Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	13123163	13123163	+	IGR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13123163delA								PRAMEF5 (5412 upstream) : LOC440563 (59798 downstream)																																			---	---	---	---
PLEKHH2	130271	broad.mit.edu	37	2	43934335	43934336	+	Intron	INS	-	AAAA	AAAA	rs67550912		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43934335_43934336insAAAA	uc010yny.1	+						PLEKHH2_uc002rte.3_Intron|PLEKHH2_uc002rtf.3_Intron	NM_172069	NP_742066			pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	90108680	90108680	+	Intron	DEL	T	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90108680delT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	96548119	96548119	+	RNA	DEL	T	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96548119delT	uc002sva.1	-	37		c.1802delA			uc002suz.1_Frame_Shift_Del_p.I127fs|uc002svb.1_Frame_Shift_Del_p.I127fs					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100916481	100916482	+	Intron	INS	-	GG	GG	rs139033934	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100916481_100916482insGG	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
TANC1	85461	broad.mit.edu	37	2	159992561	159992566	+	Intron	DEL	GCGCGC	-	-	rs35231270		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992561_159992566delGCGCGC	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
HSPD1	3329	broad.mit.edu	37	2	198360214	198360214	+	Intron	DEL	T	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198360214delT	uc002uui.2	-						HSPD1_uc002uuj.2_Intron|HSPD1_uc010zgx.1_Intron|HSPD1_uc010fsm.2_5'UTR|HSPD1_uc002uuk.2_Intron	NM_002156	NP_002147			chaperonin						'de novo' protein folding|activation of caspase activity|B cell cytokine production|B cell proliferation|chaperone-mediated protein complex assembly|interspecies interaction between organisms|isotype switching to IgG isotypes|MyD88-dependent toll-like receptor signaling pathway|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of interferon-alpha production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of macrophage activation|positive regulation of T cell activation|positive regulation of T cell mediated immune response to tumor cell|protein maturation|protein refolding|protein stabilization|response to unfolded protein|T cell activation	cell surface|coated pit|coated vesicle|cytosol|early endosome|extracellular space|lipopolysaccharide receptor complex|mitochondrial inner membrane|mitochondrial matrix|stored secretory granule	ATP binding|ATPase activity|cell surface binding|chaperone binding|DNA replication origin binding|lipopolysaccharide binding|p53 binding|single-stranded DNA binding				0			Epithelial(96;0.225)															---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89457111	89457114	+	Intron	DEL	TTGT	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89457111_89457114delTTGT	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
TMPRSS11F	389208	broad.mit.edu	37	4	68929077	68929077	+	Intron	DEL	T	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68929077delT	uc003hdt.1	-						LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron|SYT14L_uc010ihn.2_5'Flank	NM_207407	NP_997290			transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
MANBA	4126	broad.mit.edu	37	4	103649712	103649712	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103649712delA	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899			mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)														---	---	---	---
METTL14	57721	broad.mit.edu	37	4	119613381	119613382	+	Intron	INS	-	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119613381_119613382insT	uc003icf.2	+						METTL14_uc003icg.2_Intron	NM_020961	NP_066012			methyltransferase like 14							nucleus	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity				0																		---	---	---	---
TBC1D9	23158	broad.mit.edu	37	4	141600640	141600641	+	Intron	INS	-	A	A	rs144405227	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141600640_141600641insA	uc010ioj.2	-							NM_015130	NP_055945			TBC1 domain family, member 9 (with GRAM domain)							intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)																---	---	---	---
SPINK5	11005	broad.mit.edu	37	5	147493803	147493804	+	Intron	INS	-	A	A	rs142874955		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147493803_147493804insA	uc003lox.2	+						SPINK5_uc010jgs.1_Intron|SPINK5_uc010jgr.2_Intron|SPINK5_uc003low.2_Intron|SPINK5_uc003loy.2_Intron	NM_006846	NP_006837			serine peptidase inhibitor, Kazal type 5 isoform						anagen|epithelial cell differentiation|extracellular matrix organization|hair cell differentiation|negative regulation of angiogenesis|negative regulation of immune response|regulation of T cell differentiation	cell cortex|cytosol|endoplasmic reticulum membrane|extracellular region|lamellar body|perinuclear region of cytoplasm	serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)|breast(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
KIF13A	63971	broad.mit.edu	37	6	17773893	17773894	+	Intron	INS	-	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17773893_17773894insT	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003nce.1_Intron	NM_022113	NP_071396			kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---
ZNF107	51427	broad.mit.edu	37	7	64169562	64169562	+	3'UTR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64169562delA	uc003ttd.2	+	7					ZNF107_uc003tte.2_3'UTR	NM_016220	NP_057304			zinc finger protein 107						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)																---	---	---	---
HR	55806	broad.mit.edu	37	8	21977129	21977130	+	Intron	INS	-	A	A	rs74995556		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21977129_21977130insA	uc003xas.2	-						HR_uc003xat.2_Intron	NM_005144	NP_005135			hairless protein isoform a								DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)														---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104922219	104922220	+	Intron	DEL	TA	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922219_104922220delTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
AGAP5	729092	broad.mit.edu	37	10	75486922	75486923	+	Intron	INS	-	A	A	rs11387949		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75486922_75486923insA	uc001juu.3	-						BMS1P4_uc001juv.3_Intron|BMS1P4_uc010qkm.1_Intron	NM_001144000	NP_001137472			ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0																		---	---	---	---
VAX1	11023	broad.mit.edu	37	10	118897608	118897608	+	5'UTR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897608delA	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175			ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3789651	3789651	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3789651delA	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_Intron|NUP98_uc001lyk.1_Intron	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
CTNND1	1500	broad.mit.edu	37	11	57486126	57486126	+	Intron	DEL	T	-	-	rs35097323		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57486126delT	uc001nlf.1	+						TMX2_uc001nlc.1_Intron|TMX2_uc001nld.1_Intron|TMX2_uc001nle.1_Intron	NM_001085462	NP_001078931			catenin, delta 1 isoform 1A						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)																---	---	---	---
POLA2	23649	broad.mit.edu	37	11	65064420	65064420	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65064420delA	uc001odj.2	+						POLA2_uc001odk.2_Intron	NM_002689	NP_002680			DNA-directed DNA polymerase alpha 2						DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)													---	---	---	---
KDM2A	22992	broad.mit.edu	37	11	66983146	66983146	+	Intron	DEL	A	-	-	rs113780245	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66983146delA	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Intron	NM_012308	NP_036440			F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
TPCN2	219931	broad.mit.edu	37	11	68851279	68851280	+	Intron	DEL	GT	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68851279_68851280delGT	uc001oos.2	+						TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_Intron	NM_139075	NP_620714			two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
SLCO1A2	6579	broad.mit.edu	37	12	21531006	21531006	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21531006delA	uc001res.2	-						SLCO1A2_uc010siq.1_Intron|IAPP_uc001rev.2_Intron	NM_134431	NP_602307			organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
FMNL3	91010	broad.mit.edu	37	12	50045327	50045327	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50045327delA	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron|FMNL3_uc001rut.1_Intron|FMNL3_uc001ruu.1_Intron	NM_175736	NP_783863			formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4																		---	---	---	---
VPS33A	65082	broad.mit.edu	37	12	122716609	122716609	+	3'UTR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122716609delA	uc001ucd.2	-	13					VPS33A_uc001ucc.2_Intron	NM_022916	NP_075067			vacuolar protein sorting 33A						lysosome localization|melanosome localization|platelet formation|protein transport|regulation of developmental pigmentation|vesicle docking involved in exocytosis	early endosome|late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			skin(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)														---	---	---	---
AQR	9716	broad.mit.edu	37	15	35174666	35174667	+	Intron	INS	-	A	A	rs34949352		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35174666_35174667insA	uc001ziv.2	-							NM_014691	NP_055506			aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---
UBR1	197131	broad.mit.edu	37	15	43280844	43280845	+	Intron	INS	-	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43280844_43280845insA	uc001zqq.2	-							NM_174916	NP_777576			ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)														---	---	---	---
PRTG	283659	broad.mit.edu	37	15	55919118	55919146	+	Intron	DEL	CTAAAAGGCACTTGACTTTCATTTGTTTC	-	-	rs12591646	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55919118_55919146delCTAAAAGGCACTTGACTTTCATTTGTTTC	uc002adg.2	-							NM_173814	NP_776175			protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	62563040	62563040	+	IGR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62563040delA								C2CD4B (105558 upstream) : MGC15885 (366331 downstream)																																			---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81611436	81611436	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81611436delA	uc002bgm.2	-						STARD5_uc002bgn.2_Intron	NM_181900	NP_871629			StAR-related lipid transfer protein 5						C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
CLEC18C	283971	broad.mit.edu	37	16	70066043	70066043	+	Intron	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70066043delA	uc002exy.2	+						PDXDC2_uc002eyb.2_Intron|PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425			secretory protein LOC348174 precursor							extracellular region	sugar binding				0																		---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76482605	76482606	+	Intron	INS	-	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482605_76482606insT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
C17orf80	55028	broad.mit.edu	37	17	71238649	71238650	+	Intron	INS	-	C	C	rs138492113	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71238649_71238650insC	uc002jjm.3	+						C17orf80_uc010wqu.1_Intron|C17orf80_uc010dfj.2_Intron|C17orf80_uc002jjk.1_Intron|C17orf80_uc002jjl.3_Intron	NM_017941	NP_060411			lung cancer-related protein 8 isoform a							integral to membrane				skin(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)															---	---	---	---
TSEN54	283989	broad.mit.edu	37	17	73513183	73513191	+	Intron	DEL	GCCCTCCCT	-	-	rs113075319		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73513183_73513191delGCCCTCCCT	uc002jof.1	+						CASKIN2_uc002joc.2_5'Flank|CASKIN2_uc002jod.2_5'Flank|TSEN54_uc002joe.1_Intron	NM_207346	NP_997229			tRNA splicing endonuclease 54 homolog						mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
SAP30BP	29115	broad.mit.edu	37	17	73698388	73698395	+	Intron	DEL	GCCACCGT	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73698388_73698395delGCCACCGT	uc002jpe.2	+						SAP30BP_uc002jpc.1_Intron|SAP30BP_uc010wsf.1_Intron|SAP30BP_uc010wsg.1_Intron|SAP30BP_uc002jpf.2_Intron	NM_013260	NP_037392			transcriptional regulator protein						apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
IER3IP1	51124	broad.mit.edu	37	18	44682386	44682386	+	3'UTR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44682386delA	uc002lcu.2	-	3						NM_016097	NP_057181			immediate early response 3 interacting protein							endoplasmic reticulum membrane|Golgi apparatus|integral to membrane					0																		---	---	---	---
ZNF791	163049	broad.mit.edu	37	19	12734687	12734688	+	Intron	INS	-	GGA	GGA	rs139467837	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12734687_12734688insGGA	uc002mua.2	+						ZNF791_uc010xml.1_Intron|ZNF791_uc010dyu.1_Intron|ZNF791_uc010xmm.1_Intron	NM_153358	NP_699189			zinc finger protein 791						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---
PSMA7	5688	broad.mit.edu	37	20	60715677	60715678	+	Intron	INS	-	TC	TC	rs3078900		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60715677_60715678insTC	uc002ybx.1	-						PSMA7_uc002yby.1_Intron	NM_002792	NP_002783			proteasome alpha 7 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity				0	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)															---	---	---	---
GYG2	8908	broad.mit.edu	37	X	2774790	2774793	+	Intron	DEL	TATG	-	-	rs151089910		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774790_2774793delTATG	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909			glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
CNKSR2	22866	broad.mit.edu	37	X	21627677	21627678	+	In_Frame_Ins	INS	-	GAG	GAG			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21627677_21627678insGAG	uc004czx.1	+	20	2670_2671	c.2634_2635insGAG	c.(2632-2637)insGAG	p.886_887insE	CNKSR2_uc004czw.2_In_Frame_Ins_p.886_887insE|CNKSR2_uc011mjn.1_In_Frame_Ins_p.837_838insE|CNKSR2_uc011mjo.1_In_Frame_Ins_p.856_857insE|CNKSR2_uc004czy.2_In_Frame_Ins_p.478_479insE	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	886_887	Potential.|Poly-Glu.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2																		---	---	---	---
USP11	8237	broad.mit.edu	37	X	47107351	47107351	+	3'UTR	DEL	A	-	-			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47107351delA	uc004dhp.2	+	21					USP11_uc004dhq.2_3'UTR	NM_004651	NP_004642			ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
NCRNA00182	100302692	broad.mit.edu	37	X	73407056	73407057	+	Intron	INS	-	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73407056_73407057insA	uc010nlq.1	-											Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0																		---	---	---	---
VWA1	64856	broad.mit.edu	37	1	1372328	1372328	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1372328G>A	uc001afs.2	+	2	315	c.95G>A	c.(94-96)CGA>CAA	p.R32Q	VWA1_uc001afr.2_Intron	NM_022834	NP_073745	Q6PCB0	VWA1_HUMAN	von Willebrand factor A domain containing 1	32						basement membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27107162	27107162	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27107162T>G	uc001bmv.1	+	20	7146	c.6773T>G	c.(6772-6774)CTG>CGG	p.L2258R	ARID1A_uc001bmu.1_Missense_Mutation_p.L2041R|ARID1A_uc001bmx.1_Missense_Mutation_p.L1104R|ARID1A_uc009vsm.1_Missense_Mutation_p.L586R|ARID1A_uc009vsn.1_Missense_Mutation_p.L500R	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2258					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
YRDC	79693	broad.mit.edu	37	1	38272879	38272879	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38272879C>A	uc001cca.1	-	2	411	c.398G>T	c.(397-399)CGT>CTT	p.R133L	C1orf122_uc001ccb.1_5'UTR	NM_024640	NP_078916	Q86U90	YRDC_HUMAN	ischemia/reperfusion inducible protein	133	YrdC-like.				negative regulation of transport	membrane|mitochondrion					0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
PTGER3	5733	broad.mit.edu	37	1	71478123	71478123	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71478123G>A	uc001dfg.1	-	2	1173	c.942C>T	c.(940-942)CAC>CAT	p.H314H	PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Silent_p.H314H|PTGER3_uc001dfl.1_Silent_p.H314H|PTGER3_uc009wbm.1_Silent_p.H314H|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Silent_p.H314H|PTGER3_uc009wbn.1_Silent_p.H314H|PTGER3_uc009wbo.2_Silent_p.H314H|PTGER3_uc001dfo.2_Silent_p.H314H|PTGER3_uc001dfp.1_Silent_p.H314H|PTGER3_uc001dfq.2_Silent_p.H314H	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	314	Extracellular (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)													---	---	---	---
EPHX4	253152	broad.mit.edu	37	1	92508453	92508453	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92508453G>T	uc001don.2	+	3	495	c.391G>T	c.(391-393)GGA>TGA	p.G131*		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	131						integral to membrane	hydrolase activity			central_nervous_system(1)	1																		---	---	---	---
NRAS	4893	broad.mit.edu	37	1	115258748	115258748	+	Missense_Mutation	SNP	C	A	A	rs121913250		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115258748C>A	uc009wgu.2	-	2	288	c.34G>T	c.(34-36)GGT>TGT	p.G12C		NM_002524	NP_002515	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12	GTP.		G -> C (in leukemia).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	Golgi membrane|plasma membrane	GTP binding|GTPase activity	p.G12D(333)|p.G12S(118)|p.G12C(71)|p.G12V(54)|p.G12A(36)|p.G12R(16)|p.G12G(4)|p.G12N(1)|p.G12T(1)|p.G12P(1)|p.G12Y(1)		haematopoietic_and_lymphoid_tissue(1008)|skin(956)|thyroid(334)|large_intestine(62)|NS(60)|soft_tissue(32)|lung(31)|upper_aerodigestive_tract(25)|urinary_tract(12)|liver(10)|adrenal_gland(9)|autonomic_ganglia(8)|testis(8)|central_nervous_system(8)|prostate(8)|breast(7)|biliary_tract(6)|ovary(6)|stomach(5)|pancreas(5)|endometrium(2)|kidney(2)|cervix(2)|eye(1)	2607	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		G12C(P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		melanoma|MM|AML|thyroid				Noonan_syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)			---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144916601	144916601	+	Missense_Mutation	SNP	G	A	A	rs146793096	by1000genomes	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144916601G>A	uc001elw.3	-	13	2045	c.1754C>T	c.(1753-1755)ACG>ATG	p.T585M	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.T651M|PDE4DIP_uc001emc.1_Missense_Mutation_p.T585M|PDE4DIP_uc001emd.1_Missense_Mutation_p.T585M|PDE4DIP_uc001emb.1_Missense_Mutation_p.T748M|PDE4DIP_uc001eme.1_Missense_Mutation_p.T114M|PDE4DIP_uc001emf.1_Missense_Mutation_p.T372M	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	585	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
POGZ	23126	broad.mit.edu	37	1	151396574	151396574	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151396574G>A	uc001eyd.1	-	9	1680	c.1374C>T	c.(1372-1374)GGC>GGT	p.G458G	POGZ_uc001eye.1_Silent_p.G405G|POGZ_uc010pdb.1_Silent_p.G449G|POGZ_uc001eyf.1_Silent_p.G405G|POGZ_uc010pdc.1_Silent_p.G396G|POGZ_uc009wmv.1_Silent_p.G363G|POGZ_uc010pdd.1_Intron	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	458					cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding			ovary(3)	3	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152080964	152080964	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152080964G>A	uc001ezp.2	-	2	4729	c.4729C>T	c.(4729-4731)CGT>TGT	p.R1577C	TCHH_uc009wne.1_Missense_Mutation_p.R1577C	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1577	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
RAG1AP1	55974	broad.mit.edu	37	1	155109433	155109433	+	Intron	SNP	G	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155109433G>C	uc001fhj.3	+						RAG1AP1_uc010pey.1_Intron|RAG1AP1_uc001fhk.3_Intron|RAG1AP1_uc001fhl.3_Intron	NM_018845	NP_061333			recombination activating gene 1 activating						positive regulation of gene expression, epigenetic	Golgi membrane|integral to membrane|plasma membrane	glucoside transmembrane transporter activity				0	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
ADORA1	134	broad.mit.edu	37	1	203134919	203134919	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203134919G>A	uc001gze.1	+	4	1305	c.872G>A	c.(871-873)CGC>CAC	p.R291H	FMOD_uc010pqi.1_Intron|ADORA1_uc001gzf.1_Missense_Mutation_p.R291H|ADORA1_uc010pqg.1_Missense_Mutation_p.R223H|ADORA1_uc009xak.1_Silent_p.P216P|ADORA1_uc010pqh.1_Missense_Mutation_p.R324H	NM_000674	NP_000665	P30542	AA1R_HUMAN	adenosine A1 receptor	291	Helical; Name=7; (Potential).				induction of apoptosis by extracellular signals|inflammatory response|nervous system development|phagocytosis	integral to plasma membrane				large_intestine(1)	1					Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Gabapentin(DB00996)|Imipramine(DB00458)|Pegademase bovine(DB00061)|Theophylline(DB00277)													---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228524806	228524806	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228524806G>A	uc009xez.1	+	65	16683	c.16639G>A	c.(16639-16641)GTA>ATA	p.V5547I	OBSCN_uc001hsn.2_Missense_Mutation_p.V5547I|OBSCN_uc001hsr.1_Missense_Mutation_p.V175I	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5547					apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237801713	237801713	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237801713G>A	uc001hyl.1	+	45	6969	c.6849G>A	c.(6847-6849)AAG>AAA	p.K2283K		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2283	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1653281	1653281	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1653281G>A	uc002qxa.2	-	17	2335	c.2271C>T	c.(2269-2271)GGC>GGT	p.G757G		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	757					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11750964	11750964	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11750964G>A	uc002rbk.1	+	18	3117	c.2817G>A	c.(2815-2817)CCG>CCA	p.P939P	GREB1_uc002rbo.1_Silent_p.P573P|GREB1_uc002rbp.1_5'Flank	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	939						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
ACTG2	72	broad.mit.edu	37	2	74143812	74143812	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74143812G>A	uc002sjw.2	+	8	1029	c.907G>A	c.(907-909)GGC>AGC	p.G303S	ACTG2_uc010fey.2_Missense_Mutation_p.G303S|ACTG2_uc010yrn.1_Missense_Mutation_p.G260S	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	303					muscle contraction	cytoskeleton|cytosol	ATP binding				0																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79878715	79878715	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79878715A>T	uc010ysh.1	+	1	38	c.33A>T	c.(31-33)AAA>AAT	p.K11N	CTNNA2_uc010yse.1_Missense_Mutation_p.K11N|CTNNA2_uc010ysf.1_Missense_Mutation_p.K11N|CTNNA2_uc010ysg.1_Missense_Mutation_p.K11N|hsa-mir-4264|MI0015877_5'Flank	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	11					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
PSD4	23550	broad.mit.edu	37	2	113940394	113940394	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113940394G>T	uc002tjc.2	+	2	544	c.361G>T	c.(361-363)GCC>TCC	p.A121S	PSD4_uc002tjd.2_5'UTR|PSD4_uc002tje.2_Missense_Mutation_p.A120S|PSD4_uc002tjf.2_5'Flank	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	121					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141055366	141055366	+	Intron	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055366C>T	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
WDSUB1	151525	broad.mit.edu	37	2	160132102	160132102	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160132102C>A	uc002uaj.3	-	4	780	c.631G>T	c.(631-633)GAT>TAT	p.D211Y	WDSUB1_uc002uak.3_Missense_Mutation_p.D211Y|WDSUB1_uc002ual.3_Missense_Mutation_p.D211Y|WDSUB1_uc002uam.3_Missense_Mutation_p.D211Y|WDSUB1_uc010foo.2_Missense_Mutation_p.D211Y	NM_152528	NP_689741	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain	211	WD 5.					ubiquitin ligase complex	ubiquitin-protein ligase activity				0																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171371472	171371472	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171371472G>A	uc002ufy.2	+	29	3555	c.3412G>A	c.(3412-3414)GCA>ACA	p.A1138T	MYO3B_uc002ufv.2_Missense_Mutation_p.A1125T|MYO3B_uc010fqb.1_Missense_Mutation_p.A1125T|MYO3B_uc002ufz.2_Missense_Mutation_p.A1111T|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	1138					response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179454415	179454415	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179454415A>T	uc010zfg.1	-	253	54557	c.54333T>A	c.(54331-54333)GAT>GAA	p.D18111E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D11806E|TTN_uc010zfi.1_Missense_Mutation_p.D11739E|TTN_uc010zfj.1_Missense_Mutation_p.D11614E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19038							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ZDBF2	57683	broad.mit.edu	37	2	207172945	207172945	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207172945G>A	uc002vbp.2	+	5	3943	c.3693G>A	c.(3691-3693)ACG>ACA	p.T1231T		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1231							nucleic acid binding|zinc ion binding			ovary(3)	3																		---	---	---	---
C2orf57	165100	broad.mit.edu	37	2	232458738	232458738	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232458738G>A	uc002vrz.2	+	1	1127	c.1076G>A	c.(1075-1077)CGT>CAT	p.R359H		NM_152614	NP_689827	Q53QW1	CB057_HUMAN	hypothetical protein LOC165100	359										ovary(1)	1		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)														---	---	---	---
GPR35	2859	broad.mit.edu	37	2	241569891	241569891	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241569891G>A	uc002vzs.1	+	1	1097	c.522G>A	c.(520-522)GCG>GCA	p.A174A	GPR35_uc010fzh.1_Silent_p.A205A|GPR35_uc010fzi.1_Silent_p.A205A	NM_005301	NP_005292	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	174	Extracellular (Potential).			A -> R (in Ref. 1; AAC52028).		integral to plasma membrane	G-protein coupled receptor activity			skin(2)|pancreas(1)	3		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)														---	---	---	---
GOLGA4	2803	broad.mit.edu	37	3	37365781	37365781	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37365781G>A	uc003cgv.2	+	14	2708	c.2404G>A	c.(2404-2406)GTT>ATT	p.V802I	GOLGA4_uc010hgr.1_Missense_Mutation_p.V363I|GOLGA4_uc003cgw.2_Missense_Mutation_p.V824I|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.V683I	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	802	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4																		---	---	---	---
SLC38A3	10991	broad.mit.edu	37	3	50254855	50254855	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50254855G>A	uc003cyn.3	+	9	781	c.640G>A	c.(640-642)GGC>AGC	p.G214S	SLC38A3_uc011bdl.1_Missense_Mutation_p.G189S|SLC38A3_uc011bdm.1_Missense_Mutation_p.G145S	NM_006841	NP_006832	Q99624	S38A3_HUMAN	solute carrier family 38, member 3	214	Helical; (Potential).				cellular nitrogen compound metabolic process|sodium ion transport	integral to plasma membrane	antiporter activity|L-alanine transmembrane transporter activity|L-asparagine transmembrane transporter activity|L-glutamine transmembrane transporter activity|L-histidine transmembrane transporter activity|symporter activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)	L-Asparagine(DB00174)|L-Glutamine(DB00130)|L-Histidine(DB00117)													---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52380535	52380535	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52380535C>T	uc011bef.1	+	11	1965	c.1704C>T	c.(1702-1704)GCC>GCT	p.A568A	DNAH1_uc003ddt.1_Silent_p.A568A	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	568	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52417495	52417495	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52417495G>A	uc011bef.1	+	51	8296	c.8035G>A	c.(8035-8037)GTC>ATC	p.V2679I	DNAH1_uc003ddv.2_5'Flank	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2679	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
DNAH1	25981	broad.mit.edu	37	3	52426895	52426895	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52426895G>A	uc011bef.1	+	65	10589	c.10328G>A	c.(10327-10329)CGC>CAC	p.R3443H	DNAH1_uc003ddv.2_Missense_Mutation_p.R301H	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3508					ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---
ITIH3	3699	broad.mit.edu	37	3	52841937	52841937	+	Intron	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52841937G>A	uc003dfv.2	+						ITIH3_uc011bek.1_Intron	NM_002217	NP_002208			inter-alpha (globulin) inhibitor H3						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
BOC	91653	broad.mit.edu	37	3	113003420	113003420	+	Intron	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113003420G>A	uc003dzx.2	+						BOC_uc003dzy.2_Intron|BOC_uc003dzz.2_Intron|BOC_uc003eab.2_Intron|BOC_uc003eac.2_Intron	NM_033254	NP_150279			brother of CDO precursor						cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	129140548	129140548	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129140548A>T	uc003emg.2	-	2	311	c.148T>A	c.(148-150)TTC>ATC	p.F50I		NM_207307	NP_997190			hypothetical protein LOC90288																														---	---	---	---
COL29A1	256076	broad.mit.edu	37	3	130162345	130162345	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130162345G>A	uc010htj.1	+	36	7007	c.6513G>A	c.(6511-6513)CCG>CCA	p.P2171P	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Silent_p.P210P	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2171	Nonhelical region.				axon guidance|cell adhesion	collagen					0																		---	---	---	---
NCK1	4690	broad.mit.edu	37	3	136664893	136664893	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136664893G>A	uc003erh.2	+	3	802	c.695G>A	c.(694-696)TGC>TAC	p.C232Y	NCK1_uc011bme.1_Missense_Mutation_p.C168Y	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1	232	SH3 3.				axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1																		---	---	---	---
ZBTB38	253461	broad.mit.edu	37	3	141164795	141164795	+	Missense_Mutation	SNP	G	A	A	rs76129297		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141164795G>A	uc003etw.2	+	8	4547	c.3565G>A	c.(3565-3567)GGT>AGT	p.G1189S	ZBTB38_uc010hun.2_Missense_Mutation_p.G1186S|ZBTB38_uc010huo.2_Missense_Mutation_p.G1189S|ZBTB38_uc003ety.2_Missense_Mutation_p.G1189S|ZBTB38_uc010hup.2_Missense_Mutation_p.G1190S	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	1189					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	C	C	rs121913272		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178927980T>C	uc003fjk.2	+	8	1415	c.1258T>C	c.(1258-1260)TGT>CGT	p.C420R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	420	C2 PI3K-type.		C -> R (in cancer; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.C420R(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			C420R(EFM192A_BREAST)|C420R(OVISE_OVARY)|C420R(HEC151_ENDOMETRIUM)|C420R(CCK81_LARGE_INTESTINE)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
KCTD8	386617	broad.mit.edu	37	4	44449880	44449880	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44449880G>A	uc003gwu.2	-	1	945	c.661C>T	c.(661-663)CGC>TGC	p.R221C		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	221						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3															HNSCC(17;0.042)			---	---	---	---
CEP135	9662	broad.mit.edu	37	4	56832011	56832011	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56832011C>A	uc003hbi.2	+	8	1264	c.1030C>A	c.(1030-1032)CTT>ATT	p.L344I	CEP135_uc003hbj.2_Missense_Mutation_p.L50I|CEP135_uc010igz.1_Missense_Mutation_p.L174I	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	344	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
C4orf33	132321	broad.mit.edu	37	4	130030790	130030790	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130030790C>G	uc003igu.3	+	5	821	c.457C>G	c.(457-459)CCT>GCT	p.P153A	C4orf33_uc010ioc.1_Missense_Mutation_p.P153A|C4orf33_uc010iod.2_Missense_Mutation_p.P153A	NM_173487	NP_775758	Q8N1A6	CD033_HUMAN	hypothetical protein LOC132321	153										upper_aerodigestive_tract(1)	1																		---	---	---	---
NR3C2	4306	broad.mit.edu	37	4	149041319	149041319	+	Silent	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149041319T>C	uc003ilj.3	-	7	2965	c.2631A>G	c.(2629-2631)CTA>CTG	p.L877L	NR3C2_uc003ilk.3_Silent_p.L760L|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	877	Steroid-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)													---	---	---	---
MTRR	4552	broad.mit.edu	37	5	7869131	7869131	+	5'Flank	SNP	C	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7869131C>G	uc003jed.2	+						FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jeb.2_5'Flank|FASTKD3_uc003jec.2_5'Flank|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024010	NP_076915			methionine synthase reductase isoform 2						methionine biosynthetic process	cytosol	[methionine synthase] reductase activity|flavin adenine dinucleotide binding|FMN binding|iron ion binding|NADP binding			ovary(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)													---	---	---	---
FYB	2533	broad.mit.edu	37	5	39202557	39202557	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39202557G>A	uc003jls.2	-	1	573	c.506C>T	c.(505-507)GCG>GTG	p.A169V	FYB_uc003jlt.2_Missense_Mutation_p.A169V|FYB_uc003jlu.2_Missense_Mutation_p.A169V|FYB_uc011cpl.1_Missense_Mutation_p.A179V	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	169					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)															---	---	---	---
POU5F2	134187	broad.mit.edu	37	5	93077167	93077167	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93077167A>C	uc003kkl.1	-	1	143	c.103T>G	c.(103-105)TTG>GTG	p.L35V	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	35						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)														---	---	---	---
RHOBTB3	22836	broad.mit.edu	37	5	95103874	95103874	+	Intron	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95103874C>T	uc003klm.2	+							NM_014899	NP_055714			rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)														---	---	---	---
YTHDC2	64848	broad.mit.edu	37	5	112888990	112888990	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112888990G>A	uc003kqn.2	+	13	1984	c.1801G>A	c.(1801-1803)GAT>AAT	p.D601N	YTHDC2_uc010jce.1_Missense_Mutation_p.D601N|YTHDC2_uc010jcf.1_Missense_Mutation_p.D301N	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	601							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)														---	---	---	---
P4HA2	8974	broad.mit.edu	37	5	131552925	131552925	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131552925G>A	uc003kwh.2	-	4	860	c.296C>T	c.(295-297)GCG>GTG	p.A99V	P4HA2_uc003kwg.2_Missense_Mutation_p.A99V|P4HA2_uc003kwi.2_Missense_Mutation_p.A99V|P4HA2_uc003kwk.2_Missense_Mutation_p.A99V|P4HA2_uc003kwl.2_Missense_Mutation_p.A99V|P4HA2_uc003kwj.2_Missense_Mutation_p.A99V	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	99						endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)													---	---	---	---
BRD8	10902	broad.mit.edu	37	5	137475855	137475855	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137475855C>T	uc003lcf.1	-	27	3671	c.3616G>A	c.(3616-3618)GTA>ATA	p.V1206I	BRD8_uc003lcc.1_Intron|NME5_uc003lce.2_5'Flank	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	1206					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
PCDHB8	56128	broad.mit.edu	37	5	140559781	140559781	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140559781G>A	uc011dai.1	+	1	2352	c.2166G>A	c.(2164-2166)TCG>TCA	p.S722S	PCDHB16_uc003liv.2_5'Flank|PCDHB16_uc010jfw.1_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	722	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
SH3RF2	153769	broad.mit.edu	37	5	145317619	145317619	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145317619C>T	uc003lnt.2	+	2	366	c.128C>T	c.(127-129)GCC>GTC	p.A43V	SH3RF2_uc011dbl.1_Missense_Mutation_p.A43V	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	43	RING-type.						ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PCYOX1L	78991	broad.mit.edu	37	5	148748009	148748009	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148748009C>T	uc003lqk.2	+	6	1339	c.1277C>T	c.(1276-1278)CCC>CTC	p.P426L	PCYOX1L_uc003lql.2_Missense_Mutation_p.P409L|PCYOX1L_uc010jgz.2_Missense_Mutation_p.P350L|PCYOX1L_uc003lqm.2_Missense_Mutation_p.P308L|PCYOX1L_uc003lqn.2_Missense_Mutation_p.P336L	NM_024028	NP_076933	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like precursor	426					prenylcysteine catabolic process	extracellular region	oxidoreductase activity, acting on a sulfur group of donors, oxygen as acceptor			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158158138	158158138	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158158138C>T	uc010jip.2	-	11	1366	c.1064G>A	c.(1063-1065)GGT>GAT	p.G355D	EBF1_uc011ddw.1_Missense_Mutation_p.G223D|EBF1_uc011ddx.1_Missense_Mutation_p.G356D|EBF1_uc003lxl.3_Missense_Mutation_p.G324D	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	355					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
LCP2	3937	broad.mit.edu	37	5	169689677	169689677	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169689677C>A	uc003man.1	-	13	1095	c.888G>T	c.(886-888)AGG>AGT	p.R296S	LCP2_uc011des.1_Missense_Mutation_p.R91S|LCP2_uc011det.1_Missense_Mutation_p.R125S|LCP2_uc010jjo.1_Missense_Mutation_p.R103S	NM_005565	NP_005556	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2	296					immune response|platelet activation|T cell receptor signaling pathway|transmembrane receptor protein tyrosine kinase signaling pathway	cytosol	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)														---	---	---	---
ZNF318	24149	broad.mit.edu	37	6	43325509	43325509	+	Intron	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43325509G>A	uc003oux.2	-						ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160			zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)															---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51512896	51512896	+	Silent	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51512896C>A	uc003pah.1	-	63	11607	c.11331G>T	c.(11329-11331)CTG>CTT	p.L3777L		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3777	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75893230	75893230	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75893230C>T	uc003phs.2	-	10	1593	c.1427G>A	c.(1426-1428)AGG>AAG	p.R476K	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Missense_Mutation_p.R134K	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	476	VWFA 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
SLC35D3	340146	broad.mit.edu	37	6	137245222	137245222	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137245222C>T	uc003qhe.2	+	2	804	c.639C>T	c.(637-639)CAC>CAT	p.H213H		NM_001008783	NP_001008783	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	213					carbohydrate transport	integral to membrane				ovary(1)|central_nervous_system(1)	2	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)														---	---	---	---
GRM1	2911	broad.mit.edu	37	6	146720544	146720544	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720544C>T	uc010khw.1	+	8	2839	c.2369C>T	c.(2368-2370)ACC>ATC	p.T790I	GRM1_uc010khv.1_Missense_Mutation_p.T790I|GRM1_uc003qll.2_Missense_Mutation_p.T790I|GRM1_uc011edz.1_Missense_Mutation_p.T790I|GRM1_uc011eea.1_Missense_Mutation_p.T790I	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	790	Helical; Name=6; (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152651705	152651705	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152651705G>A	uc010kiw.2	-	78	14717	c.14115C>T	c.(14113-14115)GCC>GCT	p.A4705A	SYNE1_uc003qot.3_Silent_p.A4634A|SYNE1_uc003qou.3_Silent_p.A4705A|SYNE1_uc010kiz.2_Silent_p.A460A	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4705	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
PDGFA	5154	broad.mit.edu	37	7	552006	552006	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:552006G>A	uc003sir.2	-	3	1090	c.247C>T	c.(247-249)CGG>TGG	p.R83W	PDGFA_uc003sis.2_Missense_Mutation_p.R83W|PDGFA_uc003sit.1_Missense_Mutation_p.R97W	NM_002607	NP_002598	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha isoform 1	83					actin cytoskeleton organization|angiogenesis|cell projection assembly|embryo development|hair follicle development|lung alveolus development|negative chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|organ morphogenesis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of DNA replication|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of MAP kinase activity|positive regulation of mesenchymal cell proliferation|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|regulation of actin cytoskeleton organization|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling|regulation of peptidyl-tyrosine phosphorylation|regulation of smooth muscle cell migration|skin development	cell surface|endoplasmic reticulum lumen|extracellular space|Golgi membrane|microvillus|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)														---	---	---	---
URGCP	55665	broad.mit.edu	37	7	43917871	43917871	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43917871G>A	uc003tiw.2	-	6	1248	c.1191C>T	c.(1189-1191)AAC>AAT	p.N397N	URGCP_uc003tiu.2_Silent_p.N354N|URGCP_uc003tiv.2_Silent_p.N322N|URGCP_uc003tix.2_Silent_p.N388N|URGCP_uc003tiy.2_Silent_p.N354N|URGCP_uc003tiz.2_Silent_p.N354N|URGCP_uc011kbj.1_Silent_p.N354N	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	397					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
ADCY1	107	broad.mit.edu	37	7	45614571	45614571	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45614571C>T	uc003tne.3	+	1	447	c.429C>T	c.(427-429)GGC>GGT	p.G143G	ADCY1_uc003tnd.2_5'UTR	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	143	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100678664	100678664	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678664G>A	uc003uxp.1	+	3	4020	c.3967G>A	c.(3967-3969)GAA>AAA	p.E1323K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1323	Extracellular (Potential).|20.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100684284	100684284	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100684284C>A	uc003uxp.1	+	3	9640	c.9587C>A	c.(9586-9588)ACC>AAC	p.T3196N	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3196	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
IFRD1	3475	broad.mit.edu	37	7	112102348	112102348	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112102348T>C	uc003vgh.2	+	9	1264	c.821T>C	c.(820-822)CTC>CCC	p.L274P	IFRD1_uc011kmn.1_Missense_Mutation_p.L224P|IFRD1_uc003vgj.2_Missense_Mutation_p.L274P|IFRD1_uc011kmo.1_RNA|IFRD1_uc011kmp.1_Missense_Mutation_p.L224P	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	274					multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2																		---	---	---	---
FAM180A	389558	broad.mit.edu	37	7	135418743	135418743	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135418743G>T	uc003vtd.2	-	3	768	c.502C>A	c.(502-504)CAG>AAG	p.Q168K	FAM180A_uc010lmt.2_RNA|FAM180A_uc010lmu.2_Missense_Mutation_p.Q168K	NM_205855	NP_995327	Q6UWF9	F180A_HUMAN	hypothetical protein LOC389558 precursor	168						extracellular region				ovary(2)	2																		---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139209873	139209873	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139209873C>T	uc003yuy.2	-	8	880	c.709G>A	c.(709-711)GCA>ACA	p.A237T	FAM135B_uc003yux.2_Missense_Mutation_p.A138T|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	237										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
PLEC	5339	broad.mit.edu	37	8	144997456	144997456	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144997456G>A	uc003zaf.1	-	31	7222	c.7052C>T	c.(7051-7053)GCG>GTG	p.A2351V	PLEC_uc003zab.1_Missense_Mutation_p.A2214V|PLEC_uc003zac.1_Missense_Mutation_p.A2218V|PLEC_uc003zad.2_Missense_Mutation_p.A2214V|PLEC_uc003zae.1_Missense_Mutation_p.A2182V|PLEC_uc003zag.1_Missense_Mutation_p.A2192V|PLEC_uc003zah.2_Missense_Mutation_p.A2200V|PLEC_uc003zaj.2_Missense_Mutation_p.A2241V	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2351	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9																		---	---	---	---
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20414343A>G	uc003zoe.2	-	5	760	c.501T>C	c.(499-501)AGT>AGC	p.S167S	MLLT3_uc011lne.1_Silent_p.S135S|MLLT3_uc011lnf.1_Silent_p.S164S|MLLT3_uc003zof.2_5'UTR|MLLT3_uc011lng.1_Missense_Mutation_p.V129A	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	167	Poly-Ser.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)				T	MLL	ALL								---	---	---	---
FAM166B	730112	broad.mit.edu	37	9	35562915	35562915	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35562915G>A	uc010mkr.2	-	3	520	c.449C>T	c.(448-450)CCG>CTG	p.P150L	FAM166B_uc011lov.1_Missense_Mutation_p.P150L|FAM166B_uc011low.1_Missense_Mutation_p.P150L|FAM166B_uc003zwy.2_Missense_Mutation_p.P150L	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	150											0																		---	---	---	---
C9orf79	286234	broad.mit.edu	37	9	90500381	90500381	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90500381C>A	uc004app.3	+	4	1014	c.979C>A	c.(979-981)CAG>AAG	p.Q327K	C9orf79_uc004apo.1_Missense_Mutation_p.Q139K	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	327						integral to membrane				ovary(3)	3																		---	---	---	---
PPP3R2	5535	broad.mit.edu	37	9	104356919	104356919	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356919C>T	uc004bbr.2	-	1	365	c.294G>A	c.(292-294)GCG>GCA	p.A98A	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	95	EF-hand 3.						calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)													---	---	---	---
NUP188	23511	broad.mit.edu	37	9	131768031	131768031	+	Silent	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131768031T>C	uc004bws.1	+	41	4867	c.4845T>C	c.(4843-4845)AAT>AAC	p.N1615N		NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1615					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7																		---	---	---	---
FBXW5	54461	broad.mit.edu	37	9	139835750	139835750	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139835750G>A	uc004cjx.2	-	8	1561	c.1410C>T	c.(1408-1410)GAC>GAT	p.D470D	FBXW5_uc010nbx.2_RNA|FBXW5_uc004cjy.2_Silent_p.D218D|FBXW5_uc004cjz.2_Silent_p.D200D	NM_018998	NP_061871	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	470	WD 2.						catalytic activity|protein binding				0	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)														---	---	---	---
C9orf140	89958	broad.mit.edu	37	9	139960781	139960781	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139960781C>T	uc011men.1	-	2	733	c.617G>A	c.(616-618)CGG>CAG	p.R206Q		NM_178448	NP_848543	Q86UD0	CI140_HUMAN	tumor specificity and mitosis phase-dependent	206						cytoplasm|nucleus				skin(1)	1	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;3.02e-05)|Epithelial(140;0.000499)														---	---	---	---
SLC39A12	221074	broad.mit.edu	37	10	18331626	18331626	+	Intron	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18331626T>C	uc001ipo.2	+						SLC39A12_uc001ipn.2_Intron|SLC39A12_uc001ipp.2_Intron|SLC39A12_uc010qck.1_Intron	NM_001145195	NP_001138667			solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2																		---	---	---	---
PDE6C	5146	broad.mit.edu	37	10	95372701	95372701	+	Silent	SNP	G	A	A	rs140469169	byFrequency	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95372701G>A	uc001kiu.3	+	1	357	c.219G>A	c.(217-219)GGG>GGA	p.G73G		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	73					visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)																---	---	---	---
PYROXD2	84795	broad.mit.edu	37	10	100154955	100154955	+	Silent	SNP	A	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100154955A>G	uc001kpc.2	-	8	869	c.783T>C	c.(781-783)AGT>AGC	p.S261S	PYROXD2_uc001kpb.2_RNA|PYROXD2_uc001kpd.2_RNA|PYROXD2_uc010qpe.1_Silent_p.S261S	NM_032709	NP_116098	Q8N2H3	PYRD2_HUMAN	pyridine nucleotide-disulphide oxidoreductase	261							oxidoreductase activity			central_nervous_system(1)	1																		---	---	---	---
CSTF3	1479	broad.mit.edu	37	11	33106623	33106623	+	3'UTR	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33106623G>A	uc001muh.2	-	21					TCP11L1_uc001muf.1_RNA	NM_001326	NP_001317			cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0																		---	---	---	---
NDUFS3	4722	broad.mit.edu	37	11	47604020	47604020	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47604020G>A	uc001nga.2	+	6	709	c.627G>A	c.(625-627)GAG>GAA	p.E209E	NDUFS3_uc001nft.3_Silent_p.E188E	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3	209					induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)													---	---	---	---
CNTF	1270	broad.mit.edu	37	11	58391516	58391516	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58391516C>T	uc001nna.3	+	2	204	c.124C>T	c.(124-126)CAG>TAG	p.Q42*	ZFP91-CNTF_uc010rkm.1_RNA	NM_000614	NP_000605	P26441	CNTF_HUMAN	ciliary neurotrophic factor	42					ciliary neurotrophic factor-mediated signaling pathway|growth|negative regulation of neuron apoptosis|positive regulation of tyrosine phosphorylation of Stat3 protein		ciliary neurotrophic factor receptor binding|growth factor activity|interleukin-6 receptor binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)																---	---	---	---
MS4A8B	83661	broad.mit.edu	37	11	60476242	60476242	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60476242C>T	uc001npv.2	+	5	725	c.522C>T	c.(520-522)TAC>TAT	p.Y174Y	MS4A8B_uc009yne.1_Silent_p.Y174Y	NM_031457	NP_113645	Q9BY19	M4A8B_HUMAN	membrane-spanning 4-domains, subfamily A, member	174	Extracellular (Potential).					integral to membrane	receptor activity				0																		---	---	---	---
BIRC3	330	broad.mit.edu	37	11	102195339	102195339	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102195339G>C	uc001pgx.2	+	3	321	c.99G>C	c.(97-99)ATG>ATC	p.M33I		NM_182962	NP_892007	Q13489	BIRC3_HUMAN	baculoviral IAP repeat-containing protein 3	33	BIR 1.				anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|skin(1)	4	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)				T	MALT1	MALT								---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2719812	2719812	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2719812G>T	uc009zdu.1	+	29	4037	c.3724G>T	c.(3724-3726)GAG>TAG	p.E1242*	CACNA1C_uc009zdv.1_Nonsense_Mutation_p.E1219*|CACNA1C_uc001qkb.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkc.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qke.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkf.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qjz.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkd.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkg.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc009zdw.1_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkh.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkl.2_Nonsense_Mutation_p.E1242*|CACNA1C_uc001qkn.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qko.2_Nonsense_Mutation_p.E1242*|CACNA1C_uc001qkp.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkr.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qku.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkq.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qks.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qkt.2_Nonsense_Mutation_p.E1222*|CACNA1C_uc001qka.1_Nonsense_Mutation_p.E757*|CACNA1C_uc001qki.1_Nonsense_Mutation_p.E958*|CACNA1C_uc001qkj.1_Nonsense_Mutation_p.E958*|CACNA1C_uc001qkk.1_Nonsense_Mutation_p.E958*|CACNA1C_uc001qkm.1_Nonsense_Mutation_p.E958*	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1242	Helical; Name=S1 of repeat IV; (Potential).|IV.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
TEAD4	7004	broad.mit.edu	37	12	3131110	3131110	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3131110C>T	uc010sej.1	+	10	1098	c.821C>T	c.(820-822)CCG>CTG	p.P274L	TEAD4_uc010sek.1_Missense_Mutation_p.P231L|TEAD4_uc001qln.2_Missense_Mutation_p.P146L	NM_003213	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4 isoform 1	275					hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
ALG10	84920	broad.mit.edu	37	12	34179654	34179654	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34179654C>T	uc001rlm.2	+	3	1545	c.1226C>T	c.(1225-1227)CCT>CTT	p.P409L		NM_032834	NP_116223	Q5BKT4	AG10A_HUMAN	asparagine-linked glycosylation 10 homolog	409	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			skin(1)	1	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)																---	---	---	---
MLL2	8085	broad.mit.edu	37	12	49424062	49424062	+	Splice_Site	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49424062C>T	uc001rta.3	-	42	13999	c.13999_splice	c.e42+1	p.D4667_splice		NM_003482	NP_003473			myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41								N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			---	---	---	---
RBMS2	5939	broad.mit.edu	37	12	56975886	56975886	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56975886G>A	uc001sln.2	+	9	1022	c.823G>A	c.(823-825)GCT>ACT	p.A275T	RBMS2_uc010sqp.1_Missense_Mutation_p.A130T|RBMS2_uc010sqq.1_Missense_Mutation_p.A150T|RBMS2_uc009zou.2_Missense_Mutation_p.A32T	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting	275					RNA processing	nucleus	nucleotide binding|RNA binding				0																		---	---	---	---
ALX1	8092	broad.mit.edu	37	12	85677378	85677378	+	Silent	SNP	A	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85677378A>G	uc001tae.3	+	2	259	c.255A>G	c.(253-255)GGA>GGG	p.G85G		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	85					brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)														---	---	---	---
CCDC122	160857	broad.mit.edu	37	13	44433927	44433927	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44433927A>G	uc010acf.2	-	5	695	c.436T>C	c.(436-438)TGG>CGG	p.W146R	CCDC122_uc010tfn.1_Missense_Mutation_p.W146R	NM_144974	NP_659411	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	146											0		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)														---	---	---	---
NID2	22795	broad.mit.edu	37	14	52508986	52508986	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52508986C>T	uc001wzo.2	-	7	1896	c.1662G>A	c.(1660-1662)CTG>CTA	p.L554L	NID2_uc010tqs.1_Silent_p.L554L|NID2_uc010tqt.1_Silent_p.L554L|NID2_uc001wzp.2_Silent_p.L554L	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	554	Nidogen G2 beta-barrel.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)																	---	---	---	---
MTHFD1	4522	broad.mit.edu	37	14	64894054	64894054	+	Splice_Site	SNP	G	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64894054G>C	uc001xhb.2	+	12	1515	c.1128_splice	c.e12-1	p.G376_splice	MTHFD1_uc010aqe.2_Splice_Site_p.G412_splice|MTHFD1_uc010aqf.2_Splice_Site_p.G432_splice	NM_005956	NP_005947			methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)													---	---	---	---
WDR25	79446	broad.mit.edu	37	14	100992196	100992196	+	Intron	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100992196C>T	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948			WD repeat domain 25												0		Melanoma(154;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	15	22466482	22466482	+	5'Flank	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22466482G>A	uc001yui.1	-											Homo sapiens clone IgA5728-2 immunoglobulin A heavy chain mRNA, partial cds.																														---	---	---	---
CYP19A1	1588	broad.mit.edu	37	15	51503068	51503068	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51503068C>T	uc001zyz.3	-	11	1700	c.1449G>A	c.(1447-1449)GAG>GAA	p.E483E	CYP19A1_uc001zza.3_Silent_p.E483E	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	483					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)													---	---	---	---
ISLR	3671	broad.mit.edu	37	15	74467619	74467619	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74467619C>T	uc002axg.1	+	2	702	c.420C>T	c.(418-420)GAC>GAT	p.D140D	ISLR_uc002axh.1_Silent_p.D140D	NM_005545	NP_005536	O14498	ISLR_HUMAN	immunoglobulin superfamily containing	140	LRR 4.				cell adhesion	extracellular region				large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
AXIN1	8312	broad.mit.edu	37	16	339583	339583	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:339583G>A	uc002cgp.1	-	10	2496	c.2319C>T	c.(2317-2319)GGC>GGT	p.G773G	AXIN1_uc002cgq.1_Silent_p.G737G	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a	773	Interaction with PPP2CA.				activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)																---	---	---	---
C16orf73	254528	broad.mit.edu	37	16	1891975	1891975	+	Splice_Site	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1891975C>T	uc002cne.2	-	11	999	c.881_splice	c.e11-1	p.L294_splice	C16orf73_uc010uvq.1_Splice_Site_p.L294_splice|C16orf73_uc010uvr.1_Splice_Site_p.L87_splice	NM_152764	NP_689977			hypothetical protein LOC254528 isoform 2						meiosis	cytoplasm					0																		---	---	---	---
ITPRIPL2	162073	broad.mit.edu	37	16	19126204	19126204	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19126204G>A	uc002dfu.3	+	1	951	c.421G>A	c.(421-423)GGT>AGT	p.G141S	ITPRIPL2_uc002dft.2_5'UTR	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-triphosphate receptor interacting	141	Cytoplasmic (Potential).					integral to membrane				skin(2)	2																		---	---	---	---
TUFM	7284	broad.mit.edu	37	16	28855126	28855126	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28855126G>A	uc002drh.2	-	9	1264	c.1125C>T	c.(1123-1125)TCC>TCT	p.S375S	uc010vct.1_Intron|SH2B1_uc002dri.2_5'Flank	NM_003321	NP_003312	P49411	EFTU_HUMAN	Tu translation elongation factor, mitochondrial	372						mitochondrial nucleoid	GTP binding|GTPase activity|protein binding|translation elongation factor activity			ovary(1)	1																		---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	70908761	70908761	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70908761G>A	uc002ezr.2	-	63	10744	c.10616C>T	c.(10615-10617)GCG>GTG	p.A3539V		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3540										ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
FA2H	79152	broad.mit.edu	37	16	74750315	74750315	+	Silent	SNP	C	A	A	rs144071567	byFrequency	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74750315C>A	uc002fde.1	-	6	1037	c.969G>T	c.(967-969)CCG>CCT	p.P323P	FA2H_uc002fdd.1_Silent_p.P96P|FA2H_uc010vmy.1_RNA	NM_024306	NP_077282	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	323					cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0																		---	---	---	---
OVCA2	124641	broad.mit.edu	37	17	1945948	1945948	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1945948G>A	uc002ftx.2	+	2	299	c.234G>A	c.(232-234)CAG>CAA	p.Q78Q	DPH1_uc002ftr.1_Intron|DPH1_uc002fts.2_3'UTR|DPH1_uc002ftt.2_3'UTR|DPH1_uc010cjx.2_3'UTR|DPH1_uc010vqs.1_3'UTR|DPH1_uc002ftu.2_3'UTR|DPH1_uc002ftv.2_3'UTR|DPH1_uc002ftw.2_3'UTR	NM_080822	NP_543012	Q8WZ82	OVCA2_HUMAN	candidate tumor suppressor in ovarian cancer 2	78					response to retinoic acid	cytoplasm	hydrolase activity				0																OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ZMYND15	84225	broad.mit.edu	37	17	4646694	4646694	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4646694C>T	uc002fyt.2	+	6	1280	c.1241C>T	c.(1240-1242)CCG>CTG	p.P414L	ZMYND15_uc002fyv.2_Missense_Mutation_p.P414L|ZMYND15_uc002fyu.2_Missense_Mutation_p.P414L	NM_032265	NP_115641	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15 isoform 2	414							zinc ion binding				0																		---	---	---	---
MYH4	4622	broad.mit.edu	37	17	10362660	10362660	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10362660G>A	uc002gmn.2	-	15	1606	c.1495C>T	c.(1495-1497)CTG>TTG	p.L499L	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	499	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13																		---	---	---	---
FBXW10	10517	broad.mit.edu	37	17	18675802	18675802	+	Missense_Mutation	SNP	C	T	T	rs150329747	byFrequency	TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18675802C>T	uc002guk.2	+	12	2316	c.2084C>T	c.(2083-2085)ACG>ATG	p.T695M	FBXW10_uc002guj.2_Missense_Mutation_p.T695M|FBXW10_uc002gul.2_Missense_Mutation_p.T724M|FBXW10_uc010cqh.1_Missense_Mutation_p.T642M	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	695	Potential.									ovary(1)	1																		---	---	---	---
SLC4A1	6521	broad.mit.edu	37	17	42338119	42338119	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42338119G>A	uc002igf.3	-	5	382	c.233C>T	c.(232-234)GCG>GTG	p.A78V	SLC4A1_uc002igg.3_Missense_Mutation_p.A78V	NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	78	Cytoplasmic.				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)														---	---	---	---
DGKE	8526	broad.mit.edu	37	17	54912541	54912541	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54912541C>T	uc002iur.2	+	2	565	c.385C>T	c.(385-387)CGG>TGG	p.R129W	DGKE_uc002ius.1_Missense_Mutation_p.R129W|C17orf67_uc002iuq.2_5'Flank	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	129	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)																	---	---	---	---
BAHCC1	57597	broad.mit.edu	37	17	79428363	79428363	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79428363C>T	uc002kaf.2	+	24	6674	c.6674C>T	c.(6673-6675)GCG>GTG	p.A2225V	BAHCC1_uc002kae.2_Missense_Mutation_p.A1455V	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	2225							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---
EPB41L3	23136	broad.mit.edu	37	18	5398077	5398077	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5398077C>T	uc002kmt.1	-	17	2501	c.2415G>A	c.(2413-2415)GCG>GCA	p.A805A	EPB41L3_uc010wzh.1_Silent_p.A636A|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Silent_p.A110A|EPB41L3_uc010wzf.1_Silent_p.A102A|EPB41L3_uc010wzg.1_Silent_p.A77A|EPB41L3_uc010dkr.2_Silent_p.A197A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	805	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5																		---	---	---	---
MBP	4155	broad.mit.edu	37	18	74700441	74700441	+	Intron	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74700441C>T	uc010xfd.1	-						MBP_uc002lml.2_Intron|MBP_uc002lmn.2_Intron|MBP_uc002lmp.2_Intron|MBP_uc010xfe.1_Missense_Mutation_p.E121K|MBP_uc010dqz.2_5'Flank	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10305550	10305550	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10305550C>A	uc002mng.2	-	1	206	c.26G>T	c.(25-27)CGG>CTG	p.R9L	DNMT1_uc010xlc.1_Missense_Mutation_p.R9L|DNMT1_uc002mnh.2_5'UTR|DNMT1_uc010xld.1_Missense_Mutation_p.R9L	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	9	Interaction with DMAP1.|Interaction with DNMT3A.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)													---	---	---	---
CYP4F2	8529	broad.mit.edu	37	19	15989736	15989736	+	Missense_Mutation	SNP	C	T	T	rs146148233		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15989736C>T	uc002nbs.1	-	13	1458	c.1408G>A	c.(1408-1410)GGG>AGG	p.G470R	CYP4F2_uc010xot.1_Missense_Mutation_p.G321R	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	470					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
LSM4	25804	broad.mit.edu	37	19	18420552	18420552	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18420552G>A	uc002niq.2	-	4	435	c.264C>T	c.(262-264)CGC>CGT	p.R88R		NM_012321	NP_036453	Q9Y4Z0	LSM4_HUMAN	U6 snRNA-associated Sm-like protein 4	88					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|mRNA processing|RNA splicing	cytosol|U6 snRNP	protein binding|RNA binding				0																		---	---	---	---
NCCRP1	342897	broad.mit.edu	37	19	39689910	39689910	+	Intron	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39689910G>A	uc002okq.1	+							NM_001001414	NP_001001414			non-specific cytotoxic cell receptor protein 1						protein catabolic process					ovary(1)	1																		---	---	---	---
MED29	55588	broad.mit.edu	37	19	39882040	39882040	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39882040T>C	uc002olf.2	+	1	78	c.41T>C	c.(40-42)CTT>CCT	p.L14P	PAF1_uc002old.2_5'Flank|PAF1_uc002ole.1_5'Flank|PAF1_uc010xuv.1_5'Flank|MED29_uc010xuw.1_Missense_Mutation_p.L14P|MED29_uc010xux.1_RNA	NM_017592	NP_060062	Q9NX70	MED29_HUMAN	mediator complex subunit 29	161					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	protein binding			ovary(1)|pancreas(1)	2	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)															---	---	---	---
PHLDB3	653583	broad.mit.edu	37	19	43990419	43990419	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43990419G>A	uc002own.3	-	13	1743	c.1484C>T	c.(1483-1485)ACG>ATG	p.T495M	PHLDB3_uc010eit.2_Missense_Mutation_p.T199M	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,	495											0		Prostate(69;0.0153)																---	---	---	---
MARK4	57787	broad.mit.edu	37	19	45800926	45800926	+	Intron	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45800926G>T	uc002pbb.1	+						MARK4_uc002pba.1_Intron					RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)														---	---	---	---
LIN7B	64130	broad.mit.edu	37	19	49619588	49619588	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49619588G>A	uc002pmp.2	+	4	341	c.297G>A	c.(295-297)ACG>ACA	p.T99T		NM_022165	NP_071448	Q9HAP6	LIN7B_HUMAN	lin-7 homolog B	99	PDZ.				exocytosis|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein domain specific binding				0		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;5e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000191)|GBM - Glioblastoma multiforme(486;0.00449)|Epithelial(262;0.01)														---	---	---	---
ZNF610	162963	broad.mit.edu	37	19	52857558	52857558	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52857558C>T	uc002pyx.3	+	5	651	c.245C>T	c.(244-246)CCC>CTC	p.P82L	ZNF610_uc002pyy.3_Missense_Mutation_p.P82L|ZNF610_uc002pyz.3_Intron|ZNF610_uc002pza.2_Missense_Mutation_p.P82L	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	82	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)														---	---	---	---
PPP1R12C	54776	broad.mit.edu	37	19	55606106	55606106	+	Silent	SNP	C	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55606106C>T	uc002qix.2	-	12	1531	c.1515G>A	c.(1513-1515)CCG>CCA	p.P505P	PPP1R12C_uc010yfs.1_Silent_p.P431P|PPP1R12C_uc002qiy.2_Silent_p.P504P	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	505	Pro-rich.					cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)														---	---	---	---
BPI	671	broad.mit.edu	37	20	36932707	36932707	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36932707G>A	uc002xib.2	+	1	156	c.94G>A	c.(94-96)GTC>ATC	p.V32I		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	32					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)																---	---	---	---
MAFB	9935	broad.mit.edu	37	20	39317062	39317062	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39317062G>A	uc002xji.2	-	1	815	c.429C>T	c.(427-429)CAC>CAT	p.H143H		NM_005461	NP_005452	Q9Y5Q3	MAFB_HUMAN	transcription factor MAFB	143	Poly-His.				negative regulation of erythrocyte differentiation		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding				0		Myeloproliferative disorder(115;0.00878)						T	IGH@	MM								---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47589805	47589805	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47589805G>A	uc002xtx.3	+	12	1801	c.1649G>A	c.(1648-1650)GGA>GAA	p.G550E		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	550					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37833744	37833744	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37833744T>C	uc002yvk.1	-	2	392	c.250A>G	c.(250-252)ATG>GTG	p.M84V	CLDN14_uc002yvn.1_Missense_Mutation_p.M84V|CLDN14_uc002yvo.1_Missense_Mutation_p.M84V|CLDN14_uc002yvl.1_Missense_Mutation_p.M84V|CLDN14_uc002yvm.1_Missense_Mutation_p.M84V	NM_012130	NP_036262	O95500	CLD14_HUMAN	claudin 14	84	Helical; (Potential).				calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
LSS	4047	broad.mit.edu	37	21	47636354	47636354	+	Silent	SNP	G	A	A	rs138974013		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47636354G>A	uc002zij.2	-	7	811	c.732C>T	c.(730-732)TAC>TAT	p.Y244Y	LSS_uc011afv.1_Silent_p.Y233Y|LSS_uc002zil.2_Silent_p.Y244Y|LSS_uc002zik.2_Silent_p.Y164Y	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	244					cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)																	---	---	---	---
POLR2F	5435	broad.mit.edu	37	22	38352790	38352790	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38352790G>A	uc003aul.2	+	2	152	c.31G>A	c.(31-33)GAC>AAC	p.D11N	POLR2F_uc010gxi.2_5'UTR|POLR2F_uc003aum.2_RNA	NM_021974	NP_068809	P61218	RPAB2_HUMAN	DNA directed RNA polymerase II polypeptide F	11					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA binding|DNA-directed RNA polymerase activity			breast(1)	1	Melanoma(58;0.045)																	---	---	---	---
C22orf40	150383	broad.mit.edu	37	22	46640993	46640993	+	Missense_Mutation	SNP	G	A	A	rs151250954		TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46640993G>A	uc003bhe.2	-	4	409	c.368C>T	c.(367-369)ACG>ATG	p.T123M	C22orf40_uc003bhc.2_3'UTR|C22orf40_uc003bhd.2_Missense_Mutation_p.T118M|C22orf40_uc003bhf.2_RNA	NM_207327	NP_997210	Q6NVV7	CV040_HUMAN	hypothetical protein LOC150383	123											0																		---	---	---	---
TUBGCP6	85378	broad.mit.edu	37	22	50682244	50682244	+	Silent	SNP	G	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50682244G>A	uc003bkb.1	-	1	1157	c.645C>T	c.(643-645)TTC>TTT	p.F215F	TUBGCP6_uc010har.1_Silent_p.F215F|TUBGCP6_uc010has.1_RNA|TUBGCP6_uc010hau.1_Silent_p.F215F	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	215					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)														---	---	---	---
SHROOM2	357	broad.mit.edu	37	X	9862508	9862508	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9862508G>T	uc004csu.1	+	4	650	c.560G>T	c.(559-561)CGC>CTC	p.R187L		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	187					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)																---	---	---	---
BCOR	54880	broad.mit.edu	37	X	39931763	39931763	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6455-01	TCGA-BR-6455-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39931763C>A	uc004den.3	-	4	3128	c.2836G>T	c.(2836-2838)GAG>TAG	p.E946*	BCOR_uc004dep.3_Nonsense_Mutation_p.E946*|BCOR_uc004deo.3_Nonsense_Mutation_p.E946*|BCOR_uc004dem.3_Nonsense_Mutation_p.E946*|BCOR_uc004deq.3_Nonsense_Mutation_p.E946*	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	946					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4																		---	---	---	---
