Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRDM16	63976	broad.mit.edu	37	1	2985621	2985623	+	5'Flank	DEL	GGC	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2985621_2985623delGGC	uc001akf.2	+						PRDM16_uc001akc.2_5'Flank|PRDM16_uc001akd.2_5'Flank|PRDM16_uc001ake.2_5'Flank|PRDM16_uc009vlh.2_5'Flank|FLJ42875_uc010nzg.1_5'Flank	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
BMP8A	353500	broad.mit.edu	37	1	39988318	39988319	+	Intron	INS	-	TTG	TTG	rs139401553	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39988318_39988319insTTG	uc001cdi.2	+						PPIEL_uc001cdj.1_Intron|PPIEL_uc001cdk.2_Intron	NM_181809	NP_861525			bone morphogenetic protein 8A precursor						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
TMCO2	127391	broad.mit.edu	37	1	40716809	40716810	+	Intron	DEL	AA	-	-	rs145848914		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40716809_40716810delAA	uc001cfe.2	+							NM_001008740	NP_001008740			transmembrane and coiled-coil domains 2							integral to membrane				ovary(1)	1	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)															---	---	---	---
ZYG11B	79699	broad.mit.edu	37	1	53238350	53238351	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53238350_53238351insT	uc001cuj.2	+						ZYG11B_uc009vzg.2_Intron|ZYG11B_uc010onj.1_Intron	NM_024646	NP_078922			zyg-11 homolog B								protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115399757	115399758	+	Intron	INS	-	A	A	rs71582509		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399757_115399758insA	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240371023	240371055	+	In_Frame_Del	DEL	CCCGGAGCAGGAATACCTCCTCCACCCCCTCTA	-	-	rs150923193	byFrequency;by1000genomes;byFrequency;by1000genomes;byFrequency;by1000genomes;byFrequency;byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371023_240371055delCCCGGAGCAGGAATACCTCCTCCACCCCCTCTA	uc010pyd.1	+	5	3136_3168	c.2911_2943delCCCGGAGCAGGAATACCTCCTCCACCCCCTCTA	c.(2911-2943)CCCGGAGCAGGAATACCTCCTCCACCCCCTCTAdel	p.PGAGIPPPPPL1092del	FMN2_uc010pye.1_In_Frame_Del_p.PGAGIPPPPPL1096del	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1092_1102	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	38710019	38710019	+	3'UTR	DEL	T	-	-	rs57303101		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38710019delT	uc002rqu.1	+	2										SubName: Full=RPLP0 protein;																														---	---	---	---
PAPOLG	64895	broad.mit.edu	37	2	60997770	60997771	+	Intron	INS	-	A	A	rs10187671	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60997770_60997771insA	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron	NM_022894	NP_075045			poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)															---	---	---	---
PUS10	150962	broad.mit.edu	37	2	61174986	61174986	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61174986delG	uc010fci.2	-						PUS10_uc002sao.2_Intron|PUS10_uc010ypk.1_Intron	NM_144709	NP_653310			pseudouridylate synthase 10						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	4920266	4920267	+	IGR	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4920266_4920267insT								ITPR1 (30980 upstream) : BHLHE40 (100830 downstream)																																			---	---	---	---
GK5	256356	broad.mit.edu	37	3	141906447	141906447	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141906447delA	uc003euq.1	-						GK5_uc010hus.1_Intron	NM_001039547	NP_001034636			glycerol kinase 5 (putative)						glycerol metabolic process		ATP binding|glycerol kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	167606634	167606634	+	IGR	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167606634delT								SERPINI1 (63278 upstream) : GOLIM4 (121020 downstream)																																			---	---	---	---
RG9MTD2	93587	broad.mit.edu	37	4	100470093	100470093	+	3'UTR	DEL	T	-	-	rs35333223		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100470093delT	uc003huy.2	-	8					RG9MTD2_uc003huz.3_3'UTR|RG9MTD2_uc003hva.3_3'UTR	NM_152292	NP_689505			RNA (guanine-9-) methyltransferase domain								methyltransferase activity			ovary(2)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.7e-08)														---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119163440	119163441	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119163440_119163441insA	uc003ibx.2	+							NM_004784	NP_004775			N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
SSR1	6745	broad.mit.edu	37	6	7295544	7295544	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7295544delT	uc003mxf.3	-						SSR1_uc003mxg.3_Intron|SSR1_uc010jny.2_Intron	NM_003144	NP_003135			signal sequence receptor, alpha precursor						cotranslational protein targeting to membrane|positive regulation of cell proliferation	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Ovarian(93;0.0398)																	---	---	---	---
SLC17A2	10246	broad.mit.edu	37	6	25925739	25925740	+	Intron	DEL	AA	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25925739_25925740delAA	uc011dkb.1	-						SLC17A2_uc011dkc.1_Intron|SLC17A2_uc003nfl.2_Intron					SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1																		---	---	---	---
HACE1	57531	broad.mit.edu	37	6	105300074	105300075	+	Intron	INS	-	TGTG	TGTG	rs2499661	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105300074_105300075insTGTG	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron	NM_020771	NP_065822			HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)														---	---	---	---
AMPH	273	broad.mit.edu	37	7	38543104	38543105	+	Intron	INS	-	C	C	rs139707552	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38543104_38543105insC	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56088983	56088984	+	Intron	INS	-	C	C	rs148993783	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56088983_56088984insC	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
CCT6A	908	broad.mit.edu	37	7	56129362	56129364	+	Intron	DEL	TTT	-	-	rs72194741		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56129362_56129364delTTT	uc003trl.1	+						PSPH_uc003trj.2_Intron|CCT6A_uc003trm.1_Intron|CCT6A_uc011kcu.1_Intron|SUMF2_uc003tro.2_5'Flank|SUMF2_uc011kcv.1_5'Flank|SUMF2_uc011kcw.1_5'Flank|SUMF2_uc011kcx.1_5'Flank|SUMF2_uc003trv.2_5'Flank|SUMF2_uc003trt.2_5'Flank|SUMF2_uc011kcy.1_5'Flank|SUMF2_uc011kcz.1_5'Flank|SUMF2_uc003tru.2_5'Flank|SUMF2_uc011kda.1_5'Flank|SUMF2_uc003trx.2_5'Flank	NM_001762	NP_001753			chaperonin containing TCP1, subunit 6A isoform						'de novo' posttranslational protein folding	cytosol	ATP binding|unfolded protein binding			upper_aerodigestive_tract(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
ERI1	90459	broad.mit.edu	37	8	8874058	8874059	+	Intron	INS	-	A	A	rs55825019		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8874058_8874059insA	uc011kwu.1	+						ERI1_uc003wsk.2_Intron	NM_153332	NP_699163			three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	68728773	68728775	+	Intron	DEL	ATG	-	-	rs62554276		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68728773_68728775delATG	uc004aez.1	+						uc004afa.1_Intron|uc010mnp.1_Intron					Homo sapiens cDNA, FLJ18209.																														---	---	---	---
FAM129B	64855	broad.mit.edu	37	9	130340946	130340947	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130340946_130340947insA	uc004bri.2	-							NM_001035534	NP_001030611			hypothetical protein LOC64855 isoform 2								protein binding				0																		---	---	---	---
PLEKHA1	59338	broad.mit.edu	37	10	124189011	124189016	+	Intron	DEL	TGTGTG	-	-	rs140551676		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124189011_124189016delTGTGTG	uc001lge.1	+						PLEKHA1_uc001lgf.1_Intron|PLEKHA1_uc001lgg.1_Intron	NM_001001974	NP_001001974			pleckstrin homology domain containing, family A						B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
C10orf88	80007	broad.mit.edu	37	10	124711590	124711595	+	Intron	DEL	TTTTAA	-	-	rs66582449		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124711590_124711595delTTTTAA	uc001lgw.2	-						C10orf88_uc001lgx.2_Intron	NM_024942	NP_079218			hypothetical protein LOC80007												0		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)														---	---	---	---
NXF1	10482	broad.mit.edu	37	11	62561637	62561638	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62561637_62561638insA	uc001nvf.1	-						TMEM223_uc001nve.2_5'Flank|NXF1_uc001nvg.1_Intron	NM_006362	NP_006353			nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3																		---	---	---	---
C1R	715	broad.mit.edu	37	12	7241599	7241600	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7241599_7241600insT	uc010sfy.1	-						C1R_uc010sfz.1_Intron|C1R_uc010sga.1_Intron	NM_001733	NP_001724			complement component 1, r subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity				0					Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)													---	---	---	---
PAN2	9924	broad.mit.edu	37	12	56726385	56726385	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56726385delA	uc001skx.2	-						PAN2_uc001skz.2_Intron|PAN2_uc001sky.2_Intron	NM_001127460	NP_001120932			PAN2 polyA specific ribonuclease subunit homolog						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	77054675	77054676	+	IGR	INS	-	A	A	rs34680604		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77054675_77054676insA								OSBPL8 (101086 upstream) : ZDHHC17 (103178 downstream)																																			---	---	---	---
USP30	84749	broad.mit.edu	37	12	109490426	109490427	+	5'UTR	INS	-	CGGCGG	CGGCGG	rs140371213	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109490426_109490427insCGGCGG	uc010sxi.1	+	1					USP30_uc001tnu.3_Intron	NM_032663	NP_116052			ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1																		---	---	---	---
TDRD3	81550	broad.mit.edu	37	13	61109083	61109083	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61109083delG	uc001via.2	+						TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421			tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)														---	---	---	---
ZC3H14	79882	broad.mit.edu	37	14	89074206	89074206	+	Intron	DEL	T	-	-	rs67044102		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89074206delT	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron|ZC3H14_uc001xxc.2_Intron|ZC3H14_uc001xxb.2_Intron	NM_024824	NP_079100			zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TTC7B	145567	broad.mit.edu	37	14	91110624	91110625	+	Intron	DEL	CG	-	-	rs1286424	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110624_91110625delCG	uc001xyp.2	-						TTC7B_uc001xyo.2_5'Flank|TTC7B_uc010ats.2_Intron|uc001xyq.2_Intron	NM_001010854	NP_001010854			tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)																---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71329896	71329897	+	Intron	INS	-	A	A	rs76391784		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329896_71329897insA	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161			leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21071848	21071848	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21071848delT	uc010vbe.1	-							NM_017539	NP_060009			dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
PLCG2	5336	broad.mit.edu	37	16	81973807	81973808	+	Intron	INS	-	TGCA	TGCA	rs141767011	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81973807_81973808insTGCA	uc002fgt.2	+							NM_002661	NP_002652			phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8																		---	---	---	---
TMEM97	27346	broad.mit.edu	37	17	26653991	26653991	+	3'UTR	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26653991delT	uc002hat.2	+	3						NM_014573	NP_055388			transmembrane protein 97						cholesterol homeostasis|regulation of cell growth	integral to membrane|lysosome|nuclear membrane|plasma membrane|rough endoplasmic reticulum	protein binding				0	all_lung(13;0.000238)|Lung NSC(42;0.000789)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)														---	---	---	---
CRLF3	51379	broad.mit.edu	37	17	29112800	29112800	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29112800delA	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070			cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
PSMD3	5709	broad.mit.edu	37	17	38140452	38140453	+	Intron	INS	-	A	A	rs34306234		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38140452_38140453insA	uc002htn.1	+						PSMD3_uc010wen.1_Intron|PSMD3_uc010weo.1_Intron	NM_002809	NP_002800			proteasome 26S non-ATPase subunit 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)																	---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48602072	48602073	+	Intron	INS	-	GT	GT			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48602072_48602073insGT	uc010wmr.1	+						MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509			Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
C18orf45	85019	broad.mit.edu	37	18	20889479	20889480	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20889479_20889480insT	uc002kuf.2	-						C18orf45_uc010xaq.1_Intron|C18orf45_uc010xar.1_Intron|C18orf45_uc002kug.2_Intron|C18orf45_uc002kuh.2_Intron|C18orf45_uc002kue.2_Intron	NM_032933	NP_116322			hypothetical protein LOC85019							integral to membrane					0	all_cancers(21;0.000238)|all_epithelial(16;5.29e-06)|Lung NSC(20;0.00925)|Colorectal(14;0.0202)|all_lung(20;0.0255)|Ovarian(20;0.127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	48574683	48574684	+	IGR	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48574683_48574684insT								RNF114 (4263 upstream) : SNAI1 (24843 downstream)																																			---	---	---	---
C21orf7	56911	broad.mit.edu	37	21	30464623	30464624	+	Intron	INS	-	ACTCCAGTTTATAGG	ACTCCAGTTTATAGG	rs147901306	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30464623_30464624insACTCCAGTTTATAGG	uc002yne.2	+						C21orf7_uc011acr.1_Intron|C21orf7_uc002ynd.2_Intron|C21orf7_uc010gln.2_Intron|C21orf7_uc002ynf.2_Intron	NM_020152	NP_064537			chromosome 21 open reading frame 7							cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)														---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35260248	35260248	+	Intron	DEL	T	-	-	rs11343877		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35260248delT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
SF3A1	10291	broad.mit.edu	37	22	30737507	30737593	+	Intron	DEL	GGAGCTGGAAAGAGGCTCTGTGCTGCCTGGACTTGGGCAGCTGTATGGCCTTGTTCAGGACCCACGCCTCCTTTCAAGGCTCACAGG	-	-	rs60619338		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30737507_30737593delGGAGCTGGAAAGAGGCTCTGTGCTGCCTGGACTTGGGCAGCTGTATGGCCTTGTTCAGGACCCACGCCTCCTTTCAAGGCTCACAGG	uc003ahl.2	-							NM_005877	NP_005868			splicing factor 3a, subunit 1, 120kDa isoform 1						nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5																		---	---	---	---
OPHN1	4983	broad.mit.edu	37	X	67331931	67331932	+	Intron	DEL	AG	-	-	rs59924749		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67331931_67331932delAG	uc004dww.3	-						OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538			oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2																		---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115399757	115399758	+	Intron	INS	-	A	A	rs71582509		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399757_115399758insA	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
C2orf67	151050	broad.mit.edu	37	2	211018090	211018091	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018090_211018091insA	uc002vds.2	-						C2orf67_uc002vdt.2_Intron|C2orf67_uc002vdw.2_Intron|C2orf67_uc002vdy.1_3'UTR|C2orf67_uc002vdv.2_Intron|C2orf67_uc002vdx.1_Intron	NM_152519	NP_689732			hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	4920266	4920267	+	IGR	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4920266_4920267insT								ITPR1 (30980 upstream) : BHLHE40 (100830 downstream)																																			---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52692428	52692429	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52692428_52692429insT	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73174951	73174951	+	Intron	DEL	T	-	-	rs76753805		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73174951delT	uc003hgk.1	-						ADAMTS3_uc003hgl.2_Intron	NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
RG9MTD2	93587	broad.mit.edu	37	4	100470093	100470093	+	3'UTR	DEL	T	-	-	rs35333223		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100470093delT	uc003huy.2	-	8					RG9MTD2_uc003huz.3_3'UTR|RG9MTD2_uc003hva.3_3'UTR	NM_152292	NP_689505			RNA (guanine-9-) methyltransferase domain								methyltransferase activity			ovary(2)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.7e-08)														---	---	---	---
HMGCS1	3157	broad.mit.edu	37	5	43297956	43297956	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43297956delG	uc003jnr.3	-						HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742			hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0																		---	---	---	---
CLINT1	9685	broad.mit.edu	37	5	157236506	157236506	+	Intron	DEL	A	-	-	rs72318416		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157236506delA	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481			epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
PAPOLB	56903	broad.mit.edu	37	7	4901465	4901466	+	5'UTR	INS	-	CACGTCCCCCACCACCGCGACCTT	CACGTCCCCCACCACCGCGACCTT	rs143942823	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4901465_4901466insCACGTCCCCCACCACCGCGACCTT	uc003snk.2	-	1					RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529			poly(A) polymerase beta (testis specific)						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)														---	---	---	---
TRA2A	29896	broad.mit.edu	37	7	23552393	23552393	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23552393delA	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425			transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56088983	56088984	+	Intron	INS	-	C	C	rs148993783	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56088983_56088984insC	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																														---	---	---	---
PRSS3	5646	broad.mit.edu	37	9	33795418	33795423	+	Intron	DEL	GCCGAG	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33795418_33795423delGCCGAG	uc003ztj.3	+						uc003ztk.1_Intron|PRSS3_uc003zti.3_Intron|PRSS3_uc003ztl.3_5'Flank	NM_007343	NP_031369			mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)															---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16996173	16996174	+	Intron	INS	-	T	T	rs140380478		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16996173_16996174insT	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
NXF1	10482	broad.mit.edu	37	11	62561637	62561638	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62561637_62561638insA	uc001nvf.1	-						TMEM223_uc001nve.2_5'Flank|NXF1_uc001nvg.1_Intron	NM_006362	NP_006353			nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
TDRD3	81550	broad.mit.edu	37	13	61109083	61109083	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61109083delG	uc001via.2	+						TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421			tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)														---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58699122	58699123	+	Intron	INS	-	T	T	rs5808963		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58699122_58699123insT	uc010tro.1	-						ACTR10_uc001xdf.2_Intron|ACTR10_uc001xdg.2_Intron|ACTR10_uc001xdh.2_Intron|ACTR10_uc010trp.1_Intron|ACTR10_uc010apc.2_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
C14orf135	64430	broad.mit.edu	37	14	60623037	60623037	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60623037delA	uc001xeq.2	+						DHRS7_uc001xes.2_Intron|DHRS7_uc001xet.2_Intron|DHRS7_uc001xeu.2_Intron	NM_022495	NP_071940			hepatitis C virus F protein-binding protein 2							integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)														---	---	---	---
CRLF3	51379	broad.mit.edu	37	17	29112800	29112800	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29112800delA	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070			cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
SNRPD1	6632	broad.mit.edu	37	18	19202890	19202891	+	Intron	INS	-	T	T	rs111943199		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19202890_19202891insT	uc002ktj.1	+							NM_006938	NP_008869			small nuclear ribonucleoprotein D1 polypeptide						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding				0																		---	---	---	---
CALR3	125972	broad.mit.edu	37	19	16596142	16596143	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16596142_16596143insT	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483			calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0																		---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
TXNRD2	10587	broad.mit.edu	37	22	19919684	19919684	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19919684delA	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_Intron|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_Intron	NM_006440	NP_006431			thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)																	---	---	---	---
TTLL12	23170	broad.mit.edu	37	22	43568708	43568708	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43568708delT	uc003bdq.2	-						TTLL12_uc003bdp.2_5'Flank|TTLL12_uc003bdr.1_Intron	NM_015140	NP_055955			tubulin tyrosine ligase-like family, member 12						protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)																---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115399757	115399758	+	Intron	INS	-	A	A	rs71582509		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399757_115399758insA	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
C2orf67	151050	broad.mit.edu	37	2	211018090	211018091	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018090_211018091insA	uc002vds.2	-						C2orf67_uc002vdt.2_Intron|C2orf67_uc002vdw.2_Intron|C2orf67_uc002vdy.1_3'UTR|C2orf67_uc002vdv.2_Intron|C2orf67_uc002vdx.1_Intron	NM_152519	NP_689732			hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	4920266	4920267	+	IGR	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4920266_4920267insT								ITPR1 (30980 upstream) : BHLHE40 (100830 downstream)																																			---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52692428	52692429	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52692428_52692429insT	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73174951	73174951	+	Intron	DEL	T	-	-	rs76753805		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73174951delT	uc003hgk.1	-						ADAMTS3_uc003hgl.2_Intron	NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
RG9MTD2	93587	broad.mit.edu	37	4	100470093	100470093	+	3'UTR	DEL	T	-	-	rs35333223		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100470093delT	uc003huy.2	-	8					RG9MTD2_uc003huz.3_3'UTR|RG9MTD2_uc003hva.3_3'UTR	NM_152292	NP_689505			RNA (guanine-9-) methyltransferase domain								methyltransferase activity			ovary(2)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.7e-08)														---	---	---	---
HMGCS1	3157	broad.mit.edu	37	5	43297956	43297956	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43297956delG	uc003jnr.3	-						HMGCS1_uc003jnp.3_5'Flank|HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742			hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0																		---	---	---	---
CLINT1	9685	broad.mit.edu	37	5	157236506	157236506	+	Intron	DEL	A	-	-	rs72318416		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157236506delA	uc003lxj.1	-						CLINT1_uc003lxi.1_Intron|CLINT1_uc011ddv.1_Intron	NM_014666	NP_055481			epsin 4						endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
PAPOLB	56903	broad.mit.edu	37	7	4901465	4901466	+	5'UTR	INS	-	CACGTCCCCCACCACCGCGACCTT	CACGTCCCCCACCACCGCGACCTT	rs143942823	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4901465_4901466insCACGTCCCCCACCACCGCGACCTT	uc003snk.2	-	1					RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529			poly(A) polymerase beta (testis specific)						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)														---	---	---	---
TRA2A	29896	broad.mit.edu	37	7	23552393	23552393	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23552393delA	uc003swi.2	-						TRA2A_uc011jzb.1_Intron|TRA2A_uc011jzc.1_Intron|TRA2A_uc011jzd.1_Intron	NM_013293	NP_037425			transformer-2 alpha						nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
PSPH	5723	broad.mit.edu	37	7	56088983	56088984	+	Intron	INS	-	C	C	rs148993783	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56088983_56088984insC	uc003trg.2	-						PSPH_uc003trh.2_Intron|PSPH_uc003tri.2_Intron|PSPH_uc003trj.2_Intron	NM_004577	NP_004568			phosphoserine phosphatase						L-serine biosynthetic process	cytoplasm	calcium ion binding|magnesium ion binding|phosphoserine phosphatase activity|protein homodimerization activity			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																														---	---	---	---
PRSS3	5646	broad.mit.edu	37	9	33795418	33795423	+	Intron	DEL	GCCGAG	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33795418_33795423delGCCGAG	uc003ztj.3	+						uc003ztk.1_Intron|PRSS3_uc003zti.3_Intron|PRSS3_uc003ztl.3_5'Flank	NM_007343	NP_031369			mesotrypsin isoform 1 preproprotein						digestion|endothelial cell migration|zymogen activation	extracellular space	calcium ion binding|protein binding|serine-type endopeptidase activity|serine-type peptidase activity				0			LUSC - Lung squamous cell carcinoma(29;0.0176)															---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16996173	16996174	+	Intron	INS	-	T	T	rs140380478		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16996173_16996174insT	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
NXF1	10482	broad.mit.edu	37	11	62561637	62561638	+	Intron	INS	-	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62561637_62561638insA	uc001nvf.1	-						TMEM223_uc001nve.2_5'Flank|NXF1_uc001nvg.1_Intron	NM_006362	NP_006353			nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3																		---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
TDRD3	81550	broad.mit.edu	37	13	61109083	61109083	+	Intron	DEL	G	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61109083delG	uc001via.2	+						TDRD3_uc001vhz.3_Intron|TDRD3_uc010aeg.2_Intron|TDRD3_uc001vib.3_Intron	NM_030794	NP_110421			tudor domain containing 3 isoform 2						chromatin modification	cytoplasm|nucleus	chromatin binding|methylated histone residue binding|nucleic acid binding|transcription coactivator activity			upper_aerodigestive_tract(1)|skin(1)	2		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)														---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58699122	58699123	+	Intron	INS	-	T	T	rs5808963		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58699122_58699123insT	uc010tro.1	-						ACTR10_uc001xdf.2_Intron|ACTR10_uc001xdg.2_Intron|ACTR10_uc001xdh.2_Intron|ACTR10_uc010trp.1_Intron|ACTR10_uc010apc.2_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
C14orf135	64430	broad.mit.edu	37	14	60623037	60623037	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60623037delA	uc001xeq.2	+						DHRS7_uc001xes.2_Intron|DHRS7_uc001xet.2_Intron|DHRS7_uc001xeu.2_Intron	NM_022495	NP_071940			hepatitis C virus F protein-binding protein 2							integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)														---	---	---	---
CRLF3	51379	broad.mit.edu	37	17	29112800	29112800	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29112800delA	uc002hfr.3	-						CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070			cytokine receptor-like factor 3						negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)																---	---	---	---
SNRPD1	6632	broad.mit.edu	37	18	19202890	19202891	+	Intron	INS	-	T	T	rs111943199		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19202890_19202891insT	uc002ktj.1	+							NM_006938	NP_008869			small nuclear ribonucleoprotein D1 polypeptide						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding				0																		---	---	---	---
CALR3	125972	broad.mit.edu	37	19	16596142	16596143	+	Intron	INS	-	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16596142_16596143insT	uc002ned.2	-						MED26_uc002nee.2_Intron	NM_145046	NP_659483			calreticulin 3 precursor						protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0																		---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
TXNRD2	10587	broad.mit.edu	37	22	19919684	19919684	+	Intron	DEL	A	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19919684delA	uc011ahc.1	-						TXNRD2_uc002zql.1_Intron|TXNRD2_uc002zqm.1_Intron|TXNRD2_uc002zqn.1_Intron|TXNRD2_uc002zqo.1_Intron|TXNRD2_uc002zqp.1_Intron|TXNRD2_uc002zqr.1_Intron|TXNRD2_uc010grv.1_Intron|TXNRD2_uc002zqj.1_Intron|TXNRD2_uc002zqs.2_Intron	NM_006440	NP_006431			thioredoxin reductase 2 precursor						cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)																	---	---	---	---
TTLL12	23170	broad.mit.edu	37	22	43568708	43568708	+	Intron	DEL	T	-	-			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43568708delT	uc003bdq.2	-						TTLL12_uc003bdp.2_5'Flank|TTLL12_uc003bdr.1_Intron	NM_015140	NP_055955			tubulin tyrosine ligase-like family, member 12						protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)																---	---	---	---
CA6	765	broad.mit.edu	37	1	9009386	9009386	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9009386G>A	uc001apm.2	+	2	168	c.144G>A	c.(142-144)TCG>TCA	p.S48S	CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	48					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22188576	22188576	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22188576G>A	uc001bfj.2	-	38	4813	c.4773C>T	c.(4771-4773)TGC>TGT	p.C1591C	HSPG2_uc009vqd.2_Silent_p.C1592C	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1591	Laminin EGF-like 10.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24418800	24418800	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24418800C>T	uc001bin.3	-	11	1259	c.1096G>A	c.(1096-1098)GAG>AAG	p.E366K	MYOM3_uc001bim.3_Missense_Mutation_p.E23K|MYOM3_uc001bio.2_Missense_Mutation_p.E366K|MYOM3_uc001bip.1_Missense_Mutation_p.E23K	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	366										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
C8A	731	broad.mit.edu	37	1	57347266	57347266	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57347266T>C	uc001cyo.2	+	5	745	c.613T>C	c.(613-615)TAC>CAC	p.Y205H		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	205	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82302724	82302724	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82302724T>G	uc001dit.3	+	3	236	c.55T>G	c.(55-57)TTC>GTC	p.F19V	LPHN2_uc001dis.2_Missense_Mutation_p.F19V|LPHN2_uc001diu.2_Missense_Mutation_p.F19V|LPHN2_uc001div.2_Missense_Mutation_p.F19V|LPHN2_uc009wcd.2_Missense_Mutation_p.F19V	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	19					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
WNT2B	7482	broad.mit.edu	37	1	113058897	113058897	+	Missense_Mutation	SNP	G	A	A	rs35058556	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113058897G>A	uc001ecb.2	+	3	1054	c.539G>A	c.(538-540)CGT>CAT	p.R180H	WNT2B_uc001eca.2_Missense_Mutation_p.R161H|WNT2B_uc009wgg.2_Missense_Mutation_p.R88H	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	180					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152327633	152327633	+	Missense_Mutation	SNP	T	A	A	rs144938115		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327633T>A	uc001ezw.3	-	3	2702	c.2629A>T	c.(2629-2631)AGC>TGC	p.S877C	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	877	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ZBTB7B	51043	broad.mit.edu	37	1	154988280	154988280	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988280C>A	uc001fgk.3	+	3	1302	c.1144C>A	c.(1144-1146)CGA>AGA	p.R382R	ZBTB7B_uc009wpa.2_Silent_p.R382R|ZBTB7B_uc001fgj.3_Silent_p.R416R|ZBTB7B_uc010peq.1_Silent_p.R416R|ZBTB7B_uc001fgl.3_Silent_p.R382R	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	382	C2H2-type 2.				cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
LMX1A	4009	broad.mit.edu	37	1	165175089	165175089	+	Intron	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165175089A>G	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron|LMX1A_uc001gcw.1_Intron|LMX1A_uc001gcx.1_Intron	NM_177398	NP_796372			LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)																	---	---	---	---
POGK	57645	broad.mit.edu	37	1	166819038	166819038	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166819038G>T	uc001gdt.1	+	5	1342	c.1222G>T	c.(1222-1224)GGG>TGG	p.G408W	POGK_uc010ple.1_Missense_Mutation_p.G323W|POGK_uc010plf.1_Missense_Mutation_p.G290W	NM_017542	NP_060012	Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	408	DDE.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
ATP6V1G3	127124	broad.mit.edu	37	1	198509695	198509695	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198509695T>C	uc001gup.2	-						ATP6V1G3_uc009wzd.2_Intron|ATP6V1G3_uc001guo.2_Intron	NM_133262	NP_573569			ATPase, H+ transporting, lysosomal, V1 subunit						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding			central_nervous_system(1)	1																		---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228437778	228437778	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228437778G>A	uc009xez.1	+	14	4190	c.4146G>A	c.(4144-4146)ACG>ACA	p.T1382T	OBSCN_uc001hsn.2_Silent_p.T1382T	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1382	Ig-like 14.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232581434	232581434	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232581434G>A	uc001hvg.2	-	9	3352	c.3194C>T	c.(3193-3195)ACG>ATG	p.T1065M	SIPA1L2_uc001hvf.2_Missense_Mutation_p.T139M	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1065					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)																---	---	---	---
LGALS8	3964	broad.mit.edu	37	1	236708103	236708103	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236708103A>T	uc001hxz.1	+	10	1073	c.692A>T	c.(691-693)AAC>ATC	p.N231I	LGALS8_uc001hxw.1_Missense_Mutation_p.N273I|LGALS8_uc001hxy.1_Missense_Mutation_p.N273I|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.N231I|LGALS8_uc001hyb.1_Missense_Mutation_p.N231I|LGALS8_uc001hyc.1_Missense_Mutation_p.N214I	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	231	Galectin 2.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240555838	240555838	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240555838A>C	uc010pyd.1	+	15	5111	c.4886A>C	c.(4885-4887)AAT>ACT	p.N1629T	FMN2_uc010pye.1_Missense_Mutation_p.N1633T|FMN2_uc010pyf.1_Missense_Mutation_p.N244T|FMN2_uc010pyg.1_Missense_Mutation_p.N225T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1629	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457994	248457994	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457994T>G	uc010pzj.1	-	1	887	c.887A>C	c.(886-888)AAG>ACG	p.K296T		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
OR2M7	391196	broad.mit.edu	37	1	248487429	248487429	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487429A>G	uc010pzk.1	-	1	442	c.442T>C	c.(442-444)TCC>CCC	p.S148P		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1652393	1652393	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652393G>A	uc002qxa.2	-	17	3223	c.3159C>T	c.(3157-3159)TAC>TAT	p.Y1053Y		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1053					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98392446	98392446	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98392446G>A	uc002syh.3	-	32	4409	c.4180C>T	c.(4180-4182)CCT>TCT	p.P1394S		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1394	Lys-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211465372	211465372	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211465372A>C	uc002vee.3	+	15	1775	c.1643A>C	c.(1642-1644)CAG>CCG	p.Q548P	CPS1_uc010fur.2_Missense_Mutation_p.Q554P|CPS1_uc010fus.2_Missense_Mutation_p.Q97P	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	548					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
ACSL3	2181	broad.mit.edu	37	2	223773557	223773557	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223773557T>A	uc002vni.2	+	4	518	c.67T>A	c.(67-69)TTA>ATA	p.L23I	ACSL3_uc002vnj.2_Missense_Mutation_p.L23I	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	23	Helical; Signal-anchor for type III membrane protein; (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)			T	ETV1	prostate								---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225688336	225688336	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225688336G>T	uc010fwz.1	-	28	3304	c.3065C>A	c.(3064-3066)TCT>TAT	p.S1022Y	DOCK10_uc002vob.2_Missense_Mutation_p.S1016Y	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1022							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9027370	9027370	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9027370C>A	uc003brf.1	-	22	3809	c.3133G>T	c.(3133-3135)GCC>TCC	p.A1045S	SRGAP3_uc003brg.1_Missense_Mutation_p.A1021S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	1045					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
PFKFB4	5210	broad.mit.edu	37	3	48587369	48587369	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48587369C>T	uc003ctv.2	-	3	256	c.239G>A	c.(238-240)CGG>CAG	p.R80Q	PFKFB4_uc003ctw.2_5'UTR|PFKFB4_uc010hkc.2_Missense_Mutation_p.R80Q|PFKFB4_uc003ctx.2_Missense_Mutation_p.R37Q|PFKFB4_uc010hkb.2_Missense_Mutation_p.R80Q|PFKFB4_uc011bbm.1_Missense_Mutation_p.R69Q|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	80	6-phosphofructo-2-kinase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)														---	---	---	---
QARS	5859	broad.mit.edu	37	3	49139687	49139687	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49139687A>C	uc003cvx.2	-	7	587	c.582T>G	c.(580-582)GCT>GCG	p.A194A	QARS_uc011bcc.1_5'Flank|QARS_uc011bcd.1_Silent_p.A49A|QARS_uc003cvy.2_Silent_p.A49A|QARS_uc011bce.1_Silent_p.A183A|QARS_uc011bcf.1_Silent_p.A194A	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	194					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)													---	---	---	---
VPRBP	9730	broad.mit.edu	37	3	51457862	51457862	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51457862T>C	uc003dbe.1	-	14	2730	c.2562A>G	c.(2560-2562)ATA>ATG	p.I854M	VPRBP_uc003dbf.1_Missense_Mutation_p.I130M	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	854	LisH.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)														---	---	---	---
SNTN	132203	broad.mit.edu	37	3	63638466	63638466	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63638466C>T	uc003dlr.2	+	1	123	c.103C>T	c.(103-105)CCC>TCC	p.P35S		NM_001080537	NP_001074006	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	35						cilium	calcium ion binding			ovary(1)	1																		---	---	---	---
ARL13B	200894	broad.mit.edu	37	3	93758757	93758757	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93758757T>G	uc003drc.2	+	6	1009	c.723T>G	c.(721-723)GAT>GAG	p.D241E	ARL13B_uc010hop.2_Missense_Mutation_p.D92E|ARL13B_uc003drd.2_Missense_Mutation_p.D134E|ARL13B_uc003dre.2_Missense_Mutation_p.D226E|ARL13B_uc003drf.2_Missense_Mutation_p.D241E|ARL13B_uc003drg.2_Missense_Mutation_p.D138E	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	241	Potential.						GTP binding				0																		---	---	---	---
MRPL47	57129	broad.mit.edu	37	3	179311560	179311560	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179311560T>G	uc003fjz.2	-	5	548	c.526A>C	c.(526-528)ATC>CTC	p.I176L	MRPL47_uc003fka.2_Missense_Mutation_p.I66L|MRPL47_uc003fkb.2_Missense_Mutation_p.I156L	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	176					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)															---	---	---	---
EVC	2121	broad.mit.edu	37	4	5733156	5733156	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5733156T>C	uc003gil.1	+	4	573	c.389T>C	c.(388-390)CTG>CCG	p.L130P	EVC_uc003gim.1_RNA	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	130					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)																---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16587554	16587554	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16587554G>C	uc003goz.2	-	5	922	c.606C>G	c.(604-606)AAC>AAG	p.N202K	LDB2_uc003gpa.2_Missense_Mutation_p.N202K|LDB2_uc003gpb.2_Missense_Mutation_p.N202K|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Missense_Mutation_p.N202K|LDB2_uc003goy.2_Missense_Mutation_p.N78K|LDB2_uc011bxi.1_Missense_Mutation_p.N78K	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	202							LIM domain binding|transcription cofactor activity				0																		---	---	---	---
SPATA18	132671	broad.mit.edu	37	4	52926960	52926960	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52926960A>T	uc003gzl.2	+	3	484	c.206A>T	c.(205-207)GAT>GTT	p.D69V	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.D69V|SPATA18_uc003gzk.1_Missense_Mutation_p.D69V	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	69					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)															---	---	---	---
KDR	3791	broad.mit.edu	37	4	55968591	55968591	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55968591G>T	uc003has.2	-	14	2374	c.2072C>A	c.(2071-2073)TCT>TAT	p.S691Y	KDR_uc003hat.1_Missense_Mutation_p.S691Y	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	691	Ig-like C2-type 7.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123252486	123252486	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123252486C>T	uc003ieh.2	+	65	11300	c.11255C>T	c.(11254-11256)ACG>ATG	p.T3752M	KIAA1109_uc003iem.2_Missense_Mutation_p.T143M	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3752					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126241072	126241072	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241072G>A	uc003ifj.3	+	1	3506	c.3506G>A	c.(3505-3507)CGG>CAG	p.R1169Q		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1169	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
ZNF827	152485	broad.mit.edu	37	4	146806888	146806888	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146806888T>C	uc003ikn.2	-	4	1737	c.1689A>G	c.(1687-1689)GCA>GCG	p.A563A	ZNF827_uc003ikm.2_Silent_p.A563A|ZNF827_uc010iox.2_Silent_p.A213A	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	563					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)																	---	---	---	---
NPY1R	4886	broad.mit.edu	37	4	164246633	164246633	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164246633T>G	uc003iqm.1	-	3	1243	c.977A>C	c.(976-978)AAC>ACC	p.N326T	NPY1R_uc011cjj.1_Missense_Mutation_p.N83T	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	326	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19839105	19839105	+	5'UTR	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19839105A>C	uc003jgc.2	-	2					CDH18_uc003jgd.2_5'UTR|CDH18_uc011cnm.1_5'UTR	NM_004934	NP_004925			cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
PRDM9	56979	broad.mit.edu	37	5	23522743	23522743	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522743T>G	uc003jgo.2	+	8	813	c.631T>G	c.(631-633)TTC>GTC	p.F211V		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	211					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288677	65288677	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288677T>A	uc003juk.1	+	3	439	c.131T>A	c.(130-132)TTT>TAT	p.F44Y	ERBB2IP_uc003juh.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jui.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003juj.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqy.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqz.1_Missense_Mutation_p.F44Y|ERBB2IP_uc010iwx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jul.1_Missense_Mutation_p.F44Y	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288678	65288678	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288678T>C	uc003juk.1	+	3	440	c.132T>C	c.(130-132)TTT>TTC	p.F44F	ERBB2IP_uc003juh.1_Silent_p.F44F|ERBB2IP_uc003jui.1_Silent_p.F44F|ERBB2IP_uc003juj.1_Silent_p.F44F|ERBB2IP_uc011cqx.1_Silent_p.F44F|ERBB2IP_uc011cqy.1_Silent_p.F44F|ERBB2IP_uc011cqz.1_Silent_p.F44F|ERBB2IP_uc010iwx.1_Silent_p.F44F|ERBB2IP_uc003jul.1_Silent_p.F44F	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89954028	89954028	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89954028G>T	uc003kju.2	+	21	4781	c.4685G>T	c.(4684-4686)AGA>ATA	p.R1562I	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1562	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94764400	94764400	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94764400C>T	uc003kla.1	+	6	796	c.750C>T	c.(748-750)CCC>CCT	p.P250P	FAM81B_uc010jbe.1_Silent_p.P46P	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	250										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
SLC25A46	91137	broad.mit.edu	37	5	110097216	110097216	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110097216C>G	uc003koz.2	+	8	1058	c.991C>G	c.(991-993)CTT>GTT	p.L331V	SLC25A46_uc011cvi.1_Missense_Mutation_p.L240V	NM_138773	NP_620128	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	331	Solcar 2.|Helical; Name=5; (Potential).				transport	integral to membrane|mitochondrial inner membrane					0		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)														---	---	---	---
ZNF300	91975	broad.mit.edu	37	5	150275190	150275190	+	Silent	SNP	C	T	T	rs140923053		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275190C>T	uc003lsy.1	-	6	1878	c.1611G>A	c.(1609-1611)CCG>CCA	p.P537P	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	537	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	345906	345906	+	Missense_Mutation	SNP	G	A	A	rs148279164		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:345906G>A	uc003msx.2	+	5	680	c.241G>A	c.(241-243)GGT>AGT	p.G81S	DUSP22_uc011dhn.1_Missense_Mutation_p.G81S|DUSP22_uc003msy.1_Missense_Mutation_p.G38S	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	81	Tyrosine-protein phosphatase.				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17629488	17629488	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17629488A>C	uc003ncd.1	-	18	3142	c.2942T>G	c.(2941-2943)TTT>TGT	p.F981C	NUP153_uc011dje.1_Missense_Mutation_p.F1012C|NUP153_uc010jpl.1_Missense_Mutation_p.F939C	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	981					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
C6orf134	79969	broad.mit.edu	37	6	30610778	30610778	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30610778C>T	uc003nqu.2	+	10	1008	c.958C>T	c.(958-960)CGT>TGT	p.R320C	C6orf134_uc003nqr.3_Missense_Mutation_p.R320C|C6orf134_uc003rdc.2_Missense_Mutation_p.R320C|C6orf134_uc003nqs.3_Missense_Mutation_p.R297C|C6orf134_uc003rdd.2_Missense_Mutation_p.R297C|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Missense_Mutation_p.R285C|C6orf134_uc003nqv.2_Missense_Mutation_p.R308C	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2	320							tubulin N-acetyltransferase activity				0																		---	---	---	---
BRD2	6046	broad.mit.edu	37	6	32945244	32945244	+	Missense_Mutation	SNP	G	T	T	rs141044200		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32945244G>T	uc003ocn.3	+	8	2927	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.R409L|BRD2_uc003ocp.3_Missense_Mutation_p.R289L|BRD2_uc010juh.2_Missense_Mutation_p.R409L	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	409	Bromo 2.				spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5																		---	---	---	---
KCNK5	8645	broad.mit.edu	37	6	39159379	39159379	+	Missense_Mutation	SNP	G	A	A	rs150380866	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39159379G>A	uc003oon.2	-	5	1151	c.787C>T	c.(787-789)CGG>TGG	p.R263W		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	263	Cytoplasmic (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144811268	144811268	+	Missense_Mutation	SNP	G	A	A	rs151173089		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144811268G>A	uc003qkt.2	+	30	4288	c.4196G>A	c.(4195-4197)CGT>CAT	p.R1399H		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1399	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149826767	149826767	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149826767T>C	uc003qmo.1	-	13	1331	c.1301A>G	c.(1300-1302)AAG>AGG	p.K434R	PPIL4_uc010kic.2_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	434					protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	153603773	153603773	+	IGR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603773G>A								RGS17 (151384 upstream) : OPRM1 (727863 downstream)																																			---	---	---	---
LPA	4018	broad.mit.edu	37	6	161010612	161010612	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161010612T>C	uc003qtl.2	-	25	4040	c.3920A>G	c.(3919-3921)CAG>CGG	p.Q1307R		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3815	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
ABCB5	340273	broad.mit.edu	37	7	20685666	20685666	+	5'Flank	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20685666T>G	uc003suw.3	+						ABCB5_uc010kuh.2_Missense_Mutation_p.F296V|ABCB5_uc003suv.3_5'Flank|ABCB5_uc011jyi.1_5'Flank	NM_178559	NP_848654			ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40132537	40132537	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40132537A>T	uc003thh.3	+	13	3671	c.3389A>T	c.(3388-3390)AAC>ATC	p.N1130I	CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_Missense_Mutation_p.N181I|CDK13_uc003thk.2_Missense_Mutation_p.N63I	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1130					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42004616	42004616	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42004616G>T	uc011kbh.1	-	15	4146	c.4055C>A	c.(4054-4056)TCA>TAA	p.S1352*	GLI3_uc011kbg.1_Nonsense_Mutation_p.S1293*	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1352					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
POLD2	5425	broad.mit.edu	37	7	44157562	44157562	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44157562G>A	uc010kxz.2	-	4	972	c.322C>T	c.(322-324)CTG>TTG	p.L108L	POLD2_uc003tke.3_Silent_p.L108L|POLD2_uc010kya.2_Silent_p.L108L|POLD2_uc003tkf.3_Silent_p.L108L	NM_006230	NP_006221	P49005	DPOD2_HUMAN	DNA-directed DNA polymerase delta 2	108					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding			ovary(2)	2																		---	---	---	---
SLC13A1	6561	broad.mit.edu	37	7	122765669	122765669	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122765669A>G	uc003vkm.2	-	11	1219	c.1194T>C	c.(1192-1194)CTT>CTC	p.L398L	SLC13A1_uc010lks.2_Silent_p.L274L	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	398	Helical; (Potential).					integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)													---	---	---	---
OR2F1	26211	broad.mit.edu	37	7	143657178	143657178	+	Missense_Mutation	SNP	G	A	A	rs141187562	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657178G>A	uc003wds.1	+	1	159	c.115G>A	c.(115-117)GTG>ATG	p.V39M		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)																	---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151932911	151932911	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932911T>C	uc003wla.2	-	16	2979	c.2760A>G	c.(2758-2760)GTA>GTG	p.V920V	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	920					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3200843	3200843	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3200843C>T	uc011kwk.1	-	23	3997	c.3607G>A	c.(3607-3609)GAC>AAC	p.D1203N	CSMD1_uc011kwj.1_Missense_Mutation_p.D595N|CSMD1_uc003wqe.2_Missense_Mutation_p.D359N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1203	Extracellular (Potential).|CUB 7.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
PRSS55	203074	broad.mit.edu	37	8	10396212	10396212	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10396212C>T	uc003wta.2	+	5	983	c.968C>T	c.(967-969)CCA>CTA	p.P323L	uc010lru.2_Intron|PRSS55_uc003wtb.2_Intron	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	323	Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13258989	13258989	+	Missense_Mutation	SNP	C	T	T	rs150701452		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13258989C>T	uc003wwm.2	-	3	1607	c.1163G>A	c.(1162-1164)CGG>CAG	p.R388Q	DLC1_uc003wwn.2_Missense_Mutation_p.R388Q|DLC1_uc011kxy.1_Missense_Mutation_p.R388Q	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	388					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15480646	15480646	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15480646T>G	uc003wwt.2	+	2	406	c.196T>G	c.(196-198)TTC>GTC	p.F66V	TUSC3_uc003wwr.2_Missense_Mutation_p.F66V|TUSC3_uc003wws.2_Missense_Mutation_p.F66V|TUSC3_uc003wwu.2_Missense_Mutation_p.F66V|TUSC3_uc003wwv.2_Missense_Mutation_p.F66V|TUSC3_uc003www.2_Missense_Mutation_p.F66V|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.F66V	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	66					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
ZMAT4	79698	broad.mit.edu	37	8	40625183	40625183	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40625183C>A	uc003xnr.2	-	3	315	c.169G>T	c.(169-171)GCC>TCC	p.A57S	ZMAT4_uc003xns.2_Missense_Mutation_p.A57S	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	57						nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55541424	55541424	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541424C>G	uc003xsd.1	+	4	5130	c.4982C>G	c.(4981-4983)TCT>TGT	p.S1661C	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1661					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
CRISPLD1	83690	broad.mit.edu	37	8	75944480	75944480	+	3'UTR	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75944480C>A	uc003yan.2	+	15					CRISPLD1_uc011lfk.1_3'UTR|CRISPLD1_uc011lfl.1_3'UTR	NM_031461	NP_113649			cysteine-rich secretory protein LCCL domain							extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87491204	87491204	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87491204C>T	uc003ydu.2	-	7	837	c.677G>A	c.(676-678)AGA>AAA	p.R226K	FAM82B_uc011lfz.1_Missense_Mutation_p.R196K|FAM82B_uc011lga.1_Missense_Mutation_p.R196K	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	226	TPR 2.					microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97614693	97614693	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97614693T>G	uc003yhv.1	+	3	861	c.243T>G	c.(241-243)AGT>AGG	p.S81R	SDC2_uc011lgu.1_Missense_Mutation_p.S52R	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	81	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108306233	108306233	+	Silent	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108306233A>T	uc003ymn.2	-	6	1437	c.969T>A	c.(967-969)GGT>GGA	p.G323G	ANGPT1_uc011lhv.1_Silent_p.G123G|ANGPT1_uc003ymo.2_Silent_p.G322G|ANGPT1_uc003ymp.3_Silent_p.G122G	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	323	Fibrinogen C-terminal.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113317004	113317004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113317004C>T	uc003ynu.2	-	52	8371	c.8212G>A	c.(8212-8214)GAA>AAA	p.E2738K	CSMD3_uc003yns.2_Missense_Mutation_p.E1940K|CSMD3_uc003ynt.2_Missense_Mutation_p.E2698K|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2738	Extracellular (Potential).|Sushi 16.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113318286	113318286	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113318286C>A	uc003ynu.2	-	51	8180	c.8021G>T	c.(8020-8022)TGC>TTC	p.C2674F	CSMD3_uc003yns.2_Missense_Mutation_p.C1876F|CSMD3_uc003ynt.2_Missense_Mutation_p.C2634F|CSMD3_uc011lhx.1_Missense_Mutation_p.C2570F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2674	Extracellular (Potential).|Sushi 15.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113323373	113323373	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323373T>G	uc003ynu.2	-	50	7878	c.7719A>C	c.(7717-7719)GAA>GAC	p.E2573D	CSMD3_uc003yns.2_Missense_Mutation_p.E1775D|CSMD3_uc003ynt.2_Missense_Mutation_p.E2533D|CSMD3_uc011lhx.1_Missense_Mutation_p.E2469D|CSMD3_uc003ynw.1_Missense_Mutation_p.E284D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2573	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121823992	121823992	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823992C>A	uc010mdg.2	-	1	318	c.92G>T	c.(91-93)CGG>CTG	p.R31L	SNTB1_uc003ype.2_Missense_Mutation_p.R31L	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	31	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132052057	132052057	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132052057A>C	uc003ytd.3	-	1	779	c.523T>G	c.(523-525)TTG>GTG	p.L175V	ADCY8_uc010mds.2_Missense_Mutation_p.L175V	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	175	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
DENND3	22898	broad.mit.edu	37	8	142188211	142188211	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142188211G>T	uc003yvy.2	+	16	2790	c.2512G>T	c.(2512-2514)GAC>TAC	p.D838Y	DENND3_uc010mep.2_Missense_Mutation_p.D799Y	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	838										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
NFKBIL2	4796	broad.mit.edu	37	8	145661049	145661049	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145661049G>A	uc011llg.1	-	17	2782	c.2767C>T	c.(2767-2769)CAG>TAG	p.Q923*	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	923					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)															---	---	---	---
KIAA2026	158358	broad.mit.edu	37	9	6007466	6007466	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6007466C>A	uc003zjq.3	-	1	538	c.322G>T	c.(322-324)GTT>TTT	p.V108F		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	108										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18657714	18657714	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18657714G>A	uc003zne.3	+	8	1039	c.912G>A	c.(910-912)ACG>ACA	p.T304T	ADAMTSL1_uc003znb.2_Silent_p.T304T|ADAMTSL1_uc003znc.3_Silent_p.T304T	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	304						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35375189	35375189	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35375189C>T	uc003zwq.2	+	13	1651	c.1359C>T	c.(1357-1359)GAC>GAT	p.D453D	UNC13B_uc003zwr.2_Silent_p.D453D	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	453					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114462251	114462251	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114462251C>T	uc004bfr.2	-	22	3109	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.E953K|C9orf84_uc010mug.2_Missense_Mutation_p.E903K	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	992										ovary(2)	2																		---	---	---	---
RGS3	5998	broad.mit.edu	37	9	116357901	116357901	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116357901C>T	uc004bhq.2	+	25	3476	c.3267C>T	c.(3265-3267)GCC>GCT	p.A1089A	RGS3_uc004bhs.2_Silent_p.A979A|RGS3_uc004bht.2_Silent_p.A808A|RGS3_uc010muy.2_Silent_p.A482A|RGS3_uc004bhv.2_Silent_p.A410A|RGS3_uc004bhw.2_Silent_p.A59A|RGS3_uc011lxh.1_Silent_p.A399A|RGS3_uc004bhx.2_Silent_p.A410A|RGS3_uc004bhz.2_Silent_p.A431A|RGS3_uc004bia.2_Silent_p.A202A	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	1089	RGS.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
QRFP	347148	broad.mit.edu	37	9	133768995	133768995	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133768995C>A	uc011mcb.1	-	1	231	c.231G>T	c.(229-231)TCG>TCT	p.S77S		NM_198180	NP_937823	P83859	OX26_HUMAN	RF(Arg-Phe)amide family 26 amino acid peptide	77					locomotory behavior|neuropeptide signaling pathway|positive regulation of blood pressure|regulation of feeding behavior	extracellular region	neuropeptide hormone activity|orexigenic neuropeptide QRFP receptor binding				0	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)														---	---	---	---
SARDH	1757	broad.mit.edu	37	9	136596596	136596596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136596596G>A	uc004cep.3	-	4	655	c.521C>T	c.(520-522)GCG>GTG	p.A174V	SARDH_uc004ceo.2_Missense_Mutation_p.A174V|SARDH_uc011mdn.1_Missense_Mutation_p.A174V|SARDH_uc011mdo.1_Missense_Mutation_p.A6V	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	174					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)														---	---	---	---
ZMYND11	10771	broad.mit.edu	37	10	288050	288050	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:288050C>T	uc010pzt.1	+	10	1349	c.921C>T	c.(919-921)GAC>GAT	p.D307D	ZMYND11_uc001ifk.2_Silent_p.D306D|ZMYND11_uc010pzu.1_Silent_p.D307D|ZMYND11_uc010pzv.1_Silent_p.D252D|ZMYND11_uc010pzw.1_Silent_p.D222D|ZMYND11_uc001ifm.2_Silent_p.D253D|ZMYND11_uc010pzx.1_Silent_p.D307D|ZMYND11_uc001ifn.2_Silent_p.D253D|ZMYND11_uc009xhg.2_Silent_p.D290D|ZMYND11_uc009xhh.2_Silent_p.D181D|ZMYND11_uc010pzy.1_Silent_p.D159D	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	267	PWWP.				cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
C10orf18	54906	broad.mit.edu	37	10	5766451	5766451	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5766451G>A	uc001iij.2	+	8	931	c.306G>A	c.(304-306)GGG>GGA	p.G102G		NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	102										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15688912	15688912	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15688912G>A	uc001ioc.1	-	12	1140	c.1140C>T	c.(1138-1140)ACC>ACT	p.T380T	ITGA8_uc010qcb.1_Silent_p.T365T	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	380	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63852438	63852438	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63852438C>A	uc001jlt.1	+	10	3242	c.3216C>A	c.(3214-3216)CCC>CCA	p.P1072P		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1072					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88220968	88220968	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88220968C>T	uc001kdo.2	-	10	2889	c.2447G>A	c.(2446-2448)CGG>CAG	p.R816Q	WAPAL_uc009xsv.2_Missense_Mutation_p.R130Q|WAPAL_uc001kdn.2_Missense_Mutation_p.R853Q|WAPAL_uc009xsw.2_Missense_Mutation_p.R810Q	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	816	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
KIF20B	9585	broad.mit.edu	37	10	91533796	91533796	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91533796A>G	uc001kgs.1	+	33	5526	c.5454A>G	c.(5452-5454)ACA>ACG	p.T1818T	KIF20B_uc001kgr.1_Silent_p.T1778T|KIF20B_uc001kgt.1_Silent_p.T1029T|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1818	Interaction with PIN1.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93250996	93250996	+	Missense_Mutation	SNP	G	A	A	rs149760758	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93250996G>A	uc001khl.2	+	12	1331	c.1231G>A	c.(1231-1233)GAT>AAT	p.D411N	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.D415N|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'UTR|HECTD2_uc001khn.1_Missense_Mutation_p.D61N	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	411					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1																		---	---	---	---
ADAM8	101	broad.mit.edu	37	10	135082361	135082361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135082361C>A	uc010qva.1	-	17	1810	c.1759G>T	c.(1759-1761)GGG>TGG	p.G587W	ADAM8_uc010quz.1_Missense_Mutation_p.G652W|ADAM8_uc009ybi.2_Intron			P78325	ADAM8_HUMAN	SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);	587					integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity			large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)														---	---	---	---
KRTAP5-5	439915	broad.mit.edu	37	11	1651127	1651127	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651127C>T	uc001lty.2	+	1	95	c.57C>T	c.(55-57)TCC>TCT	p.S19S		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	19						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32632734	32632734	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32632734C>T	uc001mtv.2	-	17	3018	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	992										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
OR4C13	283092	broad.mit.edu	37	11	49974468	49974468	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974468C>T	uc010rhz.1	+	1	494	c.494C>T	c.(493-495)CCT>CTT	p.P165L		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4																		---	---	---	---
OR5D13	390142	broad.mit.edu	37	11	55541130	55541130	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541130T>G	uc010ril.1	+	1	217	c.217T>G	c.(217-219)TTC>GTC	p.F73V		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)																---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61070051	61070051	+	Intron	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61070051T>G	uc001nrc.3	-						DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Intron	NM_001923	NP_001914			damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
C11orf9	745	broad.mit.edu	37	11	61539366	61539366	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61539366T>C	uc001nsc.1	+	7	1153	c.1057T>C	c.(1057-1059)TGG>CGG	p.W353R	C11orf9_uc001nse.1_Missense_Mutation_p.W344R	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	353	NDT80.				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1																		---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62299903	62299903	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62299903G>A	uc001ntl.2	-	5	2286	c.1986C>T	c.(1984-1986)CCC>CCT	p.P662P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	662					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
SLC22A6	9356	broad.mit.edu	37	11	62747361	62747361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62747361C>A	uc001nwk.2	-	7	1404	c.1097G>T	c.(1096-1098)AGC>ATC	p.S366I	SLC22A6_uc001nwl.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwj.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwm.2_Missense_Mutation_p.S366I	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	366	Extracellular (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0																		---	---	---	---
ZFPL1	7542	broad.mit.edu	37	11	64854058	64854058	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64854058G>A	uc001ocq.1	+	4	551	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	CDCA5_uc001ocp.2_5'Flank	NM_006782	NP_006773	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	129	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|vesicle-mediated transport	Golgi apparatus|integral to membrane|nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64875710	64875710	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64875710A>G	uc001ocr.1	+	5	807	c.767A>G	c.(766-768)GAG>GGG	p.E256G	C11orf2_uc001ocs.1_Missense_Mutation_p.E132G	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	256					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
SLC36A4	120103	broad.mit.edu	37	11	92918925	92918925	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92918925A>T	uc001pdn.2	-	2	208	c.111T>A	c.(109-111)GAT>GAA	p.D37E	SLC36A4_uc001pdm.2_5'UTR	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	37					L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120811160	120811160	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120811160C>T	uc001pxn.2	+	14	1868	c.1581C>T	c.(1579-1581)CGC>CGT	p.R527R	GRIK4_uc009zav.1_Silent_p.R527R|GRIK4_uc009zaw.1_Silent_p.R527R|GRIK4_uc009zax.1_Silent_p.R527R	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	527	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2558239	2558239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2558239G>A	uc009zdu.1	+	4	888	c.575G>A	c.(574-576)CGC>CAC	p.R192H	CACNA1C_uc009zdv.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkb.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkc.2_Missense_Mutation_p.R192H|CACNA1C_uc001qke.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkf.2_Missense_Mutation_p.R192H|CACNA1C_uc001qjz.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkd.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkg.2_Missense_Mutation_p.R192H|CACNA1C_uc009zdw.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkh.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkl.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkn.2_Missense_Mutation_p.R192H|CACNA1C_uc001qko.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkp.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkr.2_Missense_Mutation_p.R192H|CACNA1C_uc001qku.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkq.2_Missense_Mutation_p.R192H|CACNA1C_uc001qks.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkt.2_Missense_Mutation_p.R192H|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	192	I.|Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
A2M	2	broad.mit.edu	37	12	9231877	9231877	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9231877A>C	uc001qvk.1	-	25	3195	c.3082T>G	c.(3082-3084)TTT>GTT	p.F1028V	A2M_uc001qvj.1_Missense_Mutation_p.F70V|A2M_uc009zgk.1_Missense_Mutation_p.F878V	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1028					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21028196	21028196	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028196C>A	uc001rek.2	+	8	881	c.755C>A	c.(754-756)TCT>TAT	p.S252Y	SLCO1B3_uc001rel.2_Missense_Mutation_p.S252Y|SLCO1B3_uc010sil.1_Missense_Mutation_p.S252Y|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.S77Y	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	252	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21051412	21051412	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21051412G>C	uc001rek.2	+	13	1851	c.1725G>C	c.(1723-1725)CAG>CAC	p.Q575H	SLCO1B3_uc001rel.2_Missense_Mutation_p.Q575H|SLCO1B3_uc010sil.1_Missense_Mutation_p.Q575H|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.Q400H	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	575	Helical; Name=11; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
HELB	92797	broad.mit.edu	37	12	66725385	66725385	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725385G>T	uc001sti.2	+	12	3150	c.3122G>T	c.(3121-3123)TGT>TTT	p.C1041F	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1041					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)														---	---	---	---
CLLU1OS	574016	broad.mit.edu	37	12	92814941	92814941	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92814941G>A	uc001tcb.1	-	3	153	c.151C>T	c.(151-153)CTA>TTA	p.L51L	CLLU1_uc001tcc.2_5'Flank|CLLU1_uc001tcd.2_5'Flank|CLLU1_uc001tce.1_5'Flank|CLLU1_uc001tcf.2_5'Flank	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	51											0																		---	---	---	---
ANO4	121601	broad.mit.edu	37	12	101520783	101520783	+	Missense_Mutation	SNP	C	T	T	rs139827573		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101520783C>T	uc010svm.1	+	27	3375	c.2803C>T	c.(2803-2805)CGT>TGT	p.R935C	ANO4_uc001thw.2_Missense_Mutation_p.R900C|ANO4_uc001thx.2_Missense_Mutation_p.R935C|ANO4_uc001thy.2_Missense_Mutation_p.R455C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6															HNSCC(74;0.22)			---	---	---	---
POLR3B	55703	broad.mit.edu	37	12	106820987	106820987	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820987C>T	uc001tlp.2	+	13	1336	c.1114C>T	c.(1114-1116)CTT>TTT	p.L372F	POLR3B_uc001tlq.2_Missense_Mutation_p.L314F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	372					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113704147	113704147	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113704147C>T	uc001tuw.2	+	4	697	c.400C>T	c.(400-402)CGG>TGG	p.R134W	TPCN1_uc001tux.2_Missense_Mutation_p.R206W|TPCN1_uc010syt.1_Missense_Mutation_p.R66W	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	134	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
SPG20	23111	broad.mit.edu	37	13	36878722	36878722	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36878722G>T	uc001uvn.2	-	10	2051	c.1781C>A	c.(1780-1782)GCG>GAG	p.A594E	SPG20_uc010ten.1_Missense_Mutation_p.A584E|SPG20_uc001uvm.2_Missense_Mutation_p.A594E|SPG20_uc001uvo.2_Missense_Mutation_p.A594E|SPG20_uc001uvq.2_Missense_Mutation_p.A594E	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	594					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37427777	37427777	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37427777C>A	uc001uvw.2	-	6	1382	c.1039G>T	c.(1039-1041)GCC>TCC	p.A347S	SMAD9_uc001uvx.2_Missense_Mutation_p.A310S|SMAD9_uc010tep.1_Missense_Mutation_p.A140S	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	347	MH2.				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58208453	58208453	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208453C>A	uc001vhq.1	+	1	2665	c.1773C>A	c.(1771-1773)GAC>GAA	p.D591E	PCDH17_uc010aec.1_Missense_Mutation_p.D591E	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	591	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58298735	58298735	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58298735T>C	uc001vhq.1	+						PCDH17_uc010aec.1_Intron|PCDH17_uc001vhr.1_Intron	NM_001040429	NP_001035519			protocadherin 17 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94938678	94938678	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94938678A>G	uc001vlt.2	+	5	1585	c.953A>G	c.(952-954)AAG>AGG	p.K318R	GPC6_uc010tig.1_Missense_Mutation_p.K318R	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	318						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
TPP2	7174	broad.mit.edu	37	13	103288731	103288731	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103288731C>A	uc001vpi.3	+	13	1770	c.1667C>A	c.(1666-1668)CCG>CAG	p.P556Q		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	556					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
ZNF219	51222	broad.mit.edu	37	14	21560052	21560052	+	Silent	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21560052C>G	uc001vzr.2	-	3	1825	c.1404G>C	c.(1402-1404)GGG>GGC	p.G468G	ZNF219_uc001vzs.2_Silent_p.G468G|ZNF219_uc010aik.1_Silent_p.G468G	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	468					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)														---	---	---	---
OR10G2	26534	broad.mit.edu	37	14	22102378	22102378	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102378G>A	uc010tmc.1	-	1	621	c.621C>T	c.(619-621)GAC>GAT	p.D207D		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22979958	22979958	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22979958C>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_5'UTR|uc001wfi.2_5'Flank|uc001wfj.1_5'Flank|uc001wfk.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
NRL	4901	broad.mit.edu	37	14	24551826	24551826	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24551826G>T	uc001wlo.2	-	2	363	c.232C>A	c.(232-234)CTG>ATG	p.L78M	NRL_uc001wlp.2_Missense_Mutation_p.L78M|NRL_uc001wlq.2_Missense_Mutation_p.L78M	NM_006177	NP_006168	P54845	NRL_HUMAN	neural retina leucine zipper	78					response to stimulus|transcription from RNA polymerase II promoter|visual perception	nucleus	leucine zipper domain binding|sequence-specific DNA binding				0				GBM - Glioblastoma multiforme(265;0.0181)														---	---	---	---
FITM1	161247	broad.mit.edu	37	14	24601699	24601699	+	Silent	SNP	C	T	T	rs139067370		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24601699C>T	uc001wmf.2	+	2	644	c.546C>T	c.(544-546)ACC>ACT	p.T182T		NM_203402	NP_981947	A5D6W6	FITM1_HUMAN	fat-inducing transcript 1	182	Extracellular (Potential).				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37180670	37180670	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37180670A>C	uc001wtz.1	-	7	766	c.456T>G	c.(454-456)GGT>GGG	p.G152G		NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial	152	Solcar 2.				lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
ZFYVE1	53349	broad.mit.edu	37	14	73459882	73459882	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73459882C>T	uc001xnm.2	-	4	1812	c.1172G>A	c.(1171-1173)CGG>CAG	p.R391Q	ZFYVE1_uc010arj.2_Missense_Mutation_p.R391Q	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	391						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)														---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75248531	75248531	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75248531C>T	uc001xqj.3	+	4	1909	c.1785C>T	c.(1783-1785)TCC>TCT	p.S595S	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
SLC25A29	123096	broad.mit.edu	37	14	100765194	100765194	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100765194C>T	uc001yha.2	-	2	354	c.63G>A	c.(61-63)CCG>CCA	p.P21P	SLC25A29_uc010twx.1_Intron|SLC25A29_uc010avw.2_Silent_p.P21P	NM_001039355	NP_001034444	Q8N8R3	MCATL_HUMAN	solute carrier family 25, member 29	21	Solcar 1.|Helical; Name=1; (Potential).					integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1		Melanoma(154;0.152)			L-Carnitine(DB00583)													---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33855184	33855184	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33855184T>G	uc001zhi.2	+	11	1189	c.1119T>G	c.(1117-1119)ACT>ACG	p.T373T	RYR3_uc010bar.2_Silent_p.T373T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	373	Cytoplasmic (By similarity).|MIR 5.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
DISP2	85455	broad.mit.edu	37	15	40661112	40661112	+	Silent	SNP	G	A	A	rs140286504	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40661112G>A	uc001zlk.1	+	8	2888	c.2799G>A	c.(2797-2799)GCG>GCA	p.A933A		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	933					smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)														---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90342480	90342480	+	Intron	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90342480G>T	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94983411	94983411	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94983411T>G	uc002btj.2	+	17	2157	c.2092T>G	c.(2092-2094)TTG>GTG	p.L698V	MCTP2_uc010boj.2_Missense_Mutation_p.L427V|MCTP2_uc010bok.2_Intron|MCTP2_uc002btl.2_Missense_Mutation_p.L286V	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	698	Helical; (Potential).				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
OR4F15	390649	broad.mit.edu	37	15	102358857	102358857	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358857A>C	uc010uts.1	+	1	468	c.468A>C	c.(466-468)TCA>TCC	p.S156S		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)															---	---	---	---
WDR24	84219	broad.mit.edu	37	16	737649	737649	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:737649C>A	uc002ciz.1	-	2	1332	c.572G>T	c.(571-573)TGG>TTG	p.W191L		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)																---	---	---	---
TBL3	10607	broad.mit.edu	37	16	2025184	2025184	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2025184T>C	uc002cnu.1	+						TBL3_uc002cnv.1_Intron|TBL3_uc010bsb.1_Intron|TBL3_uc010bsc.1_Intron|TBL3_uc010uvt.1_Intron|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444			transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0																		---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22268113	22268113	+	Silent	SNP	G	T	T	rs112106407		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22268113G>T	uc002dki.2	+	7	1148	c.663G>T	c.(661-663)CCG>CCT	p.P221P	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	221	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	24226123	24226123	+	Intron	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24226123G>A	uc002dmd.2	+						PRKCB_uc002dme.2_Missense_Mutation_p.E670K	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
AQP8	343	broad.mit.edu	37	16	25235898	25235898	+	Splice_Site	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25235898G>A	uc002doc.2	+	4	684	c.602_splice	c.e4+1	p.G201_splice		NM_001169	NP_001160			aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)														---	---	---	---
SLC7A6OS	84138	broad.mit.edu	37	16	68344764	68344764	+	Silent	SNP	A	C	C	rs147089863		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68344764A>C	uc002evw.1	-	1	85	c.66T>G	c.(64-66)GCT>GCG	p.A22A	PRMT7_uc002evx.1_5'Flank|PRMT7_uc002evy.1_5'Flank|PRMT7_uc010vlg.1_5'Flank	NM_032178	NP_115554	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite	22					protein transport	cytoplasm|nucleus				ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)														---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74487204	74487204	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74487204A>T	uc002fcy.3	-	26	3451	c.3401T>A	c.(3400-3402)CTT>CAT	p.L1134H	GLG1_uc002fcx.2_Missense_Mutation_p.L1134H|GLG1_uc002fcw.3_Missense_Mutation_p.L1123H|GLG1_uc002fcz.3_Missense_Mutation_p.L551H	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	1134	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	A	A	rs121913344		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577022G>A	uc002gim.2	-	8	1110	c.916C>T	c.(916-918)CGA>TGA	p.R306*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.R306*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R174*|TP53_uc010cng.1_Nonsense_Mutation_p.R174*|TP53_uc002gii.1_Nonsense_Mutation_p.R174*|TP53_uc010cnh.1_Nonsense_Mutation_p.R306*|TP53_uc010cni.1_Nonsense_Mutation_p.R306*|TP53_uc002gij.2_Nonsense_Mutation_p.R306*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	306	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		R -> Q (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R306*(99)|p.0?(7)|p.?(3)|p.R306R(2)|p.R306fs*39(2)|p.K305fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R306*(MFE296_ENDOMETRIUM)|R306*(HCC1937_BREAST)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KRT28	162605	broad.mit.edu	37	17	38953225	38953225	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38953225G>A	uc002hvh.1	-	5	987	c.921C>T	c.(919-921)ACC>ACT	p.T307T		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	307	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)																---	---	---	---
STAT3	6774	broad.mit.edu	37	17	40485746	40485746	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40485746G>A	uc002hzl.1	-	10	1234	c.994C>T	c.(994-996)CAT>TAT	p.H332Y	STAT3_uc002hzk.1_Missense_Mutation_p.H332Y|STAT3_uc002hzm.1_Missense_Mutation_p.H332Y|STAT3_uc010wgh.1_Missense_Mutation_p.H234Y|STAT3_uc002hzn.1_Missense_Mutation_p.H332Y	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	332					cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)										Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				---	---	---	---
ACBD4	79777	broad.mit.edu	37	17	43213915	43213915	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43213915A>G	uc002iid.2	+	3	481	c.137A>G	c.(136-138)TAC>TGC	p.Y46C	ACBD4_uc010wjj.1_Missense_Mutation_p.Y46C|ACBD4_uc002iie.2_Missense_Mutation_p.Y46C|ACBD4_uc002iif.2_Missense_Mutation_p.Y46C|ACBD4_uc002iic.2_Missense_Mutation_p.Y46C|ACBD4_uc010dae.2_5'UTR	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4	46	ACB.						fatty-acyl-CoA binding			ovary(1)|kidney(1)	2																		---	---	---	---
GPRC5C	55890	broad.mit.edu	37	17	72436661	72436661	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72436661C>A	uc002jks.2	+	1	785	c.746C>A	c.(745-747)ACA>AAA	p.T249K	GPRC5C_uc002jkp.2_Missense_Mutation_p.T294K|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Missense_Mutation_p.T261K|GPRC5C_uc002jkt.2_Missense_Mutation_p.T249K|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	249	Helical; Name=6; (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
C17orf77	146723	broad.mit.edu	37	17	72588200	72588200	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72588200G>A	uc002jla.1	+	3	377	c.15G>A	c.(13-15)GCG>GCA	p.A5A	CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	5						extracellular region					0																		---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65180695	65180695	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180695G>A	uc002lke.1	-	2	2405	c.1181C>T	c.(1180-1182)ACT>ATT	p.T394I		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	384						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9047473	9047473	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9047473T>G	uc002mkp.2	-	5	34362	c.34158A>C	c.(34156-34158)GAA>GAC	p.E11386D		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11388	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
CDC37	11140	broad.mit.edu	37	19	10505732	10505732	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10505732G>A	uc002mof.1	-	5	807	c.691C>T	c.(691-693)CGG>TGG	p.R231W	CDC37_uc002moe.1_Missense_Mutation_p.R186W|CDC37_uc010dxf.1_Missense_Mutation_p.R68W|CDC37_uc002mog.1_Intron|CDC37_uc002moh.2_Missense_Mutation_p.R231W	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	231					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)														---	---	---	---
KLF1	10661	broad.mit.edu	37	19	12996921	12996921	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12996921C>A	uc002mvo.2	-	2	186	c.123G>T	c.(121-123)CCG>CCT	p.P41P		NM_006563	NP_006554	Q13351	KLF1_HUMAN	erythroid Kruppel-like factor	41	Pro-rich.				erythrocyte differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17008738	17008738	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17008738G>A	uc002nfb.2	-	38	5089	c.5057C>T	c.(5056-5058)TCG>TTG	p.S1686L	CPAMD8_uc010xpj.1_5'Flank|CPAMD8_uc002nfd.1_Missense_Mutation_p.S151L	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1639						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
DDX49	54555	broad.mit.edu	37	19	19035507	19035507	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19035507C>T	uc002nkq.1	+	8	985	c.928C>T	c.(928-930)CGG>TGG	p.R310W	HOMER3_uc002nko.1_Intron|HOMER3_uc002nkp.1_Intron|DDX49_uc002nkr.1_RNA|DDX49_uc002nks.1_Missense_Mutation_p.R203W|DDX49_uc002nkt.1_Missense_Mutation_p.R192W	NM_019070	NP_061943	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	310	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			Epithelial(12;0.0289)															---	---	---	---
C19orf2	8725	broad.mit.edu	37	19	30502064	30502064	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30502064C>T	uc002nsr.2	+	9	1129	c.1099C>T	c.(1099-1101)CGT>TGT	p.R367C	C19orf2_uc002nsq.2_Missense_Mutation_p.R349C|C19orf2_uc002nss.2_Missense_Mutation_p.R327C|C19orf2_uc002nst.2_Missense_Mutation_p.R291C	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	367					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF568	374900	broad.mit.edu	37	19	37440970	37440970	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37440970T>G	uc002ofc.2	+	7	1430	c.915T>G	c.(913-915)CCT>CCG	p.P305P	ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Silent_p.P229P|ZNF568_uc010efe.2_Silent_p.P229P|ZNF568_uc010eff.1_Intron	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	305					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
LYPD4	147719	broad.mit.edu	37	19	42343074	42343074	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42343074T>C	uc002orp.1	-	3	1076	c.92A>G	c.(91-93)GAA>GGA	p.E31G	LYPD4_uc002orq.1_Intron	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	31						anchored to membrane|plasma membrane				ovary(1)	1																		---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42471430	42471430	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42471430C>T	uc002osg.2	-	22	3138	c.2984G>A	c.(2983-2985)CGC>CAC	p.R995H	ATP1A3_uc010xwf.1_Missense_Mutation_p.R1006H|ATP1A3_uc010xwg.1_Missense_Mutation_p.R965H|ATP1A3_uc010xwh.1_Missense_Mutation_p.R1008H|ATP1A3_uc002osh.2_Missense_Mutation_p.R995H	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	995	Helical; (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
ZNF233	353355	broad.mit.edu	37	19	44777834	44777834	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44777834C>A	uc002oyz.1	+	5	1148	c.1021C>A	c.(1021-1023)CTC>ATC	p.L341I	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Missense_Mutation_p.L156I	NM_181756	NP_861421	A6NK53	ZN233_HUMAN	zinc finger protein 233	341					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)																---	---	---	---
LILRA3	11026	broad.mit.edu	37	19	54803095	54803095	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54803095C>T	uc002qfd.2	-	4	647	c.582G>A	c.(580-582)TCG>TCA	p.S194S	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Intron	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	194	Ig-like C2-type 2.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
CPXM1	56265	broad.mit.edu	37	20	2774829	2774829	+	3'UTR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2774829G>A	uc002wgu.2	-	14					CPXM1_uc010gas.2_3'UTR	NM_019609	NP_062555			carboxypeptidase X, member 1 precursor						cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4																		---	---	---	---
FAM113A	64773	broad.mit.edu	37	20	2818920	2818920	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2818920C>T	uc002wgz.1	-	6	1296	c.799G>A	c.(799-801)GAC>AAC	p.D267N	FAM113A_uc002whb.1_Missense_Mutation_p.D118N|FAM113A_uc002wha.1_Missense_Mutation_p.D118N|FAM113A_uc010zqa.1_Missense_Mutation_p.D114N|FAM113A_uc002whc.1_Missense_Mutation_p.D216N|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	NM_022760	NP_073597	Q9H1Q7	F113A_HUMAN	hypothetical protein LOC64773	267							hydrolase activity|protein binding			ovary(2)	2																		---	---	---	---
SIGLEC1	6614	broad.mit.edu	37	20	3674309	3674309	+	Missense_Mutation	SNP	C	T	T	rs61734522	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3674309C>T	uc002wja.2	-	13	3293	c.3293G>A	c.(3292-3294)CGG>CAG	p.R1098Q	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.R1098Q	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1098	Ig-like C2-type 11.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15412042	15412042	+	Intron	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15412042A>T	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
C20orf3	57136	broad.mit.edu	37	20	24954292	24954292	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24954292G>A	uc002wty.2	-	4	511	c.410C>T	c.(409-411)TCG>TTG	p.S137L	C20orf3_uc002wtz.2_Missense_Mutation_p.S137L|C20orf3_uc010zsw.1_Missense_Mutation_p.S137L	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3	137	Extracellular (Potential).				biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1																		---	---	---	---
NECAB3	63941	broad.mit.edu	37	20	32248104	32248104	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32248104C>A	uc002wzn.3	-	6	591	c.485G>T	c.(484-486)GGG>GTG	p.G162V	NECAB3_uc002wzl.2_5'UTR|NECAB3_uc002wzm.3_Missense_Mutation_p.G162V|NECAB3_uc002wzo.3_RNA|NECAB3_uc002wzp.3_Missense_Mutation_p.G113V|NECAB3_uc002wzq.3_Missense_Mutation_p.G162V|NECAB3_uc002wzr.3_RNA|NECAB3_uc010geo.2_Missense_Mutation_p.G162V|C20orf144_uc002wzs.1_5'Flank	NM_031232	NP_112509	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	162					antibiotic biosynthetic process|protein metabolic process|protein secretion|regulation of amyloid precursor protein biosynthetic process	endoplasmic reticulum membrane|Golgi cis cisterna|nucleus	calcium ion binding|oxidoreductase activity|protein binding			lung(1)	1																		---	---	---	---
SRC	6714	broad.mit.edu	37	20	36022573	36022573	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36022573C>A	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408			proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)													---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42344707	42344707	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42344707C>T	uc002xlb.1	+	14	2298	c.2083C>T	c.(2083-2085)CGG>TGG	p.R695W	MYBL2_uc010zwj.1_Missense_Mutation_p.R671W	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	695						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62126325	62126325	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62126325C>T	uc002yfd.1	-	3	555	c.454G>A	c.(454-456)GTG>ATG	p.V152M	EEF1A2_uc002yfe.1_Missense_Mutation_p.V152M|EEF1A2_uc010gkg.1_Missense_Mutation_p.V152M	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	152						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
ARFRP1	10139	broad.mit.edu	37	20	62331793	62331793	+	3'UTR	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62331793G>C	uc002yga.2	-	7					ARFRP1_uc002ygc.2_3'UTR|ARFRP1_uc002ygh.3_3'UTR|ARFRP1_uc011abf.1_3'UTR|ARFRP1_uc011abg.1_3'UTR|ARFRP1_uc002yge.2_RNA|ARFRP1_uc002ygd.2_RNA|ARFRP1_uc002ygf.2_3'UTR|ARFRP1_uc002ygg.2_RNA|ARFRP1_uc011abh.1_RNA	NM_003224	NP_003215			ADP-ribosylation factor related protein 1						small GTPase mediated signal transduction	Golgi apparatus|membrane fraction	GTP binding|GTPase activity			breast(1)|skin(1)	2	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)															---	---	---	---
ZDHHC8	29801	broad.mit.edu	37	22	20130417	20130417	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20130417G>A	uc002zrq.2	+	10	1370	c.1264G>A	c.(1264-1266)GCC>ACC	p.A422T	ZDHHC8_uc002zrr.1_Missense_Mutation_p.A422T|ZDHHC8_uc010gsa.2_Missense_Mutation_p.A228T	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	422	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)																	---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25019873	25019873	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25019873A>G	uc003aan.1	+	11	1497	c.1010A>G	c.(1009-1011)GAT>GGT	p.D337G	GGT1_uc003aas.1_Missense_Mutation_p.D337G|GGT1_uc003aat.1_Missense_Mutation_p.D337G|GGT1_uc003aau.1_Missense_Mutation_p.D337G|GGT1_uc003aav.1_Missense_Mutation_p.D337G|GGT1_uc003aaw.1_Missense_Mutation_p.D337G|GGT1_uc003aax.1_Missense_Mutation_p.D337G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	337	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
TAF9B	51616	broad.mit.edu	37	X	77393257	77393257	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77393257A>T	uc004eda.2	-	4	465	c.394T>A	c.(394-396)TTA>ATA	p.L132I		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	132					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0																		---	---	---	---
FAM46D	169966	broad.mit.edu	37	X	79698713	79698713	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79698713C>A	uc004edl.1	+	5	1009	c.675C>A	c.(673-675)ACC>ACA	p.T225T	FAM46D_uc004edm.1_Silent_p.T225T	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	225										lung(2)	2																		---	---	---	---
ESX1	80712	broad.mit.edu	37	X	103495269	103495269	+	Silent	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103495269G>T	uc004ely.2	-	4	919	c.861C>A	c.(859-861)CCC>CCA	p.P287P		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	287	5.|15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
CA6	765	broad.mit.edu	37	1	9009386	9009386	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9009386G>A	uc001apm.2	+	2	168	c.144G>A	c.(142-144)TCG>TCA	p.S48S	CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	48					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22188576	22188576	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22188576G>A	uc001bfj.2	-	38	4813	c.4773C>T	c.(4771-4773)TGC>TGT	p.C1591C	HSPG2_uc009vqd.2_Silent_p.C1592C	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1591	Laminin EGF-like 10.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24418800	24418800	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24418800C>T	uc001bin.3	-	11	1259	c.1096G>A	c.(1096-1098)GAG>AAG	p.E366K	MYOM3_uc001bim.3_Missense_Mutation_p.E23K|MYOM3_uc001bio.2_Missense_Mutation_p.E366K|MYOM3_uc001bip.1_Missense_Mutation_p.E23K	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	366										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
C8A	731	broad.mit.edu	37	1	57347266	57347266	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57347266T>C	uc001cyo.2	+	5	745	c.613T>C	c.(613-615)TAC>CAC	p.Y205H		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	205	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82302724	82302724	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82302724T>G	uc001dit.3	+	3	236	c.55T>G	c.(55-57)TTC>GTC	p.F19V	LPHN2_uc001dis.2_Missense_Mutation_p.F19V|LPHN2_uc001diu.2_Missense_Mutation_p.F19V|LPHN2_uc001div.2_Missense_Mutation_p.F19V|LPHN2_uc009wcd.2_Missense_Mutation_p.F19V	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	19					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
WNT2B	7482	broad.mit.edu	37	1	113058897	113058897	+	Missense_Mutation	SNP	G	A	A	rs35058556	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113058897G>A	uc001ecb.2	+	3	1054	c.539G>A	c.(538-540)CGT>CAT	p.R180H	WNT2B_uc001eca.2_Missense_Mutation_p.R161H|WNT2B_uc009wgg.2_Missense_Mutation_p.R88H	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	180					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152327633	152327633	+	Missense_Mutation	SNP	T	A	A	rs144938115		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327633T>A	uc001ezw.3	-	3	2702	c.2629A>T	c.(2629-2631)AGC>TGC	p.S877C	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	877	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ZBTB7B	51043	broad.mit.edu	37	1	154988280	154988280	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988280C>A	uc001fgk.3	+	3	1302	c.1144C>A	c.(1144-1146)CGA>AGA	p.R382R	ZBTB7B_uc009wpa.2_Silent_p.R382R|ZBTB7B_uc001fgj.3_Silent_p.R416R|ZBTB7B_uc010peq.1_Silent_p.R416R|ZBTB7B_uc001fgl.3_Silent_p.R382R	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	382	C2H2-type 2.				cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
LMX1A	4009	broad.mit.edu	37	1	165175089	165175089	+	Intron	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165175089A>G	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron|LMX1A_uc001gcw.1_Intron|LMX1A_uc001gcx.1_Intron	NM_177398	NP_796372			LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)																	---	---	---	---
POGK	57645	broad.mit.edu	37	1	166819038	166819038	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166819038G>T	uc001gdt.1	+	5	1342	c.1222G>T	c.(1222-1224)GGG>TGG	p.G408W	POGK_uc010ple.1_Missense_Mutation_p.G323W|POGK_uc010plf.1_Missense_Mutation_p.G290W	NM_017542	NP_060012	Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	408	DDE.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
ATP6V1G3	127124	broad.mit.edu	37	1	198509695	198509695	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198509695T>C	uc001gup.2	-						ATP6V1G3_uc009wzd.2_Intron|ATP6V1G3_uc001guo.2_Intron	NM_133262	NP_573569			ATPase, H+ transporting, lysosomal, V1 subunit						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding			central_nervous_system(1)	1																		---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228437778	228437778	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228437778G>A	uc009xez.1	+	14	4190	c.4146G>A	c.(4144-4146)ACG>ACA	p.T1382T	OBSCN_uc001hsn.2_Silent_p.T1382T	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1382	Ig-like 14.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232581434	232581434	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232581434G>A	uc001hvg.2	-	9	3352	c.3194C>T	c.(3193-3195)ACG>ATG	p.T1065M	SIPA1L2_uc001hvf.2_Missense_Mutation_p.T139M	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1065					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)																---	---	---	---
LGALS8	3964	broad.mit.edu	37	1	236708103	236708103	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236708103A>T	uc001hxz.1	+	10	1073	c.692A>T	c.(691-693)AAC>ATC	p.N231I	LGALS8_uc001hxw.1_Missense_Mutation_p.N273I|LGALS8_uc001hxy.1_Missense_Mutation_p.N273I|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.N231I|LGALS8_uc001hyb.1_Missense_Mutation_p.N231I|LGALS8_uc001hyc.1_Missense_Mutation_p.N214I	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	231	Galectin 2.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240555838	240555838	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240555838A>C	uc010pyd.1	+	15	5111	c.4886A>C	c.(4885-4887)AAT>ACT	p.N1629T	FMN2_uc010pye.1_Missense_Mutation_p.N1633T|FMN2_uc010pyf.1_Missense_Mutation_p.N244T|FMN2_uc010pyg.1_Missense_Mutation_p.N225T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1629	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457994	248457994	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457994T>G	uc010pzj.1	-	1	887	c.887A>C	c.(886-888)AAG>ACG	p.K296T		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
OR2M7	391196	broad.mit.edu	37	1	248487429	248487429	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487429A>G	uc010pzk.1	-	1	442	c.442T>C	c.(442-444)TCC>CCC	p.S148P		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1652393	1652393	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652393G>A	uc002qxa.2	-	17	3223	c.3159C>T	c.(3157-3159)TAC>TAT	p.Y1053Y		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1053					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98392446	98392446	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98392446G>A	uc002syh.3	-	32	4409	c.4180C>T	c.(4180-4182)CCT>TCT	p.P1394S		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1394	Lys-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211465372	211465372	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211465372A>C	uc002vee.3	+	15	1775	c.1643A>C	c.(1642-1644)CAG>CCG	p.Q548P	CPS1_uc010fur.2_Missense_Mutation_p.Q554P|CPS1_uc010fus.2_Missense_Mutation_p.Q97P	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	548					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
ACSL3	2181	broad.mit.edu	37	2	223773557	223773557	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223773557T>A	uc002vni.2	+	4	518	c.67T>A	c.(67-69)TTA>ATA	p.L23I	ACSL3_uc002vnj.2_Missense_Mutation_p.L23I	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	23	Helical; Signal-anchor for type III membrane protein; (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)			T	ETV1	prostate								---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225688336	225688336	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225688336G>T	uc010fwz.1	-	28	3304	c.3065C>A	c.(3064-3066)TCT>TAT	p.S1022Y	DOCK10_uc002vob.2_Missense_Mutation_p.S1016Y	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1022							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9027370	9027370	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9027370C>A	uc003brf.1	-	22	3809	c.3133G>T	c.(3133-3135)GCC>TCC	p.A1045S	SRGAP3_uc003brg.1_Missense_Mutation_p.A1021S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	1045					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
PFKFB4	5210	broad.mit.edu	37	3	48587369	48587369	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48587369C>T	uc003ctv.2	-	3	256	c.239G>A	c.(238-240)CGG>CAG	p.R80Q	PFKFB4_uc003ctw.2_5'UTR|PFKFB4_uc010hkc.2_Missense_Mutation_p.R80Q|PFKFB4_uc003ctx.2_Missense_Mutation_p.R37Q|PFKFB4_uc010hkb.2_Missense_Mutation_p.R80Q|PFKFB4_uc011bbm.1_Missense_Mutation_p.R69Q|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	80	6-phosphofructo-2-kinase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)														---	---	---	---
QARS	5859	broad.mit.edu	37	3	49139687	49139687	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49139687A>C	uc003cvx.2	-	7	587	c.582T>G	c.(580-582)GCT>GCG	p.A194A	QARS_uc011bcc.1_5'Flank|QARS_uc011bcd.1_Silent_p.A49A|QARS_uc003cvy.2_Silent_p.A49A|QARS_uc011bce.1_Silent_p.A183A|QARS_uc011bcf.1_Silent_p.A194A	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	194					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)													---	---	---	---
VPRBP	9730	broad.mit.edu	37	3	51457862	51457862	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51457862T>C	uc003dbe.1	-	14	2730	c.2562A>G	c.(2560-2562)ATA>ATG	p.I854M	VPRBP_uc003dbf.1_Missense_Mutation_p.I130M	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	854	LisH.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)														---	---	---	---
SNTN	132203	broad.mit.edu	37	3	63638466	63638466	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63638466C>T	uc003dlr.2	+	1	123	c.103C>T	c.(103-105)CCC>TCC	p.P35S		NM_001080537	NP_001074006	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	35						cilium	calcium ion binding			ovary(1)	1																		---	---	---	---
ARL13B	200894	broad.mit.edu	37	3	93758757	93758757	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93758757T>G	uc003drc.2	+	6	1009	c.723T>G	c.(721-723)GAT>GAG	p.D241E	ARL13B_uc010hop.2_Missense_Mutation_p.D92E|ARL13B_uc003drd.2_Missense_Mutation_p.D134E|ARL13B_uc003dre.2_Missense_Mutation_p.D226E|ARL13B_uc003drf.2_Missense_Mutation_p.D241E|ARL13B_uc003drg.2_Missense_Mutation_p.D138E	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	241	Potential.						GTP binding				0																		---	---	---	---
MRPL47	57129	broad.mit.edu	37	3	179311560	179311560	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179311560T>G	uc003fjz.2	-	5	548	c.526A>C	c.(526-528)ATC>CTC	p.I176L	MRPL47_uc003fka.2_Missense_Mutation_p.I66L|MRPL47_uc003fkb.2_Missense_Mutation_p.I156L	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	176					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)															---	---	---	---
LETM1	3954	broad.mit.edu	37	4	1823927	1823927	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1823927G>T	uc003gdv.2	-	10	1886	c.1589C>A	c.(1588-1590)CCG>CAG	p.P530Q		NM_012318	NP_036450	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane	530	Mitochondrial matrix (Potential).				cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)															---	---	---	---
EVC	2121	broad.mit.edu	37	4	5733156	5733156	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5733156T>C	uc003gil.1	+	4	573	c.389T>C	c.(388-390)CTG>CCG	p.L130P	EVC_uc003gim.1_RNA	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	130					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)																---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16587554	16587554	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16587554G>C	uc003goz.2	-	5	922	c.606C>G	c.(604-606)AAC>AAG	p.N202K	LDB2_uc003gpa.2_Missense_Mutation_p.N202K|LDB2_uc003gpb.2_Missense_Mutation_p.N202K|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Missense_Mutation_p.N202K|LDB2_uc003goy.2_Missense_Mutation_p.N78K|LDB2_uc011bxi.1_Missense_Mutation_p.N78K	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	202							LIM domain binding|transcription cofactor activity				0																		---	---	---	---
SPATA18	132671	broad.mit.edu	37	4	52926960	52926960	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52926960A>T	uc003gzl.2	+	3	484	c.206A>T	c.(205-207)GAT>GTT	p.D69V	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.D69V|SPATA18_uc003gzk.1_Missense_Mutation_p.D69V	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	69					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)															---	---	---	---
KDR	3791	broad.mit.edu	37	4	55968591	55968591	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55968591G>T	uc003has.2	-	14	2374	c.2072C>A	c.(2071-2073)TCT>TAT	p.S691Y	KDR_uc003hat.1_Missense_Mutation_p.S691Y	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	691	Ig-like C2-type 7.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123252486	123252486	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123252486C>T	uc003ieh.2	+	65	11300	c.11255C>T	c.(11254-11256)ACG>ATG	p.T3752M	KIAA1109_uc003iem.2_Missense_Mutation_p.T143M	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3752					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126241072	126241072	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241072G>A	uc003ifj.3	+	1	3506	c.3506G>A	c.(3505-3507)CGG>CAG	p.R1169Q		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1169	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
ZNF827	152485	broad.mit.edu	37	4	146806888	146806888	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146806888T>C	uc003ikn.2	-	4	1737	c.1689A>G	c.(1687-1689)GCA>GCG	p.A563A	ZNF827_uc003ikm.2_Silent_p.A563A|ZNF827_uc010iox.2_Silent_p.A213A	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	563					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)																	---	---	---	---
NPY1R	4886	broad.mit.edu	37	4	164246633	164246633	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164246633T>G	uc003iqm.1	-	3	1243	c.977A>C	c.(976-978)AAC>ACC	p.N326T	NPY1R_uc011cjj.1_Missense_Mutation_p.N83T	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	326	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19839105	19839105	+	5'UTR	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19839105A>C	uc003jgc.2	-	2					CDH18_uc003jgd.2_5'UTR|CDH18_uc011cnm.1_5'UTR	NM_004934	NP_004925			cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
PRDM9	56979	broad.mit.edu	37	5	23522743	23522743	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522743T>G	uc003jgo.2	+	8	813	c.631T>G	c.(631-633)TTC>GTC	p.F211V		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	211					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288677	65288677	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288677T>A	uc003juk.1	+	3	439	c.131T>A	c.(130-132)TTT>TAT	p.F44Y	ERBB2IP_uc003juh.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jui.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003juj.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqy.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqz.1_Missense_Mutation_p.F44Y|ERBB2IP_uc010iwx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jul.1_Missense_Mutation_p.F44Y	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288678	65288678	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288678T>C	uc003juk.1	+	3	440	c.132T>C	c.(130-132)TTT>TTC	p.F44F	ERBB2IP_uc003juh.1_Silent_p.F44F|ERBB2IP_uc003jui.1_Silent_p.F44F|ERBB2IP_uc003juj.1_Silent_p.F44F|ERBB2IP_uc011cqx.1_Silent_p.F44F|ERBB2IP_uc011cqy.1_Silent_p.F44F|ERBB2IP_uc011cqz.1_Silent_p.F44F|ERBB2IP_uc010iwx.1_Silent_p.F44F|ERBB2IP_uc003jul.1_Silent_p.F44F	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89954028	89954028	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89954028G>T	uc003kju.2	+	21	4781	c.4685G>T	c.(4684-4686)AGA>ATA	p.R1562I	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1562	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94764400	94764400	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94764400C>T	uc003kla.1	+	6	796	c.750C>T	c.(748-750)CCC>CCT	p.P250P	FAM81B_uc010jbe.1_Silent_p.P46P	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	250										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
SLC25A46	91137	broad.mit.edu	37	5	110097216	110097216	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110097216C>G	uc003koz.2	+	8	1058	c.991C>G	c.(991-993)CTT>GTT	p.L331V	SLC25A46_uc011cvi.1_Missense_Mutation_p.L240V	NM_138773	NP_620128	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	331	Solcar 2.|Helical; Name=5; (Potential).				transport	integral to membrane|mitochondrial inner membrane					0		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)														---	---	---	---
ZNF300	91975	broad.mit.edu	37	5	150275190	150275190	+	Silent	SNP	C	T	T	rs140923053		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275190C>T	uc003lsy.1	-	6	1878	c.1611G>A	c.(1609-1611)CCG>CCA	p.P537P	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	537	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	345906	345906	+	Missense_Mutation	SNP	G	A	A	rs148279164		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:345906G>A	uc003msx.2	+	5	680	c.241G>A	c.(241-243)GGT>AGT	p.G81S	DUSP22_uc011dhn.1_Missense_Mutation_p.G81S|DUSP22_uc003msy.1_Missense_Mutation_p.G38S	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	81	Tyrosine-protein phosphatase.				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17629488	17629488	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17629488A>C	uc003ncd.1	-	18	3142	c.2942T>G	c.(2941-2943)TTT>TGT	p.F981C	NUP153_uc011dje.1_Missense_Mutation_p.F1012C|NUP153_uc010jpl.1_Missense_Mutation_p.F939C	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	981					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
C6orf134	79969	broad.mit.edu	37	6	30610778	30610778	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30610778C>T	uc003nqu.2	+	10	1008	c.958C>T	c.(958-960)CGT>TGT	p.R320C	C6orf134_uc003nqr.3_Missense_Mutation_p.R320C|C6orf134_uc003rdc.2_Missense_Mutation_p.R320C|C6orf134_uc003nqs.3_Missense_Mutation_p.R297C|C6orf134_uc003rdd.2_Missense_Mutation_p.R297C|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Missense_Mutation_p.R285C|C6orf134_uc003nqv.2_Missense_Mutation_p.R308C	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2	320							tubulin N-acetyltransferase activity				0																		---	---	---	---
HLA-DOB	3112	broad.mit.edu	37	6	32781497	32781497	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32781497T>C	uc003oca.2	-							NM_002120	NP_002111			major histocompatibility complex, class II, DO						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
BRD2	6046	broad.mit.edu	37	6	32945244	32945244	+	Missense_Mutation	SNP	G	T	T	rs141044200		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32945244G>T	uc003ocn.3	+	8	2927	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.R409L|BRD2_uc003ocp.3_Missense_Mutation_p.R289L|BRD2_uc010juh.2_Missense_Mutation_p.R409L	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	409	Bromo 2.				spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5																		---	---	---	---
KCNK5	8645	broad.mit.edu	37	6	39159379	39159379	+	Missense_Mutation	SNP	G	A	A	rs150380866	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39159379G>A	uc003oon.2	-	5	1151	c.787C>T	c.(787-789)CGG>TGG	p.R263W		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	263	Cytoplasmic (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144811268	144811268	+	Missense_Mutation	SNP	G	A	A	rs151173089		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144811268G>A	uc003qkt.2	+	30	4288	c.4196G>A	c.(4195-4197)CGT>CAT	p.R1399H		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1399	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149826767	149826767	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149826767T>C	uc003qmo.1	-	13	1331	c.1301A>G	c.(1300-1302)AAG>AGG	p.K434R	PPIL4_uc010kic.2_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	434					protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	153603773	153603773	+	IGR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603773G>A								RGS17 (151384 upstream) : OPRM1 (727863 downstream)																																			---	---	---	---
LPA	4018	broad.mit.edu	37	6	161010612	161010612	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161010612T>C	uc003qtl.2	-	25	4040	c.3920A>G	c.(3919-3921)CAG>CGG	p.Q1307R		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3815	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
ABCB5	340273	broad.mit.edu	37	7	20685666	20685666	+	5'Flank	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20685666T>G	uc003suw.3	+						ABCB5_uc010kuh.2_Missense_Mutation_p.F296V|ABCB5_uc003suv.3_5'Flank|ABCB5_uc011jyi.1_5'Flank	NM_178559	NP_848654			ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40132537	40132537	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40132537A>T	uc003thh.3	+	13	3671	c.3389A>T	c.(3388-3390)AAC>ATC	p.N1130I	CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_Missense_Mutation_p.N181I|CDK13_uc003thk.2_Missense_Mutation_p.N63I	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1130					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42004616	42004616	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42004616G>T	uc011kbh.1	-	15	4146	c.4055C>A	c.(4054-4056)TCA>TAA	p.S1352*	GLI3_uc011kbg.1_Nonsense_Mutation_p.S1293*	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1352					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
POLD2	5425	broad.mit.edu	37	7	44157562	44157562	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44157562G>A	uc010kxz.2	-	4	972	c.322C>T	c.(322-324)CTG>TTG	p.L108L	POLD2_uc003tke.3_Silent_p.L108L|POLD2_uc010kya.2_Silent_p.L108L|POLD2_uc003tkf.3_Silent_p.L108L	NM_006230	NP_006221	P49005	DPOD2_HUMAN	DNA-directed DNA polymerase delta 2	108					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding			ovary(2)	2																		---	---	---	---
SLC13A1	6561	broad.mit.edu	37	7	122765669	122765669	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122765669A>G	uc003vkm.2	-	11	1219	c.1194T>C	c.(1192-1194)CTT>CTC	p.L398L	SLC13A1_uc010lks.2_Silent_p.L274L	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	398	Helical; (Potential).					integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)													---	---	---	---
OR2F1	26211	broad.mit.edu	37	7	143657178	143657178	+	Missense_Mutation	SNP	G	A	A	rs141187562	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657178G>A	uc003wds.1	+	1	159	c.115G>A	c.(115-117)GTG>ATG	p.V39M		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)																	---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151932911	151932911	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932911T>C	uc003wla.2	-	16	2979	c.2760A>G	c.(2758-2760)GTA>GTG	p.V920V	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	920					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3200843	3200843	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3200843C>T	uc011kwk.1	-	23	3997	c.3607G>A	c.(3607-3609)GAC>AAC	p.D1203N	CSMD1_uc011kwj.1_Missense_Mutation_p.D595N|CSMD1_uc003wqe.2_Missense_Mutation_p.D359N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1203	Extracellular (Potential).|CUB 7.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13258989	13258989	+	Missense_Mutation	SNP	C	T	T	rs150701452		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13258989C>T	uc003wwm.2	-	3	1607	c.1163G>A	c.(1162-1164)CGG>CAG	p.R388Q	DLC1_uc003wwn.2_Missense_Mutation_p.R388Q|DLC1_uc011kxy.1_Missense_Mutation_p.R388Q	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	388					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15480646	15480646	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15480646T>G	uc003wwt.2	+	2	406	c.196T>G	c.(196-198)TTC>GTC	p.F66V	TUSC3_uc003wwr.2_Missense_Mutation_p.F66V|TUSC3_uc003wws.2_Missense_Mutation_p.F66V|TUSC3_uc003wwu.2_Missense_Mutation_p.F66V|TUSC3_uc003wwv.2_Missense_Mutation_p.F66V|TUSC3_uc003www.2_Missense_Mutation_p.F66V|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.F66V	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	66					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
ZMAT4	79698	broad.mit.edu	37	8	40625183	40625183	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40625183C>A	uc003xnr.2	-	3	315	c.169G>T	c.(169-171)GCC>TCC	p.A57S	ZMAT4_uc003xns.2_Missense_Mutation_p.A57S	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	57						nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55541424	55541424	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541424C>G	uc003xsd.1	+	4	5130	c.4982C>G	c.(4981-4983)TCT>TGT	p.S1661C	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1661					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
CRISPLD1	83690	broad.mit.edu	37	8	75944480	75944480	+	3'UTR	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75944480C>A	uc003yan.2	+	15					CRISPLD1_uc011lfk.1_3'UTR|CRISPLD1_uc011lfl.1_3'UTR	NM_031461	NP_113649			cysteine-rich secretory protein LCCL domain							extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87491204	87491204	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87491204C>T	uc003ydu.2	-	7	837	c.677G>A	c.(676-678)AGA>AAA	p.R226K	FAM82B_uc011lfz.1_Missense_Mutation_p.R196K|FAM82B_uc011lga.1_Missense_Mutation_p.R196K	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	226	TPR 2.					microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97614693	97614693	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97614693T>G	uc003yhv.1	+	3	861	c.243T>G	c.(241-243)AGT>AGG	p.S81R	SDC2_uc011lgu.1_Missense_Mutation_p.S52R	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	81	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108306233	108306233	+	Silent	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108306233A>T	uc003ymn.2	-	6	1437	c.969T>A	c.(967-969)GGT>GGA	p.G323G	ANGPT1_uc011lhv.1_Silent_p.G123G|ANGPT1_uc003ymo.2_Silent_p.G322G|ANGPT1_uc003ymp.3_Silent_p.G122G	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	323	Fibrinogen C-terminal.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113317004	113317004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113317004C>T	uc003ynu.2	-	52	8371	c.8212G>A	c.(8212-8214)GAA>AAA	p.E2738K	CSMD3_uc003yns.2_Missense_Mutation_p.E1940K|CSMD3_uc003ynt.2_Missense_Mutation_p.E2698K|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2738	Extracellular (Potential).|Sushi 16.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113318286	113318286	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113318286C>A	uc003ynu.2	-	51	8180	c.8021G>T	c.(8020-8022)TGC>TTC	p.C2674F	CSMD3_uc003yns.2_Missense_Mutation_p.C1876F|CSMD3_uc003ynt.2_Missense_Mutation_p.C2634F|CSMD3_uc011lhx.1_Missense_Mutation_p.C2570F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2674	Extracellular (Potential).|Sushi 15.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113323373	113323373	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323373T>G	uc003ynu.2	-	50	7878	c.7719A>C	c.(7717-7719)GAA>GAC	p.E2573D	CSMD3_uc003yns.2_Missense_Mutation_p.E1775D|CSMD3_uc003ynt.2_Missense_Mutation_p.E2533D|CSMD3_uc011lhx.1_Missense_Mutation_p.E2469D|CSMD3_uc003ynw.1_Missense_Mutation_p.E284D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2573	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121823992	121823992	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823992C>A	uc010mdg.2	-	1	318	c.92G>T	c.(91-93)CGG>CTG	p.R31L	SNTB1_uc003ype.2_Missense_Mutation_p.R31L	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	31	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132052057	132052057	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132052057A>C	uc003ytd.3	-	1	779	c.523T>G	c.(523-525)TTG>GTG	p.L175V	ADCY8_uc010mds.2_Missense_Mutation_p.L175V	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	175	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
DENND3	22898	broad.mit.edu	37	8	142188211	142188211	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142188211G>T	uc003yvy.2	+	16	2790	c.2512G>T	c.(2512-2514)GAC>TAC	p.D838Y	DENND3_uc010mep.2_Missense_Mutation_p.D799Y	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	838										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
NFKBIL2	4796	broad.mit.edu	37	8	145661049	145661049	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145661049G>A	uc011llg.1	-	17	2782	c.2767C>T	c.(2767-2769)CAG>TAG	p.Q923*	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	923					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)															---	---	---	---
KIAA2026	158358	broad.mit.edu	37	9	6007466	6007466	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6007466C>A	uc003zjq.3	-	1	538	c.322G>T	c.(322-324)GTT>TTT	p.V108F		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	108										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18657714	18657714	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18657714G>A	uc003zne.3	+	8	1039	c.912G>A	c.(910-912)ACG>ACA	p.T304T	ADAMTSL1_uc003znb.2_Silent_p.T304T|ADAMTSL1_uc003znc.3_Silent_p.T304T	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	304						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35375189	35375189	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35375189C>T	uc003zwq.2	+	13	1651	c.1359C>T	c.(1357-1359)GAC>GAT	p.D453D	UNC13B_uc003zwr.2_Silent_p.D453D	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	453					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114462251	114462251	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114462251C>T	uc004bfr.2	-	22	3109	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.E953K|C9orf84_uc010mug.2_Missense_Mutation_p.E903K	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	992										ovary(2)	2																		---	---	---	---
RGS3	5998	broad.mit.edu	37	9	116357901	116357901	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116357901C>T	uc004bhq.2	+	25	3476	c.3267C>T	c.(3265-3267)GCC>GCT	p.A1089A	RGS3_uc004bhs.2_Silent_p.A979A|RGS3_uc004bht.2_Silent_p.A808A|RGS3_uc010muy.2_Silent_p.A482A|RGS3_uc004bhv.2_Silent_p.A410A|RGS3_uc004bhw.2_Silent_p.A59A|RGS3_uc011lxh.1_Silent_p.A399A|RGS3_uc004bhx.2_Silent_p.A410A|RGS3_uc004bhz.2_Silent_p.A431A|RGS3_uc004bia.2_Silent_p.A202A	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	1089	RGS.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
QRFP	347148	broad.mit.edu	37	9	133768995	133768995	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133768995C>A	uc011mcb.1	-	1	231	c.231G>T	c.(229-231)TCG>TCT	p.S77S		NM_198180	NP_937823	P83859	OX26_HUMAN	RF(Arg-Phe)amide family 26 amino acid peptide	77					locomotory behavior|neuropeptide signaling pathway|positive regulation of blood pressure|regulation of feeding behavior	extracellular region	neuropeptide hormone activity|orexigenic neuropeptide QRFP receptor binding				0	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)														---	---	---	---
SARDH	1757	broad.mit.edu	37	9	136596596	136596596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136596596G>A	uc004cep.3	-	4	655	c.521C>T	c.(520-522)GCG>GTG	p.A174V	SARDH_uc004ceo.2_Missense_Mutation_p.A174V|SARDH_uc011mdn.1_Missense_Mutation_p.A174V|SARDH_uc011mdo.1_Missense_Mutation_p.A6V	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	174					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)														---	---	---	---
ZMYND11	10771	broad.mit.edu	37	10	288050	288050	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:288050C>T	uc010pzt.1	+	10	1349	c.921C>T	c.(919-921)GAC>GAT	p.D307D	ZMYND11_uc001ifk.2_Silent_p.D306D|ZMYND11_uc010pzu.1_Silent_p.D307D|ZMYND11_uc010pzv.1_Silent_p.D252D|ZMYND11_uc010pzw.1_Silent_p.D222D|ZMYND11_uc001ifm.2_Silent_p.D253D|ZMYND11_uc010pzx.1_Silent_p.D307D|ZMYND11_uc001ifn.2_Silent_p.D253D|ZMYND11_uc009xhg.2_Silent_p.D290D|ZMYND11_uc009xhh.2_Silent_p.D181D|ZMYND11_uc010pzy.1_Silent_p.D159D	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	267	PWWP.				cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
C10orf18	54906	broad.mit.edu	37	10	5766451	5766451	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5766451G>A	uc001iij.2	+	8	931	c.306G>A	c.(304-306)GGG>GGA	p.G102G		NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	102										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15688912	15688912	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15688912G>A	uc001ioc.1	-	12	1140	c.1140C>T	c.(1138-1140)ACC>ACT	p.T380T	ITGA8_uc010qcb.1_Silent_p.T365T	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	380	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63852438	63852438	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63852438C>A	uc001jlt.1	+	10	3242	c.3216C>A	c.(3214-3216)CCC>CCA	p.P1072P		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1072					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88220968	88220968	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88220968C>T	uc001kdo.2	-	10	2889	c.2447G>A	c.(2446-2448)CGG>CAG	p.R816Q	WAPAL_uc009xsv.2_Missense_Mutation_p.R130Q|WAPAL_uc001kdn.2_Missense_Mutation_p.R853Q|WAPAL_uc009xsw.2_Missense_Mutation_p.R810Q	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	816	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
KIF20B	9585	broad.mit.edu	37	10	91533796	91533796	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91533796A>G	uc001kgs.1	+	33	5526	c.5454A>G	c.(5452-5454)ACA>ACG	p.T1818T	KIF20B_uc001kgr.1_Silent_p.T1778T|KIF20B_uc001kgt.1_Silent_p.T1029T|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1818	Interaction with PIN1.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93250996	93250996	+	Missense_Mutation	SNP	G	A	A	rs149760758	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93250996G>A	uc001khl.2	+	12	1331	c.1231G>A	c.(1231-1233)GAT>AAT	p.D411N	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.D415N|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'UTR|HECTD2_uc001khn.1_Missense_Mutation_p.D61N	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	411					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1																		---	---	---	---
ADAM8	101	broad.mit.edu	37	10	135082361	135082361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135082361C>A	uc010qva.1	-	17	1810	c.1759G>T	c.(1759-1761)GGG>TGG	p.G587W	ADAM8_uc010quz.1_Missense_Mutation_p.G652W|ADAM8_uc009ybi.2_Intron			P78325	ADAM8_HUMAN	SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);	587					integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity			large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)														---	---	---	---
KRTAP5-5	439915	broad.mit.edu	37	11	1651127	1651127	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651127C>T	uc001lty.2	+	1	95	c.57C>T	c.(55-57)TCC>TCT	p.S19S		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	19						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32632734	32632734	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32632734C>T	uc001mtv.2	-	17	3018	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	992										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
OR4C13	283092	broad.mit.edu	37	11	49974468	49974468	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974468C>T	uc010rhz.1	+	1	494	c.494C>T	c.(493-495)CCT>CTT	p.P165L		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4																		---	---	---	---
OR5D13	390142	broad.mit.edu	37	11	55541130	55541130	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541130T>G	uc010ril.1	+	1	217	c.217T>G	c.(217-219)TTC>GTC	p.F73V		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)																---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61070051	61070051	+	Intron	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61070051T>G	uc001nrc.3	-						DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Intron	NM_001923	NP_001914			damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
C11orf9	745	broad.mit.edu	37	11	61539366	61539366	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61539366T>C	uc001nsc.1	+	7	1153	c.1057T>C	c.(1057-1059)TGG>CGG	p.W353R	C11orf9_uc001nse.1_Missense_Mutation_p.W344R	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	353	NDT80.				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1																		---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62299903	62299903	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62299903G>A	uc001ntl.2	-	5	2286	c.1986C>T	c.(1984-1986)CCC>CCT	p.P662P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	662					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
SLC22A6	9356	broad.mit.edu	37	11	62747361	62747361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62747361C>A	uc001nwk.2	-	7	1404	c.1097G>T	c.(1096-1098)AGC>ATC	p.S366I	SLC22A6_uc001nwl.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwj.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwm.2_Missense_Mutation_p.S366I	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	366	Extracellular (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0																		---	---	---	---
ZFPL1	7542	broad.mit.edu	37	11	64854058	64854058	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64854058G>A	uc001ocq.1	+	4	551	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	CDCA5_uc001ocp.2_5'Flank	NM_006782	NP_006773	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	129	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|vesicle-mediated transport	Golgi apparatus|integral to membrane|nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64875710	64875710	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64875710A>G	uc001ocr.1	+	5	807	c.767A>G	c.(766-768)GAG>GGG	p.E256G	C11orf2_uc001ocs.1_Missense_Mutation_p.E132G	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	256					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
SLC36A4	120103	broad.mit.edu	37	11	92918925	92918925	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92918925A>T	uc001pdn.2	-	2	208	c.111T>A	c.(109-111)GAT>GAA	p.D37E	SLC36A4_uc001pdm.2_5'UTR	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	37					L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120811160	120811160	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120811160C>T	uc001pxn.2	+	14	1868	c.1581C>T	c.(1579-1581)CGC>CGT	p.R527R	GRIK4_uc009zav.1_Silent_p.R527R|GRIK4_uc009zaw.1_Silent_p.R527R|GRIK4_uc009zax.1_Silent_p.R527R	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	527	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2558239	2558239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2558239G>A	uc009zdu.1	+	4	888	c.575G>A	c.(574-576)CGC>CAC	p.R192H	CACNA1C_uc009zdv.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkb.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkc.2_Missense_Mutation_p.R192H|CACNA1C_uc001qke.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkf.2_Missense_Mutation_p.R192H|CACNA1C_uc001qjz.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkd.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkg.2_Missense_Mutation_p.R192H|CACNA1C_uc009zdw.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkh.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkl.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkn.2_Missense_Mutation_p.R192H|CACNA1C_uc001qko.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkp.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkr.2_Missense_Mutation_p.R192H|CACNA1C_uc001qku.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkq.2_Missense_Mutation_p.R192H|CACNA1C_uc001qks.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkt.2_Missense_Mutation_p.R192H|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	192	I.|Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
A2M	2	broad.mit.edu	37	12	9231877	9231877	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9231877A>C	uc001qvk.1	-	25	3195	c.3082T>G	c.(3082-3084)TTT>GTT	p.F1028V	A2M_uc001qvj.1_Missense_Mutation_p.F70V|A2M_uc009zgk.1_Missense_Mutation_p.F878V	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1028					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21028196	21028196	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028196C>A	uc001rek.2	+	8	881	c.755C>A	c.(754-756)TCT>TAT	p.S252Y	SLCO1B3_uc001rel.2_Missense_Mutation_p.S252Y|SLCO1B3_uc010sil.1_Missense_Mutation_p.S252Y|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.S77Y	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	252	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21051412	21051412	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21051412G>C	uc001rek.2	+	13	1851	c.1725G>C	c.(1723-1725)CAG>CAC	p.Q575H	SLCO1B3_uc001rel.2_Missense_Mutation_p.Q575H|SLCO1B3_uc010sil.1_Missense_Mutation_p.Q575H|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.Q400H	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	575	Helical; Name=11; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
HELB	92797	broad.mit.edu	37	12	66725385	66725385	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725385G>T	uc001sti.2	+	12	3150	c.3122G>T	c.(3121-3123)TGT>TTT	p.C1041F	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1041					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)														---	---	---	---
CLLU1OS	574016	broad.mit.edu	37	12	92814941	92814941	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92814941G>A	uc001tcb.1	-	3	153	c.151C>T	c.(151-153)CTA>TTA	p.L51L	CLLU1_uc001tcc.2_5'Flank|CLLU1_uc001tcd.2_5'Flank|CLLU1_uc001tce.1_5'Flank|CLLU1_uc001tcf.2_5'Flank	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	51											0																		---	---	---	---
ANO4	121601	broad.mit.edu	37	12	101520783	101520783	+	Missense_Mutation	SNP	C	T	T	rs139827573		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101520783C>T	uc010svm.1	+	27	3375	c.2803C>T	c.(2803-2805)CGT>TGT	p.R935C	ANO4_uc001thw.2_Missense_Mutation_p.R900C|ANO4_uc001thx.2_Missense_Mutation_p.R935C|ANO4_uc001thy.2_Missense_Mutation_p.R455C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6															HNSCC(74;0.22)			---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113704147	113704147	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113704147C>T	uc001tuw.2	+	4	697	c.400C>T	c.(400-402)CGG>TGG	p.R134W	TPCN1_uc001tux.2_Missense_Mutation_p.R206W|TPCN1_uc010syt.1_Missense_Mutation_p.R66W	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	134	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
SPG20	23111	broad.mit.edu	37	13	36878722	36878722	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36878722G>T	uc001uvn.2	-	10	2051	c.1781C>A	c.(1780-1782)GCG>GAG	p.A594E	SPG20_uc010ten.1_Missense_Mutation_p.A584E|SPG20_uc001uvm.2_Missense_Mutation_p.A594E|SPG20_uc001uvo.2_Missense_Mutation_p.A594E|SPG20_uc001uvq.2_Missense_Mutation_p.A594E	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	594					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37427777	37427777	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37427777C>A	uc001uvw.2	-	6	1382	c.1039G>T	c.(1039-1041)GCC>TCC	p.A347S	SMAD9_uc001uvx.2_Missense_Mutation_p.A310S|SMAD9_uc010tep.1_Missense_Mutation_p.A140S	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	347	MH2.				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58208453	58208453	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208453C>A	uc001vhq.1	+	1	2665	c.1773C>A	c.(1771-1773)GAC>GAA	p.D591E	PCDH17_uc010aec.1_Missense_Mutation_p.D591E	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	591	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58298735	58298735	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58298735T>C	uc001vhq.1	+						PCDH17_uc010aec.1_Intron|PCDH17_uc001vhr.1_Intron	NM_001040429	NP_001035519			protocadherin 17 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94938678	94938678	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94938678A>G	uc001vlt.2	+	5	1585	c.953A>G	c.(952-954)AAG>AGG	p.K318R	GPC6_uc010tig.1_Missense_Mutation_p.K318R	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	318						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
TPP2	7174	broad.mit.edu	37	13	103288731	103288731	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103288731C>A	uc001vpi.3	+	13	1770	c.1667C>A	c.(1666-1668)CCG>CAG	p.P556Q		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	556					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
ZNF219	51222	broad.mit.edu	37	14	21560052	21560052	+	Silent	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21560052C>G	uc001vzr.2	-	3	1825	c.1404G>C	c.(1402-1404)GGG>GGC	p.G468G	ZNF219_uc001vzs.2_Silent_p.G468G|ZNF219_uc010aik.1_Silent_p.G468G	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	468					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)														---	---	---	---
OR10G2	26534	broad.mit.edu	37	14	22102378	22102378	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102378G>A	uc010tmc.1	-	1	621	c.621C>T	c.(619-621)GAC>GAT	p.D207D		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22979958	22979958	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22979958C>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_5'UTR|uc001wfi.2_5'Flank|uc001wfj.1_5'Flank|uc001wfk.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
NRL	4901	broad.mit.edu	37	14	24551826	24551826	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24551826G>T	uc001wlo.2	-	2	363	c.232C>A	c.(232-234)CTG>ATG	p.L78M	NRL_uc001wlp.2_Missense_Mutation_p.L78M|NRL_uc001wlq.2_Missense_Mutation_p.L78M	NM_006177	NP_006168	P54845	NRL_HUMAN	neural retina leucine zipper	78					response to stimulus|transcription from RNA polymerase II promoter|visual perception	nucleus	leucine zipper domain binding|sequence-specific DNA binding				0				GBM - Glioblastoma multiforme(265;0.0181)														---	---	---	---
FITM1	161247	broad.mit.edu	37	14	24601699	24601699	+	Silent	SNP	C	T	T	rs139067370		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24601699C>T	uc001wmf.2	+	2	644	c.546C>T	c.(544-546)ACC>ACT	p.T182T		NM_203402	NP_981947	A5D6W6	FITM1_HUMAN	fat-inducing transcript 1	182	Extracellular (Potential).				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37180670	37180670	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37180670A>C	uc001wtz.1	-	7	766	c.456T>G	c.(454-456)GGT>GGG	p.G152G		NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial	152	Solcar 2.				lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
ZFYVE1	53349	broad.mit.edu	37	14	73459882	73459882	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73459882C>T	uc001xnm.2	-	4	1812	c.1172G>A	c.(1171-1173)CGG>CAG	p.R391Q	ZFYVE1_uc010arj.2_Missense_Mutation_p.R391Q	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	391						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)														---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75248531	75248531	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75248531C>T	uc001xqj.3	+	4	1909	c.1785C>T	c.(1783-1785)TCC>TCT	p.S595S	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
SLC25A29	123096	broad.mit.edu	37	14	100765194	100765194	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100765194C>T	uc001yha.2	-	2	354	c.63G>A	c.(61-63)CCG>CCA	p.P21P	SLC25A29_uc010twx.1_Intron|SLC25A29_uc010avw.2_Silent_p.P21P	NM_001039355	NP_001034444	Q8N8R3	MCATL_HUMAN	solute carrier family 25, member 29	21	Solcar 1.|Helical; Name=1; (Potential).					integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1		Melanoma(154;0.152)			L-Carnitine(DB00583)													---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33855184	33855184	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33855184T>G	uc001zhi.2	+	11	1189	c.1119T>G	c.(1117-1119)ACT>ACG	p.T373T	RYR3_uc010bar.2_Silent_p.T373T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	373	Cytoplasmic (By similarity).|MIR 5.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
DISP2	85455	broad.mit.edu	37	15	40661112	40661112	+	Silent	SNP	G	A	A	rs140286504	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40661112G>A	uc001zlk.1	+	8	2888	c.2799G>A	c.(2797-2799)GCG>GCA	p.A933A		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	933					smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)														---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90342480	90342480	+	Intron	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90342480G>T	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94983411	94983411	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94983411T>G	uc002btj.2	+	17	2157	c.2092T>G	c.(2092-2094)TTG>GTG	p.L698V	MCTP2_uc010boj.2_Missense_Mutation_p.L427V|MCTP2_uc010bok.2_Intron|MCTP2_uc002btl.2_Missense_Mutation_p.L286V	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	698	Helical; (Potential).				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
OR4F15	390649	broad.mit.edu	37	15	102358857	102358857	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358857A>C	uc010uts.1	+	1	468	c.468A>C	c.(466-468)TCA>TCC	p.S156S		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)															---	---	---	---
WDR24	84219	broad.mit.edu	37	16	737649	737649	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:737649C>A	uc002ciz.1	-	2	1332	c.572G>T	c.(571-573)TGG>TTG	p.W191L		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)																---	---	---	---
TBL3	10607	broad.mit.edu	37	16	2025184	2025184	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2025184T>C	uc002cnu.1	+						TBL3_uc002cnv.1_Intron|TBL3_uc010bsb.1_Intron|TBL3_uc010bsc.1_Intron|TBL3_uc010uvt.1_Intron|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444			transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0																		---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22268113	22268113	+	Silent	SNP	G	T	T	rs112106407		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22268113G>T	uc002dki.2	+	7	1148	c.663G>T	c.(661-663)CCG>CCT	p.P221P	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	221	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	24226123	24226123	+	Intron	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24226123G>A	uc002dmd.2	+						PRKCB_uc002dme.2_Missense_Mutation_p.E670K	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
AQP8	343	broad.mit.edu	37	16	25235898	25235898	+	Splice_Site	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25235898G>A	uc002doc.2	+	4	684	c.602_splice	c.e4+1	p.G201_splice		NM_001169	NP_001160			aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)														---	---	---	---
SLC7A6OS	84138	broad.mit.edu	37	16	68344764	68344764	+	Silent	SNP	A	C	C	rs147089863		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68344764A>C	uc002evw.1	-	1	85	c.66T>G	c.(64-66)GCT>GCG	p.A22A	PRMT7_uc002evx.1_5'Flank|PRMT7_uc002evy.1_5'Flank|PRMT7_uc010vlg.1_5'Flank	NM_032178	NP_115554	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite	22					protein transport	cytoplasm|nucleus				ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)														---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74487204	74487204	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74487204A>T	uc002fcy.3	-	26	3451	c.3401T>A	c.(3400-3402)CTT>CAT	p.L1134H	GLG1_uc002fcx.2_Missense_Mutation_p.L1134H|GLG1_uc002fcw.3_Missense_Mutation_p.L1123H|GLG1_uc002fcz.3_Missense_Mutation_p.L551H	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	1134	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	A	A	rs121913344		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577022G>A	uc002gim.2	-	8	1110	c.916C>T	c.(916-918)CGA>TGA	p.R306*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.R306*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R174*|TP53_uc010cng.1_Nonsense_Mutation_p.R174*|TP53_uc002gii.1_Nonsense_Mutation_p.R174*|TP53_uc010cnh.1_Nonsense_Mutation_p.R306*|TP53_uc010cni.1_Nonsense_Mutation_p.R306*|TP53_uc002gij.2_Nonsense_Mutation_p.R306*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	306	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		R -> Q (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R306*(99)|p.0?(7)|p.?(3)|p.R306R(2)|p.R306fs*39(2)|p.K305fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R306*(MFE296_ENDOMETRIUM)|R306*(HCC1937_BREAST)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KRT28	162605	broad.mit.edu	37	17	38953225	38953225	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38953225G>A	uc002hvh.1	-	5	987	c.921C>T	c.(919-921)ACC>ACT	p.T307T		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	307	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)																---	---	---	---
STAT3	6774	broad.mit.edu	37	17	40485746	40485746	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40485746G>A	uc002hzl.1	-	10	1234	c.994C>T	c.(994-996)CAT>TAT	p.H332Y	STAT3_uc002hzk.1_Missense_Mutation_p.H332Y|STAT3_uc002hzm.1_Missense_Mutation_p.H332Y|STAT3_uc010wgh.1_Missense_Mutation_p.H234Y|STAT3_uc002hzn.1_Missense_Mutation_p.H332Y	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	332					cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)										Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				---	---	---	---
ACBD4	79777	broad.mit.edu	37	17	43213915	43213915	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43213915A>G	uc002iid.2	+	3	481	c.137A>G	c.(136-138)TAC>TGC	p.Y46C	ACBD4_uc010wjj.1_Missense_Mutation_p.Y46C|ACBD4_uc002iie.2_Missense_Mutation_p.Y46C|ACBD4_uc002iif.2_Missense_Mutation_p.Y46C|ACBD4_uc002iic.2_Missense_Mutation_p.Y46C|ACBD4_uc010dae.2_5'UTR	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4	46	ACB.						fatty-acyl-CoA binding			ovary(1)|kidney(1)	2																		---	---	---	---
GPRC5C	55890	broad.mit.edu	37	17	72436661	72436661	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72436661C>A	uc002jks.2	+	1	785	c.746C>A	c.(745-747)ACA>AAA	p.T249K	GPRC5C_uc002jkp.2_Missense_Mutation_p.T294K|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Missense_Mutation_p.T261K|GPRC5C_uc002jkt.2_Missense_Mutation_p.T249K|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	249	Helical; Name=6; (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
C17orf77	146723	broad.mit.edu	37	17	72588200	72588200	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72588200G>A	uc002jla.1	+	3	377	c.15G>A	c.(13-15)GCG>GCA	p.A5A	CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	5						extracellular region					0																		---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65180695	65180695	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180695G>A	uc002lke.1	-	2	2405	c.1181C>T	c.(1180-1182)ACT>ATT	p.T394I		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	384						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9047473	9047473	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9047473T>G	uc002mkp.2	-	5	34362	c.34158A>C	c.(34156-34158)GAA>GAC	p.E11386D		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11388	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
CDC37	11140	broad.mit.edu	37	19	10505732	10505732	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10505732G>A	uc002mof.1	-	5	807	c.691C>T	c.(691-693)CGG>TGG	p.R231W	CDC37_uc002moe.1_Missense_Mutation_p.R186W|CDC37_uc010dxf.1_Missense_Mutation_p.R68W|CDC37_uc002mog.1_Intron|CDC37_uc002moh.2_Missense_Mutation_p.R231W	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	231					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)														---	---	---	---
KLF1	10661	broad.mit.edu	37	19	12996921	12996921	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12996921C>A	uc002mvo.2	-	2	186	c.123G>T	c.(121-123)CCG>CCT	p.P41P		NM_006563	NP_006554	Q13351	KLF1_HUMAN	erythroid Kruppel-like factor	41	Pro-rich.				erythrocyte differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17008738	17008738	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17008738G>A	uc002nfb.2	-	38	5089	c.5057C>T	c.(5056-5058)TCG>TTG	p.S1686L	CPAMD8_uc010xpj.1_5'Flank|CPAMD8_uc002nfd.1_Missense_Mutation_p.S151L	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1639						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
DDX49	54555	broad.mit.edu	37	19	19035507	19035507	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19035507C>T	uc002nkq.1	+	8	985	c.928C>T	c.(928-930)CGG>TGG	p.R310W	HOMER3_uc002nko.1_Intron|HOMER3_uc002nkp.1_Intron|DDX49_uc002nkr.1_RNA|DDX49_uc002nks.1_Missense_Mutation_p.R203W|DDX49_uc002nkt.1_Missense_Mutation_p.R192W	NM_019070	NP_061943	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	310	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			Epithelial(12;0.0289)															---	---	---	---
C19orf2	8725	broad.mit.edu	37	19	30502064	30502064	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30502064C>T	uc002nsr.2	+	9	1129	c.1099C>T	c.(1099-1101)CGT>TGT	p.R367C	C19orf2_uc002nsq.2_Missense_Mutation_p.R349C|C19orf2_uc002nss.2_Missense_Mutation_p.R327C|C19orf2_uc002nst.2_Missense_Mutation_p.R291C	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	367					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF568	374900	broad.mit.edu	37	19	37440970	37440970	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37440970T>G	uc002ofc.2	+	7	1430	c.915T>G	c.(913-915)CCT>CCG	p.P305P	ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Silent_p.P229P|ZNF568_uc010efe.2_Silent_p.P229P|ZNF568_uc010eff.1_Intron	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	305					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
LYPD4	147719	broad.mit.edu	37	19	42343074	42343074	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42343074T>C	uc002orp.1	-	3	1076	c.92A>G	c.(91-93)GAA>GGA	p.E31G	LYPD4_uc002orq.1_Intron	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	31						anchored to membrane|plasma membrane				ovary(1)	1																		---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42471430	42471430	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42471430C>T	uc002osg.2	-	22	3138	c.2984G>A	c.(2983-2985)CGC>CAC	p.R995H	ATP1A3_uc010xwf.1_Missense_Mutation_p.R1006H|ATP1A3_uc010xwg.1_Missense_Mutation_p.R965H|ATP1A3_uc010xwh.1_Missense_Mutation_p.R1008H|ATP1A3_uc002osh.2_Missense_Mutation_p.R995H	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	995	Helical; (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
ZNF233	353355	broad.mit.edu	37	19	44777834	44777834	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44777834C>A	uc002oyz.1	+	5	1148	c.1021C>A	c.(1021-1023)CTC>ATC	p.L341I	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Missense_Mutation_p.L156I	NM_181756	NP_861421	A6NK53	ZN233_HUMAN	zinc finger protein 233	341					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)																---	---	---	---
LILRA3	11026	broad.mit.edu	37	19	54803095	54803095	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54803095C>T	uc002qfd.2	-	4	647	c.582G>A	c.(580-582)TCG>TCA	p.S194S	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Intron	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	194	Ig-like C2-type 2.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
CPXM1	56265	broad.mit.edu	37	20	2774829	2774829	+	3'UTR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2774829G>A	uc002wgu.2	-	14					CPXM1_uc010gas.2_3'UTR	NM_019609	NP_062555			carboxypeptidase X, member 1 precursor						cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4																		---	---	---	---
FAM113A	64773	broad.mit.edu	37	20	2818920	2818920	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2818920C>T	uc002wgz.1	-	6	1296	c.799G>A	c.(799-801)GAC>AAC	p.D267N	FAM113A_uc002whb.1_Missense_Mutation_p.D118N|FAM113A_uc002wha.1_Missense_Mutation_p.D118N|FAM113A_uc010zqa.1_Missense_Mutation_p.D114N|FAM113A_uc002whc.1_Missense_Mutation_p.D216N|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	NM_022760	NP_073597	Q9H1Q7	F113A_HUMAN	hypothetical protein LOC64773	267							hydrolase activity|protein binding			ovary(2)	2																		---	---	---	---
SIGLEC1	6614	broad.mit.edu	37	20	3674309	3674309	+	Missense_Mutation	SNP	C	T	T	rs61734522	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3674309C>T	uc002wja.2	-	13	3293	c.3293G>A	c.(3292-3294)CGG>CAG	p.R1098Q	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.R1098Q	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1098	Ig-like C2-type 11.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15412042	15412042	+	Intron	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15412042A>T	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
C20orf3	57136	broad.mit.edu	37	20	24954292	24954292	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24954292G>A	uc002wty.2	-	4	511	c.410C>T	c.(409-411)TCG>TTG	p.S137L	C20orf3_uc002wtz.2_Missense_Mutation_p.S137L|C20orf3_uc010zsw.1_Missense_Mutation_p.S137L	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3	137	Extracellular (Potential).				biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1																		---	---	---	---
NECAB3	63941	broad.mit.edu	37	20	32248104	32248104	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32248104C>A	uc002wzn.3	-	6	591	c.485G>T	c.(484-486)GGG>GTG	p.G162V	NECAB3_uc002wzl.2_5'UTR|NECAB3_uc002wzm.3_Missense_Mutation_p.G162V|NECAB3_uc002wzo.3_RNA|NECAB3_uc002wzp.3_Missense_Mutation_p.G113V|NECAB3_uc002wzq.3_Missense_Mutation_p.G162V|NECAB3_uc002wzr.3_RNA|NECAB3_uc010geo.2_Missense_Mutation_p.G162V|C20orf144_uc002wzs.1_5'Flank	NM_031232	NP_112509	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	162					antibiotic biosynthetic process|protein metabolic process|protein secretion|regulation of amyloid precursor protein biosynthetic process	endoplasmic reticulum membrane|Golgi cis cisterna|nucleus	calcium ion binding|oxidoreductase activity|protein binding			lung(1)	1																		---	---	---	---
SRC	6714	broad.mit.edu	37	20	36022573	36022573	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36022573C>A	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408			proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)													---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42344707	42344707	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42344707C>T	uc002xlb.1	+	14	2298	c.2083C>T	c.(2083-2085)CGG>TGG	p.R695W	MYBL2_uc010zwj.1_Missense_Mutation_p.R671W	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	695						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62126325	62126325	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62126325C>T	uc002yfd.1	-	3	555	c.454G>A	c.(454-456)GTG>ATG	p.V152M	EEF1A2_uc002yfe.1_Missense_Mutation_p.V152M|EEF1A2_uc010gkg.1_Missense_Mutation_p.V152M	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	152						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
ARFRP1	10139	broad.mit.edu	37	20	62331793	62331793	+	3'UTR	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62331793G>C	uc002yga.2	-	7					ARFRP1_uc002ygc.2_3'UTR|ARFRP1_uc002ygh.3_3'UTR|ARFRP1_uc011abf.1_3'UTR|ARFRP1_uc011abg.1_3'UTR|ARFRP1_uc002yge.2_RNA|ARFRP1_uc002ygd.2_RNA|ARFRP1_uc002ygf.2_3'UTR|ARFRP1_uc002ygg.2_RNA|ARFRP1_uc011abh.1_RNA	NM_003224	NP_003215			ADP-ribosylation factor related protein 1						small GTPase mediated signal transduction	Golgi apparatus|membrane fraction	GTP binding|GTPase activity			breast(1)|skin(1)	2	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)															---	---	---	---
ZDHHC8	29801	broad.mit.edu	37	22	20130417	20130417	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20130417G>A	uc002zrq.2	+	10	1370	c.1264G>A	c.(1264-1266)GCC>ACC	p.A422T	ZDHHC8_uc002zrr.1_Missense_Mutation_p.A422T|ZDHHC8_uc010gsa.2_Missense_Mutation_p.A228T	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	422	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)																	---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25019873	25019873	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25019873A>G	uc003aan.1	+	11	1497	c.1010A>G	c.(1009-1011)GAT>GGT	p.D337G	GGT1_uc003aas.1_Missense_Mutation_p.D337G|GGT1_uc003aat.1_Missense_Mutation_p.D337G|GGT1_uc003aau.1_Missense_Mutation_p.D337G|GGT1_uc003aav.1_Missense_Mutation_p.D337G|GGT1_uc003aaw.1_Missense_Mutation_p.D337G|GGT1_uc003aax.1_Missense_Mutation_p.D337G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	337	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
TAF9B	51616	broad.mit.edu	37	X	77393257	77393257	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77393257A>T	uc004eda.2	-	4	465	c.394T>A	c.(394-396)TTA>ATA	p.L132I		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	132					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0																		---	---	---	---
FAM46D	169966	broad.mit.edu	37	X	79698713	79698713	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79698713C>A	uc004edl.1	+	5	1009	c.675C>A	c.(673-675)ACC>ACA	p.T225T	FAM46D_uc004edm.1_Silent_p.T225T	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	225										lung(2)	2																		---	---	---	---
ESX1	80712	broad.mit.edu	37	X	103495269	103495269	+	Silent	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103495269G>T	uc004ely.2	-	4	919	c.861C>A	c.(859-861)CCC>CCA	p.P287P		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	287	5.|15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
CA6	765	broad.mit.edu	37	1	9009386	9009386	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9009386G>A	uc001apm.2	+	2	168	c.144G>A	c.(142-144)TCG>TCA	p.S48S	CA6_uc009vmn.2_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	48					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22188576	22188576	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22188576G>A	uc001bfj.2	-	38	4813	c.4773C>T	c.(4771-4773)TGC>TGT	p.C1591C	HSPG2_uc009vqd.2_Silent_p.C1592C	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1591	Laminin EGF-like 10.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
MYOM3	127294	broad.mit.edu	37	1	24418800	24418800	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24418800C>T	uc001bin.3	-	11	1259	c.1096G>A	c.(1096-1098)GAG>AAG	p.E366K	MYOM3_uc001bim.3_Missense_Mutation_p.E23K|MYOM3_uc001bio.2_Missense_Mutation_p.E366K|MYOM3_uc001bip.1_Missense_Mutation_p.E23K	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	366										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---
C8A	731	broad.mit.edu	37	1	57347266	57347266	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57347266T>C	uc001cyo.2	+	5	745	c.613T>C	c.(613-615)TAC>CAC	p.Y205H		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	205	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82302724	82302724	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82302724T>G	uc001dit.3	+	3	236	c.55T>G	c.(55-57)TTC>GTC	p.F19V	LPHN2_uc001dis.2_Missense_Mutation_p.F19V|LPHN2_uc001diu.2_Missense_Mutation_p.F19V|LPHN2_uc001div.2_Missense_Mutation_p.F19V|LPHN2_uc009wcd.2_Missense_Mutation_p.F19V	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	19					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
WNT2B	7482	broad.mit.edu	37	1	113058897	113058897	+	Missense_Mutation	SNP	G	A	A	rs35058556	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113058897G>A	uc001ecb.2	+	3	1054	c.539G>A	c.(538-540)CGT>CAT	p.R180H	WNT2B_uc001eca.2_Missense_Mutation_p.R161H|WNT2B_uc009wgg.2_Missense_Mutation_p.R88H	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	180					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152327633	152327633	+	Missense_Mutation	SNP	T	A	A	rs144938115		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327633T>A	uc001ezw.3	-	3	2702	c.2629A>T	c.(2629-2631)AGC>TGC	p.S877C	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	877	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
ZBTB7B	51043	broad.mit.edu	37	1	154988280	154988280	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988280C>A	uc001fgk.3	+	3	1302	c.1144C>A	c.(1144-1146)CGA>AGA	p.R382R	ZBTB7B_uc009wpa.2_Silent_p.R382R|ZBTB7B_uc001fgj.3_Silent_p.R416R|ZBTB7B_uc010peq.1_Silent_p.R416R|ZBTB7B_uc001fgl.3_Silent_p.R382R	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	382	C2H2-type 2.				cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
LMX1A	4009	broad.mit.edu	37	1	165175089	165175089	+	Intron	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165175089A>G	uc001gcy.1	-						LMX1A_uc001gcz.1_Intron|LMX1A_uc001gcw.1_Intron|LMX1A_uc001gcx.1_Intron	NM_177398	NP_796372			LIM homeobox transcription factor 1, alpha							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(3)|upper_aerodigestive_tract(1)|pancreas(1)	5	all_hematologic(923;0.248)																	---	---	---	---
POGK	57645	broad.mit.edu	37	1	166819038	166819038	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166819038G>T	uc001gdt.1	+	5	1342	c.1222G>T	c.(1222-1224)GGG>TGG	p.G408W	POGK_uc010ple.1_Missense_Mutation_p.G323W|POGK_uc010plf.1_Missense_Mutation_p.G290W	NM_017542	NP_060012	Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	408	DDE.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
ATP6V1G3	127124	broad.mit.edu	37	1	198509695	198509695	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198509695T>C	uc001gup.2	-						ATP6V1G3_uc009wzd.2_Intron|ATP6V1G3_uc001guo.2_Intron	NM_133262	NP_573569			ATPase, H+ transporting, lysosomal, V1 subunit						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding			central_nervous_system(1)	1																		---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228437778	228437778	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228437778G>A	uc009xez.1	+	14	4190	c.4146G>A	c.(4144-4146)ACG>ACA	p.T1382T	OBSCN_uc001hsn.2_Silent_p.T1382T	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1382	Ig-like 14.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
SIPA1L2	57568	broad.mit.edu	37	1	232581434	232581434	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232581434G>A	uc001hvg.2	-	9	3352	c.3194C>T	c.(3193-3195)ACG>ATG	p.T1065M	SIPA1L2_uc001hvf.2_Missense_Mutation_p.T139M	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1065					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)																---	---	---	---
LGALS8	3964	broad.mit.edu	37	1	236708103	236708103	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236708103A>T	uc001hxz.1	+	10	1073	c.692A>T	c.(691-693)AAC>ATC	p.N231I	LGALS8_uc001hxw.1_Missense_Mutation_p.N273I|LGALS8_uc001hxy.1_Missense_Mutation_p.N273I|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.N231I|LGALS8_uc001hyb.1_Missense_Mutation_p.N231I|LGALS8_uc001hyc.1_Missense_Mutation_p.N214I	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	231	Galectin 2.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240555838	240555838	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240555838A>C	uc010pyd.1	+	15	5111	c.4886A>C	c.(4885-4887)AAT>ACT	p.N1629T	FMN2_uc010pye.1_Missense_Mutation_p.N1633T|FMN2_uc010pyf.1_Missense_Mutation_p.N244T|FMN2_uc010pyg.1_Missense_Mutation_p.N225T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1629	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248457994	248457994	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248457994T>G	uc010pzj.1	-	1	887	c.887A>C	c.(886-888)AAG>ACG	p.K296T		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	296	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
OR2M7	391196	broad.mit.edu	37	1	248487429	248487429	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487429A>G	uc010pzk.1	-	1	442	c.442T>C	c.(442-444)TCC>CCC	p.S148P		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1652393	1652393	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652393G>A	uc002qxa.2	-	17	3223	c.3159C>T	c.(3157-3159)TAC>TAT	p.Y1053Y		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1053					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98392446	98392446	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98392446G>A	uc002syh.3	-	32	4409	c.4180C>T	c.(4180-4182)CCT>TCT	p.P1394S		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	1394	Lys-rich.					integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
CPS1	1373	broad.mit.edu	37	2	211465372	211465372	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211465372A>C	uc002vee.3	+	15	1775	c.1643A>C	c.(1642-1644)CAG>CCG	p.Q548P	CPS1_uc010fur.2_Missense_Mutation_p.Q554P|CPS1_uc010fus.2_Missense_Mutation_p.Q97P	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	548					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---
ACSL3	2181	broad.mit.edu	37	2	223773557	223773557	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223773557T>A	uc002vni.2	+	4	518	c.67T>A	c.(67-69)TTA>ATA	p.L23I	ACSL3_uc002vnj.2_Missense_Mutation_p.L23I	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	23	Helical; Signal-anchor for type III membrane protein; (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)			T	ETV1	prostate								---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225688336	225688336	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225688336G>T	uc010fwz.1	-	28	3304	c.3065C>A	c.(3064-3066)TCT>TAT	p.S1022Y	DOCK10_uc002vob.2_Missense_Mutation_p.S1016Y	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1022							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9027370	9027370	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9027370C>A	uc003brf.1	-	22	3809	c.3133G>T	c.(3133-3135)GCC>TCC	p.A1045S	SRGAP3_uc003brg.1_Missense_Mutation_p.A1021S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	1045					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
PFKFB4	5210	broad.mit.edu	37	3	48587369	48587369	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48587369C>T	uc003ctv.2	-	3	256	c.239G>A	c.(238-240)CGG>CAG	p.R80Q	PFKFB4_uc003ctw.2_5'UTR|PFKFB4_uc010hkc.2_Missense_Mutation_p.R80Q|PFKFB4_uc003ctx.2_Missense_Mutation_p.R37Q|PFKFB4_uc010hkb.2_Missense_Mutation_p.R80Q|PFKFB4_uc011bbm.1_Missense_Mutation_p.R69Q|PFKFB4_uc011bbn.1_RNA	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,	80	6-phosphofructo-2-kinase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)														---	---	---	---
QARS	5859	broad.mit.edu	37	3	49139687	49139687	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49139687A>C	uc003cvx.2	-	7	587	c.582T>G	c.(580-582)GCT>GCG	p.A194A	QARS_uc011bcc.1_5'Flank|QARS_uc011bcd.1_Silent_p.A49A|QARS_uc003cvy.2_Silent_p.A49A|QARS_uc011bce.1_Silent_p.A183A|QARS_uc011bcf.1_Silent_p.A194A	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	194					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)													---	---	---	---
VPRBP	9730	broad.mit.edu	37	3	51457862	51457862	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51457862T>C	uc003dbe.1	-	14	2730	c.2562A>G	c.(2560-2562)ATA>ATG	p.I854M	VPRBP_uc003dbf.1_Missense_Mutation_p.I130M	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	854	LisH.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)														---	---	---	---
SNTN	132203	broad.mit.edu	37	3	63638466	63638466	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63638466C>T	uc003dlr.2	+	1	123	c.103C>T	c.(103-105)CCC>TCC	p.P35S		NM_001080537	NP_001074006	A6NMZ2	SNTAN_HUMAN	sentan, cilia apical structure protein	35						cilium	calcium ion binding			ovary(1)	1																		---	---	---	---
ARL13B	200894	broad.mit.edu	37	3	93758757	93758757	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93758757T>G	uc003drc.2	+	6	1009	c.723T>G	c.(721-723)GAT>GAG	p.D241E	ARL13B_uc010hop.2_Missense_Mutation_p.D92E|ARL13B_uc003drd.2_Missense_Mutation_p.D134E|ARL13B_uc003dre.2_Missense_Mutation_p.D226E|ARL13B_uc003drf.2_Missense_Mutation_p.D241E|ARL13B_uc003drg.2_Missense_Mutation_p.D138E	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1	241	Potential.						GTP binding				0																		---	---	---	---
MRPL47	57129	broad.mit.edu	37	3	179311560	179311560	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179311560T>G	uc003fjz.2	-	5	548	c.526A>C	c.(526-528)ATC>CTC	p.I176L	MRPL47_uc003fka.2_Missense_Mutation_p.I66L|MRPL47_uc003fkb.2_Missense_Mutation_p.I156L	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	176					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)															---	---	---	---
LETM1	3954	broad.mit.edu	37	4	1823927	1823927	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1823927G>T	uc003gdv.2	-	10	1886	c.1589C>A	c.(1588-1590)CCG>CAG	p.P530Q		NM_012318	NP_036450	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane	530	Mitochondrial matrix (Potential).				cristae formation	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			central_nervous_system(1)	1			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)															---	---	---	---
EVC	2121	broad.mit.edu	37	4	5733156	5733156	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5733156T>C	uc003gil.1	+	4	573	c.389T>C	c.(388-390)CTG>CCG	p.L130P	EVC_uc003gim.1_RNA	NM_153717	NP_714928	P57679	EVC_HUMAN	Ellis van Creveld syndrome protein	130					muscle organ development	integral to membrane				ovary(1)|skin(1)	2		Myeloproliferative disorder(84;0.117)																---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16587554	16587554	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16587554G>C	uc003goz.2	-	5	922	c.606C>G	c.(604-606)AAC>AAG	p.N202K	LDB2_uc003gpa.2_Missense_Mutation_p.N202K|LDB2_uc003gpb.2_Missense_Mutation_p.N202K|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Missense_Mutation_p.N202K|LDB2_uc003goy.2_Missense_Mutation_p.N78K|LDB2_uc011bxi.1_Missense_Mutation_p.N78K	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	202							LIM domain binding|transcription cofactor activity				0																		---	---	---	---
SPATA18	132671	broad.mit.edu	37	4	52926960	52926960	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52926960A>T	uc003gzl.2	+	3	484	c.206A>T	c.(205-207)GAT>GTT	p.D69V	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.D69V|SPATA18_uc003gzk.1_Missense_Mutation_p.D69V	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	69					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)															---	---	---	---
KDR	3791	broad.mit.edu	37	4	55968591	55968591	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55968591G>T	uc003has.2	-	14	2374	c.2072C>A	c.(2071-2073)TCT>TAT	p.S691Y	KDR_uc003hat.1_Missense_Mutation_p.S691Y	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	691	Ig-like C2-type 7.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123252486	123252486	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123252486C>T	uc003ieh.2	+	65	11300	c.11255C>T	c.(11254-11256)ACG>ATG	p.T3752M	KIAA1109_uc003iem.2_Missense_Mutation_p.T143M	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3752					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126241072	126241072	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241072G>A	uc003ifj.3	+	1	3506	c.3506G>A	c.(3505-3507)CGG>CAG	p.R1169Q		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1169	Cadherin 11.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
ZNF827	152485	broad.mit.edu	37	4	146806888	146806888	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146806888T>C	uc003ikn.2	-	4	1737	c.1689A>G	c.(1687-1689)GCA>GCG	p.A563A	ZNF827_uc003ikm.2_Silent_p.A563A|ZNF827_uc010iox.2_Silent_p.A213A	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	563					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)																	---	---	---	---
NPY1R	4886	broad.mit.edu	37	4	164246633	164246633	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164246633T>G	uc003iqm.1	-	3	1243	c.977A>C	c.(976-978)AAC>ACC	p.N326T	NPY1R_uc011cjj.1_Missense_Mutation_p.N83T	NM_000909	NP_000900	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	326	Cytoplasmic (Potential).				inhibition of adenylate cyclase activity by G-protein signaling pathway|outflow tract morphogenesis	integral to plasma membrane	protein binding			lung(1)|pancreas(1)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19839105	19839105	+	5'UTR	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19839105A>C	uc003jgc.2	-	2					CDH18_uc003jgd.2_5'UTR|CDH18_uc011cnm.1_5'UTR	NM_004934	NP_004925			cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
PRDM9	56979	broad.mit.edu	37	5	23522743	23522743	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522743T>G	uc003jgo.2	+	8	813	c.631T>G	c.(631-633)TTC>GTC	p.F211V		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	211					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288677	65288677	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288677T>A	uc003juk.1	+	3	439	c.131T>A	c.(130-132)TTT>TAT	p.F44Y	ERBB2IP_uc003juh.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jui.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003juj.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqy.1_Missense_Mutation_p.F44Y|ERBB2IP_uc011cqz.1_Missense_Mutation_p.F44Y|ERBB2IP_uc010iwx.1_Missense_Mutation_p.F44Y|ERBB2IP_uc003jul.1_Missense_Mutation_p.F44Y	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
ERBB2IP	55914	broad.mit.edu	37	5	65288678	65288678	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65288678T>C	uc003juk.1	+	3	440	c.132T>C	c.(130-132)TTT>TTC	p.F44F	ERBB2IP_uc003juh.1_Silent_p.F44F|ERBB2IP_uc003jui.1_Silent_p.F44F|ERBB2IP_uc003juj.1_Silent_p.F44F|ERBB2IP_uc011cqx.1_Silent_p.F44F|ERBB2IP_uc011cqy.1_Silent_p.F44F|ERBB2IP_uc011cqz.1_Silent_p.F44F|ERBB2IP_uc010iwx.1_Silent_p.F44F|ERBB2IP_uc003jul.1_Silent_p.F44F	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	44	LRR 1.				basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89954028	89954028	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89954028G>T	uc003kju.2	+	21	4781	c.4685G>T	c.(4684-4686)AGA>ATA	p.R1562I	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1562	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM81B	153643	broad.mit.edu	37	5	94764400	94764400	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94764400C>T	uc003kla.1	+	6	796	c.750C>T	c.(748-750)CCC>CCT	p.P250P	FAM81B_uc010jbe.1_Silent_p.P46P	NM_152548	NP_689761	Q96LP2	FA81B_HUMAN	hypothetical protein LOC153643	250										ovary(1)|skin(1)	2		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)														---	---	---	---
SLC25A46	91137	broad.mit.edu	37	5	110097216	110097216	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110097216C>G	uc003koz.2	+	8	1058	c.991C>G	c.(991-993)CTT>GTT	p.L331V	SLC25A46_uc011cvi.1_Missense_Mutation_p.L240V	NM_138773	NP_620128	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	331	Solcar 2.|Helical; Name=5; (Potential).				transport	integral to membrane|mitochondrial inner membrane					0		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)														---	---	---	---
ZNF300	91975	broad.mit.edu	37	5	150275190	150275190	+	Silent	SNP	C	T	T	rs140923053		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150275190C>T	uc003lsy.1	-	6	1878	c.1611G>A	c.(1609-1611)CCG>CCA	p.P537P	IRGM_uc011dcl.1_Intron	NM_052860	NP_443092	Q96RE9	ZN300_HUMAN	zinc finger protein 300	537	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	345906	345906	+	Missense_Mutation	SNP	G	A	A	rs148279164		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:345906G>A	uc003msx.2	+	5	680	c.241G>A	c.(241-243)GGT>AGT	p.G81S	DUSP22_uc011dhn.1_Missense_Mutation_p.G81S|DUSP22_uc003msy.1_Missense_Mutation_p.G38S	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	81	Tyrosine-protein phosphatase.				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17629488	17629488	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17629488A>C	uc003ncd.1	-	18	3142	c.2942T>G	c.(2941-2943)TTT>TGT	p.F981C	NUP153_uc011dje.1_Missense_Mutation_p.F1012C|NUP153_uc010jpl.1_Missense_Mutation_p.F939C	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	981					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
C6orf134	79969	broad.mit.edu	37	6	30610778	30610778	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30610778C>T	uc003nqu.2	+	10	1008	c.958C>T	c.(958-960)CGT>TGT	p.R320C	C6orf134_uc003nqr.3_Missense_Mutation_p.R320C|C6orf134_uc003rdc.2_Missense_Mutation_p.R320C|C6orf134_uc003nqs.3_Missense_Mutation_p.R297C|C6orf134_uc003rdd.2_Missense_Mutation_p.R297C|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Missense_Mutation_p.R285C|C6orf134_uc003nqv.2_Missense_Mutation_p.R308C	NM_024909	NP_079185	Q5SQI0	ATAT_HUMAN	hypothetical protein LOC79969 isoform 2	320							tubulin N-acetyltransferase activity				0																		---	---	---	---
HLA-DOB	3112	broad.mit.edu	37	6	32781497	32781497	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32781497T>C	uc003oca.2	-							NM_002120	NP_002111			major histocompatibility complex, class II, DO						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
BRD2	6046	broad.mit.edu	37	6	32945244	32945244	+	Missense_Mutation	SNP	G	T	T	rs141044200		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32945244G>T	uc003ocn.3	+	8	2927	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.R409L|BRD2_uc003ocp.3_Missense_Mutation_p.R289L|BRD2_uc010juh.2_Missense_Mutation_p.R409L	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	409	Bromo 2.				spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5																		---	---	---	---
KCNK5	8645	broad.mit.edu	37	6	39159379	39159379	+	Missense_Mutation	SNP	G	A	A	rs150380866	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39159379G>A	uc003oon.2	-	5	1151	c.787C>T	c.(787-789)CGG>TGG	p.R263W		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	263	Cytoplasmic (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144811268	144811268	+	Missense_Mutation	SNP	G	A	A	rs151173089		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144811268G>A	uc003qkt.2	+	30	4288	c.4196G>A	c.(4195-4197)CGT>CAT	p.R1399H		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1399	Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149826767	149826767	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149826767T>C	uc003qmo.1	-	13	1331	c.1301A>G	c.(1300-1302)AAG>AGG	p.K434R	PPIL4_uc010kic.2_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4	434					protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	153603773	153603773	+	IGR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603773G>A								RGS17 (151384 upstream) : OPRM1 (727863 downstream)																																			---	---	---	---
LPA	4018	broad.mit.edu	37	6	161010612	161010612	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161010612T>C	uc003qtl.2	-	25	4040	c.3920A>G	c.(3919-3921)CAG>CGG	p.Q1307R		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3815	Kringle 34.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)													---	---	---	---
ABCB5	340273	broad.mit.edu	37	7	20685666	20685666	+	5'Flank	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20685666T>G	uc003suw.3	+						ABCB5_uc010kuh.2_Missense_Mutation_p.F296V|ABCB5_uc003suv.3_5'Flank|ABCB5_uc011jyi.1_5'Flank	NM_178559	NP_848654			ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40132537	40132537	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40132537A>T	uc003thh.3	+	13	3671	c.3389A>T	c.(3388-3390)AAC>ATC	p.N1130I	CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_Missense_Mutation_p.N181I|CDK13_uc003thk.2_Missense_Mutation_p.N63I	NM_003718	NP_003709	Q14004	CDK13_HUMAN	cell division cycle 2-like 5 isoform 1	1130					alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42004616	42004616	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42004616G>T	uc011kbh.1	-	15	4146	c.4055C>A	c.(4054-4056)TCA>TAA	p.S1352*	GLI3_uc011kbg.1_Nonsense_Mutation_p.S1293*	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1352					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
POLD2	5425	broad.mit.edu	37	7	44157562	44157562	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44157562G>A	uc010kxz.2	-	4	972	c.322C>T	c.(322-324)CTG>TTG	p.L108L	POLD2_uc003tke.3_Silent_p.L108L|POLD2_uc010kya.2_Silent_p.L108L|POLD2_uc003tkf.3_Silent_p.L108L	NM_006230	NP_006221	P49005	DPOD2_HUMAN	DNA-directed DNA polymerase delta 2	108					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding			ovary(2)	2																		---	---	---	---
SLC13A1	6561	broad.mit.edu	37	7	122765669	122765669	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122765669A>G	uc003vkm.2	-	11	1219	c.1194T>C	c.(1192-1194)CTT>CTC	p.L398L	SLC13A1_uc010lks.2_Silent_p.L274L	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	398	Helical; (Potential).					integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)													---	---	---	---
OR2F1	26211	broad.mit.edu	37	7	143657178	143657178	+	Missense_Mutation	SNP	G	A	A	rs141187562	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657178G>A	uc003wds.1	+	1	159	c.115G>A	c.(115-117)GTG>ATG	p.V39M		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)																	---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151932911	151932911	+	Silent	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151932911T>C	uc003wla.2	-	16	2979	c.2760A>G	c.(2758-2760)GTA>GTG	p.V920V	MLL3_uc003wkz.2_5'UTR	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	920					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3200843	3200843	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3200843C>T	uc011kwk.1	-	23	3997	c.3607G>A	c.(3607-3609)GAC>AAC	p.D1203N	CSMD1_uc011kwj.1_Missense_Mutation_p.D595N|CSMD1_uc003wqe.2_Missense_Mutation_p.D359N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1203	Extracellular (Potential).|CUB 7.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13258989	13258989	+	Missense_Mutation	SNP	C	T	T	rs150701452		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13258989C>T	uc003wwm.2	-	3	1607	c.1163G>A	c.(1162-1164)CGG>CAG	p.R388Q	DLC1_uc003wwn.2_Missense_Mutation_p.R388Q|DLC1_uc011kxy.1_Missense_Mutation_p.R388Q	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	388					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15480646	15480646	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15480646T>G	uc003wwt.2	+	2	406	c.196T>G	c.(196-198)TTC>GTC	p.F66V	TUSC3_uc003wwr.2_Missense_Mutation_p.F66V|TUSC3_uc003wws.2_Missense_Mutation_p.F66V|TUSC3_uc003wwu.2_Missense_Mutation_p.F66V|TUSC3_uc003wwv.2_Missense_Mutation_p.F66V|TUSC3_uc003www.2_Missense_Mutation_p.F66V|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.F66V	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	66					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
ZMAT4	79698	broad.mit.edu	37	8	40625183	40625183	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40625183C>A	uc003xnr.2	-	3	315	c.169G>T	c.(169-171)GCC>TCC	p.A57S	ZMAT4_uc003xns.2_Missense_Mutation_p.A57S	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a	57						nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55541424	55541424	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541424C>G	uc003xsd.1	+	4	5130	c.4982C>G	c.(4981-4983)TCT>TGT	p.S1661C	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1661					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
CRISPLD1	83690	broad.mit.edu	37	8	75944480	75944480	+	3'UTR	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75944480C>A	uc003yan.2	+	15					CRISPLD1_uc011lfk.1_3'UTR|CRISPLD1_uc011lfl.1_3'UTR	NM_031461	NP_113649			cysteine-rich secretory protein LCCL domain							extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87491204	87491204	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87491204C>T	uc003ydu.2	-	7	837	c.677G>A	c.(676-678)AGA>AAA	p.R226K	FAM82B_uc011lfz.1_Missense_Mutation_p.R196K|FAM82B_uc011lga.1_Missense_Mutation_p.R196K	NM_016033	NP_057117	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	226	TPR 2.					microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
SDC2	6383	broad.mit.edu	37	8	97614693	97614693	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97614693T>G	uc003yhv.1	+	3	861	c.243T>G	c.(241-243)AGT>AGG	p.S81R	SDC2_uc011lgu.1_Missense_Mutation_p.S52R	NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	81	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)													---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108306233	108306233	+	Silent	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108306233A>T	uc003ymn.2	-	6	1437	c.969T>A	c.(967-969)GGT>GGA	p.G323G	ANGPT1_uc011lhv.1_Silent_p.G123G|ANGPT1_uc003ymo.2_Silent_p.G322G|ANGPT1_uc003ymp.3_Silent_p.G122G	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	323	Fibrinogen C-terminal.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113317004	113317004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113317004C>T	uc003ynu.2	-	52	8371	c.8212G>A	c.(8212-8214)GAA>AAA	p.E2738K	CSMD3_uc003yns.2_Missense_Mutation_p.E1940K|CSMD3_uc003ynt.2_Missense_Mutation_p.E2698K|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2738	Extracellular (Potential).|Sushi 16.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113318286	113318286	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113318286C>A	uc003ynu.2	-	51	8180	c.8021G>T	c.(8020-8022)TGC>TTC	p.C2674F	CSMD3_uc003yns.2_Missense_Mutation_p.C1876F|CSMD3_uc003ynt.2_Missense_Mutation_p.C2634F|CSMD3_uc011lhx.1_Missense_Mutation_p.C2570F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2674	Extracellular (Potential).|Sushi 15.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113323373	113323373	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323373T>G	uc003ynu.2	-	50	7878	c.7719A>C	c.(7717-7719)GAA>GAC	p.E2573D	CSMD3_uc003yns.2_Missense_Mutation_p.E1775D|CSMD3_uc003ynt.2_Missense_Mutation_p.E2533D|CSMD3_uc011lhx.1_Missense_Mutation_p.E2469D|CSMD3_uc003ynw.1_Missense_Mutation_p.E284D	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2573	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
SNTB1	6641	broad.mit.edu	37	8	121823992	121823992	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823992C>A	uc010mdg.2	-	1	318	c.92G>T	c.(91-93)CGG>CTG	p.R31L	SNTB1_uc003ype.2_Missense_Mutation_p.R31L	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	31	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132052057	132052057	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132052057A>C	uc003ytd.3	-	1	779	c.523T>G	c.(523-525)TTG>GTG	p.L175V	ADCY8_uc010mds.2_Missense_Mutation_p.L175V	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	175	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
DENND3	22898	broad.mit.edu	37	8	142188211	142188211	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142188211G>T	uc003yvy.2	+	16	2790	c.2512G>T	c.(2512-2514)GAC>TAC	p.D838Y	DENND3_uc010mep.2_Missense_Mutation_p.D799Y	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	838										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
NFKBIL2	4796	broad.mit.edu	37	8	145661049	145661049	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145661049G>A	uc011llg.1	-	17	2782	c.2767C>T	c.(2767-2769)CAG>TAG	p.Q923*	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	923					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)															---	---	---	---
KIAA2026	158358	broad.mit.edu	37	9	6007466	6007466	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6007466C>A	uc003zjq.3	-	1	538	c.322G>T	c.(322-324)GTT>TTT	p.V108F		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	108										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18657714	18657714	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18657714G>A	uc003zne.3	+	8	1039	c.912G>A	c.(910-912)ACG>ACA	p.T304T	ADAMTSL1_uc003znb.2_Silent_p.T304T|ADAMTSL1_uc003znc.3_Silent_p.T304T	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	304						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35375189	35375189	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35375189C>T	uc003zwq.2	+	13	1651	c.1359C>T	c.(1357-1359)GAC>GAT	p.D453D	UNC13B_uc003zwr.2_Silent_p.D453D	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	453					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114462251	114462251	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114462251C>T	uc004bfr.2	-	22	3109	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.E953K|C9orf84_uc010mug.2_Missense_Mutation_p.E903K	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	992										ovary(2)	2																		---	---	---	---
RGS3	5998	broad.mit.edu	37	9	116357901	116357901	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116357901C>T	uc004bhq.2	+	25	3476	c.3267C>T	c.(3265-3267)GCC>GCT	p.A1089A	RGS3_uc004bhs.2_Silent_p.A979A|RGS3_uc004bht.2_Silent_p.A808A|RGS3_uc010muy.2_Silent_p.A482A|RGS3_uc004bhv.2_Silent_p.A410A|RGS3_uc004bhw.2_Silent_p.A59A|RGS3_uc011lxh.1_Silent_p.A399A|RGS3_uc004bhx.2_Silent_p.A410A|RGS3_uc004bhz.2_Silent_p.A431A|RGS3_uc004bia.2_Silent_p.A202A	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	1089	RGS.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
QRFP	347148	broad.mit.edu	37	9	133768995	133768995	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133768995C>A	uc011mcb.1	-	1	231	c.231G>T	c.(229-231)TCG>TCT	p.S77S		NM_198180	NP_937823	P83859	OX26_HUMAN	RF(Arg-Phe)amide family 26 amino acid peptide	77					locomotory behavior|neuropeptide signaling pathway|positive regulation of blood pressure|regulation of feeding behavior	extracellular region	neuropeptide hormone activity|orexigenic neuropeptide QRFP receptor binding				0	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.17e-05)|Epithelial(140;0.000267)														---	---	---	---
SARDH	1757	broad.mit.edu	37	9	136596596	136596596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136596596G>A	uc004cep.3	-	4	655	c.521C>T	c.(520-522)GCG>GTG	p.A174V	SARDH_uc004ceo.2_Missense_Mutation_p.A174V|SARDH_uc011mdn.1_Missense_Mutation_p.A174V|SARDH_uc011mdo.1_Missense_Mutation_p.A6V	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	174					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)														---	---	---	---
ZMYND11	10771	broad.mit.edu	37	10	288050	288050	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:288050C>T	uc010pzt.1	+	10	1349	c.921C>T	c.(919-921)GAC>GAT	p.D307D	ZMYND11_uc001ifk.2_Silent_p.D306D|ZMYND11_uc010pzu.1_Silent_p.D307D|ZMYND11_uc010pzv.1_Silent_p.D252D|ZMYND11_uc010pzw.1_Silent_p.D222D|ZMYND11_uc001ifm.2_Silent_p.D253D|ZMYND11_uc010pzx.1_Silent_p.D307D|ZMYND11_uc001ifn.2_Silent_p.D253D|ZMYND11_uc009xhg.2_Silent_p.D290D|ZMYND11_uc009xhh.2_Silent_p.D181D|ZMYND11_uc010pzy.1_Silent_p.D159D	NM_006624	NP_006615	Q15326	ZMY11_HUMAN	zinc finger, MYND domain containing 11 isoform	267	PWWP.				cell cycle|cell proliferation|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;1.32e-05)|all_lung(4;3.67e-05)|Lung NSC(4;0.000301)|all_epithelial(10;0.000416)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.132)	Epithelial(11;0.00289)|all cancers(11;0.0108)|Lung(33;0.0689)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
C10orf18	54906	broad.mit.edu	37	10	5766451	5766451	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5766451G>A	uc001iij.2	+	8	931	c.306G>A	c.(304-306)GGG>GGA	p.G102G		NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	102										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15688912	15688912	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15688912G>A	uc001ioc.1	-	12	1140	c.1140C>T	c.(1138-1140)ACC>ACT	p.T380T	ITGA8_uc010qcb.1_Silent_p.T365T	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	380	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63852438	63852438	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63852438C>A	uc001jlt.1	+	10	3242	c.3216C>A	c.(3214-3216)CCC>CCA	p.P1072P		NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	1072					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88220968	88220968	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88220968C>T	uc001kdo.2	-	10	2889	c.2447G>A	c.(2446-2448)CGG>CAG	p.R816Q	WAPAL_uc009xsv.2_Missense_Mutation_p.R130Q|WAPAL_uc001kdn.2_Missense_Mutation_p.R853Q|WAPAL_uc009xsw.2_Missense_Mutation_p.R810Q	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	816	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
KIF20B	9585	broad.mit.edu	37	10	91533796	91533796	+	Silent	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91533796A>G	uc001kgs.1	+	33	5526	c.5454A>G	c.(5452-5454)ACA>ACG	p.T1818T	KIF20B_uc001kgr.1_Silent_p.T1778T|KIF20B_uc001kgt.1_Silent_p.T1029T|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1818	Interaction with PIN1.				cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
HECTD2	143279	broad.mit.edu	37	10	93250996	93250996	+	Missense_Mutation	SNP	G	A	A	rs149760758	byFrequency	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93250996G>A	uc001khl.2	+	12	1331	c.1231G>A	c.(1231-1233)GAT>AAT	p.D411N	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.D415N|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_5'UTR|HECTD2_uc001khn.1_Missense_Mutation_p.D61N	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	411					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1																		---	---	---	---
ADAM8	101	broad.mit.edu	37	10	135082361	135082361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135082361C>A	uc010qva.1	-	17	1810	c.1759G>T	c.(1759-1761)GGG>TGG	p.G587W	ADAM8_uc010quz.1_Missense_Mutation_p.G652W|ADAM8_uc009ybi.2_Intron			P78325	ADAM8_HUMAN	SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);	587					integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity			large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)														---	---	---	---
KRTAP5-5	439915	broad.mit.edu	37	11	1651127	1651127	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651127C>T	uc001lty.2	+	1	95	c.57C>T	c.(55-57)TCC>TCT	p.S19S		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	19						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32632734	32632734	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32632734C>T	uc001mtv.2	-	17	3018	c.2974G>A	c.(2974-2976)GAA>AAA	p.E992K		NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	992										ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
OR4C13	283092	broad.mit.edu	37	11	49974468	49974468	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974468C>T	uc010rhz.1	+	1	494	c.494C>T	c.(493-495)CCT>CTT	p.P165L		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4																		---	---	---	---
OR5D13	390142	broad.mit.edu	37	11	55541130	55541130	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541130T>G	uc010ril.1	+	1	217	c.217T>G	c.(217-219)TTC>GTC	p.F73V		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)																---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61070051	61070051	+	Intron	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61070051T>G	uc001nrc.3	-						DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Intron	NM_001923	NP_001914			damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
C11orf9	745	broad.mit.edu	37	11	61539366	61539366	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61539366T>C	uc001nsc.1	+	7	1153	c.1057T>C	c.(1057-1059)TGG>CGG	p.W353R	C11orf9_uc001nse.1_Missense_Mutation_p.W344R	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	353	NDT80.				central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1																		---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62299903	62299903	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62299903G>A	uc001ntl.2	-	5	2286	c.1986C>T	c.(1984-1986)CCC>CCT	p.P662P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	662					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
SLC22A6	9356	broad.mit.edu	37	11	62747361	62747361	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62747361C>A	uc001nwk.2	-	7	1404	c.1097G>T	c.(1096-1098)AGC>ATC	p.S366I	SLC22A6_uc001nwl.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwj.2_Missense_Mutation_p.S366I|SLC22A6_uc001nwm.2_Missense_Mutation_p.S366I	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	366	Extracellular (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0																		---	---	---	---
ZFPL1	7542	broad.mit.edu	37	11	64854058	64854058	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64854058G>A	uc001ocq.1	+	4	551	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	CDCA5_uc001ocp.2_5'Flank	NM_006782	NP_006773	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	129	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|vesicle-mediated transport	Golgi apparatus|integral to membrane|nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64875710	64875710	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64875710A>G	uc001ocr.1	+	5	807	c.767A>G	c.(766-768)GAG>GGG	p.E256G	C11orf2_uc001ocs.1_Missense_Mutation_p.E132G	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	256					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
SLC36A4	120103	broad.mit.edu	37	11	92918925	92918925	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92918925A>T	uc001pdn.2	-	2	208	c.111T>A	c.(109-111)GAT>GAA	p.D37E	SLC36A4_uc001pdm.2_5'UTR	NM_152313	NP_689526	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid	37					L-alanine transport|proline transport|tryptophan transport	integral to membrane	symporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120811160	120811160	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120811160C>T	uc001pxn.2	+	14	1868	c.1581C>T	c.(1579-1581)CGC>CGT	p.R527R	GRIK4_uc009zav.1_Silent_p.R527R|GRIK4_uc009zaw.1_Silent_p.R527R|GRIK4_uc009zax.1_Silent_p.R527R	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	527	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2558239	2558239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2558239G>A	uc009zdu.1	+	4	888	c.575G>A	c.(574-576)CGC>CAC	p.R192H	CACNA1C_uc009zdv.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkb.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkc.2_Missense_Mutation_p.R192H|CACNA1C_uc001qke.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkf.2_Missense_Mutation_p.R192H|CACNA1C_uc001qjz.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkd.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkg.2_Missense_Mutation_p.R192H|CACNA1C_uc009zdw.1_Missense_Mutation_p.R192H|CACNA1C_uc001qkh.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkl.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkn.2_Missense_Mutation_p.R192H|CACNA1C_uc001qko.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkp.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkr.2_Missense_Mutation_p.R192H|CACNA1C_uc001qku.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkq.2_Missense_Mutation_p.R192H|CACNA1C_uc001qks.2_Missense_Mutation_p.R192H|CACNA1C_uc001qkt.2_Missense_Mutation_p.R192H|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	192	I.|Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
A2M	2	broad.mit.edu	37	12	9231877	9231877	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9231877A>C	uc001qvk.1	-	25	3195	c.3082T>G	c.(3082-3084)TTT>GTT	p.F1028V	A2M_uc001qvj.1_Missense_Mutation_p.F70V|A2M_uc009zgk.1_Missense_Mutation_p.F878V	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1028					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)													---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21028196	21028196	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028196C>A	uc001rek.2	+	8	881	c.755C>A	c.(754-756)TCT>TAT	p.S252Y	SLCO1B3_uc001rel.2_Missense_Mutation_p.S252Y|SLCO1B3_uc010sil.1_Missense_Mutation_p.S252Y|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.S77Y	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	252	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21051412	21051412	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21051412G>C	uc001rek.2	+	13	1851	c.1725G>C	c.(1723-1725)CAG>CAC	p.Q575H	SLCO1B3_uc001rel.2_Missense_Mutation_p.Q575H|SLCO1B3_uc010sil.1_Missense_Mutation_p.Q575H|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.Q400H	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	575	Helical; Name=11; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
HELB	92797	broad.mit.edu	37	12	66725385	66725385	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66725385G>T	uc001sti.2	+	12	3150	c.3122G>T	c.(3121-3123)TGT>TTT	p.C1041F	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	1041					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)														---	---	---	---
CLLU1OS	574016	broad.mit.edu	37	12	92814941	92814941	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92814941G>A	uc001tcb.1	-	3	153	c.151C>T	c.(151-153)CTA>TTA	p.L51L	CLLU1_uc001tcc.2_5'Flank|CLLU1_uc001tcd.2_5'Flank|CLLU1_uc001tce.1_5'Flank|CLLU1_uc001tcf.2_5'Flank	NM_001025232	NP_001020403	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1	51											0																		---	---	---	---
ANO4	121601	broad.mit.edu	37	12	101520783	101520783	+	Missense_Mutation	SNP	C	T	T	rs139827573		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101520783C>T	uc010svm.1	+	27	3375	c.2803C>T	c.(2803-2805)CGT>TGT	p.R935C	ANO4_uc001thw.2_Missense_Mutation_p.R900C|ANO4_uc001thx.2_Missense_Mutation_p.R935C|ANO4_uc001thy.2_Missense_Mutation_p.R455C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6															HNSCC(74;0.22)			---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113704147	113704147	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113704147C>T	uc001tuw.2	+	4	697	c.400C>T	c.(400-402)CGG>TGG	p.R134W	TPCN1_uc001tux.2_Missense_Mutation_p.R206W|TPCN1_uc010syt.1_Missense_Mutation_p.R66W	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	134	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
SPG20	23111	broad.mit.edu	37	13	36878722	36878722	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36878722G>T	uc001uvn.2	-	10	2051	c.1781C>A	c.(1780-1782)GCG>GAG	p.A594E	SPG20_uc010ten.1_Missense_Mutation_p.A584E|SPG20_uc001uvm.2_Missense_Mutation_p.A594E|SPG20_uc001uvo.2_Missense_Mutation_p.A594E|SPG20_uc001uvq.2_Missense_Mutation_p.A594E	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	594					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37427777	37427777	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37427777C>A	uc001uvw.2	-	6	1382	c.1039G>T	c.(1039-1041)GCC>TCC	p.A347S	SMAD9_uc001uvx.2_Missense_Mutation_p.A310S|SMAD9_uc010tep.1_Missense_Mutation_p.A140S	NM_001127217	NP_001120689	O15198	SMAD9_HUMAN	SMAD family member 9 isoform a	347	MH2.				BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58208453	58208453	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208453C>A	uc001vhq.1	+	1	2665	c.1773C>A	c.(1771-1773)GAC>GAA	p.D591E	PCDH17_uc010aec.1_Missense_Mutation_p.D591E	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	591	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
PCDH17	27253	broad.mit.edu	37	13	58298735	58298735	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58298735T>C	uc001vhq.1	+						PCDH17_uc010aec.1_Intron|PCDH17_uc001vhr.1_Intron	NM_001040429	NP_001035519			protocadherin 17 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94938678	94938678	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94938678A>G	uc001vlt.2	+	5	1585	c.953A>G	c.(952-954)AAG>AGG	p.K318R	GPC6_uc010tig.1_Missense_Mutation_p.K318R	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	318						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
TPP2	7174	broad.mit.edu	37	13	103288731	103288731	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103288731C>A	uc001vpi.3	+	13	1770	c.1667C>A	c.(1666-1668)CCG>CAG	p.P556Q		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	556					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
ZNF219	51222	broad.mit.edu	37	14	21560052	21560052	+	Silent	SNP	C	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21560052C>G	uc001vzr.2	-	3	1825	c.1404G>C	c.(1402-1404)GGG>GGC	p.G468G	ZNF219_uc001vzs.2_Silent_p.G468G|ZNF219_uc010aik.1_Silent_p.G468G	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	468					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)														---	---	---	---
OR10G2	26534	broad.mit.edu	37	14	22102378	22102378	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102378G>A	uc010tmc.1	-	1	621	c.621C>T	c.(619-621)GAC>GAT	p.D207D		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	207	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22979958	22979958	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22979958C>A	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001weh.1_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_5'UTR|uc001wfi.2_5'Flank|uc001wfj.1_5'Flank|uc001wfk.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
NRL	4901	broad.mit.edu	37	14	24551826	24551826	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24551826G>T	uc001wlo.2	-	2	363	c.232C>A	c.(232-234)CTG>ATG	p.L78M	NRL_uc001wlp.2_Missense_Mutation_p.L78M|NRL_uc001wlq.2_Missense_Mutation_p.L78M	NM_006177	NP_006168	P54845	NRL_HUMAN	neural retina leucine zipper	78					response to stimulus|transcription from RNA polymerase II promoter|visual perception	nucleus	leucine zipper domain binding|sequence-specific DNA binding				0				GBM - Glioblastoma multiforme(265;0.0181)														---	---	---	---
FITM1	161247	broad.mit.edu	37	14	24601699	24601699	+	Silent	SNP	C	T	T	rs139067370		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24601699C>T	uc001wmf.2	+	2	644	c.546C>T	c.(544-546)ACC>ACT	p.T182T		NM_203402	NP_981947	A5D6W6	FITM1_HUMAN	fat-inducing transcript 1	182	Extracellular (Potential).				lipid particle organization|positive regulation of sequestering of triglyceride	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37180670	37180670	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37180670A>C	uc001wtz.1	-	7	766	c.456T>G	c.(454-456)GGT>GGG	p.G152G		NM_030631	NP_085134	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial	152	Solcar 2.				lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
ZFYVE1	53349	broad.mit.edu	37	14	73459882	73459882	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73459882C>T	uc001xnm.2	-	4	1812	c.1172G>A	c.(1171-1173)CGG>CAG	p.R391Q	ZFYVE1_uc010arj.2_Missense_Mutation_p.R391Q	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	391						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)														---	---	---	---
YLPM1	56252	broad.mit.edu	37	14	75248531	75248531	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75248531C>T	uc001xqj.3	+	4	1909	c.1785C>T	c.(1783-1785)TCC>TCT	p.S595S	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)														---	---	---	---
SLC25A29	123096	broad.mit.edu	37	14	100765194	100765194	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100765194C>T	uc001yha.2	-	2	354	c.63G>A	c.(61-63)CCG>CCA	p.P21P	SLC25A29_uc010twx.1_Intron|SLC25A29_uc010avw.2_Silent_p.P21P	NM_001039355	NP_001034444	Q8N8R3	MCATL_HUMAN	solute carrier family 25, member 29	21	Solcar 1.|Helical; Name=1; (Potential).					integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1		Melanoma(154;0.152)			L-Carnitine(DB00583)													---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33855184	33855184	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33855184T>G	uc001zhi.2	+	11	1189	c.1119T>G	c.(1117-1119)ACT>ACG	p.T373T	RYR3_uc010bar.2_Silent_p.T373T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	373	Cytoplasmic (By similarity).|MIR 5.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
DISP2	85455	broad.mit.edu	37	15	40661112	40661112	+	Silent	SNP	G	A	A	rs140286504	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40661112G>A	uc001zlk.1	+	8	2888	c.2799G>A	c.(2797-2799)GCG>GCA	p.A933A		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	933					smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)														---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90342480	90342480	+	Intron	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90342480G>T	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
MCTP2	55784	broad.mit.edu	37	15	94983411	94983411	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94983411T>G	uc002btj.2	+	17	2157	c.2092T>G	c.(2092-2094)TTG>GTG	p.L698V	MCTP2_uc010boj.2_Missense_Mutation_p.L427V|MCTP2_uc010bok.2_Intron|MCTP2_uc002btl.2_Missense_Mutation_p.L286V	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	698	Helical; (Potential).				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)															---	---	---	---
OR4F15	390649	broad.mit.edu	37	15	102358857	102358857	+	Silent	SNP	A	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358857A>C	uc010uts.1	+	1	468	c.468A>C	c.(466-468)TCA>TCC	p.S156S		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)															---	---	---	---
WDR24	84219	broad.mit.edu	37	16	737649	737649	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:737649C>A	uc002ciz.1	-	2	1332	c.572G>T	c.(571-573)TGG>TTG	p.W191L		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)																---	---	---	---
TBL3	10607	broad.mit.edu	37	16	2025184	2025184	+	Intron	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2025184T>C	uc002cnu.1	+						TBL3_uc002cnv.1_Intron|TBL3_uc010bsb.1_Intron|TBL3_uc010bsc.1_Intron|TBL3_uc010uvt.1_Intron|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444			transducin beta-like 3						G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0																		---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22268113	22268113	+	Silent	SNP	G	T	T	rs112106407		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22268113G>T	uc002dki.2	+	7	1148	c.663G>T	c.(661-663)CCG>CCT	p.P221P	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	221	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	24226123	24226123	+	Intron	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24226123G>A	uc002dmd.2	+						PRKCB_uc002dme.2_Missense_Mutation_p.E670K	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
AQP8	343	broad.mit.edu	37	16	25235898	25235898	+	Splice_Site	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25235898G>A	uc002doc.2	+	4	684	c.602_splice	c.e4+1	p.G201_splice		NM_001169	NP_001160			aquaporin 8						cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)														---	---	---	---
SLC7A6OS	84138	broad.mit.edu	37	16	68344764	68344764	+	Silent	SNP	A	C	C	rs147089863		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68344764A>C	uc002evw.1	-	1	85	c.66T>G	c.(64-66)GCT>GCG	p.A22A	PRMT7_uc002evx.1_5'Flank|PRMT7_uc002evy.1_5'Flank|PRMT7_uc010vlg.1_5'Flank	NM_032178	NP_115554	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite	22					protein transport	cytoplasm|nucleus				ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)														---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74487204	74487204	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74487204A>T	uc002fcy.3	-	26	3451	c.3401T>A	c.(3400-3402)CTT>CAT	p.L1134H	GLG1_uc002fcx.2_Missense_Mutation_p.L1134H|GLG1_uc002fcw.3_Missense_Mutation_p.L1123H|GLG1_uc002fcz.3_Missense_Mutation_p.L551H	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	1134	Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	A	A	rs121913344		TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577022G>A	uc002gim.2	-	8	1110	c.916C>T	c.(916-918)CGA>TGA	p.R306*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.R306*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R174*|TP53_uc010cng.1_Nonsense_Mutation_p.R174*|TP53_uc002gii.1_Nonsense_Mutation_p.R174*|TP53_uc010cnh.1_Nonsense_Mutation_p.R306*|TP53_uc010cni.1_Nonsense_Mutation_p.R306*|TP53_uc002gij.2_Nonsense_Mutation_p.R306*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	306	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		R -> Q (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R306*(99)|p.0?(7)|p.?(3)|p.R306R(2)|p.R306fs*39(2)|p.K305fs*1(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R306*(MFE296_ENDOMETRIUM)|R306*(HCC1937_BREAST)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
KRT28	162605	broad.mit.edu	37	17	38953225	38953225	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38953225G>A	uc002hvh.1	-	5	987	c.921C>T	c.(919-921)ACC>ACT	p.T307T		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	307	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)																---	---	---	---
STAT3	6774	broad.mit.edu	37	17	40485746	40485746	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40485746G>A	uc002hzl.1	-	10	1234	c.994C>T	c.(994-996)CAT>TAT	p.H332Y	STAT3_uc002hzk.1_Missense_Mutation_p.H332Y|STAT3_uc002hzm.1_Missense_Mutation_p.H332Y|STAT3_uc010wgh.1_Missense_Mutation_p.H234Y|STAT3_uc002hzn.1_Missense_Mutation_p.H332Y	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	332					cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)										Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				---	---	---	---
ACBD4	79777	broad.mit.edu	37	17	43213915	43213915	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43213915A>G	uc002iid.2	+	3	481	c.137A>G	c.(136-138)TAC>TGC	p.Y46C	ACBD4_uc010wjj.1_Missense_Mutation_p.Y46C|ACBD4_uc002iie.2_Missense_Mutation_p.Y46C|ACBD4_uc002iif.2_Missense_Mutation_p.Y46C|ACBD4_uc002iic.2_Missense_Mutation_p.Y46C|ACBD4_uc010dae.2_5'UTR	NM_001135707	NP_001129179	Q8NC06	ACBD4_HUMAN	acyl-Coenzyme A binding domain containing 4	46	ACB.						fatty-acyl-CoA binding			ovary(1)|kidney(1)	2																		---	---	---	---
GPRC5C	55890	broad.mit.edu	37	17	72436661	72436661	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72436661C>A	uc002jks.2	+	1	785	c.746C>A	c.(745-747)ACA>AAA	p.T249K	GPRC5C_uc002jkp.2_Missense_Mutation_p.T294K|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Missense_Mutation_p.T261K|GPRC5C_uc002jkt.2_Missense_Mutation_p.T249K|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	249	Helical; Name=6; (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
C17orf77	146723	broad.mit.edu	37	17	72588200	72588200	+	Silent	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72588200G>A	uc002jla.1	+	3	377	c.15G>A	c.(13-15)GCG>GCA	p.A5A	CD300LD_uc002jkz.2_Intron	NM_152460	NP_689673	Q96MU5	CQ077_HUMAN	hypothetical protein LOC146723	5						extracellular region					0																		---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65180695	65180695	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180695G>A	uc002lke.1	-	2	2405	c.1181C>T	c.(1180-1182)ACT>ATT	p.T394I		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	384						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9047473	9047473	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9047473T>G	uc002mkp.2	-	5	34362	c.34158A>C	c.(34156-34158)GAA>GAC	p.E11386D		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11388	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
CDC37	11140	broad.mit.edu	37	19	10505732	10505732	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10505732G>A	uc002mof.1	-	5	807	c.691C>T	c.(691-693)CGG>TGG	p.R231W	CDC37_uc002moe.1_Missense_Mutation_p.R186W|CDC37_uc010dxf.1_Missense_Mutation_p.R68W|CDC37_uc002mog.1_Intron|CDC37_uc002moh.2_Missense_Mutation_p.R231W	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	231					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)														---	---	---	---
KLF1	10661	broad.mit.edu	37	19	12996921	12996921	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12996921C>A	uc002mvo.2	-	2	186	c.123G>T	c.(121-123)CCG>CCT	p.P41P		NM_006563	NP_006554	Q13351	KLF1_HUMAN	erythroid Kruppel-like factor	41	Pro-rich.				erythrocyte differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CPAMD8	27151	broad.mit.edu	37	19	17008738	17008738	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17008738G>A	uc002nfb.2	-	38	5089	c.5057C>T	c.(5056-5058)TCG>TTG	p.S1686L	CPAMD8_uc010xpj.1_5'Flank|CPAMD8_uc002nfd.1_Missense_Mutation_p.S151L	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1639						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---
DDX49	54555	broad.mit.edu	37	19	19035507	19035507	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19035507C>T	uc002nkq.1	+	8	985	c.928C>T	c.(928-930)CGG>TGG	p.R310W	HOMER3_uc002nko.1_Intron|HOMER3_uc002nkp.1_Intron|DDX49_uc002nkr.1_RNA|DDX49_uc002nks.1_Missense_Mutation_p.R203W|DDX49_uc002nkt.1_Missense_Mutation_p.R192W	NM_019070	NP_061943	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	310	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			Epithelial(12;0.0289)															---	---	---	---
C19orf2	8725	broad.mit.edu	37	19	30502064	30502064	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30502064C>T	uc002nsr.2	+	9	1129	c.1099C>T	c.(1099-1101)CGT>TGT	p.R367C	C19orf2_uc002nsq.2_Missense_Mutation_p.R349C|C19orf2_uc002nss.2_Missense_Mutation_p.R327C|C19orf2_uc002nst.2_Missense_Mutation_p.R291C	NM_003796	NP_003787	O94763	RMP_HUMAN	RPB5-mediating protein isoform a	367					protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF568	374900	broad.mit.edu	37	19	37440970	37440970	+	Silent	SNP	T	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37440970T>G	uc002ofc.2	+	7	1430	c.915T>G	c.(913-915)CCT>CCG	p.P305P	ZNF568_uc010efg.2_Intron|ZNF568_uc010xtn.1_Intron|ZNF568_uc002ofd.2_Silent_p.P229P|ZNF568_uc010efe.2_Silent_p.P229P|ZNF568_uc010eff.1_Intron	NM_198539	NP_940941	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	305					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
LYPD4	147719	broad.mit.edu	37	19	42343074	42343074	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42343074T>C	uc002orp.1	-	3	1076	c.92A>G	c.(91-93)GAA>GGA	p.E31G	LYPD4_uc002orq.1_Intron	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	31						anchored to membrane|plasma membrane				ovary(1)	1																		---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42471430	42471430	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42471430C>T	uc002osg.2	-	22	3138	c.2984G>A	c.(2983-2985)CGC>CAC	p.R995H	ATP1A3_uc010xwf.1_Missense_Mutation_p.R1006H|ATP1A3_uc010xwg.1_Missense_Mutation_p.R965H|ATP1A3_uc010xwh.1_Missense_Mutation_p.R1008H|ATP1A3_uc002osh.2_Missense_Mutation_p.R995H	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	995	Helical; (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
ZNF233	353355	broad.mit.edu	37	19	44777834	44777834	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44777834C>A	uc002oyz.1	+	5	1148	c.1021C>A	c.(1021-1023)CTC>ATC	p.L341I	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF233_uc002oyy.1_Missense_Mutation_p.L156I	NM_181756	NP_861421	A6NK53	ZN233_HUMAN	zinc finger protein 233	341					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2		Prostate(69;0.0435)|all_neural(266;0.226)																---	---	---	---
LILRA3	11026	broad.mit.edu	37	19	54803095	54803095	+	Silent	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54803095C>T	uc002qfd.2	-	4	647	c.582G>A	c.(580-582)TCG>TCA	p.S194S	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Intron	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	194	Ig-like C2-type 2.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
CPXM1	56265	broad.mit.edu	37	20	2774829	2774829	+	3'UTR	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2774829G>A	uc002wgu.2	-	14					CPXM1_uc010gas.2_3'UTR	NM_019609	NP_062555			carboxypeptidase X, member 1 precursor						cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4																		---	---	---	---
FAM113A	64773	broad.mit.edu	37	20	2818920	2818920	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2818920C>T	uc002wgz.1	-	6	1296	c.799G>A	c.(799-801)GAC>AAC	p.D267N	FAM113A_uc002whb.1_Missense_Mutation_p.D118N|FAM113A_uc002wha.1_Missense_Mutation_p.D118N|FAM113A_uc010zqa.1_Missense_Mutation_p.D114N|FAM113A_uc002whc.1_Missense_Mutation_p.D216N|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	NM_022760	NP_073597	Q9H1Q7	F113A_HUMAN	hypothetical protein LOC64773	267							hydrolase activity|protein binding			ovary(2)	2																		---	---	---	---
SIGLEC1	6614	broad.mit.edu	37	20	3674309	3674309	+	Missense_Mutation	SNP	C	T	T	rs61734522	byFrequency;by1000genomes	TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3674309C>T	uc002wja.2	-	13	3293	c.3293G>A	c.(3292-3294)CGG>CAG	p.R1098Q	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.R1098Q	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	1098	Ig-like C2-type 11.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15412042	15412042	+	Intron	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15412042A>T	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
C20orf3	57136	broad.mit.edu	37	20	24954292	24954292	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24954292G>A	uc002wty.2	-	4	511	c.410C>T	c.(409-411)TCG>TTG	p.S137L	C20orf3_uc002wtz.2_Missense_Mutation_p.S137L|C20orf3_uc010zsw.1_Missense_Mutation_p.S137L	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3	137	Extracellular (Potential).				biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1																		---	---	---	---
NECAB3	63941	broad.mit.edu	37	20	32248104	32248104	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32248104C>A	uc002wzn.3	-	6	591	c.485G>T	c.(484-486)GGG>GTG	p.G162V	NECAB3_uc002wzl.2_5'UTR|NECAB3_uc002wzm.3_Missense_Mutation_p.G162V|NECAB3_uc002wzo.3_RNA|NECAB3_uc002wzp.3_Missense_Mutation_p.G113V|NECAB3_uc002wzq.3_Missense_Mutation_p.G162V|NECAB3_uc002wzr.3_RNA|NECAB3_uc010geo.2_Missense_Mutation_p.G162V|C20orf144_uc002wzs.1_5'Flank	NM_031232	NP_112509	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3	162					antibiotic biosynthetic process|protein metabolic process|protein secretion|regulation of amyloid precursor protein biosynthetic process	endoplasmic reticulum membrane|Golgi cis cisterna|nucleus	calcium ion binding|oxidoreductase activity|protein binding			lung(1)	1																		---	---	---	---
SRC	6714	broad.mit.edu	37	20	36022573	36022573	+	Intron	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36022573C>A	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408			proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)													---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42344707	42344707	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42344707C>T	uc002xlb.1	+	14	2298	c.2083C>T	c.(2083-2085)CGG>TGG	p.R695W	MYBL2_uc010zwj.1_Missense_Mutation_p.R671W	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	695						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
EEF1A2	1917	broad.mit.edu	37	20	62126325	62126325	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62126325C>T	uc002yfd.1	-	3	555	c.454G>A	c.(454-456)GTG>ATG	p.V152M	EEF1A2_uc002yfe.1_Missense_Mutation_p.V152M|EEF1A2_uc010gkg.1_Missense_Mutation_p.V152M	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	152						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)															---	---	---	---
ARFRP1	10139	broad.mit.edu	37	20	62331793	62331793	+	3'UTR	SNP	G	C	C			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62331793G>C	uc002yga.2	-	7					ARFRP1_uc002ygc.2_3'UTR|ARFRP1_uc002ygh.3_3'UTR|ARFRP1_uc011abf.1_3'UTR|ARFRP1_uc011abg.1_3'UTR|ARFRP1_uc002yge.2_RNA|ARFRP1_uc002ygd.2_RNA|ARFRP1_uc002ygf.2_3'UTR|ARFRP1_uc002ygg.2_RNA|ARFRP1_uc011abh.1_RNA	NM_003224	NP_003215			ADP-ribosylation factor related protein 1						small GTPase mediated signal transduction	Golgi apparatus|membrane fraction	GTP binding|GTPase activity			breast(1)|skin(1)	2	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)															---	---	---	---
ZDHHC8	29801	broad.mit.edu	37	22	20130417	20130417	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20130417G>A	uc002zrq.2	+	10	1370	c.1264G>A	c.(1264-1266)GCC>ACC	p.A422T	ZDHHC8_uc002zrr.1_Missense_Mutation_p.A422T|ZDHHC8_uc010gsa.2_Missense_Mutation_p.A228T	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	422	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)																	---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25019873	25019873	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25019873A>G	uc003aan.1	+	11	1497	c.1010A>G	c.(1009-1011)GAT>GGT	p.D337G	GGT1_uc003aas.1_Missense_Mutation_p.D337G|GGT1_uc003aat.1_Missense_Mutation_p.D337G|GGT1_uc003aau.1_Missense_Mutation_p.D337G|GGT1_uc003aav.1_Missense_Mutation_p.D337G|GGT1_uc003aaw.1_Missense_Mutation_p.D337G|GGT1_uc003aax.1_Missense_Mutation_p.D337G	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	337	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
TAF9B	51616	broad.mit.edu	37	X	77393257	77393257	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77393257A>T	uc004eda.2	-	4	465	c.394T>A	c.(394-396)TTA>ATA	p.L132I		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	132					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0																		---	---	---	---
FAM46D	169966	broad.mit.edu	37	X	79698713	79698713	+	Silent	SNP	C	A	A			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79698713C>A	uc004edl.1	+	5	1009	c.675C>A	c.(673-675)ACC>ACA	p.T225T	FAM46D_uc004edm.1_Silent_p.T225T	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	225										lung(2)	2																		---	---	---	---
ESX1	80712	broad.mit.edu	37	X	103495269	103495269	+	Silent	SNP	G	T	T			TCGA-BR-6457-01	TCGA-BR-6457-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103495269G>T	uc004ely.2	-	4	919	c.861C>A	c.(859-861)CCC>CCA	p.P287P		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	287	5.|15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
