Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
NBPF1	55672	broad.mit.edu	37	1	16894081	16894082	+	Intron	DEL	AG	-	-	rs35523431		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16894081_16894082delAG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
FCRL1	115350	broad.mit.edu	37	1	157769756	157769757	+	Intron	INS	-	A	A	rs74121536	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157769756_157769757insA	uc001frg.2	-						FCRL1_uc001frf.2_Intron|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170			Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)															---	---	---	---
COX7A2L	9167	broad.mit.edu	37	2	42578274	42578275	+	3'UTR	INS	-	A	A	rs71682791		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42578274_42578275insA	uc002rsk.2	-	3					COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709			cytochrome c oxidase subunit VIIa polypeptide 2						respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0																		---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100916481	100916482	+	Intron	INS	-	GG	GG	rs139033934	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100916481_100916482insGG	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
TANC1	85461	broad.mit.edu	37	2	159992543	159992562	+	Intron	DEL	GTGTGTGTGTGTGTGTGTGC	-	-	rs70994268	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992543_159992562delGTGTGTGTGTGTGTGTGTGC	uc002uag.2	+						TANC1_uc010fol.1_Intron|TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc002uah.1_5'Flank	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	217475032	217475032	+	IGR	DEL	A	-	-	rs72040741		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217475032delA								RPL37A (108846 upstream) : IGFBP2 (23095 downstream)																																			---	---	---	---
CGGBP1	8545	broad.mit.edu	37	3	88104472	88104473	+	3'UTR	INS	-	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88104472_88104473insT	uc003dqs.2	-	4					CGGBP1_uc003dqt.2_3'UTR|CGGBP1_uc003dqu.2_3'UTR	NM_001008390	NP_001008391			CGG triplet repeat binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	129717831	129717831	+	IGR	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129717831delA								TRH (21055 upstream) : ALG1L2 (82843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3626236	3626236	+	IGR	DEL	C	-	-	rs111703937		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3626236delC								LRPAP1 (92012 upstream) : ADRA2C (141839 downstream)																																			---	---	---	---
STIM2	57620	broad.mit.edu	37	4	27009077	27009077	+	Intron	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27009077delA	uc003gsh.3	+						STIM2_uc003gsg.3_Intron|STIM2_uc010iex.2_Intron|STIM2_uc010iey.2_Intron	NM_020860	NP_065911			stromal interaction molecule 2						activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	99877753	99877753	+	IGR	DEL	A	-	-	rs33952764		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99877753delA								EIF4E (25967 upstream) : METAP1 (39035 downstream)																																			---	---	---	---
LRAT	9227	broad.mit.edu	37	4	155666144	155666145	+	Intron	INS	-	CTTTTT	CTTTTT	rs146204691	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155666144_155666145insCTTTTT	uc003iom.1	+						uc003iol.2_Intron|LRAT_uc003ion.1_Intron	NM_004744	NP_004735			lecithin retinol acyltransferase						response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)													---	---	---	---
AFF4	27125	broad.mit.edu	37	5	132280658	132280659	+	Intron	INS	-	A	A	rs142291614	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132280658_132280659insA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron|AFF4_uc003kyf.3_Intron	NM_014423	NP_055238			ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29865448	29865448	+	Intron	DEL	G	-	-	rs9278416		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29865448delG	uc011dmb.1	+						HCG2P7_uc003nof.2_5'Flank	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32441392	32441393	+	IGR	INS	-	T	T	rs71556927		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441392_32441393insT								HLA-DRA (28571 upstream) : HLA-DRB1 (43770 downstream)																																			---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75855327	75855327	+	Intron	DEL	C	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855327delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	56636647	56636649	+	IGR	DEL	TTT	-	-	rs145866655		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56636647_56636649delTTT								DKFZp434L192 (71670 upstream) : ZNF479 (550679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67206114	67206117	+	IGR	DEL	TTCT	-	-	rs56895053		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67206114_67206117delTTCT								STAG3L4 (419602 upstream) : None (None downstream)																																			---	---	---	---
ZNF704	619279	broad.mit.edu	37	8	81750968	81750970	+	Intron	DEL	GGA	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81750968_81750970delGGA	uc003yby.1	-							NM_001033723	NP_001028895			zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)															---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139856552	139856555	+	Intron	DEL	CACT	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139856552_139856555delCACT	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
TTC39B	158219	broad.mit.edu	37	9	15186696	15186697	+	Intron	INS	-	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15186696_15186697insT	uc003zlr.1	-						TTC39B_uc003zlq.1_Intron|TTC39B_uc011lmp.1_Intron|TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_3'UTR|TTC39B_uc003zlp.1_Intron	NM_152574	NP_689787			tetratricopeptide repeat domain 39B								binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	99685055	99685056	+	IGR	INS	-	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99685055_99685056insA								LOC441454 (12319 upstream) : FAM22G (5536 downstream)																																			---	---	---	---
TDRD7	23424	broad.mit.edu	37	9	100201503	100201504	+	Intron	INS	-	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100201503_100201504insT	uc004axj.2	+						TDRD7_uc011lux.1_Intron	NM_014290	NP_055105			tudor domain containing 7						lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)																---	---	---	---
CHTF18	63922	broad.mit.edu	37	16	843084	843085	+	Intron	INS	-	GGGTG	GGGTG	rs139806285	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:843084_843085insGGGTG	uc002cke.3	+						CHTF18_uc010bre.1_Intron|CHTF18_uc002ckf.3_Intron|CHTF18_uc010brf.2_Intron|CHTF18_uc002ckg.3_Intron	NM_022092	NP_071375			CTF18, chromosome transmission fidelity factor						cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	32441918	32441918	+	IGR	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32441918delA								HERC2P4 (278044 upstream) : TP53TG3B (242923 downstream)																																			---	---	---	---
DULLARD	23399	broad.mit.edu	37	17	7147350	7147351	+	3'UTR	INS	-	C	C	rs147084197	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7147350_7147351insC	uc002gfd.2	-	8					GABARAP_uc002gfb.2_5'Flank|DULLARD_uc002gfe.2_3'UTR|DULLARD_uc002gff.2_3'UTR|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247			dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																																			---	---	---	---
ELAVL3	1995	broad.mit.edu	37	19	11565285	11565286	+	3'UTR	DEL	TC	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565285_11565286delTC	uc002mry.1	-	7					ELAVL3_uc002mrx.1_3'UTR	NM_001420	NP_001411			ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
NANOS3	342977	broad.mit.edu	37	19	13986003	13986003	+	5'Flank	DEL	T	-	-	rs77913995		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13986003delT	uc002mxj.3	+							NM_001098622	NP_001092092			nanos homolog 3						anti-apoptosis|germ cell development|multicellular organismal development|oogenesis|regulation of cell cycle|regulation of translation|spermatogenesis	cytoplasmic mRNA processing body|nucleus|stress granule	RNA binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(19;2e-21)															---	---	---	---
APOC2	344	broad.mit.edu	37	19	45452269	45452270	+	Intron	INS	-	CCT	CCT	rs10622462		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452269_45452270insCCT	uc002pah.2	+							NM_000483	NP_000474			apolipoprotein C-II precursor						cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)														---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074452	62074453	+	Intron	INS	-	CAC	CAC	rs139636562	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074452_62074453insCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	228010	228011	+	Intron	INS	-	TGTG	TGTG			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:228010_228011insTGTG	uc004cpd.1	-						uc004cpe.1_Intron	NM_012227	NP_036359			pseudoautosomal GTP-binding protein-like																														---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122772579	122772580	+	Intron	DEL	AC	-	-	rs35181346		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772579_122772580delAC	uc004etu.2	-						THOC2_uc011muh.1_Intron	NM_001081550	NP_001075019			THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
DNAJC16	23341	broad.mit.edu	37	1	15873410	15873410	+	Intron	DEL	C	-	-	rs76961003		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15873410delC	uc001aws.2	+						DNAJC16_uc001awr.1_Intron|DNAJC16_uc001awt.2_Intron	NM_015291	NP_056106			DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)														---	---	---	---
MFSD4	148808	broad.mit.edu	37	1	205561511	205561512	+	Intron	INS	-	A	A	rs6593956	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205561511_205561512insA	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Intron|MFSD4_uc009xbn.2_Intron	NM_181644	NP_857595			major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)															---	---	---	---
COX7A2L	9167	broad.mit.edu	37	2	42578274	42578275	+	3'UTR	INS	-	A	A	rs71682791		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42578274_42578275insA	uc002rsk.2	-	3					COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709			cytochrome c oxidase subunit VIIa polypeptide 2						respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0																		---	---	---	---
MEIS1	4211	broad.mit.edu	37	2	66667200	66667201	+	Intron	INS	-	ACACACACAC	ACACACACAC	rs144159761	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66667200_66667201insACACACACAC	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_5'Flank	NM_002398	NP_002389			Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
STK17B	9262	broad.mit.edu	37	2	197028246	197028246	+	Intron	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197028246delA	uc002utk.2	-						STK17B_uc010fsh.2_Intron	NM_004226	NP_004217			serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)															---	---	---	---
ARMC9	80210	broad.mit.edu	37	2	232121160	232121160	+	Intron	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232121160delA	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron	NM_025139	NP_079415			armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)														---	---	---	---
CGGBP1	8545	broad.mit.edu	37	3	88104472	88104473	+	3'UTR	INS	-	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88104472_88104473insT	uc003dqs.2	-	4					CGGBP1_uc003dqt.2_3'UTR|CGGBP1_uc003dqu.2_3'UTR	NM_001008390	NP_001008391			CGG triplet repeat binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding				0		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	129717831	129717831	+	IGR	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129717831delA								TRH (21055 upstream) : ALG1L2 (82843 downstream)																																			---	---	---	---
SSR3	6747	broad.mit.edu	37	3	156266563	156266564	+	Intron	INS	-	TAC	TAC	rs144621829	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156266563_156266564insTAC	uc003fau.2	-						SSR3_uc011bop.1_Intron	NM_007107	NP_009038			signal sequence receptor gamma subunit						cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161146872	161146873	+	IGR	DEL	AT	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161146872_161146873delAT								C3orf57 (57001 upstream) : OTOL1 (67723 downstream)																																			---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195494493	195494495	+	Intron	DEL	CAC	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494493_195494495delCAC	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	19815895	19815895	+	IGR	DEL	A	-	-	rs145239076		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19815895delA								None (None upstream) : SLIT2 (439340 downstream)																																			---	---	---	---
STIM2	57620	broad.mit.edu	37	4	27009077	27009077	+	Intron	DEL	A	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27009077delA	uc003gsh.3	+						STIM2_uc003gsg.3_Intron|STIM2_uc010iex.2_Intron|STIM2_uc010iey.2_Intron	NM_020860	NP_065911			stromal interaction molecule 2						activation of store-operated calcium channel activity|calcium ion transport|cellular calcium ion homeostasis|negative regulation of calcium ion transport via store-operated calcium channel activity	endoplasmic reticulum membrane|integral to membrane|plasma membrane	calcium channel regulator activity|calcium ion binding|protein binding			central_nervous_system(1)|skin(1)	2		Breast(46;0.0503)																---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48578321	48578322	+	Intron	INS	-	T	T	rs11414284		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48578321_48578322insT	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845			furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
DDX4	54514	broad.mit.edu	37	5	55088377	55088377	+	Intron	DEL	C	-	-	rs71768770		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55088377delC	uc003jqg.3	+						DDX4_uc010ivz.2_Intron|DDX4_uc003jqh.3_Intron|DDX4_uc003jqj.2_Intron	NM_001136034	NP_001129506			DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 isoform						multicellular organismal development|sperm motility	perinuclear region of cytoplasm|pi-body|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|skin(1)	2		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)																---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75855327	75855327	+	Intron	DEL	C	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855327delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
WIPI2	26100	broad.mit.edu	37	7	5270695	5270696	+	3'UTR	INS	-	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5270695_5270696insA	uc003snv.2	+	13					WIPI2_uc003snw.2_3'UTR|WIPI2_uc003snx.2_3'UTR|WIPI2_uc003sny.2_3'UTR|WIPI2_uc010ksv.2_3'UTR|WIPI2_uc003soa.2_3'UTR|WIPI2_uc003sob.2_3'UTR	NM_015610	NP_056425			WD repeat domain, phosphoinositide interacting 2						autophagic vacuole assembly	cytosol|PAS complex|pre-autophagosomal structure membrane	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding			ovary(2)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0925)|OV - Ovarian serous cystadenocarcinoma(56;2.59e-14)														---	---	---	---
EPHB4	2050	broad.mit.edu	37	7	100418088	100418088	+	Intron	DEL	A	-	-	rs71677650		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100418088delA	uc003uwn.1	-						EPHB4_uc003uwm.1_Intron|EPHB4_uc010lhj.1_Intron|EPHB4_uc011kkf.1_Intron|EPHB4_uc011kkg.1_Intron|EPHB4_uc011kkh.1_Intron	NM_004444	NP_004435			EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139856552	139856555	+	Intron	DEL	CACT	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139856552_139856555delCACT	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																																			---	---	---	---
TMEFF1	8577	broad.mit.edu	37	9	103271154	103271154	+	Intron	DEL	A	-	-	rs72170452		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103271154delA	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683			transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)																---	---	---	---
PTF1A	256297	broad.mit.edu	37	10	23482393	23482393	+	Intron	DEL	T	-	-	rs72117811		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482393delT	uc001irp.2	+							NM_178161	NP_835455			pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	22118395	22118396	+	IGR	DEL	AC	-	-	rs139043886		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118395_22118396delAC								CXADRP2 (101517 upstream) : LOC727924 (159636 downstream)																																			---	---	---	---
CNGB1	1258	broad.mit.edu	37	16	57983035	57983036	+	Intron	INS	-	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57983035_57983036insG	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288			cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4																		---	---	---	---
CCDC144C	348254	broad.mit.edu	37	17	20280158	20280159	+	Intron	INS	-	GC	GC	rs139801618		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20280158_20280159insGC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0																		---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71397914	71397915	+	Intron	INS	-	C	C	rs140071991	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71397914_71397915insC	uc010dfm.2	-						SDK2_uc002jjt.3_Intron|SDK2_uc010dfn.2_Intron	NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
MOCOS	55034	broad.mit.edu	37	18	33784959	33784960	+	Intron	INS	-	AAAAA	AAAAA			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33784959_33784960insAAAAA	uc002kzq.3	+							NM_017947	NP_060417			molybdenum cofactor sulfurase						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	17169112	17169113	+	IGR	INS	-	T	T	rs142333729	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17169112_17169113insT								OTOR (436304 upstream) : PCSK2 (37639 downstream)																																			---	---	---	---
COL20A1	57642	broad.mit.edu	37	20	61936731	61936732	+	Intron	INS	-	CC	CC	rs151066019	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61936731_61936732insCC	uc011aau.1	+						COL20A1_uc011aav.1_5'Flank	NM_020882	NP_065933			collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)																	---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074934	62074934	+	Intron	DEL	T	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074934delT	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
HIC2	23119	broad.mit.edu	37	22	21797102	21797102	+	5'UTR	DEL	G	-	-	rs66532305		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21797102delG	uc002zur.3	+	2					HIC2_uc002zus.3_5'UTR	NM_015094	NP_055909			hypermethylated in cancer 2						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding			skin(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)																---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10037863	10037863	+	IGR	DEL	C	-	-			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10037863delC								TTTY22 (387009 upstream) : None (None downstream)																																			---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22166044	22166044	+	Splice_Site	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22166044C>T	uc001bfj.2	-	73	9750	c.9710_splice	c.e73-1	p.G3237_splice	HSPG2_uc009vqd.2_Splice_Site_p.G3238_splice	NM_005529	NP_005520			heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
PTCH2	8643	broad.mit.edu	37	1	45293195	45293195	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45293195G>A	uc010olf.1	-	15	2262	c.2250C>T	c.(2248-2250)GCC>GCT	p.A750A	PTCH2_uc010olg.1_Silent_p.A448A	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	750	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)													Basal_Cell_Nevus_syndrome				---	---	---	---
HSPB11	51668	broad.mit.edu	37	1	54395805	54395805	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54395805A>C	uc001cwh.2	-	3	188	c.112T>G	c.(112-114)TTT>GTT	p.F38V	HSPB11_uc001cwi.1_Missense_Mutation_p.F38V	NM_016126	NP_057210	Q9Y547	HSB11_HUMAN	heat shock protein family B (small), member 11	38					cell adhesion|response to stress						0																		---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75038941	75038941	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038941T>C	uc001dgg.2	-	14	2672	c.2453A>G	c.(2452-2454)CAG>CGG	p.Q818R		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	818	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
EDEM3	80267	broad.mit.edu	37	1	184677466	184677466	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184677466T>C	uc010pok.1	-	17	2119	c.1858A>G	c.(1858-1860)ATC>GTC	p.I620V	EDEM3_uc010pol.1_RNA|EDEM3_uc010pom.1_Missense_Mutation_p.I620V	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like	620					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186024533	186024533	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186024533A>C	uc001grq.1	+	45	7100	c.6871A>C	c.(6871-6873)ACC>CCC	p.T2291P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2291	Ig-like C2-type 21.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
KCNK3	3777	broad.mit.edu	37	2	26950984	26950984	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26950984C>T	uc002rhn.2	+	2	896	c.733C>T	c.(733-735)CGC>TGC	p.R245C		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	245	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179463648	179463648	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179463648C>G	uc010zfg.1	-	240	49309	c.49085G>C	c.(49084-49086)AGA>ACA	p.R16362T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R10057T|TTN_uc010zfi.1_Missense_Mutation_p.R9990T|TTN_uc010zfj.1_Missense_Mutation_p.R9865T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17289							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
LIMD1	8994	broad.mit.edu	37	3	45637696	45637696	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45637696C>T	uc003coq.2	+	1	1374	c.1325C>T	c.(1324-1326)CCC>CTC	p.P442L		NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	442	Interaction with RB1.				cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)														---	---	---	---
GNAI2	2771	broad.mit.edu	37	3	50294236	50294236	+	Silent	SNP	C	T	T	rs141703681		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50294236C>T	uc003cyq.1	+	6	796	c.675C>T	c.(673-675)TGC>TGT	p.C225C	GNAI2_uc003cyo.1_Silent_p.C209C|GNAI2_uc003cyp.1_Silent_p.C209C|GNAI2_uc010hlg.1_Silent_p.C144C|GNAI2_uc011bdn.1_Silent_p.C188C|GNAI2_uc003cyr.1_Silent_p.C144C	NM_002070	NP_002061	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein),	225					adenosine receptor signaling pathway|cell cycle|cell division|gamma-aminobutyric acid signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|platelet activation|response to nutrient|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)														---	---	---	---
KTELC1	56983	broad.mit.edu	37	3	119207810	119207810	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119207810A>G	uc003ecm.2	+	8	857	c.773A>G	c.(772-774)CAT>CGT	p.H258R	KTELC1_uc011biz.1_RNA|KTELC1_uc011bja.1_Missense_Mutation_p.H99R	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	258						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)														---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	167016191	167016191	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167016191A>C	uc003fep.2	-	18	2104	c.1781T>G	c.(1780-1782)CTT>CGT	p.L594R	ZBBX_uc011bpc.1_Missense_Mutation_p.L594R|ZBBX_uc003feq.2_Missense_Mutation_p.L565R	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	594						intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
CCDC39	339829	broad.mit.edu	37	3	180364861	180364861	+	Intron	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180364861A>C	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091			coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155158023	155158023	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155158023G>A	uc003inw.2	-	25	6416	c.6416C>T	c.(6415-6417)TCA>TTA	p.S2139L		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2139	Cadherin 19.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
SKP1	6500	broad.mit.edu	37	5	133502891	133502891	+	Silent	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133502891T>C	uc003kzc.3	-	3	320	c.141A>G	c.(139-141)CTA>CTG	p.L47L	SKP1_uc003kzd.3_Silent_p.L47L|SKP1_uc010jdv.2_Silent_p.L47L	NM_170679	NP_733779	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1 isoform b	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
HIST1H4J	8363	broad.mit.edu	37	6	27791916	27791916	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27791916G>A	uc003njp.2	+	1	14	c.14G>A	c.(13-15)GGC>GAC	p.G5D	uc003njq.2_5'Flank	NM_021968	NP_068803	P62805	H4_HUMAN	histone cluster 1, H4j	5					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|pancreas(1)	2																		---	---	---	---
DEF6	50619	broad.mit.edu	37	6	35280239	35280239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35280239G>A	uc003okk.2	+	4	623	c.584G>A	c.(583-585)CGG>CAG	p.R195Q	DEF6_uc010jvs.2_Missense_Mutation_p.R195Q|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	195						cytoplasm|nucleus|plasma membrane					0																		---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143091386	143091386	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143091386C>A	uc003qjd.2	-	5	5233	c.4490G>T	c.(4489-4491)CGA>CTA	p.R1497L		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1497					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38791832	38791832	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38791832C>T	uc003tgy.2	-	22	1896	c.1870G>A	c.(1870-1872)GAT>AAT	p.D624N	VPS41_uc003tgz.2_Missense_Mutation_p.D599N|VPS41_uc010kxn.2_Missense_Mutation_p.D535N	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	624	Clathrin.				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70228050	70228050	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70228050C>G	uc003tvw.3	+	7	1680	c.937C>G	c.(937-939)CCC>GCC	p.P313A	AUTS2_uc003tvx.3_Missense_Mutation_p.P313A	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	313										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
CALCR	799	broad.mit.edu	37	7	93065271	93065271	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93065271T>C	uc003umv.1	-	13	1505	c.1244A>G	c.(1243-1245)CAT>CGT	p.H415R	CALCR_uc011kia.1_Missense_Mutation_p.H195R|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.H381R|CALCR_uc003umw.2_Missense_Mutation_p.H381R	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	397	Helical; Name=7; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---
RINT1	60561	broad.mit.edu	37	7	105177188	105177188	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105177188G>C	uc003vda.1	+	3	496	c.265G>C	c.(265-267)GAA>CAA	p.E89Q	RINT1_uc010ljj.1_Intron	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	89					cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149489038	149489038	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149489038G>A	uc010lpk.2	+	36	5379	c.5379G>A	c.(5377-5379)CTG>CTA	p.L1793L		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1793	TSP type-1 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
MYST3	7994	broad.mit.edu	37	8	41814760	41814760	+	Intron	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41814760C>A	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882			MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)															---	---	---	---
LRRC67	286187	broad.mit.edu	37	8	67929951	67929951	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67929951C>A	uc003xxc.2	-	2	177	c.32G>T	c.(31-33)AGA>ATA	p.R11I		NM_001013626	NP_001013648	Q7Z4L9	LRC67_HUMAN	leucine rich repeat containing 67	11											0																		---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113420594	113420594	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113420594G>T	uc003ynu.2	-	34	5717	c.5558C>A	c.(5557-5559)ACT>AAT	p.T1853N	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Missense_Mutation_p.T1813N|CSMD3_uc011lhx.1_Missense_Mutation_p.T1749N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1853	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
TMEM8B	51754	broad.mit.edu	37	9	35853171	35853171	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35853171A>G	uc003zym.2	+	13	2015	c.1000A>G	c.(1000-1002)ATG>GTG	p.M334V	TMEM8B_uc003zyo.2_Missense_Mutation_p.M334V	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a	334	Helical; (Potential).				cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
IGSF22	283284	broad.mit.edu	37	11	18745712	18745712	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18745712G>A	uc009yht.2	-	2	262	c.72C>T	c.(70-72)CAC>CAT	p.H24H	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	24										ovary(4)|large_intestine(2)|kidney(1)	7																		---	---	---	---
OR4X1	390113	broad.mit.edu	37	11	48285907	48285907	+	Silent	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48285907G>T	uc010rht.1	+	1	495	c.495G>T	c.(493-495)CCG>CCT	p.P165P		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65648922	65648922	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65648922G>A	uc001ogc.1	+	3	259	c.217G>A	c.(217-219)GCT>ACT	p.A73T	CTSW_uc001ogb.1_Missense_Mutation_p.A73T	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	73					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65649650	65649650	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65649650G>A	uc001ogc.1	+	4	333	c.291G>A	c.(289-291)GAG>GAA	p.E97E	CTSW_uc001ogb.1_Silent_p.E97E	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	97					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65649723	65649723	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65649723G>A	uc001ogc.1	+	4	406	c.364G>A	c.(364-366)GAA>AAA	p.E122K	CTSW_uc001ogb.1_Missense_Mutation_p.E122K	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	122					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CAPN5	726	broad.mit.edu	37	11	76833610	76833610	+	Intron	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76833610C>T	uc001oxx.2	+						CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron|CAPN5_uc001oya.2_Intron	NM_004055	NP_004046			calpain 5						proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
EED	8726	broad.mit.edu	37	11	85988118	85988118	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85988118C>T	uc001pbp.2	+	10	1520	c.1063C>T	c.(1063-1065)CGA>TGA	p.R355*	EED_uc010rtm.1_Nonsense_Mutation_p.R355*|EED_uc001pbq.2_Nonsense_Mutation_p.R355*|EED_uc001pbr.2_Nonsense_Mutation_p.R380*|EED_uc001pbs.2_Nonsense_Mutation_p.R275*|EED_uc010rtn.1_RNA	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a	355	Interaction with EZH2 (By similarity).|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)																---	---	---	---
CACNA2D4	93589	broad.mit.edu	37	12	1902853	1902853	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1902853C>T	uc001qjp.2	-	38	3613	c.3382G>A	c.(3382-3384)GCC>ACC	p.A1128T	CACNA2D4_uc001qjo.2_Silent_p.V272V	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	1128	Helical; (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)														---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2566826	2566826	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2566826G>A	uc009zdu.1	+	5	1024	c.711G>A	c.(709-711)AGG>AGA	p.R237R	CACNA1C_uc009zdv.1_Silent_p.R237R|CACNA1C_uc001qkb.2_Silent_p.R237R|CACNA1C_uc001qkc.2_Silent_p.R237R|CACNA1C_uc001qke.2_Silent_p.R237R|CACNA1C_uc001qkf.2_Silent_p.R237R|CACNA1C_uc001qjz.2_Silent_p.R237R|CACNA1C_uc001qkd.2_Silent_p.R237R|CACNA1C_uc001qkg.2_Silent_p.R237R|CACNA1C_uc009zdw.1_Silent_p.R237R|CACNA1C_uc001qkh.2_Silent_p.R237R|CACNA1C_uc001qkl.2_Silent_p.R237R|CACNA1C_uc001qkn.2_Silent_p.R237R|CACNA1C_uc001qko.2_Silent_p.R237R|CACNA1C_uc001qkp.2_Silent_p.R237R|CACNA1C_uc001qkr.2_Silent_p.R237R|CACNA1C_uc001qku.2_Silent_p.R237R|CACNA1C_uc001qkq.2_Silent_p.R237R|CACNA1C_uc001qks.2_Silent_p.R237R|CACNA1C_uc001qkt.2_Silent_p.R237R|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	237	I.|Helical; Name=S4 of repeat I; (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23687406	23687406	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23687406G>C	uc001rfw.2	-	15	2141	c.2039C>G	c.(2038-2040)GCC>GGC	p.A680G	SOX5_uc001rfx.2_Missense_Mutation_p.A667G|SOX5_uc001rfy.2_Missense_Mutation_p.A559G|SOX5_uc001rfv.2_Missense_Mutation_p.A294G|SOX5_uc010siv.1_Missense_Mutation_p.A667G	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	680					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
OVCH1	341350	broad.mit.edu	37	12	29608198	29608198	+	Silent	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29608198G>T	uc001rix.1	-	20	2421	c.2421C>A	c.(2419-2421)ATC>ATA	p.I807I		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	807	Peptidase S1 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)																	---	---	---	---
CAPRIN2	65981	broad.mit.edu	37	12	30881672	30881672	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30881672C>G	uc001rji.1	-	8	2443	c.1692G>C	c.(1690-1692)CAG>CAC	p.Q564H	CAPRIN2_uc001rjf.1_Missense_Mutation_p.Q361H|CAPRIN2_uc001rjg.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjh.1_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjj.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjk.3_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjl.3_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjm.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjn.1_Missense_Mutation_p.Q231H	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	564					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)																	---	---	---	---
SYT10	341359	broad.mit.edu	37	12	33535294	33535294	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33535294C>T	uc001rll.1	-	5	1657	c.1360G>A	c.(1360-1362)GAT>AAT	p.D454N	SYT10_uc009zju.1_Missense_Mutation_p.D264N	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	454	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)																	---	---	---	---
CCDC65	85478	broad.mit.edu	37	12	49315051	49315051	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49315051A>G	uc001rso.2	+	8	1507	c.1280A>G	c.(1279-1281)GAT>GGT	p.D427G		NM_033124	NP_149115	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	427										ovary(1)|skin(1)	2																		---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36445384	36445384	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36445384T>C	uc001uvf.2	-	5	1150	c.917A>G	c.(916-918)AAG>AGG	p.K306R	uc001uvi.1_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	306	Pro/Ser-rich.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
CTAGE5	4253	broad.mit.edu	37	14	39818102	39818102	+	Silent	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39818102T>C	uc001wvg.3	+	23	2505	c.2169T>C	c.(2167-2169)CCT>CCC	p.P723P	CTAGE5_uc001wuz.3_Silent_p.P711P|CTAGE5_uc001wuy.3_Silent_p.P643P|CTAGE5_uc001wvb.3_Silent_p.P651P|CTAGE5_uc001wvc.3_Silent_p.P625P|CTAGE5_uc001wva.3_Silent_p.P694P|CTAGE5_uc001wvh.3_Silent_p.P680P|CTAGE5_uc001wvf.3_Silent_p.P648P|CTAGE5_uc001wvi.3_Silent_p.P728P|CTAGE5_uc010amz.2_Silent_p.P339P|CTAGE5_uc001wvj.3_Silent_p.P694P	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	723	Pro-rich.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)														---	---	---	---
PPP1R13B	23368	broad.mit.edu	37	14	104206688	104206688	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104206688C>T	uc001yof.1	-	12	2348	c.2065G>A	c.(2065-2067)GCA>ACA	p.A689T	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Missense_Mutation_p.A556T	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	689	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)																---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54586215	54586215	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54586215T>A	uc002ack.2	+	9	3941	c.3941T>A	c.(3940-3942)GTA>GAA	p.V1314E	UNC13C_uc002acl.2_Missense_Mutation_p.V144E	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1314					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100514743	100514743	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100514743C>T	uc002bvv.1	-	22	3231	c.3152G>A	c.(3151-3153)CGA>CAA	p.R1051Q	ADAMTS17_uc002bvw.1_RNA	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1051	PLAC.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
C17orf97	400566	broad.mit.edu	37	17	263352	263352	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263352G>A	uc002frh.2	+	3	764	c.748G>A	c.(748-750)GAG>AAG	p.E250K	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	270	7.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1																		---	---	---	---
PAFAH1B1	5048	broad.mit.edu	37	17	2576045	2576045	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2576045A>G	uc002fuw.3	+	7	1233	c.665A>G	c.(664-666)CAA>CGA	p.Q222R	PAFAH1B1_uc010ckb.1_RNA|PAFAH1B1_uc010vqz.1_Missense_Mutation_p.Q51R	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,	222	WD 3.|Interaction with dynein and dynactin.				acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50731695	50731695	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50731695C>G	uc002lfe.1	+	10	2270	c.1683C>G	c.(1681-1683)TAC>TAG	p.Y561*	DCC_uc010xdr.1_Nonsense_Mutation_p.Y409*|DCC_uc010dpf.1_Nonsense_Mutation_p.Y216*	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	561	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65179389	65179389	+	Silent	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179389C>T	uc002lke.1	-	2	3711	c.2487G>A	c.(2485-2487)GTG>GTA	p.V829V		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	819	Helical; (Potential).					integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
ZNF559	84527	broad.mit.edu	37	19	9453327	9453327	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453327G>T	uc002mlg.2	+	7	1847	c.1200G>T	c.(1198-1200)ATG>ATT	p.M400I	ZNF559_uc002mlf.2_Missense_Mutation_p.M169I|ZNF559_uc010dwl.1_Missense_Mutation_p.M169I|ZNF559_uc010xkn.1_Missense_Mutation_p.M392I|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Missense_Mutation_p.M464I|ZNF559_uc010dwk.1_Missense_Mutation_p.M169I|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	400	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZNF559	84527	broad.mit.edu	37	19	9453328	9453328	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453328C>T	uc002mlg.2	+	7	1848	c.1201C>T	c.(1201-1203)CAG>TAG	p.Q401*	ZNF559_uc002mlf.2_Nonsense_Mutation_p.Q170*|ZNF559_uc010dwl.1_Nonsense_Mutation_p.Q170*|ZNF559_uc010xkn.1_Nonsense_Mutation_p.Q393*|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Nonsense_Mutation_p.Q465*|ZNF559_uc010dwk.1_Nonsense_Mutation_p.Q170*|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	401	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
LDLR	3949	broad.mit.edu	37	19	11218068	11218068	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11218068T>G	uc002mqk.3	+	6	986	c.818T>G	c.(817-819)GTG>GGG	p.V273G	LDLR_uc010xlk.1_Missense_Mutation_p.V273G|LDLR_uc010xll.1_Missense_Mutation_p.V232G|LDLR_uc010xlm.1_Missense_Mutation_p.V126G|LDLR_uc010xln.1_Missense_Mutation_p.V146G|LDLR_uc010xlo.1_Missense_Mutation_p.L105R	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	273	Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)													---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10094279	10094279	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10094279C>T	uc004csx.3	+	15	2237	c.2039C>T	c.(2038-2040)GCG>GTG	p.A680V	WWC3_uc010nds.2_Missense_Mutation_p.A344V|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	680	C2.									ovary(4)	4																		---	---	---	---
ZMYM3	9203	broad.mit.edu	37	X	70465871	70465871	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70465871G>C	uc004dzh.1	-	16	2737	c.2650C>G	c.(2650-2652)CAG>GAG	p.Q884E	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.Q884E|ZMYM3_uc004dzj.1_Missense_Mutation_p.Q872E	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	884					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)																	---	---	---	---
HSPG2	3339	broad.mit.edu	37	1	22166044	22166044	+	Splice_Site	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22166044C>T	uc001bfj.2	-	73	9750	c.9710_splice	c.e73-1	p.G3237_splice	HSPG2_uc009vqd.2_Splice_Site_p.G3238_splice	NM_005529	NP_005520			heparan sulfate proteoglycan 2 precursor						angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)													---	---	---	---
PTCH2	8643	broad.mit.edu	37	1	45293195	45293195	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45293195G>A	uc010olf.1	-	15	2262	c.2250C>T	c.(2248-2250)GCC>GCT	p.A750A	PTCH2_uc010olg.1_Silent_p.A448A	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	750	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)													Basal_Cell_Nevus_syndrome				---	---	---	---
HSPB11	51668	broad.mit.edu	37	1	54395805	54395805	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54395805A>C	uc001cwh.2	-	3	188	c.112T>G	c.(112-114)TTT>GTT	p.F38V	HSPB11_uc001cwi.1_Missense_Mutation_p.F38V	NM_016126	NP_057210	Q9Y547	HSB11_HUMAN	heat shock protein family B (small), member 11	38					cell adhesion|response to stress						0																		---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75038941	75038941	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038941T>C	uc001dgg.2	-	14	2672	c.2453A>G	c.(2452-2454)CAG>CGG	p.Q818R		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	818	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
EDEM3	80267	broad.mit.edu	37	1	184677466	184677466	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184677466T>C	uc010pok.1	-	17	2119	c.1858A>G	c.(1858-1860)ATC>GTC	p.I620V	EDEM3_uc010pol.1_RNA|EDEM3_uc010pom.1_Missense_Mutation_p.I620V	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like	620					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1																		---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186024533	186024533	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186024533A>C	uc001grq.1	+	45	7100	c.6871A>C	c.(6871-6873)ACC>CCC	p.T2291P		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2291	Ig-like C2-type 21.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
KCNK3	3777	broad.mit.edu	37	2	26950984	26950984	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26950984C>T	uc002rhn.2	+	2	896	c.733C>T	c.(733-735)CGC>TGC	p.R245C		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	245	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
TTN	7273	broad.mit.edu	37	2	179463648	179463648	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179463648C>G	uc010zfg.1	-	240	49309	c.49085G>C	c.(49084-49086)AGA>ACA	p.R16362T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R10057T|TTN_uc010zfi.1_Missense_Mutation_p.R9990T|TTN_uc010zfj.1_Missense_Mutation_p.R9865T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17289							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
LIMD1	8994	broad.mit.edu	37	3	45637696	45637696	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45637696C>T	uc003coq.2	+	1	1374	c.1325C>T	c.(1324-1326)CCC>CTC	p.P442L		NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	442	Interaction with RB1.				cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)														---	---	---	---
GNAI2	2771	broad.mit.edu	37	3	50294236	50294236	+	Silent	SNP	C	T	T	rs141703681		TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50294236C>T	uc003cyq.1	+	6	796	c.675C>T	c.(673-675)TGC>TGT	p.C225C	GNAI2_uc003cyo.1_Silent_p.C209C|GNAI2_uc003cyp.1_Silent_p.C209C|GNAI2_uc010hlg.1_Silent_p.C144C|GNAI2_uc011bdn.1_Silent_p.C188C|GNAI2_uc003cyr.1_Silent_p.C144C	NM_002070	NP_002061	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein),	225					adenosine receptor signaling pathway|cell cycle|cell division|gamma-aminobutyric acid signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of calcium ion transport via voltage-gated calcium channel activity|platelet activation|response to nutrient|synaptic transmission	centrosome|heterotrimeric G-protein complex|midbody	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)														---	---	---	---
KTELC1	56983	broad.mit.edu	37	3	119207810	119207810	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119207810A>G	uc003ecm.2	+	8	857	c.773A>G	c.(772-774)CAT>CGT	p.H258R	KTELC1_uc011biz.1_RNA|KTELC1_uc011bja.1_Missense_Mutation_p.H99R	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	258						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)														---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	167016191	167016191	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167016191A>C	uc003fep.2	-	18	2104	c.1781T>G	c.(1780-1782)CTT>CGT	p.L594R	ZBBX_uc011bpc.1_Missense_Mutation_p.L594R|ZBBX_uc003feq.2_Missense_Mutation_p.L565R	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	594						intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
CCDC39	339829	broad.mit.edu	37	3	180364861	180364861	+	Intron	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180364861A>C	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091			coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155158023	155158023	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155158023G>A	uc003inw.2	-	25	6416	c.6416C>T	c.(6415-6417)TCA>TTA	p.S2139L		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2139	Cadherin 19.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
SKP1	6500	broad.mit.edu	37	5	133502891	133502891	+	Silent	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133502891T>C	uc003kzc.3	-	3	320	c.141A>G	c.(139-141)CTA>CTG	p.L47L	SKP1_uc003kzd.3_Silent_p.L47L|SKP1_uc010jdv.2_Silent_p.L47L	NM_170679	NP_733779	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1 isoform b	47					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
HIST1H4J	8363	broad.mit.edu	37	6	27791916	27791916	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27791916G>A	uc003njp.2	+	1	14	c.14G>A	c.(13-15)GGC>GAC	p.G5D	uc003njq.2_5'Flank	NM_021968	NP_068803	P62805	H4_HUMAN	histone cluster 1, H4j	5					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)|pancreas(1)	2																		---	---	---	---
DEF6	50619	broad.mit.edu	37	6	35280239	35280239	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35280239G>A	uc003okk.2	+	4	623	c.584G>A	c.(583-585)CGG>CAG	p.R195Q	DEF6_uc010jvs.2_Missense_Mutation_p.R195Q|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	195						cytoplasm|nucleus|plasma membrane					0																		---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143091386	143091386	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143091386C>A	uc003qjd.2	-	5	5233	c.4490G>T	c.(4489-4491)CGA>CTA	p.R1497L		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1497					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38791832	38791832	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38791832C>T	uc003tgy.2	-	22	1896	c.1870G>A	c.(1870-1872)GAT>AAT	p.D624N	VPS41_uc003tgz.2_Missense_Mutation_p.D599N|VPS41_uc010kxn.2_Missense_Mutation_p.D535N	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	624	Clathrin.				Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70228050	70228050	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70228050C>G	uc003tvw.3	+	7	1680	c.937C>G	c.(937-939)CCC>GCC	p.P313A	AUTS2_uc003tvx.3_Missense_Mutation_p.P313A	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	313										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
CALCR	799	broad.mit.edu	37	7	93065271	93065271	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93065271T>C	uc003umv.1	-	13	1505	c.1244A>G	c.(1243-1245)CAT>CGT	p.H415R	CALCR_uc011kia.1_Missense_Mutation_p.H195R|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.H381R|CALCR_uc003umw.2_Missense_Mutation_p.H381R	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	397	Helical; Name=7; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---
RINT1	60561	broad.mit.edu	37	7	105177188	105177188	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105177188G>C	uc003vda.1	+	3	496	c.265G>C	c.(265-267)GAA>CAA	p.E89Q	RINT1_uc010ljj.1_Intron	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	89					cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149489038	149489038	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149489038G>A	uc010lpk.2	+	36	5379	c.5379G>A	c.(5377-5379)CTG>CTA	p.L1793L		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1793	TSP type-1 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
MYST3	7994	broad.mit.edu	37	8	41814760	41814760	+	Intron	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41814760C>A	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882			MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)															---	---	---	---
LRRC67	286187	broad.mit.edu	37	8	67929951	67929951	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67929951C>A	uc003xxc.2	-	2	177	c.32G>T	c.(31-33)AGA>ATA	p.R11I		NM_001013626	NP_001013648	Q7Z4L9	LRC67_HUMAN	leucine rich repeat containing 67	11											0																		---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113420594	113420594	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113420594G>T	uc003ynu.2	-	34	5717	c.5558C>A	c.(5557-5559)ACT>AAT	p.T1853N	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Missense_Mutation_p.T1813N|CSMD3_uc011lhx.1_Missense_Mutation_p.T1749N	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1853	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
TMEM8B	51754	broad.mit.edu	37	9	35853171	35853171	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35853171A>G	uc003zym.2	+	13	2015	c.1000A>G	c.(1000-1002)ATG>GTG	p.M334V	TMEM8B_uc003zyo.2_Missense_Mutation_p.M334V	NM_001042589	NP_001036054	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B isoform a	334	Helical; (Potential).				cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
IGSF22	283284	broad.mit.edu	37	11	18745712	18745712	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18745712G>A	uc009yht.2	-	2	262	c.72C>T	c.(70-72)CAC>CAT	p.H24H	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	24										ovary(4)|large_intestine(2)|kidney(1)	7																		---	---	---	---
OR4X1	390113	broad.mit.edu	37	11	48285907	48285907	+	Silent	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48285907G>T	uc010rht.1	+	1	495	c.495G>T	c.(493-495)CCG>CCT	p.P165P		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65648922	65648922	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65648922G>A	uc001ogc.1	+	3	259	c.217G>A	c.(217-219)GCT>ACT	p.A73T	CTSW_uc001ogb.1_Missense_Mutation_p.A73T	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	73					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65649650	65649650	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65649650G>A	uc001ogc.1	+	4	333	c.291G>A	c.(289-291)GAG>GAA	p.E97E	CTSW_uc001ogb.1_Silent_p.E97E	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	97					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CTSW	1521	broad.mit.edu	37	11	65649723	65649723	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65649723G>A	uc001ogc.1	+	4	406	c.364G>A	c.(364-366)GAA>AAA	p.E122K	CTSW_uc001ogb.1_Missense_Mutation_p.E122K	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein	122					immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)														---	---	---	---
CAPN5	726	broad.mit.edu	37	11	76833610	76833610	+	Intron	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76833610C>T	uc001oxx.2	+						CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron|CAPN5_uc001oya.2_Intron	NM_004055	NP_004046			calpain 5						proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
EED	8726	broad.mit.edu	37	11	85988118	85988118	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85988118C>T	uc001pbp.2	+	10	1520	c.1063C>T	c.(1063-1065)CGA>TGA	p.R355*	EED_uc010rtm.1_Nonsense_Mutation_p.R355*|EED_uc001pbq.2_Nonsense_Mutation_p.R355*|EED_uc001pbr.2_Nonsense_Mutation_p.R380*|EED_uc001pbs.2_Nonsense_Mutation_p.R275*|EED_uc010rtn.1_RNA	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a	355	Interaction with EZH2 (By similarity).|Required for interaction with the matrix protein MA of HIV-1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)																---	---	---	---
CACNA2D4	93589	broad.mit.edu	37	12	1902853	1902853	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1902853C>T	uc001qjp.2	-	38	3613	c.3382G>A	c.(3382-3384)GCC>ACC	p.A1128T	CACNA2D4_uc001qjo.2_Silent_p.V272V	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	1128	Helical; (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)														---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2566826	2566826	+	Silent	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2566826G>A	uc009zdu.1	+	5	1024	c.711G>A	c.(709-711)AGG>AGA	p.R237R	CACNA1C_uc009zdv.1_Silent_p.R237R|CACNA1C_uc001qkb.2_Silent_p.R237R|CACNA1C_uc001qkc.2_Silent_p.R237R|CACNA1C_uc001qke.2_Silent_p.R237R|CACNA1C_uc001qkf.2_Silent_p.R237R|CACNA1C_uc001qjz.2_Silent_p.R237R|CACNA1C_uc001qkd.2_Silent_p.R237R|CACNA1C_uc001qkg.2_Silent_p.R237R|CACNA1C_uc009zdw.1_Silent_p.R237R|CACNA1C_uc001qkh.2_Silent_p.R237R|CACNA1C_uc001qkl.2_Silent_p.R237R|CACNA1C_uc001qkn.2_Silent_p.R237R|CACNA1C_uc001qko.2_Silent_p.R237R|CACNA1C_uc001qkp.2_Silent_p.R237R|CACNA1C_uc001qkr.2_Silent_p.R237R|CACNA1C_uc001qku.2_Silent_p.R237R|CACNA1C_uc001qkq.2_Silent_p.R237R|CACNA1C_uc001qks.2_Silent_p.R237R|CACNA1C_uc001qkt.2_Silent_p.R237R|CACNA1C_uc001qka.1_5'UTR|CACNA1C_uc001qki.1_5'UTR|CACNA1C_uc001qkj.1_5'UTR|CACNA1C_uc001qkk.1_5'UTR|CACNA1C_uc001qkm.1_5'UTR	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	237	I.|Helical; Name=S4 of repeat I; (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23687406	23687406	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23687406G>C	uc001rfw.2	-	15	2141	c.2039C>G	c.(2038-2040)GCC>GGC	p.A680G	SOX5_uc001rfx.2_Missense_Mutation_p.A667G|SOX5_uc001rfy.2_Missense_Mutation_p.A559G|SOX5_uc001rfv.2_Missense_Mutation_p.A294G|SOX5_uc010siv.1_Missense_Mutation_p.A667G	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	680					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
OVCH1	341350	broad.mit.edu	37	12	29608198	29608198	+	Silent	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29608198G>T	uc001rix.1	-	20	2421	c.2421C>A	c.(2419-2421)ATC>ATA	p.I807I		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	807	Peptidase S1 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)																	---	---	---	---
CAPRIN2	65981	broad.mit.edu	37	12	30881672	30881672	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30881672C>G	uc001rji.1	-	8	2443	c.1692G>C	c.(1690-1692)CAG>CAC	p.Q564H	CAPRIN2_uc001rjf.1_Missense_Mutation_p.Q361H|CAPRIN2_uc001rjg.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjh.1_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjj.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjk.3_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjl.3_Missense_Mutation_p.Q564H|CAPRIN2_uc001rjm.1_Missense_Mutation_p.Q231H|CAPRIN2_uc001rjn.1_Missense_Mutation_p.Q231H	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	564					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)																	---	---	---	---
SYT10	341359	broad.mit.edu	37	12	33535294	33535294	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33535294C>T	uc001rll.1	-	5	1657	c.1360G>A	c.(1360-1362)GAT>AAT	p.D454N	SYT10_uc009zju.1_Missense_Mutation_p.D264N	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	454	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)																	---	---	---	---
CCDC65	85478	broad.mit.edu	37	12	49315051	49315051	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49315051A>G	uc001rso.2	+	8	1507	c.1280A>G	c.(1279-1281)GAT>GGT	p.D427G		NM_033124	NP_149115	Q8IXS2	CCD65_HUMAN	coiled-coil domain containing 65	427										ovary(1)|skin(1)	2																		---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36445384	36445384	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36445384T>C	uc001uvf.2	-	5	1150	c.917A>G	c.(916-918)AAG>AGG	p.K306R	uc001uvi.1_Intron	NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	306	Pro/Ser-rich.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
CTAGE5	4253	broad.mit.edu	37	14	39818102	39818102	+	Silent	SNP	T	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39818102T>C	uc001wvg.3	+	23	2505	c.2169T>C	c.(2167-2169)CCT>CCC	p.P723P	CTAGE5_uc001wuz.3_Silent_p.P711P|CTAGE5_uc001wuy.3_Silent_p.P643P|CTAGE5_uc001wvb.3_Silent_p.P651P|CTAGE5_uc001wvc.3_Silent_p.P625P|CTAGE5_uc001wva.3_Silent_p.P694P|CTAGE5_uc001wvh.3_Silent_p.P680P|CTAGE5_uc001wvf.3_Silent_p.P648P|CTAGE5_uc001wvi.3_Silent_p.P728P|CTAGE5_uc010amz.2_Silent_p.P339P|CTAGE5_uc001wvj.3_Silent_p.P694P	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	723	Pro-rich.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)														---	---	---	---
C14orf50	145376	broad.mit.edu	37	14	65054868	65054868	+	Missense_Mutation	SNP	C	T	T	rs78726030	by1000genomes	TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65054868C>T	uc001xhl.1	+	11	1033	c.937C>T	c.(937-939)CGT>TGT	p.R313C	C14orf50_uc001xhm.1_Missense_Mutation_p.R43C	NM_172365	NP_758953	Q96LQ0	CN050_HUMAN	hypothetical protein LOC145376	313										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)														---	---	---	---
PPP1R13B	23368	broad.mit.edu	37	14	104206688	104206688	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104206688C>T	uc001yof.1	-	12	2348	c.2065G>A	c.(2065-2067)GCA>ACA	p.A689T	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Missense_Mutation_p.A556T	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	689	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)																---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54586215	54586215	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54586215T>A	uc002ack.2	+	9	3941	c.3941T>A	c.(3940-3942)GTA>GAA	p.V1314E	UNC13C_uc002acl.2_Missense_Mutation_p.V144E	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1314					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100514743	100514743	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100514743C>T	uc002bvv.1	-	22	3231	c.3152G>A	c.(3151-3153)CGA>CAA	p.R1051Q	ADAMTS17_uc002bvw.1_RNA	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1051	PLAC.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
C17orf97	400566	broad.mit.edu	37	17	263352	263352	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263352G>A	uc002frh.2	+	3	764	c.748G>A	c.(748-750)GAG>AAG	p.E250K	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	270	7.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1																		---	---	---	---
PAFAH1B1	5048	broad.mit.edu	37	17	2576045	2576045	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2576045A>G	uc002fuw.3	+	7	1233	c.665A>G	c.(664-666)CAA>CGA	p.Q222R	PAFAH1B1_uc010ckb.1_RNA|PAFAH1B1_uc010vqz.1_Missense_Mutation_p.Q51R	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,	222	WD 3.|Interaction with dynein and dynactin.				acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1																		---	---	---	---
DCC	1630	broad.mit.edu	37	18	50731695	50731695	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50731695C>G	uc002lfe.1	+	10	2270	c.1683C>G	c.(1681-1683)TAC>TAG	p.Y561*	DCC_uc010xdr.1_Nonsense_Mutation_p.Y409*|DCC_uc010dpf.1_Nonsense_Mutation_p.Y216*	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	561	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65179389	65179389	+	Silent	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179389C>T	uc002lke.1	-	2	3711	c.2487G>A	c.(2485-2487)GTG>GTA	p.V829V		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	819	Helical; (Potential).					integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
ZNF559	84527	broad.mit.edu	37	19	9453327	9453327	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453327G>T	uc002mlg.2	+	7	1847	c.1200G>T	c.(1198-1200)ATG>ATT	p.M400I	ZNF559_uc002mlf.2_Missense_Mutation_p.M169I|ZNF559_uc010dwl.1_Missense_Mutation_p.M169I|ZNF559_uc010xkn.1_Missense_Mutation_p.M392I|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Missense_Mutation_p.M464I|ZNF559_uc010dwk.1_Missense_Mutation_p.M169I|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	400	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ZNF559	84527	broad.mit.edu	37	19	9453328	9453328	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9453328C>T	uc002mlg.2	+	7	1848	c.1201C>T	c.(1201-1203)CAG>TAG	p.Q401*	ZNF559_uc002mlf.2_Nonsense_Mutation_p.Q170*|ZNF559_uc010dwl.1_Nonsense_Mutation_p.Q170*|ZNF559_uc010xkn.1_Nonsense_Mutation_p.Q393*|ZNF559_uc010dwm.1_3'UTR|ZNF559_uc002mle.3_Nonsense_Mutation_p.Q465*|ZNF559_uc010dwk.1_Nonsense_Mutation_p.Q170*|ZNF559_uc002mld.2_3'UTR|ZNF559_uc010dwo.1_Intron|ZNF177_uc002mli.2_Intron|ZNF177_uc002mlj.2_Intron	NM_032497	NP_115886	Q9BR84	ZN559_HUMAN	zinc finger protein 559	401	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
LDLR	3949	broad.mit.edu	37	19	11218068	11218068	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11218068T>G	uc002mqk.3	+	6	986	c.818T>G	c.(817-819)GTG>GGG	p.V273G	LDLR_uc010xlk.1_Missense_Mutation_p.V273G|LDLR_uc010xll.1_Missense_Mutation_p.V232G|LDLR_uc010xlm.1_Missense_Mutation_p.V126G|LDLR_uc010xln.1_Missense_Mutation_p.V146G|LDLR_uc010xlo.1_Missense_Mutation_p.L105R	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	273	Extracellular (Potential).				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)													---	---	---	---
TPST2	8459	broad.mit.edu	37	22	26937214	26937214	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26937214A>C	uc003acv.2	-	2	551	c.383T>G	c.(382-384)GTG>GGG	p.V128G	TPST2_uc003acw.2_Missense_Mutation_p.V128G|TPST2_uc003acx.2_Missense_Mutation_p.V128G|TPST2_uc011akf.1_Missense_Mutation_p.V128G	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	128	Lumenal (Potential).				peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1																		---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10094279	10094279	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10094279C>T	uc004csx.3	+	15	2237	c.2039C>T	c.(2038-2040)GCG>GTG	p.A680V	WWC3_uc010nds.2_Missense_Mutation_p.A344V|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	680	C2.									ovary(4)	4																		---	---	---	---
ZMYM3	9203	broad.mit.edu	37	X	70465871	70465871	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6709-01	TCGA-BR-6709-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70465871G>C	uc004dzh.1	-	16	2737	c.2650C>G	c.(2650-2652)CAG>GAG	p.Q884E	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.Q884E|ZMYM3_uc004dzj.1_Missense_Mutation_p.Q872E	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	884					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)																	---	---	---	---
