc003noo.2_Missense_Mutation_p.G124C|HLA-A_uc010jrr.2_Missense_Mutation_p.G124C|HLA-A_uc003nom.2_Missense_Mutation_p.G3C|HLA-A_uc010klp.2_Missense_Mutation_p.G96C|HLA-A_uc011dmc.1_Missense_Mutation_p.G3C|HLA-A_uc011dmd.1_Missense_Mutation_p.G3C	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	124	Extracellular (Potential).|Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			---	---	---	---
HLA-A	3105	broad.mit.edu	37	6	29911984	29911984	+	Silent	SNP	G	A	A	rs41562919		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911984G>A	uc003nol.2	+	4	705	c.705G>A	c.(703-705)GCG>GCA	p.A235A	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Silent_p.A114A|HLA-A_uc003nok.2_Silent_p.A114A|HLA-A_uc003non.2_Silent_p.A235A|HLA-A_uc003noo.2_Silent_p.A235A|HLA-A_uc010jrr.2_Silent_p.A235A|HLA-A_uc003nom.2_Silent_p.A114A|HLA-A_uc010klp.2_Silent_p.A207A|HLA-A_uc011dmc.1_Silent_p.A114A|HLA-A_uc011dmd.1_Silent_p.A114A	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A	235	Extracellular (Potential).|Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			---	---	---	---
RDBP	7936	broad.mit.edu	37	6	31922349	31922349	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31922349C>T	uc003nyk.2	-	7	929	c.725G>A	c.(724-726)CGA>CAA	p.R242Q	RDBP_uc011dot.1_Missense_Mutation_p.R212Q|RDBP_uc003nyl.1_Missense_Mutation_p.R182Q|RDBP_uc003nym.1_Missense_Mutation_p.R237Q	NM_002904	NP_002895	P18615	NELFE_HUMAN	RD RNA-binding protein	242	30 X 2 AA approximate tandem repeats of R-[DSNE].|30.				positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	mitochondrion|nucleoplasm	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38885705	38885705	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38885705T>C	uc003ooe.1	+	68	10262	c.9662T>C	c.(9661-9663)ATG>ACG	p.M3221T	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38980347	38980347	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38980347T>G	uc003ooe.1	+	89	13597	c.12997T>G	c.(12997-12999)TTT>GTT	p.F4333V		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
SRF	6722	broad.mit.edu	37	6	43144361	43144361	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43144361G>A	uc003oui.2	+	4	1593	c.1118G>A	c.(1117-1119)CGT>CAT	p.R373H	SRF_uc011dvf.1_Missense_Mutation_p.R169H	NM_003131	NP_003122	P11831	SRF_HUMAN	serum response factor (c-fos serum response	373					angiogenesis involved in wound healing|cell migration involved in sprouting angiogenesis|cellular senescence|heart looping|muscle cell homeostasis|neuron development|positive regulation of cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription via serum response element binding|regulation of smooth muscle cell differentiation|response to cytokine stimulus|response to hormone stimulus|response to toxin|transcription from RNA polymerase II promoter|trophectodermal cell differentiation	endoplasmic reticulum	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|serum response element binding|transcription factor binding			ovary(1)|breast(1)|central_nervous_system(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)															---	---	---	---
TDRD6	221400	broad.mit.edu	37	6	46660993	46660993	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46660993G>C	uc003oyj.2	+	1	5128	c.5128G>C	c.(5128-5130)GAA>CAA	p.E1710Q	TDRD6_uc010jze.2_Missense_Mutation_p.E1704Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1710					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)															---	---	---	---
GPR116	221395	broad.mit.edu	37	6	46874462	46874462	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46874462A>C	uc003oyo.3	-	2	327	c.38T>G	c.(37-39)TTT>TGT	p.F13C	GPR116_uc003oyp.3_Missense_Mutation_p.F13C|GPR116_uc003oyq.3_Missense_Mutation_p.F13C|GPR116_uc003oyr.2_Missense_Mutation_p.F13C|uc003oys.2_Intron	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	13					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)															---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51875140	51875140	+	Silent	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51875140A>C	uc003pah.1	-	35	5994	c.5718T>G	c.(5716-5718)ACT>ACG	p.T1906T	PKHD1_uc003pai.2_Silent_p.T1906T	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1906	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
BAI3	577	broad.mit.edu	37	6	69665993	69665993	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69665993C>T	uc003pev.3	+	7	1721	c.1273C>T	c.(1273-1275)CGG>TGG	p.R425W	BAI3_uc010kak.2_Missense_Mutation_p.R425W	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	425	TSP type-1 3.|Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
COL19A1	1310	broad.mit.edu	37	6	70890427	70890427	+	Intron	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70890427T>C	uc003pfc.1	+							NM_001858	NP_001849			alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4																		---	---	---	---
CD109	135228	broad.mit.edu	37	6	74477962	74477962	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74477962T>G	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000			CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4																		---	---	---	---
FILIP1	27145	broad.mit.edu	37	6	76024709	76024709	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76024709T>C	uc003pia.2	-	5	1212	c.839A>G	c.(838-840)GAG>GGG	p.E280G	FILIP1_uc003phy.1_Missense_Mutation_p.E280G|FILIP1_uc003phz.2_Missense_Mutation_p.E181G|FILIP1_uc010kbe.2_Missense_Mutation_p.E283G|FILIP1_uc003pib.1_Missense_Mutation_p.E32G	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	280	Potential.									skin(3)|ovary(1)	4																		---	---	---	---
SNX14	57231	broad.mit.edu	37	6	86235903	86235903	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86235903A>G	uc003pkr.2	-	21	2241	c.2048T>C	c.(2047-2049)CTT>CCT	p.L683P	SNX14_uc003pkp.2_Missense_Mutation_p.L546P|SNX14_uc003pkq.2_Missense_Mutation_p.L289P|SNX14_uc011dzg.1_Missense_Mutation_p.L631P|SNX14_uc003pks.2_Missense_Mutation_p.L630P|SNX14_uc003pkt.2_Missense_Mutation_p.L674P	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	683	PX.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)														---	---	---	---
MDN1	23195	broad.mit.edu	37	6	90482330	90482330	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90482330C>T	uc003pnn.1	-	14	2161	c.2045G>A	c.(2044-2046)GGC>GAC	p.G682D	MDN1_uc003pno.1_Missense_Mutation_p.G100D	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	682	ATP (Potential).				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---
BACH2	60468	broad.mit.edu	37	6	90660225	90660225	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90660225C>T	uc011eab.1	-	7	2409	c.1600G>A	c.(1600-1602)GGG>AGG	p.G534R	BACH2_uc003pnw.2_Missense_Mutation_p.G534R|BACH2_uc010kch.2_Missense_Mutation_p.G534R	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	534						nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)														---	---	---	---
RFPL4B	442247	broad.mit.edu	37	6	112671616	112671616	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671616T>G	uc003pvx.1	+	3	1018	c.706T>G	c.(706-708)TTC>GTC	p.F236V		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	236	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)														---	---	---	---
DSE	29940	broad.mit.edu	37	6	116757328	116757328	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116757328T>G	uc003pws.2	+	6	1891	c.1697T>G	c.(1696-1698)CTT>CGT	p.L566R	DSE_uc011ebg.1_Missense_Mutation_p.L585R|DSE_uc003pwt.2_Missense_Mutation_p.L566R|DSE_uc003pwu.2_Missense_Mutation_p.L233R	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	566					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)														---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117718072	117718072	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117718072T>G	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935			proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
C6orf170	221322	broad.mit.edu	37	6	121452769	121452769	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121452769T>G	uc003pyo.1	-						C6orf170_uc003pyq.1_Intron|C6orf170_uc010kej.1_Intron|C6orf170_uc003pyp.1_Intron	NM_152730	NP_689943			hypothetical protein LOC221322						multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)														---	---	---	---
STL	7955	broad.mit.edu	37	6	125233548	125233548	+	RNA	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125233548A>G	uc003pzq.2	-	7		c.1186T>C				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0								T	ETV6	B-ALL								---	---	---	---
PHACTR2	9749	broad.mit.edu	37	6	144086591	144086591	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144086591T>G	uc003qjq.3	+	6	985	c.855T>G	c.(853-855)ACT>ACG	p.T285T	PHACTR2_uc010khh.2_Silent_p.T205T|PHACTR2_uc010khi.2_Silent_p.T296T|PHACTR2_uc003qjr.3_Silent_p.T216T	NM_014721	NP_055536	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2 isoform 3	285							actin binding|protein phosphatase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)														---	---	---	---
TFB1M	51106	broad.mit.edu	37	6	155581523	155581523	+	Silent	SNP	G	A	A	rs149796947	byFrequency;by1000genomes	TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155581523G>A	uc003qqj.3	-	6	742	c.678C>T	c.(676-678)GGC>GGT	p.G226G	TFB1M_uc003qqk.2_Intron	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	226					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)														---	---	---	---
FNDC1	84624	broad.mit.edu	37	6	159655470	159655470	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159655470A>G	uc010kjv.2	+	11	4126	c.3926A>G	c.(3925-3927)AAC>AGC	p.N1309S	FNDC1_uc010kjw.1_Missense_Mutation_p.N1194S	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1309						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)														---	---	---	---
SLC22A1	6580	broad.mit.edu	37	6	160564597	160564597	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160564597T>G	uc003qtc.2	+	8	1406	c.1301T>G	c.(1300-1302)ATC>AGC	p.I434S	SLC22A1_uc003qtd.2_Missense_Mutation_p.I434S	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	434	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)														---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166831780	166831780	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166831780G>A	uc003qvb.1	-	19	2090	c.1871C>T	c.(1870-1872)GCG>GTG	p.A624V	RPS6KA2_uc011ego.1_Missense_Mutation_p.A535V|RPS6KA2_uc010kkl.1_Missense_Mutation_p.A535V|RPS6KA2_uc003qvc.1_Missense_Mutation_p.A632V|RPS6KA2_uc003qvd.1_Missense_Mutation_p.A649V|RPS6KA2_uc010kkk.1_Missense_Mutation_p.A56V	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	624	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168349083	168349083	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168349083T>C	uc003qwd.2	+	28	3874	c.3732T>C	c.(3730-3732)CCT>CCC	p.P1244P	MLLT4_uc003qwb.1_Silent_p.P1229P|MLLT4_uc003qwc.1_Silent_p.P1245P|MLLT4_uc003qwg.1_Silent_p.P554P	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1245					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
MIOS	54468	broad.mit.edu	37	7	7612124	7612124	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7612124T>C	uc003srf.2	+	4	326	c.18T>C	c.(16-18)CCT>CCC	p.P6P	MIOS_uc010ktp.1_Silent_p.P6P	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	6											0																		---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21818658	21818658	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21818658A>C	uc003svc.2	+	58	9471	c.9440A>C	c.(9439-9441)AAG>ACG	p.K3147T		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3147	Stalk (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37889998	37889998	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37889998A>C	uc003tfn.2	+	4	424	c.52A>C	c.(52-54)AGC>CGC	p.S18R		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	18	Thioredoxin.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
ZNF680	340252	broad.mit.edu	37	7	63981937	63981937	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63981937T>G	uc003tta.2	-	4	1368	c.1195A>C	c.(1195-1197)ATT>CTT	p.I399L	ZNF680_uc010kzr.2_Missense_Mutation_p.I326L	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	399	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	79082630	79082630	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79082630T>G	uc003ugx.2	-	1	261	c.7A>C	c.(7-9)AAA>CAA	p.K3Q	MAGI2_uc003ugy.2_Missense_Mutation_p.K3Q|uc010lea.1_5'Flank	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	3						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
NPTX2	4885	broad.mit.edu	37	7	98257729	98257729	+	Silent	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98257729A>C	uc003upl.2	+	5	1261	c.1084A>C	c.(1084-1086)AGG>CGG	p.R362R		NM_002523	NP_002514	P47972	NPTX2_HUMAN	neuronal pentraxin II precursor	362	Pentaxin.				synaptic transmission	extracellular region	metal ion binding|sugar binding			central_nervous_system(2)|skin(1)	3	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
MOSPD3	64598	broad.mit.edu	37	7	100210606	100210606	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100210606G>A	uc003uvq.2	+	2	394	c.192G>A	c.(190-192)GCG>GCA	p.A64A	MOSPD3_uc003uvr.2_Silent_p.A64A|MOSPD3_uc003uvs.2_Silent_p.A64A|MOSPD3_uc003uvt.2_Silent_p.A64A	NM_001040097	NP_001035186	O75425	MSPD3_HUMAN	motile sperm domain containing 3 isoform a	64	MSP.					integral to membrane	structural molecule activity			ovary(2)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)																	---	---	---	---
RELN	5649	broad.mit.edu	37	7	103131169	103131169	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103131169T>G	uc003vca.2	-	59	9711	c.9551A>C	c.(9550-9552)AAC>ACC	p.N3184T	RELN_uc010liz.2_Missense_Mutation_p.N3184T	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3184					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
SLC13A1	6561	broad.mit.edu	37	7	122787238	122787238	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122787238A>C	uc003vkm.2	-	7	812	c.787T>G	c.(787-789)TTG>GTG	p.L263V	SLC13A1_uc010lks.2_Missense_Mutation_p.L139V	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	263						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)													---	---	---	---
LMOD2	442721	broad.mit.edu	37	7	123302475	123302475	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123302475T>G	uc003vky.2	+	2	992	c.835T>G	c.(835-837)TTC>GTC	p.F279V		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	279						cytoskeleton	actin binding|tropomyosin binding				0																		---	---	---	---
UBN2	254048	broad.mit.edu	37	7	138943355	138943355	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138943355A>C	uc011kqr.1	+	4	785	c.785A>C	c.(784-786)AAG>ACG	p.K262T	UBN2_uc003vuv.2_5'UTR	NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2	262	Lys-rich.									ovary(1)|skin(1)	2																		---	---	---	---
GALNTL5	168391	broad.mit.edu	37	7	151668084	151668084	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151668084G>A	uc003wkp.2	+	3	525	c.302G>A	c.(301-303)GGA>GAA	p.G101E	GALNTL5_uc003wkq.2_5'UTR|GALNTL5_uc003wkr.2_RNA|GALNTL5_uc003wks.2_RNA|GALNTL5_uc010lqf.2_5'UTR	NM_145292	NP_660335	Q7Z4T8	GLTL5_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	101	Lumenal (Potential).					Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)														---	---	---	---
UBE3C	9690	broad.mit.edu	37	7	156971465	156971465	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156971465T>G	uc010lqs.2	+	6	852	c.540T>G	c.(538-540)ACT>ACG	p.T180T	UBE3C_uc003wnf.2_Silent_p.T137T|UBE3C_uc003wng.2_Silent_p.T180T	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	180					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)														---	---	---	---
NKX3-1	4824	broad.mit.edu	37	8	23539026	23539026	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23539026T>G	uc011kzx.1	-	2	461	c.413A>C	c.(412-414)GAG>GCG	p.E138A	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	138	Homeobox.				negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)														---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	39068770	39068770	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39068770A>C	uc003xmt.3	+	12	1405	c.1160A>C	c.(1159-1161)AAA>ACA	p.K387T	ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441	Q8TC27	ADA32_HUMAN	a disintegrin and metalloprotease domain 32	387	Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
CHRNA6	8973	broad.mit.edu	37	8	42611197	42611197	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42611197T>G	uc003xpj.2	-	5	1191	c.1145A>C	c.(1144-1146)AAG>ACG	p.K382T	CHRNA6_uc011lcw.1_Missense_Mutation_p.K367T	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	382	Cytoplasmic.					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68184039	68184039	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68184039T>C	uc003xxo.1	-	10	1860	c.1470A>G	c.(1468-1470)TCA>TCG	p.S490S		NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	490					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69015839	69015839	+	Intron	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69015839T>C	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69031754	69031754	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69031754A>C	uc003xxv.1	+							NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72965010	72965010	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72965010A>C	uc003xza.2	-						uc011lff.1_RNA|uc003xyy.2_RNA	NM_007332	NP_015628			ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
GDAP1	54332	broad.mit.edu	37	8	75263670	75263670	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75263670C>T	uc003yah.2	+	2	358	c.279C>T	c.(277-279)ATC>ATT	p.I93I	GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Silent_p.I25I	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated	93	GST N-terminal.					cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)															---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87541161	87541161	+	Intron	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87541161G>A	uc003ydv.2	+							NM_003909	NP_003900			copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885849	88885849	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885849G>T	uc003ydz.2	-	1	448	c.351C>A	c.(349-351)CAC>CAA	p.H117Q		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	117										ovary(1)	1																		---	---	---	---
UBR5	51366	broad.mit.edu	37	8	103306244	103306244	+	Missense_Mutation	SNP	G	A	A	rs146096321		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103306244G>A	uc003ykr.1	-	33	4321	c.4288C>T	c.(4288-4290)CGT>TGT	p.R1430C	UBR5_uc003yks.1_Missense_Mutation_p.R1430C	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1430					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)															---	---	---	---
LRP12	29967	broad.mit.edu	37	8	105509726	105509726	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105509726C>G	uc003yma.2	-	5	1149	c.1054G>C	c.(1054-1056)GTA>CTA	p.V352L	LRP12_uc003ymb.2_Missense_Mutation_p.V333L|LRP12_uc003ylz.2_5'Flank	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	352	Extracellular (Potential).|CUB 2.				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
OC90	729330	broad.mit.edu	37	8	133041393	133041393	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133041393T>G	uc003ytg.2	-	12	1065	c.1065A>C	c.(1063-1065)CAA>CAC	p.Q355H	OC90_uc011lix.1_Missense_Mutation_p.Q355H	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	371	Phospholipase A2-like 2.				lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)															---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133142093	133142093	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133142093C>T	uc003ytj.2	-	15	2260	c.2035G>A	c.(2035-2037)GAT>AAT	p.D679N	KCNQ3_uc010mdt.2_Missense_Mutation_p.D667N	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	679					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
ZC3H3	23144	broad.mit.edu	37	8	144621157	144621157	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144621157A>C	uc003yyd.2	-	2	409	c.380T>G	c.(379-381)GTT>GGT	p.V127G		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	127					mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)															---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2088575	2088575	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2088575A>G	uc003zhc.2	+	19	2944	c.2845A>G	c.(2845-2847)AGA>GGA	p.R949G	SMARCA2_uc003zhd.2_Missense_Mutation_p.R949G|SMARCA2_uc010mha.2_Missense_Mutation_p.R882G	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	949					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
FOXB2	442425	broad.mit.edu	37	9	79635446	79635446	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79635446G>A	uc004ako.1	+	1	876	c.876G>A	c.(874-876)GCG>GCA	p.A292A		NM_001013735	NP_001013757	Q5VYV0	FOXB2_HUMAN	forkhead box B2	292					brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0																		---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82268964	82268964	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82268964T>G	uc004ald.2	+						TLE4_uc004alc.2_Intron|TLE4_uc010mpr.2_Intron|TLE4_uc004ale.2_Intron|TLE4_uc011lsq.1_Intron|TLE4_uc010mps.2_Intron|TLE4_uc004alf.2_Intron	NM_007005	NP_008936			transducin-like enhancer protein 4											lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
KIF27	55582	broad.mit.edu	37	9	86506355	86506355	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86506355A>C	uc004ana.2	-	6	1808	c.1664T>G	c.(1663-1665)CTT>CGT	p.L555R	KIF27_uc010mpw.2_Missense_Mutation_p.L555R|KIF27_uc010mpx.2_Missense_Mutation_p.L555R	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	555	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5																		---	---	---	---
NTRK2	4915	broad.mit.edu	37	9	87563465	87563465	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87563465A>C	uc004aoa.1	+	17	2743	c.1805A>C	c.(1804-1806)AAG>ACG	p.K602T	NTRK2_uc004any.1_Missense_Mutation_p.K602T|NTRK2_uc004anz.1_Missense_Mutation_p.K618T	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	602	Protein kinase.|Cytoplasmic (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16															TSP Lung(25;0.17)			---	---	---	---
ISCA1	81689	broad.mit.edu	37	9	88886933	88886933	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88886933A>C	uc004aop.2	-	3	347	c.230T>G	c.(229-231)GTT>GGT	p.V77G	GOLM1_uc010mqd.1_RNA	NM_030940	NP_112202	Q9BUE6	ISCA1_HUMAN	HESB like domain containing 2 precursor	77					iron-sulfur cluster assembly	mitochondrion	iron-sulfur cluster binding|metal ion binding|structural molecule activity				0				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)														---	---	---	---
C9orf89	84270	broad.mit.edu	37	9	95874168	95874168	+	Silent	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95874168A>G	uc004atd.2	+	4	490	c.312A>G	c.(310-312)TCA>TCG	p.S104S	C9orf89_uc004ate.2_RNA|C9orf89_uc004atf.2_RNA	NM_032310	NP_115686	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					negative regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|nucleus	CARD domain binding				0																		---	---	---	---
HEMGN	55363	broad.mit.edu	37	9	100692583	100692583	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100692583T>G	uc004axy.2	-	3	1202	c.1094A>C	c.(1093-1095)AAA>ACA	p.K365T	HEMGN_uc004axz.2_Missense_Mutation_p.K365T	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	365					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
OR13F1	138805	broad.mit.edu	37	9	107266780	107266780	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107266780T>C	uc011lvm.1	+	1	237	c.237T>C	c.(235-237)TCT>TCC	p.S79S		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	79	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
WDR31	114987	broad.mit.edu	37	9	116082786	116082786	+	Intron	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116082786A>G	uc004bhe.2	-						WDR31_uc004bhc.2_Intron|WDR31_uc004bhd.2_Intron|WDR31_uc004bhf.2_Intron	NM_001012361	NP_001012361			WD repeat domain 31 isoform 1												0																		---	---	---	---
OR1J1	347168	broad.mit.edu	37	9	125239595	125239595	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125239595A>G	uc011lyu.1	-	1	611	c.611T>C	c.(610-612)TTG>TCG	p.L204S	OR1J2_uc004bmj.1_Intron	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---
TTC16	158248	broad.mit.edu	37	9	130493579	130493579	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130493579G>A	uc004brq.1	+	14	2584	c.2517G>A	c.(2515-2517)CAG>CAA	p.Q839Q	TTC16_uc011mai.1_Silent_p.Q826Q|TTC16_uc004brr.1_3'UTR|TTC16_uc010mxn.1_Silent_p.Q435Q	NM_144965	NP_659402	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	839							binding				0																		---	---	---	---
FCN1	2219	broad.mit.edu	37	9	137801698	137801698	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137801698C>T	uc004cfi.2	-	9	1019	c.927G>A	c.(925-927)GCG>GCA	p.A309A		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	309	Fibrinogen C-terminal.				opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)														---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	5014908	5014908	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5014908C>T	uc001iho.2	+	12	1654	c.813C>T	c.(811-813)AGC>AGT	p.S271S	AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc001ihq.2_Silent_p.S271S	NM_001353	NP_001344	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	271	NADP (By similarity).				bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)													---	---	---	---
NET1	10276	broad.mit.edu	37	10	5471125	5471125	+	Intron	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5471125T>A	uc001iia.2	+						NET1_uc010qar.1_Intron	NM_001047160	NP_001040625			neuroepithelial cell transforming gene 1 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell growth|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	Rho guanyl-nucleotide exchange factor activity			breast(1)	1																		---	---	---	---
DHTKD1	55526	broad.mit.edu	37	10	12155013	12155013	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12155013T>G	uc001ild.3	+	13	2368	c.2269T>G	c.(2269-2271)TTC>GTC	p.F757V		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	757					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)															---	---	---	---
CUBN	8029	broad.mit.edu	37	10	17085967	17085967	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17085967T>G	uc001ioo.2	-	26	3740	c.3688A>C	c.(3688-3690)AGT>CGT	p.S1230R		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1230	CUB 7.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
ARL5B	221079	broad.mit.edu	37	10	18964145	18964145	+	Nonstop_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18964145A>C	uc001iqd.1	+	6	794	c.540A>C	c.(538-540)TAA>TAC	p.*180Y	uc001iqe.2_5'Flank	NM_178815	NP_848930	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 8	180					small GTPase mediated signal transduction	intracellular	GTP binding			ovary(1)	1																		---	---	---	---
MIR603	693188	broad.mit.edu	37	10	24564640	24564640	+	RNA	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24564640A>C	hsa-mir-603|MI0003616	+			c.27A>C			KIAA1217_uc001irs.2_Intron|KIAA1217_uc001iru.3_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron																	0																		---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30318612	30318612	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30318612T>G	uc001iux.2	-	2	524	c.465A>C	c.(463-465)GAA>GAC	p.E155D	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.E17D|KIAA1462_uc009xle.1_Missense_Mutation_p.E155D	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	155										ovary(4)	4																		---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33496530	33496530	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33496530T>C	uc001iwx.3	-	10	2252	c.1729A>G	c.(1729-1731)AGA>GGA	p.R577G	NRP1_uc001iwv.3_Missense_Mutation_p.R577G|NRP1_uc009xlz.2_Missense_Mutation_p.R577G|NRP1_uc001iww.3_Missense_Mutation_p.R396G|NRP1_uc001iwy.3_Missense_Mutation_p.R577G|NRP1_uc001iwz.2_Missense_Mutation_p.R577G|NRP1_uc001ixa.2_Missense_Mutation_p.R577G|NRP1_uc001ixb.1_Missense_Mutation_p.R577G	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	577	Extracellular (Potential).|F5/8 type C 2.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
LRRTM3	347731	broad.mit.edu	37	10	68687965	68687965	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68687965G>A	uc001jmz.1	+	2	1841	c.1291G>A	c.(1291-1293)GTG>ATG	p.V431M	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.V431M	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	431	Helical; (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3																		---	---	---	---
RRP12	23223	broad.mit.edu	37	10	99123636	99123636	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99123636G>A	uc001knf.2	-	30	3681	c.3542C>T	c.(3541-3543)CCA>CTA	p.P1181L	RRP12_uc001kne.2_Missense_Mutation_p.P196L|RRP12_uc009xvl.2_Missense_Mutation_p.P298L|RRP12_uc009xvm.2_Missense_Mutation_p.P899L|RRP12_uc010qou.1_Missense_Mutation_p.P1120L|RRP12_uc009xvn.2_Missense_Mutation_p.P1081L	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	1181						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)														---	---	---	---
VWA2	340706	broad.mit.edu	37	10	116049181	116049181	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116049181G>A	uc001lbl.1	+	12	2376	c.2055G>A	c.(2053-2055)CTG>CTA	p.L685L	VWA2_uc001lbk.1_Silent_p.L685L|VWA2_uc009xyf.1_Silent_p.L381L	NM_198496	NP_940898	Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	685	VWFA 3.					extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	116889259	116889259	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116889259C>T	uc001lcg.2	+	5	1177	c.791C>T	c.(790-792)ACT>ATT	p.T264I	ATRNL1_uc001lce.2_RNA|ATRNL1_uc001lcf.2_Missense_Mutation_p.T264I|ATRNL1_uc009xyq.2_Missense_Mutation_p.T264I	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	264	Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129179554	129179554	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129179554G>C	uc001ljt.2	+	37	3730	c.3666G>C	c.(3664-3666)AAG>AAC	p.K1222N	DOCK1_uc010qun.1_Missense_Mutation_p.K1243N|DOCK1_uc009yaq.2_Missense_Mutation_p.K217N	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1222	DHR-2.				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1284335	1284335	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1284335A>C	uc009ycr.1	+	73	18518	c.18392A>C	c.(18391-18393)AAG>ACG	p.K6131T		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	Error:Variant_position_missing_in_Q9HC84_after_alignment					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
PGAP2	27315	broad.mit.edu	37	11	3845280	3845280	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3845280G>A	uc001lys.2	+	4	642	c.516G>A	c.(514-516)CCG>CCA	p.P172P	PGAP2_uc001lyl.2_Silent_p.P129P|PGAP2_uc010qxw.1_Silent_p.P229P|PGAP2_uc010qxx.1_Missense_Mutation_p.A153T|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Silent_p.P168P|PGAP2_uc010qxz.1_Silent_p.P168P|PGAP2_uc001lyn.3_Missense_Mutation_p.A65T|PGAP2_uc010qya.1_RNA|PGAP2_uc001lyr.2_Silent_p.P111P|PGAP2_uc010qyb.1_Missense_Mutation_p.A115T|PGAP2_uc001lyt.2_5'UTR	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN	FGF receptor activating protein 1 isoform 1	172					GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity				0																		---	---	---	---
OR52R1	119695	broad.mit.edu	37	11	4825109	4825109	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4825109T>C	uc010qym.1	-	1	739	c.739A>G	c.(739-741)AGG>GGG	p.R247G		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR51A2	401667	broad.mit.edu	37	11	4976831	4976831	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4976831A>C	uc010qyt.1	-	1	113	c.113T>G	c.(112-114)CTT>CGT	p.L38R		NM_001004748	NP_001004748	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
IPO7	10527	broad.mit.edu	37	11	9442011	9442011	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9442011C>T	uc001mho.2	+	7	922	c.780C>T	c.(778-780)TGC>TGT	p.C260C		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	260					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14839895	14839895	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14839895T>G	uc001mln.2	+	6	2042	c.1689T>G	c.(1687-1689)GAT>GAG	p.D563E	PDE3B_uc010rcr.1_Missense_Mutation_p.D512E	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	563					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20699529	20699529	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20699529T>G	uc001mqe.2	+	2	260	c.107T>G	c.(106-108)CTT>CGT	p.L36R	NELL1_uc001mqf.2_Missense_Mutation_p.L36R|NELL1_uc009yid.2_Missense_Mutation_p.L64R|NELL1_uc010rdo.1_Missense_Mutation_p.L36R|NELL1_uc010rdp.1_5'UTR	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	36					cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
PRG3	10394	broad.mit.edu	37	11	57144316	57144316	+	3'UTR	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57144316C>T	uc001njv.1	-	6						NM_006093	NP_006084			proteoglycan 3 precursor						basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0																		---	---	---	---
SERPING1	710	broad.mit.edu	37	11	57373931	57373931	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57373931C>T	uc001nkp.1	+	6	1131	c.940C>T	c.(940-942)CAC>TAC	p.H314Y	SERPING1_uc001nkq.1_Missense_Mutation_p.H314Y|SERPING1_uc010rju.1_Missense_Mutation_p.H262Y|SERPING1_uc010rjv.1_Missense_Mutation_p.H319Y|SERPING1_uc001nkr.1_Missense_Mutation_p.H314Y|SERPING1_uc009ymi.1_Missense_Mutation_p.H323Y|SERPING1_uc009ymj.1_Missense_Mutation_p.H314Y|SERPING1_uc001nks.1_Missense_Mutation_p.H5Y	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	314				HFKNSVI -> QLQKLSY (in Ref. 19; AA sequence).	blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1														Hereditary_Angioedema				---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61070540	61070540	+	Silent	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61070540A>G	uc001nrc.3	-	23	3146	c.2920T>C	c.(2920-2922)TTG>CTG	p.L974L	DDB1_uc010rle.1_Silent_p.L285L|DDB1_uc010rlf.1_Silent_p.L974L	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	974	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
LTBP3	4054	broad.mit.edu	37	11	65310701	65310701	+	Intron	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65310701G>T	uc001oej.2	-						LTBP3_uc001oef.2_Intron|LTBP3_uc001oeg.2_Intron|LTBP3_uc001oeh.2_Intron|LTBP3_uc010roi.1_Intron|LTBP3_uc001oei.2_Intron|LTBP3_uc010roj.1_Intron|LTBP3_uc010rok.1_Intron	NM_001130144	NP_001123616			latent transforming growth factor beta binding							extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3																		---	---	---	---
TSGA10IP	254187	broad.mit.edu	37	11	65713226	65713226	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65713226G>T	uc001ogk.1	+	3	112	c.80G>T	c.(79-81)CGG>CTG	p.R27L	TSGA10IP_uc009yqw.1_RNA|TSGA10IP_uc009yqx.1_RNA	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	27											0																		---	---	---	---
CTTN	2017	broad.mit.edu	37	11	70263150	70263150	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70263150C>T	uc001opv.3	+	8	695	c.489C>T	c.(487-489)GGC>GGT	p.G163G	CTTN_uc001opu.2_Silent_p.G163G|CTTN_uc001opw.3_Silent_p.G163G	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	163	Cortactin 3.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)														---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89135535	89135535	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89135535T>A	uc001pct.2	-	9	1044	c.805A>T	c.(805-807)ATT>TTT	p.I269F	NOX4_uc009yvr.2_Missense_Mutation_p.I244F|NOX4_uc001pcu.2_Missense_Mutation_p.I195F|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.I269F|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Missense_Mutation_p.I103F|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Missense_Mutation_p.I245F|NOX4_uc009yvq.2_Missense_Mutation_p.I245F|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	269	Extracellular (Potential).|Ferric oxidoreductase.|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
FOLH1B	219595	broad.mit.edu	37	11	89402611	89402611	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89402611G>C	uc001pda.2	+	3	561	c.35G>C	c.(34-36)AGA>ACA	p.R12T		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	12					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
SLC35F2	54733	broad.mit.edu	37	11	107663481	107663481	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107663481A>C	uc001pjq.2	-	8	1406	c.985T>G	c.(985-987)TTT>GTT	p.F329V	SLC35F2_uc010rvu.1_Missense_Mutation_p.F181V	NM_017515	NP_059985	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	329	Helical; (Potential).				transport	integral to membrane				central_nervous_system(1)	1		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)														---	---	---	---
ATM	472	broad.mit.edu	37	11	108205757	108205757	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108205757G>A	uc001pkb.1	+	55	8457	c.8072G>A	c.(8071-8073)CGC>CAC	p.R2691H	ATM_uc009yxr.1_Missense_Mutation_p.R2691H|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Missense_Mutation_p.R1343H	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2691					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)				D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			---	---	---	---
OR8D1	283159	broad.mit.edu	37	11	124179740	124179740	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124179740T>G	uc010sag.1	-	1	923	c.923A>C	c.(922-924)AAA>ACA	p.K308T		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)														---	---	---	---
NTM	50863	broad.mit.edu	37	11	132081944	132081944	+	Silent	SNP	A	G	G	rs143759596		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132081944A>G	uc001qgp.2	+	3	1093	c.429A>G	c.(427-429)TCA>TCG	p.S143S	NTM_uc001qgm.2_Silent_p.S143S|NTM_uc010sch.1_Silent_p.S134S|NTM_uc010sci.1_Silent_p.S143S|NTM_uc010scj.1_Silent_p.S102S|NTM_uc001qgo.2_Silent_p.S143S|NTM_uc001qgq.2_Silent_p.S143S|NTM_uc001qgr.2_5'UTR	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1	143	Ig-like C2-type 2.				cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
CACNA2D4	93589	broad.mit.edu	37	12	1995481	1995481	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1995481T>G	uc001qjp.2	-	8	1132	c.901A>C	c.(901-903)AGT>CGT	p.S301R	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	301	VWFA.|MIDAS-like motif.|Extracellular (Potential).	Divalent metal cation (By similarity).				integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)														---	---	---	---
FKBP4	2288	broad.mit.edu	37	12	2909081	2909081	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2909081A>G	uc001qkz.2	+	6	935	c.737A>G	c.(736-738)GAA>GGA	p.E246G		NM_002014	NP_002005	Q02790	FKBP4_HUMAN	FK506 binding protein 52	246	PPIase FKBP-type 2.				negative regulation of microtubule polymerization or depolymerization|negative regulation of neuron projection development|protein folding	axonal growth cone|cytosol|membrane|microtubule|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity|protein binding, bridging				0			OV - Ovarian serous cystadenocarcinoma(31;0.00105)		Dimethyl sulfoxide(DB01093)													---	---	---	---
KCNA5	3741	broad.mit.edu	37	12	5153904	5153904	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5153904G>A	uc001qni.2	+	1	820	c.591G>A	c.(589-591)GCG>GCA	p.A197A		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	197						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4																		---	---	---	---
GRIN2B	2904	broad.mit.edu	37	12	13906489	13906489	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906489C>T	uc001rbt.2	-	3	951	c.772G>A	c.(772-774)GTG>ATG	p.V258M		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	258	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
CASC1	55259	broad.mit.edu	37	12	25343536	25343536	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25343536A>C	uc001rgl.2	-						CASC1_uc001rgk.2_Intron|CASC1_uc001rgm.3_Intron|CASC1_uc001rgj.2_Intron|CASC1_uc010sje.1_Intron|CASC1_uc010sjf.1_Intron|CASC1_uc010sjg.1_Intron|CASC1_uc010sjh.1_Intron	NM_001082973	NP_001076442			cancer susceptibility candidate 1 isoform b											ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)															---	---	---	---
PDZRN4	29951	broad.mit.edu	37	12	41967054	41967054	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41967054G>A	uc010skn.1	+	10	1944	c.1876G>A	c.(1876-1878)GAA>AAA	p.E626K	PDZRN4_uc001rmq.3_Missense_Mutation_p.E567K|PDZRN4_uc009zjz.2_Missense_Mutation_p.E565K|PDZRN4_uc001rmr.2_Missense_Mutation_p.E452K	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	825							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)																---	---	---	---
ADAMTS20	80070	broad.mit.edu	37	12	43886427	43886427	+	Silent	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43886427T>A	uc010skx.1	-	6	957	c.957A>T	c.(955-957)GGA>GGT	p.G319G		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	319	Peptidase M12B.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)														---	---	---	---
NR4A1	3164	broad.mit.edu	37	12	52452615	52452615	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52452615C>A	uc001rzs.2	+	8	1998	c.1684C>A	c.(1684-1686)CTG>ATG	p.L562M	NR4A1_uc010sno.1_Missense_Mutation_p.L575M|NR4A1_uc001rzt.2_Missense_Mutation_p.L562M|NR4A1_uc009zmc.2_3'UTR	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	562					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)														---	---	---	---
KRT72	140807	broad.mit.edu	37	12	52981453	52981453	+	Silent	SNP	G	A	A	rs145640018		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52981453G>A	uc001sar.2	-	7	1358	c.1272C>T	c.(1270-1272)ATC>ATT	p.I424I	KRT72_uc001saq.2_Silent_p.I424I|KRT72_uc010sns.1_Silent_p.I382I|KRT72_uc010snt.1_Silent_p.I236I	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1	424	Coil 2.|Rod.					keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)														---	---	---	---
STAT2	6773	broad.mit.edu	37	12	56749971	56749971	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56749971T>C	uc001slc.2	-	3	308	c.230A>G	c.(229-231)GAC>GGC	p.D77G	STAT2_uc001sld.2_Missense_Mutation_p.D77G|STAT2_uc010sqn.1_Missense_Mutation_p.D77G	NM_005419	NP_005410	P52630	STAT2_HUMAN	signal transducer and activator of transcription	77					interspecies interaction between organisms|JAK-STAT cascade|regulation of transcription from RNA polymerase II promoter|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	cytosol|nucleoplasm|plasma membrane	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|lung(1)|kidney(1)	3																		---	---	---	---
TIMELESS	8914	broad.mit.edu	37	12	56822098	56822098	+	Silent	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56822098A>C	uc001slf.2	-	13	1668	c.1500T>G	c.(1498-1500)CGT>CGG	p.R500R	TIMELESS_uc001slg.2_Silent_p.R499R	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	500					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8																		---	---	---	---
FRS2	10818	broad.mit.edu	37	12	69965214	69965214	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69965214A>G	uc001suy.2	+	8	922	c.412A>G	c.(412-414)ACT>GCT	p.T138A	FRS2_uc001suz.2_Missense_Mutation_p.T138A|FRS2_uc009zrj.2_Missense_Mutation_p.T138A|FRS2_uc009zrk.2_Missense_Mutation_p.T138A	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	138					activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)													OREG0021986	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70960313	70960313	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70960313T>G	uc001swb.3	-	13	3182	c.3152A>C	c.(3151-3153)AAA>ACA	p.K1051T	PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Missense_Mutation_p.K961T|PTPRB_uc001swc.3_Missense_Mutation_p.K1269T|PTPRB_uc001swa.3_Missense_Mutation_p.K1181T|PTPRB_uc001swd.3_Missense_Mutation_p.K1268T|PTPRB_uc009zrr.1_Missense_Mutation_p.K1148T	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1051	Fibronectin type-III 12.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78531121	78531121	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78531121T>G	uc001syp.2	+	19	4779	c.4606T>G	c.(4606-4608)TCA>GCA	p.S1536A	NAV3_uc001syo.2_Missense_Mutation_p.S1536A|NAV3_uc010sub.1_Missense_Mutation_p.S1022A|NAV3_uc009zsf.2_Missense_Mutation_p.S367A	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1536	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104044317	104044317	+	Silent	SNP	G	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104044317G>C	uc001tjw.2	+	11	1404	c.1218G>C	c.(1216-1218)ACG>ACC	p.T406T		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	406	Extracellular (Potential).|FAS1 1.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
LHX5	64211	broad.mit.edu	37	12	113905210	113905210	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113905210C>T	uc001tvj.1	-	4	1266	c.692G>A	c.(691-693)CGA>CAA	p.R231Q		NM_022363	NP_071758	Q9H2C1	LHX5_HUMAN	LIM homeobox protein 5	231	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
TRPC4	7223	broad.mit.edu	37	13	38211772	38211772	+	Intron	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38211772A>C	uc001uws.2	-						TRPC4_uc010abv.2_Intron|TRPC4_uc001uwt.2_Intron|TRPC4_uc010tey.1_Intron|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Intron|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263			transient receptor potential cation channel,						axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)														---	---	---	---
TRPC4	7223	broad.mit.edu	37	13	38320122	38320122	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38320122T>G	uc001uws.2	-	3	1084	c.849A>C	c.(847-849)GGA>GGC	p.G283G	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Silent_p.G283G|TRPC4_uc010tey.1_Silent_p.G283G|TRPC4_uc010abw.2_Intron|TRPC4_uc010abx.2_Silent_p.G283G|TRPC4_uc010aby.2_Silent_p.G283G	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	283	Cytoplasmic (Potential).|Multimerization domain (By similarity).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)														---	---	---	---
GPR180	160897	broad.mit.edu	37	13	95275516	95275516	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95275516A>C	uc001vly.2	+	7	1126	c.1048A>C	c.(1048-1050)AGT>CGT	p.S350R	GPR180_uc001vlz.2_Missense_Mutation_p.S249R|GPR180_uc010afi.2_Missense_Mutation_p.S111R	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor	350						integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)																	---	---	---	---
SLC15A1	6564	broad.mit.edu	37	13	99373848	99373848	+	Intron	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99373848A>G	uc001vno.2	-						SLC15A1_uc001vnp.1_Intron	NM_005073	NP_005064			solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)													---	---	---	---
OR4K5	79317	broad.mit.edu	37	14	20389381	20389381	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389381C>A	uc010tkw.1	+	1	616	c.616C>A	c.(616-618)CTT>ATT	p.L206I		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
REC8	9985	broad.mit.edu	37	14	24642165	24642165	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24642165G>A	uc001wmr.2	+	4	610	c.183G>A	c.(181-183)CCG>CCA	p.P61P	REC8_uc001wms.2_Silent_p.P61P	NM_005132	NP_005123	O95072	REC8_HUMAN	REC8 homolog	61					mitotic metaphase/anaphase transition|mitotic prometaphase|reciprocal meiotic recombination|sister chromatid cohesion	nucleoplasm					0				GBM - Glioblastoma multiforme(265;0.00839)														---	---	---	---
TGM1	7051	broad.mit.edu	37	14	24723892	24723892	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24723892C>T	uc001wod.2	-	13	2190	c.2066G>A	c.(2065-2067)CGC>CAC	p.R689H	TGM1_uc010tog.1_Missense_Mutation_p.R247H	NM_000359	NP_000350	P22735	TGM1_HUMAN	transglutaminase 1	689					cell envelope organization|keratinization|peptide cross-linking	cornified envelope|intrinsic to membrane	acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)													---	---	---	---
SLC35F4	341880	broad.mit.edu	37	14	58036502	58036502	+	Intron	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58036502T>G	uc001xdb.1	-						SLC35F4_uc010aoz.1_Intron|SLC35F4_uc010apa.1_Intron	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2																		---	---	---	---
ESRRB	2103	broad.mit.edu	37	14	76905862	76905862	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76905862C>T	uc001xsq.1	+	2	233	c.166C>T	c.(166-168)CTG>TTG	p.L56L	ESRRB_uc001xsr.2_Silent_p.L56L|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	56						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79432626	79432626	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79432626C>T	uc001xun.2	+	9	2026	c.1535C>T	c.(1534-1536)GCC>GTC	p.A512V	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.A637V	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	885	Extracellular (Potential).|Laminin G-like 5.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	26825546	26825546	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26825546G>A	uc001zaz.2	-	6	744	c.602C>T	c.(601-603)ACC>ATC	p.T201I	GABRB3_uc010uae.1_Missense_Mutation_p.T116I|GABRB3_uc001zba.2_Missense_Mutation_p.T201I|GABRB3_uc001zbb.2_Missense_Mutation_p.T257I	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	201	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRA5	2558	broad.mit.edu	37	15	27128557	27128557	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27128557G>A	uc001zbd.1	+	7	689	c.350G>A	c.(349-351)CGC>CAC	p.R117H	GABRB3_uc001zbb.2_Intron	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	117	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)													---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34040340	34040340	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34040340C>T	uc001zhi.2	+	54	8085	c.8015C>T	c.(8014-8016)GCG>GTG	p.A2672V	RYR3_uc010bar.2_Missense_Mutation_p.A2672V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2672	3.|Cytoplasmic (By similarity).|4 X approximate repeats.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
TGM7	116179	broad.mit.edu	37	15	43571432	43571432	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43571432G>C	uc001zrf.1	-	11	1727	c.1722C>G	c.(1720-1722)AAC>AAG	p.N574K		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	574					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)													---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54306723	54306723	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54306723T>G	uc002ack.2	+	1	1623	c.1623T>G	c.(1621-1623)TTT>TTG	p.F541L		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	541					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
NARG2	79664	broad.mit.edu	37	15	60760337	60760337	+	Silent	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60760337A>G	uc002agp.2	-	4	566	c.331T>C	c.(331-333)TTG>CTG	p.L111L	NARG2_uc002ago.2_5'UTR|NARG2_uc010bgk.2_Silent_p.L111L|NARG2_uc002agr.1_Silent_p.L111L	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a	111						nucleus				ovary(1)|lung(1)	2																		---	---	---	---
USP3	9960	broad.mit.edu	37	15	63862762	63862762	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63862762A>G	uc002amf.2	+	9	1021	c.892A>G	c.(892-894)AGT>GGT	p.S298G	USP3_uc010uii.1_RNA|USP3_uc002amg.2_Missense_Mutation_p.S213G|USP3_uc002amh.2_Missense_Mutation_p.S276G|USP3_uc010uij.1_Missense_Mutation_p.S254G|USP3_uc010uik.1_Missense_Mutation_p.S49G|USP3_uc010bgs.2_Missense_Mutation_p.S281G|USP3_uc002ami.2_Missense_Mutation_p.S129G	NM_006537	NP_006528	Q9Y6I4	UBP3_HUMAN	ubiquitin thiolesterase 3	298					DNA repair|histone deubiquitination|mitotic cell cycle|regulation of protein stability|ubiquitin-dependent protein catabolic process	nuclear chromatin	histone binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(80;0.0187)														---	---	---	---
PTPLAD1	51495	broad.mit.edu	37	15	65849105	65849105	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65849105T>G	uc002apc.2	+	4	381	c.233T>G	c.(232-234)GTA>GGA	p.V78G	PTPLAD1_uc002apb.1_RNA|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain	78	CS.|Cytoplasmic (Potential).				activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0																		---	---	---	---
MAP2K1	5604	broad.mit.edu	37	15	66727441	66727441	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66727441T>C	uc010bhq.2	+	2	632	c.157T>C	c.(157-159)TTT>CTT	p.F53L	MAP2K1_uc010ujp.1_Missense_Mutation_p.F31L	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC syndrome).		activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0														Cardiofaciocutaneous_syndrome				---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71341811	71341811	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71341811G>T	uc002asw.2	+	16	2168	c.1921G>T	c.(1921-1923)GAA>TAA	p.E641*	LRRC49_uc002asu.2_Nonsense_Mutation_p.E631*|LRRC49_uc002asx.2_Nonsense_Mutation_p.E597*|LRRC49_uc010ukf.1_Nonsense_Mutation_p.E646*|LRRC49_uc002asy.2_Nonsense_Mutation_p.E347*|LRRC49_uc002asz.2_Nonsense_Mutation_p.E613*	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	641						cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86259099	86259099	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86259099C>T	uc002blv.1	+	20	5850	c.5680C>T	c.(5680-5682)CGA>TGA	p.R1894*	AKAP13_uc002blu.1_Nonsense_Mutation_p.R1898*|AKAP13_uc010bnf.1_Nonsense_Mutation_p.R515*|AKAP13_uc002blw.1_Nonsense_Mutation_p.R361*|AKAP13_uc002blx.1_Nonsense_Mutation_p.R139*	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1894					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
MPG	4350	broad.mit.edu	37	16	133222	133222	+	Missense_Mutation	SNP	G	A	A	rs149812218		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:133222G>A	uc002cfn.2	+	4	805	c.487G>A	c.(487-489)GGC>AGC	p.G163S	MPG_uc002cfm.2_Missense_Mutation_p.G146S|MPG_uc010bqp.2_Missense_Mutation_p.G146S|MPG_uc002cfo.2_Missense_Mutation_p.G158S	NM_002434	NP_002425	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase isoform a	163					depurination|DNA dealkylation involved in DNA repair	nucleoplasm	alkylbase DNA N-glycosylase activity|damaged DNA binding|identical protein binding			ovary(1)|skin(1)	2		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)											BER_DNA_glycosylases					---	---	---	---
ZNF646	9726	broad.mit.edu	37	16	31092496	31092496	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31092496G>A	uc002eap.2	+	2	5140	c.4851G>A	c.(4849-4851)CAG>CAA	p.Q1617Q		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1617					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2																		---	---	---	---
RPGRIP1L	23322	broad.mit.edu	37	16	53679632	53679632	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53679632A>C	uc002ehp.2	-	17	2652	c.2588T>G	c.(2587-2589)TTT>TGT	p.F863C	RPGRIP1L_uc002eho.3_Missense_Mutation_p.F863C|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.F863C|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.F863C|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.F863C	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	863	C2 2.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)																---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72991603	72991603	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72991603G>A	uc002fck.2	-	2	3115	c.2442C>T	c.(2440-2442)AAC>AAT	p.N814N	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	814	C2H2-type 5; atypical.				muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
OR3A1	4994	broad.mit.edu	37	17	3195880	3195880	+	5'Flank	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195880T>G	uc002fvh.1	-							NM_002550	NP_002541			olfactory receptor, family 3, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3																		---	---	---	---
ANKFY1	51479	broad.mit.edu	37	17	4100766	4100766	+	Silent	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4100766T>A	uc002fxq.1	-	8	1043	c.1005A>T	c.(1003-1005)TCA>TCT	p.S335S	ANKFY1_uc002fxn.2_Silent_p.S377S|ANKFY1_uc002fxo.2_Silent_p.S335S|ANKFY1_uc002fxp.2_Silent_p.S334S|ANKFY1_uc010ckp.2_Silent_p.S276S|ANKFY1_uc002fxr.2_Silent_p.S335S	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	335	ANK 4.					endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3																		---	---	---	---
GLP2R	9340	broad.mit.edu	37	17	9792740	9792740	+	Silent	SNP	A	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9792740A>T	uc002gmd.1	+	13	1380	c.1380A>T	c.(1378-1380)TCA>TCT	p.S460S		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	460	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)													---	---	---	---
LRRC48	83450	broad.mit.edu	37	17	17919458	17919458	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17919458A>C	uc010vxd.1	+	14	1786	c.1407A>C	c.(1405-1407)GAA>GAC	p.E469D	LRRC48_uc002gsb.2_Missense_Mutation_p.E469D|ATPAF2_uc002gsd.1_RNA	NM_001130090	NP_001123562	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48 isoform a	469						cytoplasm				pancreas(1)	1	all_neural(463;0.228)																	---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21319733	21319733	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319733A>C	uc002gyv.1	+	3	1784	c.1079A>C	c.(1078-1080)AAG>ACG	p.K360T		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	360	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
SPAG5	10615	broad.mit.edu	37	17	26919402	26919402	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26919402T>A	uc002hbq.2	-	3	952	c.860A>T	c.(859-861)AAG>ATG	p.K287M	SGK494_uc010waq.1_Intron	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	287					cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)																	---	---	---	---
MAPT	4137	broad.mit.edu	37	17	44073836	44073836	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44073836T>G	uc002ijr.3	+	10	1899	c.1579T>G	c.(1579-1581)TCC>GCC	p.S527A	MAPT_uc010dau.2_Missense_Mutation_p.S545A|MAPT_uc002ijs.3_Missense_Mutation_p.S210A|MAPT_uc002ijx.3_Missense_Mutation_p.S181A|MAPT_uc002ijt.3_Missense_Mutation_p.S152A|MAPT_uc002iju.3_Missense_Mutation_p.S152A|MAPT_uc002ijv.3_Missense_Mutation_p.S159A|STH_uc002ijy.2_5'Flank	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	527					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
ABCA6	23460	broad.mit.edu	37	17	67079453	67079453	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67079453C>T	uc002jhw.1	-	35	4550	c.4375G>A	c.(4375-4377)GTT>ATT	p.V1459I		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	1459	ABC transporter 2.				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)																	---	---	---	---
PRCD	768206	broad.mit.edu	37	17	74536596	74536596	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74536596C>G	uc002jrx.2	+	2	187	c.84C>G	c.(82-84)AGC>AGG	p.S28R	CYGB_uc002jru.1_5'Flank|CYGB_uc002jrv.1_Intron|PRCD_uc002jrw.1_5'UTR|PRCD_uc002jry.1_5'UTR	NM_001077620	NP_001071088	Q00LT1	PRCD_HUMAN	progressive rod-cone degeneration	28					response to stimulus|visual perception	cytoplasm|integral to membrane					0																		---	---	---	---
FN3K	64122	broad.mit.edu	37	17	80696509	80696509	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80696509T>C	uc010wvs.1	+	2	347	c.286T>C	c.(286-288)TTG>CTG	p.L96L	FN3K_uc002kfw.1_Silent_p.L51L	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	96					fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)															---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	6965408	6965408	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6965408C>T	uc002knm.2	-	50	7168	c.7074G>A	c.(7072-7074)CTG>CTA	p.L2358L	LAMA1_uc002knl.2_5'UTR|LAMA1_uc010wzj.1_Silent_p.L1834L	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2358	Laminin G-like 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8343469	8343469	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8343469A>C	uc002knn.3	+	21	3469	c.2966A>C	c.(2965-2967)GAA>GCA	p.E989A	PTPRM_uc010dkv.2_Missense_Mutation_p.E1002A|PTPRM_uc010wzl.1_Missense_Mutation_p.E776A	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	989	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34298119	34298119	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34298119C>T	uc002kzt.1	+	15	2379	c.2282C>T	c.(2281-2283)TCC>TTC	p.S761F	FHOD3_uc002kzs.1_Missense_Mutation_p.S778F|FHOD3_uc010dmz.1_Missense_Mutation_p.S493F|FHOD3_uc010dna.1_Missense_Mutation_p.S81F	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	761					actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43523283	43523283	+	Intron	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43523283A>G	uc002lbm.2	-						KIAA1632_uc002lbo.1_Intron	NM_020964	NP_066015			hypothetical protein LOC57724						autophagy						0																		---	---	---	---
KIAA1468	57614	broad.mit.edu	37	18	59922700	59922700	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59922700C>T	uc002lil.2	+	13	2100	c.1885C>T	c.(1885-1887)CCT>TCT	p.P629S	KIAA1468_uc002lik.1_Missense_Mutation_p.P629S|KIAA1468_uc010xel.1_Missense_Mutation_p.P629S|KIAA1468_uc002lim.2_Missense_Mutation_p.P273S	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	629	HEAT 1.						binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)																---	---	---	---
FBXO15	201456	broad.mit.edu	37	18	71797822	71797822	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71797822T>C	uc002lle.2	-	4	512	c.176A>G	c.(175-177)GAG>GGG	p.E59G	FBXO15_uc002llf.2_Missense_Mutation_p.E135G	NM_152676	NP_689889	Q8NCQ5	FBX15_HUMAN	F-box protein 15 isoform 1	59										ovary(2)|pancreas(1)	3		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)														---	---	---	---
C3	718	broad.mit.edu	37	19	6679416	6679416	+	Splice_Site	SNP	A	C	C	rs112584257		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6679416A>C	uc002mfm.2	-	37	4608	c.4546_splice	c.e37+1	p.E1516_splice	C3_uc002mfl.2_Splice_Site_p.E252_splice	NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9019336	9019336	+	Silent	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9019336A>C	uc002mkp.2	-	23	37755	c.37551T>G	c.(37549-37551)CCT>CCG	p.P12517P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12519	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9087701	9087701	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087701T>G	uc002mkp.2	-	1	4318	c.4114A>C	c.(4114-4116)AGT>CGT	p.S1372R		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1372	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ZNF559	84527	broad.mit.edu	37	19	9453688	9453688	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453688T>C	uc002mlg.2	+	7	2208	c.1561T>C	c.(1561-1563)TAT>CAT	p.Y521H	ZNF559_uc002mlf.2_Missense_Mutation_p.Y290H|ZNF559_uc010dwl.1_Missense_Mutation_p.Y290H|ZNF559_uc010xkn.1_Missense_Mutation_p.Y513H|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Missense_Mutation_p.Y585H|ZNF559_uc010dwk.1_Missense_Mutation_p.Y290H|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	521					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
C3P1	388503	broad.mit.edu	37	19	10160705	10160705	+	RNA	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10160705T>C	uc010dwx.1	+	12		c.1611T>C				NR_027300				Synthetic construct DNA, clone: pF1KB7402, Homo sapiens LOC388503 gene, without stop codon, in Flexi system.												0																		---	---	---	---
CCDC151	115948	broad.mit.edu	37	19	11531607	11531607	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11531607T>C	uc002mrs.2	-	13	1827	c.1684A>G	c.(1684-1686)AGT>GGT	p.S562G	CCDC151_uc002mrr.2_Missense_Mutation_p.S497G|CCDC151_uc010dxz.2_Missense_Mutation_p.S502G|RGL3_uc002mrn.2_5'Flank|RGL3_uc002mrm.2_5'Flank|RGL3_uc002mro.2_5'Flank|RGL3_uc002mrp.2_5'Flank|RGL3_uc002mrq.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	562										ovary(1)	1																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17756839	17756839	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17756839T>C	uc002nhd.2	-	18	2390	c.2390A>G	c.(2389-2391)AAG>AGG	p.K797R		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	709	C2 2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
CRTC1	23373	broad.mit.edu	37	19	18871043	18871043	+	Intron	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18871043G>T	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron|CRTC1_uc010ebw.2_Intron|CRTC1_uc002nkc.3_Intron	NM_015321	NP_056136			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519																		---	---	---	---
ETV2	2116	broad.mit.edu	37	19	36133415	36133415	+	Missense_Mutation	SNP	A	C	C	rs146305038		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36133415A>C	uc002oas.2	+	2	492	c.53A>C	c.(52-54)AAC>ACC	p.N18T	ETV2_uc002oar.2_Missense_Mutation_p.N18T|ETV2_uc002oat.2_Intron|ETV2_uc002oau.2_Missense_Mutation_p.N18T	NM_014209	NP_055024	O00321	ETV2_HUMAN	ets variant gene 2	18							sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
SFRS16	11129	broad.mit.edu	37	19	45572331	45572331	+	Silent	SNP	G	A	A	rs141999176		TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45572331G>A	uc002pak.2	+	17	1874	c.1776G>A	c.(1774-1776)GCG>GCA	p.A592A	SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Silent_p.A530A|SFRS16_uc002pam.2_Silent_p.A573A	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16	592	Potential.|Arg-rich.				mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)														---	---	---	---
IGFL4	444882	broad.mit.edu	37	19	46543559	46543559	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46543559G>A	uc002pdy.1	-	3	240	c.186C>T	c.(184-186)TGC>TGT	p.C62C		NM_001002923	NP_001002923	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4 precursor	62						extracellular region					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)														---	---	---	---
NLRP4	147945	broad.mit.edu	37	19	56373485	56373485	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56373485G>A	uc002qmd.3	+	5	2568	c.2146G>A	c.(2146-2148)GAT>AAT	p.D716N	NLRP4_uc002qmf.2_Missense_Mutation_p.D641N|NLRP4_uc010etf.2_Missense_Mutation_p.D547N	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	716	LRR 2.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)														---	---	---	---
FASTKD5	60493	broad.mit.edu	37	20	3128424	3128424	+	Silent	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3128424G>A	uc002whz.2	-	2	1604	c.1293C>T	c.(1291-1293)GCC>GCT	p.A431A	uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	NM_021826	NP_068598	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	431					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity				0																		---	---	---	---
ASXL1	171023	broad.mit.edu	37	20	31021249	31021249	+	Silent	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31021249C>T	uc002wxs.2	+	11	1674	c.1248C>T	c.(1246-1248)CTC>CTT	p.L416L	ASXL1_uc010geb.2_Silent_p.L307L	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1 isoform 1	416					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(239)|large_intestine(6)|central_nervous_system(2)|ovary(1)	248								F|N|Mis		MDS|CMML								---	---	---	---
NFS1	9054	broad.mit.edu	37	20	34257610	34257610	+	Intron	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34257610G>A	uc002xdw.1	-						CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron	NM_021100	NP_066923			NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)													---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46252787	46252787	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46252787A>C	uc002xtk.2	+	4	421	c.216A>C	c.(214-216)TTA>TTC	p.L72F	NCOA3_uc010ght.1_Missense_Mutation_p.L72F|NCOA3_uc002xtl.2_Missense_Mutation_p.L72F|NCOA3_uc002xtm.2_Missense_Mutation_p.L72F|NCOA3_uc002xtn.2_Missense_Mutation_p.L72F|NCOA3_uc010zyc.1_5'Flank	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	72	Helix-loop-helix motif.				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
AURKA	6790	broad.mit.edu	37	20	54958081	54958081	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54958081G>A	uc002xxd.1	-	7	1092	c.526C>T	c.(526-528)CAT>TAT	p.H176Y	AURKA_uc002xxe.1_Missense_Mutation_p.H176Y|AURKA_uc002xxf.1_Missense_Mutation_p.H176Y|AURKA_uc002xxg.1_Missense_Mutation_p.H176Y|AURKA_uc002xxh.1_Missense_Mutation_p.H176Y|AURKA_uc002xxi.1_Missense_Mutation_p.H176Y|AURKA_uc002xxj.1_Missense_Mutation_p.H176Y|AURKA_uc002xxk.1_Missense_Mutation_p.H176Y|AURKA_uc010zzd.1_RNA	NM_198433	NP_940835	O14965	AURKA_HUMAN	serine/threonine protein kinase 6	176	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)															---	---	---	---
TH1L	51497	broad.mit.edu	37	20	57564645	57564645	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57564645A>C	uc002yag.2	+	6	661	c.634A>C	c.(634-636)ATT>CTT	p.I212L	TH1L_uc010zzu.1_Missense_Mutation_p.I212L|TH1L_uc002yaf.1_RNA|TH1L_uc002yah.2_Missense_Mutation_p.I212L	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein	212					negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)															---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58443608	58443608	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58443608A>C	uc002yaz.2	-	37	3987	c.3848T>G	c.(3847-3849)CTT>CGT	p.L1283R		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1283					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41505891	41505891	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41505891T>C	uc002yyq.1	-	19	3904	c.3452A>G	c.(3451-3453)GAG>GGG	p.E1151G	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1151	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
LSS	4047	broad.mit.edu	37	21	47614547	47614547	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47614547A>G	uc002zij.2	-	20	1925	c.1846T>C	c.(1846-1848)TGT>CGT	p.C616R	LSS_uc011afv.1_Missense_Mutation_p.C605R|LSS_uc002zil.2_Missense_Mutation_p.C616R|LSS_uc002zik.2_Missense_Mutation_p.C536R	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	616	PFTB 4.				cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)																	---	---	---	---
LSS	4047	broad.mit.edu	37	21	47626638	47626638	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47626638C>G	uc002zij.2	-	16	1591	c.1512G>C	c.(1510-1512)GAG>GAC	p.E504D	LSS_uc011afv.1_Missense_Mutation_p.E493D|LSS_uc002zil.2_Missense_Mutation_p.E504D|LSS_uc002zik.2_Missense_Mutation_p.E424D	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	504	PFTB 2.				cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)																	---	---	---	---
TUBA8	51807	broad.mit.edu	37	22	18609282	18609282	+	Silent	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18609282T>G	uc002znv.1	+	4	610	c.537T>G	c.(535-537)ACT>ACG	p.T179T	TUBA8_uc002znr.2_Silent_p.T113T|TUBA8_uc002znw.1_Silent_p.T203T|TUBA8_uc002znx.1_Silent_p.T26T	NM_018943	NP_061816	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	179					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0																		---	---	---	---
SEPT5	5413	broad.mit.edu	37	22	19709755	19709755	+	Intron	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19709755C>T	uc002zpv.1	+						SEPT5_uc002zpw.1_Intron|SEPT5_uc002zpx.1_Intron|SEPT5_uc002zpy.1_5'UTR|SEPT5_uc002zpz.1_5'Flank	NM_002688	NP_002679			septin 5						cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)																	---	---	---	---
CCDC116	164592	broad.mit.edu	37	22	21988657	21988657	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21988657C>T	uc002zve.2	+	3	512	c.419C>T	c.(418-420)CCG>CTG	p.P140L	CCDC116_uc011aih.1_Missense_Mutation_p.P140L	NM_152612	NP_689825	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	140										ovary(1)|skin(1)	2	Colorectal(54;0.105)																	---	---	---	---
FAM9B	171483	broad.mit.edu	37	X	8998317	8998317	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8998317T>G	uc011mhu.1	-	4	355	c.266A>C	c.(265-267)AAA>ACA	p.K89T	FAM9B_uc011mhv.1_RNA|FAM9B_uc004csh.2_Intron	NM_205849	NP_995321	Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	89						nucleus					0		Hepatocellular(5;0.219)																---	---	---	---
CNKSR2	22866	broad.mit.edu	37	X	21581361	21581361	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21581361T>C	uc004czx.1	+	13	1435	c.1399T>C	c.(1399-1401)TCT>CCT	p.S467P	CNKSR2_uc004czw.2_Missense_Mutation_p.S467P|CNKSR2_uc011mjn.1_Missense_Mutation_p.S418P|CNKSR2_uc011mjo.1_Missense_Mutation_p.S437P|CNKSR2_uc004czy.2_Missense_Mutation_p.S59P	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	467	DUF1170.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2																		---	---	---	---
TSIX	9383	broad.mit.edu	37	X	73046140	73046140	+	RNA	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73046140A>C	uc004ebn.2	+	1		c.34101A>C			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0																		---	---	---	---
SERPINA7	6906	broad.mit.edu	37	X	105280956	105280956	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105280956A>C	uc004eme.1	-	1	110	c.94T>G	c.(94-96)TCA>GCA	p.S32A	SERPINA7_uc010npd.2_Missense_Mutation_p.S32A|SERPINA7_uc010npe.1_Missense_Mutation_p.S32A	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	32					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)													---	---	---	---
ACTRT1	139741	broad.mit.edu	37	X	127185508	127185508	+	Silent	SNP	T	C	C			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185508T>C	uc004eum.2	-	1	875	c.678A>G	c.(676-678)CCA>CCG	p.P226P		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	226						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5																		---	---	---	---
GABRE	2564	broad.mit.edu	37	X	151138838	151138838	+	Silent	SNP	G	T	T			TCGA-BR-4376-01	TCGA-BR-4376-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151138838G>T	uc004ffi.2	-	2	147	c.93C>A	c.(91-93)GCC>GCA	p.A31A	GABRE_uc011myd.1_RNA|GABRE_uc011mye.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	31	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
