Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	154350594	154350594	+	IGR	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154350594delT								ATP8B2 (26815 upstream) : IL6R (27075 downstream)																																			---	---	---	---
EDEM3	80267	broad.mit.edu	37	1	184681066	184681066	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184681066delT	uc010pok.1	-						EDEM3_uc010pol.1_Intron|EDEM3_uc010pom.1_Intron	NM_025191	NP_079467			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1																		---	---	---	---
TMEM63A	9725	broad.mit.edu	37	1	226061869	226061870	+	Intron	DEL	AC	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226061869_226061870delAC	uc001hpm.1	-						TMEM63A_uc010pvi.1_Intron	NM_014698	NP_055513			transmembrane protein 63A							integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	64602814	64602815	+	IGR	INS	-	CAT	CAT			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64602814_64602815insCAT								PELI1 (231209 upstream) : HSPC159 (78512 downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87954896	87954896	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87954896delA	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
ANO10	55129	broad.mit.edu	37	3	43621635	43621635	+	Intron	DEL	A	-	-	rs71636892		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43621635delA	uc003cmv.2	-						ANO10_uc011azs.1_Intron|ANO10_uc003cmw.2_Intron|ANO10_uc010hil.2_Intron|ANO10_uc011azt.1_Intron	NM_018075	NP_060545			transmembrane protein 16K						cell death	chloride channel complex	chloride channel activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	110475293	110475294	+	IGR	INS	-	CTTCAGGAAG	CTTCAGGAAG	rs148787567	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110475293_110475294insCTTCAGGAAG								SEC24B (13679 upstream) : CCDC109B (6061 downstream)																																			---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146280143	146280143	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146280143delT	uc011dbv.1	-						PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron	NM_181675	NP_858061			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	56431160	56431161	+	IGR	INS	-	A	A	rs71528887		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56431160_56431161insA								PSPH (247070 upstream) : DKFZp434L192 (132755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	102022901	102022902	+	Intron	INS	-	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102022901_102022902insA	uc003uzd.1	+						uc003uze.1_Intron|PRKRIP1_uc003uzf.2_Intron|PRKRIP1_uc003uzg.2_Intron|PRKRIP1_uc011kkq.1_Intron	NM_001003686	NP_001003686			SubName: Full=Putative uncharacterized protein PMS2L3;																														---	---	---	---
SND1	27044	broad.mit.edu	37	7	127347821	127347826	+	Intron	DEL	GTGTGT	-	-	rs71989793		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127347821_127347826delGTGTGT	uc003vmi.2	+							NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149526874	149526874	+	Intron	DEL	C	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149526874delC	uc010lpk.2	+						SSPO_uc003wgh.2_Intron	NM_198455	NP_940857			SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61714076	61714076	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61714076delT	uc003xue.2	+							NM_017780	NP_060250			chromodomain helicase DNA binding protein 7						central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	p.556_871dup(1)		ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
TMEM38B	55151	broad.mit.edu	37	9	108468184	108468184	+	Intron	DEL	T	-	-	rs75898442		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108468184delT	uc004bcu.1	+						TMEM38B_uc010mtn.1_Intron	NM_018112	NP_060582			transmembrane protein 38B							integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2																		---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95095461	95095462	+	Intron	INS	-	TTTCC	TTTCC	rs148769270	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95095461_95095462insTTTCC	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc009xue.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135105966	135105967	+	Intron	INS	-	A	A	rs111433159	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135105966_135105967insA	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
MUC6	4588	broad.mit.edu	37	11	1030810	1030810	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1030810delA	uc001lsw.2	-							NM_005961	NP_005952			mucin 6, gastric						maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103112359	103112359	+	Intron	DEL	T	-	-	rs58174873		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103112359delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932			dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
CLEC4D	338339	broad.mit.edu	37	12	8674037	8674038	+	3'UTR	DEL	TG	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8674037_8674038delTG	uc001qun.2	+	6						NM_080387	NP_525126			C-type lectin domain family 4, member D						innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)																	---	---	---	---
DIO3	1735	broad.mit.edu	37	14	102026786	102026787	+	5'Flank	DEL	GC	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102026786_102026787delGC	uc010txq.1	+						DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353			deiodinase, iodothyronine, type III						cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)																---	---	---	---
Unknown	0	broad.mit.edu	37	15	41455326	41455326	+	IGR	DEL	C	-	-	rs150346198		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41455326delC								INO80 (46986 upstream) : EXD1 (19607 downstream)																																			---	---	---	---
HDC	3067	broad.mit.edu	37	15	50546973	50546974	+	Intron	INS	-	TCTGTG	TCTGTG	rs71424050		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50546973_50546974insTCTGTG	uc001zxz.2	-						HDC_uc001zxy.2_5'Flank|HDC_uc010uff.1_Intron|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Intron	NM_002112	NP_002103			histidine decarboxylase						catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3490633	3490634	+	Intron	INS	-	A	A	rs79841297		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3490633_3490634insA	uc002cvd.2	-							NM_152457	NP_689670			zinc finger protein 597						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	28596110	28596110	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28596110delA	uc010vct.1	-						CCDC101_uc002dqf.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81183625	81183627	+	Intron	DEL	TTT	-	-	rs35446881		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81183625_81183627delTTT	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26078300	26078301	+	IGR	INS	-	A	A	rs148491945	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26078300_26078301insA								LGALS9 (101715 upstream) : NOS2 (5492 downstream)																																			---	---	---	---
SCN4A	6329	broad.mit.edu	37	17	62029035	62029052	+	In_Frame_Del	DEL	CAGCCTCCCCGGCCCCGT	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62029035_62029052delCAGCCTCCCCGGCCCCGT	uc002jds.1	-	14	2662_2679	c.2585_2602delACGGGGCCGGGGAGGCTG	c.(2584-2604)GACGGGGCCGGGGAGGCTGGA>GGA	p.DGAGEA862del		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	862_867					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)													---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64794572	64794595	+	Intron	DEL	GGTGGTGGTGGTGGTGGTGGTGGT	-	-	rs62070964		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64794572_64794595delGGTGGTGGTGGTGGTGGTGGTGGT	uc002jfp.1	+							NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
SRP68	6730	broad.mit.edu	37	17	74037191	74037192	+	Intron	INS	-	AACAA	AACAA	rs72463390		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74037191_74037192insAACAA	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron|SRP68_uc002jqj.1_Intron	NM_014230	NP_055045			signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1																		---	---	---	---
KATNAL2	83473	broad.mit.edu	37	18	44551469	44551469	+	Intron	DEL	C	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44551469delC	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron|TCEB3C_uc010dnr.2_5'Flank	NM_031303	NP_112593			katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
UHRF1	29128	broad.mit.edu	37	19	4960949	4960949	+	3'UTR	DEL	T	-	-	rs146145010		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4960949delT	uc002mbo.2	+	19					UHRF1_uc010xik.1_RNA|UHRF1_uc010duf.2_RNA|UHRF1_uc002mbp.2_3'UTR	NM_001048201	NP_001041666			ubiquitin-like with PHD and ring finger domains						cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)														---	---	---	---
NLRP12	91662	broad.mit.edu	37	19	54304349	54304349	+	Intron	DEL	A	-	-	rs35326804		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54304349delA	uc002qch.3	-						NLRP12_uc010eqw.2_Intron|NLRP12_uc002qci.3_Intron|NLRP12_uc002qcj.3_Intron|NLRP12_uc002qck.3_Intron|NLRP12_uc010eqx.2_Intron	NM_144687	NP_653288			NLR family, pyrin domain containing 12 isoform						negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)														---	---	---	---
MAVS	57506	broad.mit.edu	37	20	3835538	3835539	+	Intron	INS	-	TTT	TTT			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3835538_3835539insTTT	uc002wjw.3	+						MAVS_uc002wjv.2_Intron|MAVS_uc010zqn.1_Intron|MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_Intron	NM_020746	NP_065797			virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0																		---	---	---	---
PANK2	80025	broad.mit.edu	37	20	3897856	3897857	+	Intron	INS	-	T	T			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3897856_3897857insT	uc002wkc.2	+						PANK2_uc002wkb.2_Intron|PANK2_uc002wkd.2_Intron|PANK2_uc002wke.2_Intron|PANK2_uc002wkf.2_Intron|uc002wkg.2_5'Flank|MIR103-2_hsa-mir-103-2|MI0000108_5'Flank	NM_153638	NP_705902			pantothenate kinase 2 isoform 1 preproprotein						cell death|coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial intermembrane space|nucleus	ATP binding|pantothenate kinase activity|protein binding				0																		---	---	---	---
PARVG	64098	broad.mit.edu	37	22	44594739	44594740	+	Intron	INS	-	ATCC	ATCC	rs142865703	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44594739_44594740insATCC	uc011aqe.1	+						PARVG_uc003bep.2_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077			parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)																---	---	---	---
MIB2	142678	broad.mit.edu	37	1	1564953	1564953	+	Intron	DEL	G	-	-	rs112177324		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1564953delG	uc001agg.2	+						MIB2_uc001agh.2_Intron|MIB2_uc001agi.2_Intron|MIB2_uc001agj.2_Intron|MIB2_uc001agk.2_Intron|MIB2_uc001agm.2_Intron|MIB2_uc010nyq.1_Intron|MIB2_uc009vkh.2_Intron|MIB2_uc001agn.2_Intron|MIB2_uc001ago.2_Intron|MMP23B_uc001agp.2_5'Flank|MMP23B_uc001agq.2_5'Flank	NM_080875	NP_543151			mindbomb homolog 2						Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)														---	---	---	---
ATP8B2	57198	broad.mit.edu	37	1	154306330	154306331	+	Intron	INS	-	A	A	rs146039327	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154306330_154306331insA	uc001fey.1	+						ATP8B2_uc001few.2_Intron|ATP8B2_uc001fex.2_Intron	NM_001005855	NP_001005855			ATPase, class I, type 8B, member 2 isoform b						ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	58479807	58479808	+	IGR	INS	-	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479807_58479808insA								FANCL (11292 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	64602814	64602815	+	IGR	INS	-	CAT	CAT			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64602814_64602815insCAT								PELI1 (231209 upstream) : HSPC159 (78512 downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87954896	87954896	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87954896delA	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	95528084	95528084	+	IGR	DEL	T	-	-	rs11332663		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95528084delT								ANKRD20B (5264 upstream) : TEKT4 (9148 downstream)																																			---	---	---	---
STK17B	9262	broad.mit.edu	37	2	197028246	197028246	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197028246delA	uc002utk.2	-						STK17B_uc010fsh.2_Intron	NM_004226	NP_004217			serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)															---	---	---	---
IL17RC	84818	broad.mit.edu	37	3	9969633	9969633	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9969633delA	uc003bua.2	+						CIDEC_uc003bto.2_Intron|IL17RC_uc011ato.1_Intron|IL17RC_uc010hcs.2_Intron|IL17RC_uc003btz.2_Intron|IL17RC_uc011atp.1_Intron|IL17RC_uc003bud.2_Intron|IL17RC_uc003bub.2_Intron|IL17RC_uc010hct.2_Intron|IL17RC_uc010hcu.2_Intron|IL17RC_uc010hcv.2_Intron|IL17RC_uc011atq.1_Intron|IL17RC_uc003buc.2_Intron|IL17RC_uc003bue.2_5'Flank	NM_153461	NP_703191			interleukin 17 receptor C isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2																		---	---	---	---
RAF1	5894	broad.mit.edu	37	3	12650636	12650637	+	Intron	DEL	TA	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12650636_12650637delTA	uc003bxf.3	-						RAF1_uc011aut.1_Intron|RAF1_uc011auu.1_Intron	NM_002880	NP_002871			v-raf-1 murine leukemia viral oncogene homolog						activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				---	---	---	---
FBXW12	285231	broad.mit.edu	37	3	48420121	48420122	+	Intron	DEL	TG	-	-	rs9311422	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48420121_48420122delTG	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985			F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	49512654	49512654	+	IGR	DEL	T	-	-	rs113012804		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49512654delT								CWH43 (448561 upstream) : None (None downstream)																																			---	---	---	---
SNCAIP	9627	broad.mit.edu	37	5	121787400	121787400	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787400delA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451			synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)														---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146280143	146280143	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146280143delT	uc011dbv.1	-						PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron	NM_181675	NP_858061			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
HCG4	54435	broad.mit.edu	37	6	29760353	29760373	+	RNA	DEL	GCGGGCGCCGTGGATGGAGCA	-	-	rs146714150		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29760353_29760373delGCGGGCGCCGTGGATGGAGCA	uc003nns.2	-	1		c.478_498delTGCTCCATCCACGGCGCCCGC			uc010jrm.1_In_Frame_Del_p.AGAVDGA111del|uc003nnt.2_In_Frame_Del_p.RAPWMEQ147del|uc011dma.1_5'Flank	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	102022901	102022902	+	Intron	INS	-	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102022901_102022902insA	uc003uzd.1	+						uc003uze.1_Intron|PRKRIP1_uc003uzf.2_Intron|PRKRIP1_uc003uzg.2_Intron|PRKRIP1_uc011kkq.1_Intron	NM_001003686	NP_001003686			SubName: Full=Putative uncharacterized protein PMS2L3;																														---	---	---	---
FAM185A	222234	broad.mit.edu	37	7	102396081	102396084	+	Intron	DEL	CTGA	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102396081_102396084delCTGA	uc011klf.1	+						FAM185A_uc011klg.1_Intron|FAM185A_uc011klh.1_Intron	NM_001145268	NP_001138740			hypothetical protein LOC222234 isoform 1												0																		---	---	---	---
CREB3L2	64764	broad.mit.edu	37	7	137583787	137583788	+	Intron	INS	-	AAAAAGAAAGAAAG	AAAAAGAAAGAAAG	rs113900167		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137583787_137583788insAAAAAGAAAGAAAG	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vtv.2_Intron	NM_194071	NP_919047			cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---
KIAA1147	57189	broad.mit.edu	37	7	141386265	141386265	+	Intron	DEL	C	-	-	rs35707772		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141386265delC	uc003vwk.2	-							NM_001080392	NP_001073861			hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)																	---	---	---	---
SSPO	23145	broad.mit.edu	37	7	149526874	149526874	+	Intron	DEL	C	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149526874delC	uc010lpk.2	+						SSPO_uc003wgh.2_Intron	NM_198455	NP_940857			SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
LOC349196	349196	broad.mit.edu	37	8	7196263	7196264	+	Intron	DEL	AC	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7196263_7196264delAC	uc010lrk.1	-						uc011kwo.1_Intron					Homo sapiens cDNA FLJ37516 fis, clone BRCAN2000832.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	7347247	7347247	+	IGR	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7347247delT								DEFB105A (175 upstream) : DEFB107A (6121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	26290434	26290435	+	IGR	INS	-	A	A	rs114412722		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26290434_26290435insA								BNIP3L (19790 upstream) : PNMA2 (71761 downstream)																																			---	---	---	---
AGPAT6	137964	broad.mit.edu	37	8	41479805	41479806	+	3'UTR	INS	-	GGAACAG	GGAACAG	rs150638711	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41479805_41479806insGGAACAG	uc003xnz.2	+	13						NM_178819	NP_848934			lysophosphatidic acid acyltransferase zeta						acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)															---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61714076	61714076	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61714076delT	uc003xue.2	+							NM_017780	NP_060250			chromodomain helicase DNA binding protein 7						central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	p.556_871dup(1)		ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
CCNE2	9134	broad.mit.edu	37	8	95903887	95903888	+	Intron	INS	-	A	A	rs34021439		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95903887_95903888insA	uc003yhc.2	-						CCNE2_uc003yhd.2_Intron	NM_057749	NP_477097			cyclin E2						cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)																	---	---	---	---
EFR3A	23167	broad.mit.edu	37	8	132966046	132966046	+	Intron	DEL	T	-	-	rs112472883		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132966046delT	uc003yte.2	+							NM_015137	NP_055952			EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)															---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	91978182	91978183	+	Intron	INS	-	C	C	rs139774075	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91978182_91978183insC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aql.2_Intron|SEMA4D_uc004aqm.2_Intron	NM_001142287	NP_001135759			semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
PPRC1	23082	broad.mit.edu	37	10	103909487	103909489	+	Intron	DEL	AAA	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909487_103909489delAAA	uc001kum.2	+						PPRC1_uc001kun.2_Intron|PPRC1_uc010qqj.1_Intron|PPRC1_uc009xxa.2_Intron|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877			peroxisome proliferator-activated receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)														---	---	---	---
GRK5	2869	broad.mit.edu	37	10	121072451	121072452	+	Intron	INS	-	TGG	TGG	rs117700465		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121072451_121072452insTGG	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299			G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)														---	---	---	---
STK33	65975	broad.mit.edu	37	11	8578833	8578834	+	Intron	INS	-	AA	AA	rs150095375	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8578833_8578834insAA	uc001mgj.1	-						STK33_uc001mgk.1_Intron|STK33_uc010rbn.1_Intron|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168			serine/threonine kinase 33							Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)														---	---	---	---
HEPHL1	341208	broad.mit.edu	37	11	93839460	93839460	+	Intron	DEL	T	-	-	rs144455207		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93839460delT	uc001pep.2	+						uc001pen.1_Intron	NM_001098672	NP_001092142			hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	117907821	117907821	+	Intron	DEL	C	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117907821delC	uc001prx.1	-						uc001pry.1_Intron|uc001prz.1_Intron|uc009yzs.1_Intron|uc001psa.1_Intron					Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit26-03-15-R.																														---	---	---	---
CLEC4D	338339	broad.mit.edu	37	12	8674037	8674038	+	3'UTR	DEL	TG	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8674037_8674038delTG	uc001qun.2	+	6						NM_080387	NP_525126			C-type lectin domain family 4, member D						innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)																	---	---	---	---
DIO3	1735	broad.mit.edu	37	14	102026786	102026787	+	5'Flank	DEL	GC	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102026786_102026787delGC	uc010txq.1	+						DIO3OS_uc001ykd.1_5'Flank|uc001yke.2_5'Flank|uc001ykf.2_5'Flank|uc001ykg.2_5'Flank|uc001ykh.3_5'Flank|MIR1247_hsa-mir-1247|MI0006382_5'Flank	NM_001362	NP_001353			deiodinase, iodothyronine, type III						cellular nitrogen compound metabolic process|hormone biosynthetic process	endosome membrane|integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|thyroxine 5-deiodinase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		all_neural(303;0.185)																---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106800210	106800211	+	Intron	INS	-	CT	CT	rs144102456	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106800210_106800211insCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
CASC5	57082	broad.mit.edu	37	15	40939055	40939055	+	Intron	DEL	A	-	-	rs146834597		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40939055delA	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468			cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)														---	---	---	---
PKM2	5315	broad.mit.edu	37	15	72502473	72502473	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72502473delA	uc002atx.1	-						PKM2_uc002att.1_5'Flank|PKM2_uc002atu.1_5'Flank|PKM2_uc010bit.1_Intron|PKM2_uc010uki.1_Intron|PKM2_uc002atv.1_Intron|PKM2_uc002atw.1_Intron|PKM2_uc002aty.1_Intron|PKM2_uc010ukj.1_Intron|PKM2_uc010ukk.1_Intron|PKM2_uc010biu.1_Intron|PKM2_uc002atz.1_Intron	NM_182471	NP_872271			pyruvate kinase, muscle isoform M1						glycolysis|programmed cell death	cytosol|nucleus|plasma membrane	ATP binding|magnesium ion binding|potassium ion binding|protein binding|pyruvate kinase activity			breast(1)	1					Pyruvic acid(DB00119)													---	---	---	---
RAB11FIP3	9727	broad.mit.edu	37	16	554512	554513	+	Intron	INS	-	G	G			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:554512_554513insG	uc002chf.2	+						RAB11FIP3_uc010uuf.1_Intron|RAB11FIP3_uc010uug.1_Intron	NM_014700	NP_055515			rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	28596110	28596110	+	Intron	DEL	A	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28596110delA	uc010vct.1	-						CCDC101_uc002dqf.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
BBS2	583	broad.mit.edu	37	16	56531894	56531895	+	Intron	DEL	AT	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56531894_56531895delAT	uc002ejd.2	-							NM_031885	NP_114091			Bardet-Biedl syndrome 2 protein						adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1														Bardet-Biedl_syndrome				---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81183625	81183627	+	Intron	DEL	TTT	-	-	rs35446881		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81183625_81183627delTTT	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	89670025	89670025	+	IGR	DEL	G	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89670025delG								CPNE7 (6372 upstream) : DPEP1 (9691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																																			---	---	---	---
SRP68	6730	broad.mit.edu	37	17	74037191	74037192	+	Intron	INS	-	AACAA	AACAA	rs72463390		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74037191_74037192insAACAA	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron|SRP68_uc002jqj.1_Intron	NM_014230	NP_055045			signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1																		---	---	---	---
KATNAL2	83473	broad.mit.edu	37	18	44551469	44551469	+	Intron	DEL	C	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44551469delC	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron|TCEB3C_uc010dnr.2_5'Flank	NM_031303	NP_112593			katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																																			---	---	---	---
ITGB1BP3	27231	broad.mit.edu	37	19	3938843	3938843	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3938843delT	uc002lyz.3	+						ITGB1BP3_uc010xia.1_Intron	NM_170678	NP_733778			integrin beta 1 binding protein 3						pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|protein binding|ribosylnicotinamide kinase activity			skin(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	40499407	40499408	+	IGR	INS	-	G	G	rs145268564	by1000genomes;by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499407_40499408insG								ETS2 (302531 upstream) : PSMG1 (47982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20150285	20150286	+	IGR	INS	-	CAT	CAT			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20150285_20150286insCAT								ZDHHC8 (14756 upstream) : LOC150197 (43569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20150779	20150781	+	IGR	DEL	ACC	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20150779_20150781delACC								ZDHHC8 (15250 upstream) : LOC150197 (43074 downstream)																																			---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24480374	24480374	+	Intron	DEL	T	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24480374delT	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron	NM_012295	NP_036427			calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
PARVG	64098	broad.mit.edu	37	22	44594739	44594740	+	Intron	INS	-	ATCC	ATCC	rs142865703	by1000genomes	TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44594739_44594740insATCC	uc011aqe.1	+						PARVG_uc003bep.2_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077			parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)																---	---	---	---
MORC4	79710	broad.mit.edu	37	X	106199946	106199947	+	Intron	DEL	AG	-	-			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106199946_106199947delAG	uc004emu.3	-						MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Intron|MORC4_uc004emw.3_Intron	NM_024657	NP_078933			zinc finger, CW type with coiled-coil domain 2								ATP binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DNAJC25	548645	broad.mit.edu	37	9	114411796	114411796	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114411796C>A	uc004bfl.2	+	3	609	c.553C>A	c.(553-555)CGT>AGT	p.R185S	DNAJC25-GNG10_uc004bfn.2_Intron|DNAJC25_uc004bfm.2_Missense_Mutation_p.R63S	NM_001015882	NP_001015882	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	185					protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0																		---	---	---	---
ZNF284	342909	broad.mit.edu	37	19	44591348	44591348	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44591348G>T	uc002oyg.1	+	5	1933	c.1717G>T	c.(1717-1719)GGG>TGG	p.G573W	ZNF284_uc010ejd.2_RNA	NM_001037813	NP_001032902	Q2VY69	ZN284_HUMAN	zinc finger protein 284	573					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)																---	---	---	---
ATP13A3	79572	broad.mit.edu	37	3	194169376	194169376	+	Intron	SNP	C	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194169376C>A	uc003fty.3	-						ATP13A3_uc003ftz.1_Intron	NM_024524	NP_078800			ATPase type 13A3						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)														---	---	---	---
DNAJC25	548645	broad.mit.edu	37	9	114411796	114411796	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114411796C>A	uc004bfl.2	+	3	609	c.553C>A	c.(553-555)CGT>AGT	p.R185S	DNAJC25-GNG10_uc004bfn.2_Intron|DNAJC25_uc004bfm.2_Missense_Mutation_p.R63S	NM_001015882	NP_001015882	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	185					protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0																		---	---	---	---
ZNF284	342909	broad.mit.edu	37	19	44591348	44591348	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6710-01	TCGA-BR-6710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44591348G>T	uc002oyg.1	+	5	1933	c.1717G>T	c.(1717-1719)GGG>TGG	p.G573W	ZNF284_uc010ejd.2_RNA	NM_001037813	NP_001032902	Q2VY69	ZN284_HUMAN	zinc finger protein 284	573					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)																---	---	---	---
