Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CCDC30	728621	broad.mit.edu	37	1	43011397	43011398	+	Intron	DEL	CG	-	-	rs112575083		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43011397_43011398delCG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319			coiled-coil domain containing 30												0																		---	---	---	---
C1orf163	65260	broad.mit.edu	37	1	53153917	53153917	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53153917delT	uc001cui.1	-							NM_023077	NP_075565			hypothetical protein LOC65260								binding				0																		---	---	---	---
KIAA0907	22889	broad.mit.edu	37	1	155886695	155886695	+	Intron	DEL	T	-	-	rs113079820		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155886695delT	uc001fmi.1	-						KIAA0907_uc001fmj.1_Intron|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_Intron	NM_014949	NP_055764			hypothetical protein LOC22889												0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)															---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227213676	227213676	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227213676delA	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Intron|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron|CDC42BPA_uc001hqt.2_Intron|CDC42BPA_uc001hqu.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	243251423	243251423	+	RNA	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243251423delA	uc001hzq.1	-	8		c.1209delT								Homo sapiens cDNA FLJ52610 complete cds.																														---	---	---	---
COX7A2L	9167	broad.mit.edu	37	2	42578275	42578275	+	3'UTR	DEL	A	-	-	rs71682791		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42578275delA	uc002rsk.2	-	3					COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709			cytochrome c oxidase subunit VIIa polypeptide 2						respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0																		---	---	---	---
MTIF2	4528	broad.mit.edu	37	2	55489677	55489678	+	Intron	INS	-	T	T	rs66500251		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55489677_55489678insT	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369			mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
MIR1285-2	100302268	broad.mit.edu	37	2	70480799	70480799	+	5'Flank	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70480799delT	hsa-mir-1285-2|MI0006347	-																							0																		---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128900552	128900552	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128900552delA	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505			UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	132533457	132533458	+	IGR	INS	-	G	G	rs142741608		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132533457_132533458insG								C2orf27A (8480 upstream) : C2orf27B (19076 downstream)																																			---	---	---	---
DPP4	1803	broad.mit.edu	37	2	162903784	162903784	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162903784delA	uc002ubz.2	-						DPP4_uc010fpb.2_Intron|DPP4_uc002uca.1_Intron|DPP4_uc002ucb.1_Intron	NM_001935	NP_001926			dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)													---	---	---	---
ITGA6	3655	broad.mit.edu	37	2	173368990	173368990	+	3'UTR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368990delA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286			integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)															---	---	---	---
ANKAR	150709	broad.mit.edu	37	2	190541860	190541861	+	Intron	DEL	TG	-	-	rs61285192		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541860_190541861delTG	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309			ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)															---	---	---	---
PDE6D	5147	broad.mit.edu	37	2	232645702	232645702	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232645702delC	uc002vse.1	-						COPS7B_uc010fxy.1_5'Flank|PDE6D_uc002vsf.1_Intron|PDE6D_uc010fxx.1_Intron	NM_002601	NP_002592			phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)														---	---	---	---
SNED1	25992	broad.mit.edu	37	2	241976616	241976616	+	Intron	DEL	G	-	-	rs71404677		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241976616delG	uc002wah.1	+							NM_001080437	NP_001073906			6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)														---	---	---	---
KIF15	56992	broad.mit.edu	37	3	44816593	44816593	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44816593delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron	NM_020242	NP_064627			kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)														---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52668500	52668500	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668500delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
ASB14	142686	broad.mit.edu	37	3	57313073	57313073	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57313073delA	uc003diq.2	-						ASB14_uc003dip.1_5'Flank	NM_001142733	NP_001136205			ankyrin repeat and SOCS box-containing 14						intracellular signal transduction						0				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)														---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69245689	69245690	+	Intron	INS	-	AAAAC	AAAAC	rs144990660	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69245689_69245690insAAAAC	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dnu.2_Intron|FRMD4B_uc011bga.1_Intron	NM_015123	NP_055938			FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130360601	130360601	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130360601delA	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078			collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
C3orf55	152078	broad.mit.edu	37	3	157295937	157295938	+	Intron	INS	-	T	T	rs112996272		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157295937_157295938insT	uc003fbp.3	+						C3orf55_uc003fbo.2_Intron|C3orf55_uc011bot.1_Intron|C3orf55_uc010hvv.2_Intron	NM_001130002	NP_001123474			hypothetical protein LOC152078 isoform 1												0			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)															---	---	---	---
OPA1	4976	broad.mit.edu	37	3	193366428	193366428	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193366428delA	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375			optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195515367	195515414	+	In_Frame_Del	DEL	GGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	-	-	rs13065584	by1000genomes;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515367_195515414delGGTGACAGGAAGAGGGGTGGTGTGACCTGTGGATACTGAGGAAGGGCT	uc011bto.1	-	2	3497_3544	c.3037_3084delAGCCCTTCCTCAGTATCCACAGGTCACACCACCCCTCTTCCTGTCACC	c.(3037-3084)AGCCCTTCCTCAGTATCCACAGGTCACACCACCCCTCTTCCTGTCACCdel	p.SPSSVSTGHTTPLPVT1013del	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1013_1029	Repeat.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
GAK	2580	broad.mit.edu	37	4	876980	876981	+	Intron	INS	-	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:876980_876981insA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246			cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)														---	---	---	---
FBXL5	26234	broad.mit.edu	37	4	15632545	15632545	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15632545delT	uc003goc.1	-						FBXL5_uc010idw.1_Intron|FBXL5_uc003gob.1_Intron|FBXL5_uc010idx.1_Intron|FBXL5_uc003god.1_Intron|FBXL5_uc010idy.1_Intron	NM_012161	NP_036293			F-box and leucine-rich repeat protein 5 isoform						iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0																		---	---	---	---
LIAS	11019	broad.mit.edu	37	4	39478849	39478849	+	3'UTR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39478849delA	uc003guf.2	+	11					LIAS_uc003gug.2_3'UTR|LIAS_uc003guh.2_3'UTR	NM_006859	NP_006850			lipoic acid synthetase isoform 1 precursor						inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)													---	---	---	---
USO1	8615	broad.mit.edu	37	4	76726517	76726517	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76726517delT	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706			USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
EGF	1950	broad.mit.edu	37	4	110925372	110925373	+	Intron	DEL	AC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925372_110925373delAC	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954			epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)													---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21502037	21502037	+	Intron	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21502037delG	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
NNT	23530	broad.mit.edu	37	5	43651679	43651680	+	Intron	INS	-	A	A	rs112687077		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43651679_43651680insA	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475			nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)													---	---	---	---
MSH3	4437	broad.mit.edu	37	5	80074815	80074816	+	Intron	DEL	AC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80074815_80074816delAC	uc003kgz.2	+							NM_002439	NP_002430			mutS homolog 3						maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)									MMR					---	---	---	---
RASA1	5921	broad.mit.edu	37	5	86644899	86644899	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86644899delA	uc003kiw.2	+						RASA1_uc010jav.2_Intron|RASA1_uc003kix.2_Intron|RASA1_uc011ctv.1_Intron|RASA1_uc011ctw.1_Intron|RASA1_uc010jaw.2_Intron	NM_002890	NP_002881			RAS p21 protein activator 1 isoform 1						cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)														---	---	---	---
ERAP2	64167	broad.mit.edu	37	5	96219739	96219750	+	Intron	DEL	TATCTATCTATC	-	-	rs146256833		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96219739_96219750delTATCTATCTATC	uc003kmq.2	+						uc003kmo.1_Intron|ERAP2_uc003kmt.2_Intron|ERAP2_uc003kmr.2_Intron|ERAP2_uc003kms.2_Intron|ERAP2_uc003kmu.2_Intron	NM_022350	NP_071745			endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I|proteolysis|regulation of blood pressure	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding				0		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	178252600	178252600	+	IGR	DEL	G	-	-	rs67254777		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178252600delG								AACSL (7164 upstream) : ZNF354B (34354 downstream)																																			---	---	---	---
DSP	1832	broad.mit.edu	37	6	7582771	7582771	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7582771delT	uc003mxp.1	+						DSP_uc003mxq.1_Intron	NM_004415	NP_004406			desmoplakin isoform I						cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)														---	---	---	---
HIST1H4K	8362	broad.mit.edu	37	6	27799470	27799470	+	5'Flank	DEL	A	-	-	rs71559051		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27799470delA	uc003njr.2	-							NM_003541	NP_003532			histone cluster 1, H4k						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0																		---	---	---	---
MDC1	9656	broad.mit.edu	37	6	30682701	30682701	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30682701delA	uc003nrg.3	-						MDC1_uc003nrf.3_5'Flank|MDC1_uc011dmp.1_Intron|MDC1_uc003nrh.1_Intron|MDC1_uc003nri.2_Intron	NM_014641	NP_055456			mediator of DNA-damage checkpoint 1						cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4													Other_conserved_DNA_damage_response_genes					---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75801416	75801417	+	Intron	DEL	TC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75801416_75801417delTC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
RRAGD	58528	broad.mit.edu	37	6	90121645	90121647	+	In_Frame_Del	DEL	TCC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90121645_90121647delTCC	uc003pnd.3	-	1	349_351	c.66_68delGGA	c.(64-69)GAGGAT>GAT	p.E22del	RRAGD_uc010kcc.2_Translation_Start_Site	NM_021244	NP_067067	Q9NQL2	RRAGD_HUMAN	Ras-related GTP binding D	22					cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosome|nucleus	GTP binding|protein heterodimerization activity			ovary(2)|central_nervous_system(1)	3		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)														---	---	---	---
NOX3	50508	broad.mit.edu	37	6	155718238	155718238	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155718238delT	uc003qqm.2	-							NM_015718	NP_056533			NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)														---	---	---	---
FAM188B	84182	broad.mit.edu	37	7	30921989	30921990	+	Intron	INS	-	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30921989_30921990insC	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron|AQP1_uc011kac.1_Intron|FAM188B_uc003tbu.2_Intron	NM_032222	NP_115598			hypothetical protein LOC84182												0																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40102293	40102293	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40102293delT	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc011kbf.1_Intron|CDK13_uc003thj.2_5'UTR	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
SEC61G	23480	broad.mit.edu	37	7	54819994	54819994	+	3'UTR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54819994delA	uc003tqf.2	-	4					SEC61G_uc003tqg.2_3'UTR	NM_001012456	NP_001012474			Sec61 gamma subunit						protein targeting to ER	endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			lung(1)	1	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)															---	---	---	---
ST7	7982	broad.mit.edu	37	7	116778444	116778444	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116778444delT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron|ST7OT2_uc003viw.2_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
GALNT11	63917	broad.mit.edu	37	7	151800067	151800067	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151800067delA	uc010lqg.1	+						GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Intron|GALNT11_uc003wkv.1_Intron|GALNT11_uc011kvn.1_Intron	NM_022087	NP_071370			N-acetylgalactosaminyltransferase 11							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)														---	---	---	---
RAB11FIP1	80223	broad.mit.edu	37	8	37725231	37725231	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37725231delA	uc003xkm.1	-						RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Intron|RAB11FIP1_uc003xko.1_3'UTR|RAB11FIP1_uc003xkp.1_3'UTR	NM_001002814	NP_001002814			RAB11 family interacting protein 1 isoform 3						protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)															---	---	---	---
WHSC1L1	54904	broad.mit.edu	37	8	38175280	38175280	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38175280delA	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_3'UTR	NM_023034	NP_075447			WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)					T	NUP98	AML								---	---	---	---
ARFGEF1	10565	broad.mit.edu	37	8	68123581	68123582	+	Intron	DEL	AA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68123581_68123582delAA	uc003xxo.1	-						ARFGEF1_uc003xxl.1_Intron|ARFGEF1_uc003xxn.1_Intron	NM_006421	NP_006412			brefeldin A-inhibited guanine						exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104922219	104922220	+	Intron	DEL	TA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922219_104922220delTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
GLDC	2731	broad.mit.edu	37	9	6639011	6639011	+	Intron	DEL	A	-	-	rs78066890		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6639011delA	uc003zkc.2	-							NM_000170	NP_000161			glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
PTAR1	375743	broad.mit.edu	37	9	72338053	72338055	+	Intron	DEL	TAA	-	-	rs146599862		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72338053_72338055delTAA	uc004ahj.3	-						PTAR1_uc004ahi.2_Intron	NM_001099666	NP_001093136			protein prenyltransferase alpha subunit repeat						protein prenylation		protein prenyltransferase activity			central_nervous_system(1)	1																		---	---	---	---
SUSD3	203328	broad.mit.edu	37	9	95838023	95838026	+	Intron	DEL	CCCC	-	-	rs56653934		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95838023_95838026delCCCC	uc004atb.2	+						SUSD3_uc004atc.2_Intron	NM_145006	NP_659443			sushi domain containing 3							integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6																		---	---	---	---
GSN	2934	broad.mit.edu	37	9	124074857	124074857	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124074857delA	uc004blf.1	+						GSN_uc004bld.1_Intron|GSN_uc010mvq.1_Intron|GSN_uc010mvr.1_Intron|GSN_uc010mvu.1_Intron|GSN_uc010mvt.1_Intron|GSN_uc010mvs.1_Intron|GSN_uc004ble.1_Intron|GSN_uc010mvv.1_Intron|GSN_uc011lyh.1_Intron|GSN_uc011lyi.1_Intron|GSN_uc011lyj.1_Intron|GSN_uc004blg.1_Intron	NM_000177	NP_000168			gelsolin isoform a precursor						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69750213	69750214	+	Intron	INS	-	A	A	rs71468901		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69750213_69750214insA	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115351797	115351797	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115351797delT	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326			nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	135524651	135524652	+	IGR	INS	-	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135524651_135524652insT								LOC653544 (29458 upstream) : None (None downstream)																																			---	---	---	---
PKP3	11187	broad.mit.edu	37	11	399184	399184	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:399184delA	uc001lpc.2	+	5	1337	c.1261delA	c.(1261-1263)AAAfs	p.K421fs		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	421	ARM 3.				cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3727549	3727549	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3727549delT	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
GTF2H1	2965	broad.mit.edu	37	11	18379447	18379447	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18379447delA	uc001moi.2	+						GTF2H1_uc001moh.2_Intron|GTF2H1_uc009yhm.2_Intron|GTF2H1_uc001moj.2_Intron	NM_001142307	NP_001135779			general transcription factor IIH, polypeptide 1,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0													NER					---	---	---	---
ATL3	25923	broad.mit.edu	37	11	63426741	63426741	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63426741delA	uc001nxk.1	-						ATL3_uc010rms.1_Intron|ATL3_uc001nxl.1_Intron	NM_015459	NP_056274			atlastin 3						endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			pancreas(1)	1																		---	---	---	---
TRIM49	57093	broad.mit.edu	37	11	89534160	89534160	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89534160delA	uc001pdb.2	-							NM_020358	NP_065091			ring finger protein 18							intracellular	zinc ion binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	129902698	129902698	+	IGR	DEL	T	-	-	rs71985644		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129902698delT								NCRNA00167 (27317 upstream) : APLP2 (37018 downstream)																																			---	---	---	---
PZP	5858	broad.mit.edu	37	12	9316490	9316490	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9316490delA	uc001qvl.2	-						PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_Intron|PZP_uc009zgm.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	9391909	9391909	+	5'Flank	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9391909delT	uc001qvm.1	+											Homo sapiens cDNA FLJ44260 fis, clone TLIVE2000979.																														---	---	---	---
PWP1	11137	broad.mit.edu	37	12	108098665	108098665	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108098665delT	uc001tmo.1	+						PWP1_uc009zuu.1_Intron	NM_007062	NP_008993			periodic tryptophan protein 1						transcription, DNA-dependent	nucleus					0																		---	---	---	---
BRAP	8315	broad.mit.edu	37	12	112082569	112082569	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112082569delT	uc001tsn.3	-						BRAP_uc010syh.1_Intron|BRAP_uc009zvv.2_Intron	NM_006768	NP_006759			BRCA1 associated protein						MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1																		---	---	---	---
ZMYM2	7750	broad.mit.edu	37	13	20657212	20657212	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20657212delT	uc001umr.2	+						ZMYM2_uc001ums.2_Intron|ZMYM2_uc001umt.2_Intron|ZMYM2_uc001umv.2_Intron|ZMYM2_uc001umw.2_Intron	NM_003453	NP_003444			zinc finger protein 198						regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)														---	---	---	---
MED4	29079	broad.mit.edu	37	13	48651536	48651536	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48651536delT	uc001vby.1	-						MED4_uc010tge.1_Intron|MED4_uc010tgf.1_Intron	NM_014166	NP_054885			mediator complex subunit 4						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)														---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67799412	67799412	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67799412delT	uc001vik.2	-						PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron|PCDH9_uc001vin.3_3'UTR	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77713625	77713625	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77713625delA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872			MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
MAP4K5	11183	broad.mit.edu	37	14	50895476	50895476	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50895476delA	uc001wya.2	-						MAP4K5_uc001wyb.2_Intron	NM_006575	NP_006566			mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(1)	1	all_epithelial(31;0.000415)|Breast(41;0.0102)																	---	---	---	---
C14orf50	145376	broad.mit.edu	37	14	65019694	65019694	+	Intron	DEL	T	-	-	rs77325213		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65019694delT	uc001xhl.1	+							NM_172365	NP_758953			hypothetical protein LOC145376											skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72009234	72009236	+	Intron	DEL	TCC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72009234_72009236delTCC	uc001xms.2	+						SIPA1L1_uc001xmr.1_Intron|SIPA1L1_uc001xmt.2_Intron	NM_015556	NP_056371			signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
HSP90AA1	3320	broad.mit.edu	37	14	102548312	102548312	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102548312delA	uc001yku.3	-						HSP90AA1_uc001ykv.3_Intron	NM_005348	NP_005339			heat shock 90kDa protein 1, alpha isoform 2						axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72208543	72208543	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72208543delT	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832			myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TMC3	342125	broad.mit.edu	37	15	81637358	81637359	+	Intron	DEL	GA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81637358_81637359delGA	uc002bgo.1	-						TMC3_uc010blr.1_Intron|TMC3_uc002bgp.2_Intron	NM_001080532	NP_001074001			transmembrane channel-like 3							integral to membrane				ovary(1)|liver(1)	2																		---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10865686	10865686	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10865686delT	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron|FAM18A_uc002dae.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
MAZ	4150	broad.mit.edu	37	16	29819823	29819823	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29819823delC	uc002dty.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAZ_uc002dtv.1_Intron|MAZ_uc010vdx.1_Intron|MAZ_uc002dtw.2_Intron|MAZ_uc002dtx.2_Intron|MAZ_uc010bzg.2_Intron|MAZ_uc002dtz.1_3'UTR|MAZ_uc002dua.2_Intron|MAZ_uc010vdy.1_Intron	NM_002383	NP_002374			MYC-associated zinc finger protein isoform 1						regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription|transcription initiation from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DULLARD	23399	broad.mit.edu	37	17	7150790	7150790	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7150790delT	uc002gfd.2	-						DULLARD_uc002gfe.2_Intron|DULLARD_uc002gff.2_Intron|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247			dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	17360190	17360190	+	IGR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17360190delA								NT5M (109215 upstream) : MED9 (20110 downstream)																																			---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	39994521	39994522	+	Intron	DEL	TT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39994521_39994522delTT	uc010cxr.2	+						NT5C3L_uc002hyb.3_5'Flank|NT5C3L_uc002hyc.3_5'Flank|NT5C3L_uc002hyd.3_5'Flank|NT5C3L_uc002hxy.3_5'Flank|NT5C3L_uc002hxz.3_5'Flank|NT5C3L_uc002hya.3_5'Flank|KLHL10_uc010wfv.1_Intron|KLHL10_uc010wfw.1_Intron	NM_152467	NP_689680			kelch-like 10							cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	44321386	44321386	+	IGR	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44321386delC								KIAA1267 (18669 upstream) : ARL17B (42477 downstream)																																			---	---	---	---
KPNB1	3837	broad.mit.edu	37	17	45729935	45729935	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45729935delA	uc002ilt.1	+						KPNB1_uc010wkw.1_Intron	NM_002265	NP_002256			karyopherin beta 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TRIM37	4591	broad.mit.edu	37	17	57141686	57141686	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57141686delA	uc002iwy.3	-						TRIM37_uc002iwz.3_Intron|TRIM37_uc002ixa.3_Intron|TRIM37_uc010woc.1_Intron	NM_001005207	NP_001005207			tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)													Mulibrey_Nanism				---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66872446	66872446	+	Intron	DEL	T	-	-	rs4148026		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66872446delT	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron	NM_007168	NP_009099			ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)																	---	---	---	---
MAFG	4097	broad.mit.edu	37	17	79881137	79881139	+	Intron	DEL	CAC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79881137_79881139delCAC	uc002kcm.2	-						MAFG_uc002kcn.2_Intron	NM_032711	NP_116100			v-maf musculoaponeurotic fibrosarcoma oncogene						blood coagulation	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			kidney(1)	1	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)															---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80544375	80544375	+	Intron	DEL	C	-	-	rs72318042		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544375delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
KIAA1012	22878	broad.mit.edu	37	18	29489050	29489050	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29489050delA	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_Intron	NM_014939	NP_055754			hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0																		---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57103522	57103523	+	Intron	INS	-	G	G	rs138297937	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57103522_57103523insG	uc002lib.2	-						CCBE1_uc010dpq.2_Intron|CCBE1_uc002lia.2_Intron	NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
MYO9B	4650	broad.mit.edu	37	19	17308872	17308872	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17308872delA	uc010eak.2	+						MYO9B_uc002nfi.2_Intron|MYO9B_uc002nfj.1_Intron|MYO9B_uc002nfl.1_5'Flank	NM_004145	NP_004136			myosin IXB isoform 1						actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17753825	17753825	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17753825delT	uc002nhd.2	-							NM_001080421	NP_001073890			unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
KLHL26	55295	broad.mit.edu	37	19	18775397	18775397	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18775397delT	uc002njz.1	+							NM_018316	NP_060786			kelch-like 26											ovary(1)	1																		---	---	---	---
PSG6	5675	broad.mit.edu	37	19	43556931	43556931	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43556931delA	uc002ovi.2	-						PSG10_uc002ouv.1_Intron|PSG6_uc010xwk.1_Intron					SubName: Full=Putative uncharacterized protein PSG6;						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	43872172	43872173	+	IGR	INS	-	TTCT	TTCT	rs59418735		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43872172_43872173insTTCT								CD177 (4693 upstream) : TEX101 (20590 downstream)																																			---	---	---	---
CGB	1082	broad.mit.edu	37	19	49550508	49550508	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49550508delT	uc010yad.1	-							NM_033183	NP_149439			chorionic gonadotropin, beta polypeptide 8						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)													---	---	---	---
MCM8	84515	broad.mit.edu	37	20	5952840	5952841	+	Intron	DEL	TT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5952840_5952841delTT	uc002wmi.2	+						MCM8_uc002wmj.2_Intron|MCM8_uc002wmk.2_Intron|MCM8_uc002wml.2_Intron|MCM8_uc010gbp.2_Intron|MCM8_uc002wmm.2_5'UTR	NM_032485	NP_115874			minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1																		---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42144564	42144566	+	Intron	DEL	GGG	-	-	rs10601749		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42144564_42144566delGGG	uc010zwh.1	+						L3MBTL_uc010ggk.1_Intron|L3MBTL_uc002xkl.2_Intron|L3MBTL_uc002xkm.2_Intron|L3MBTL_uc010ggl.2_Intron	NM_015478	NP_056293			l(3)mbt-like isoform I						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
RTEL1	51750	broad.mit.edu	37	20	62324809	62324810	+	Intron	INS	-	CCA	CCA	rs77223947		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62324809_62324810insCCA	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron|RTEL1_uc002yfx.1_Intron|TNFRSF6B_uc002yfy.2_5'Flank	NM_016434	NP_057518			regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)															---	---	---	---
Unknown	0	broad.mit.edu	37	21	21112407	21112408	+	IGR	DEL	GA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112407_21112408delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
IFNGR2	3460	broad.mit.edu	37	21	34809434	34809434	+	3'UTR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34809434delT	uc002yrp.3	+	7					IFNGR2_uc002yrq.3_3'UTR|IFNGR2_uc010gma.2_3'UTR|IFNGR2_uc002yrr.3_3'UTR|TMEM50B_uc002yrs.1_Intron	NM_005534	NP_005525			interferon gamma receptor 2 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)													---	---	---	---
NUP50	10762	broad.mit.edu	37	22	45577017	45577019	+	Intron	DEL	CCC	-	-	rs66468525		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45577017_45577019delCCC	uc003bfr.2	+						NUP50_uc003bfs.2_Intron|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Intron|NUP50_uc011aqo.1_Intron	NM_007172	NP_009103			nucleoporin 50kDa isoform b						carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)														---	---	---	---
RBBP7	5931	broad.mit.edu	37	X	16867569	16867569	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16867569delT	uc004cxt.2	-						RBBP7_uc004cxs.1_Intron|RBBP7_uc004cxu.2_Intron	NM_002893	NP_002884			retinoblastoma binding protein 7						cell proliferation|cellular heat acclimation|CenH3-containing nucleosome assembly at centromere|DNA replication|multicellular organismal development|negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex|NuRD complex	protein binding			upper_aerodigestive_tract(1)|ovary(1)	2	Hepatocellular(33;0.0997)																	---	---	---	---
BEND2	139105	broad.mit.edu	37	X	18213571	18213571	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18213571delA	uc004cyj.3	-						BEND2_uc010nfb.2_Intron	NM_153346	NP_699177			BEN domain containing 2											ovary(3)|kidney(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	36229987	36229987	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36229987delT								CXorf59 (66800 upstream) : CXorf30 (24064 downstream)																																			---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47034512	47034512	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47034512delC	uc004dhf.2	+						RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Intron|RBM10_uc004dhh.2_Intron|RBM10_uc010nhq.2_Intron|RBM10_uc004dhi.2_Intron	NM_005676	NP_005667			RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5																		---	---	---	---
HDAC6	10013	broad.mit.edu	37	X	48681900	48681901	+	Frame_Shift_Ins	INS	-	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48681900_48681901insC	uc011mmi.1	+	25	3186_3187	c.3091_3092insC	c.(3091-3093)ACCfs	p.T1031fs	HDAC6_uc004dks.1_Frame_Shift_Ins_p.T1031fs|HDAC6_uc010nig.1_Frame_Shift_Ins_p.T879fs|HDAC6_uc004dkt.1_Frame_Shift_Ins_p.T1031fs|HDAC6_uc011mmk.1_Frame_Shift_Ins_p.T1012fs|HDAC6_uc004dkv.1_Frame_Shift_Ins_p.T679fs|HDAC6_uc004dkw.1_Frame_Shift_Ins_p.T679fs|HDAC6_uc004dkx.1_Frame_Shift_Ins_p.T394fs	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1031					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)													---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53560237	53560237	+	3'UTR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53560237delA	uc004dsp.2	-	84					HUWE1_uc004dsn.2_3'UTR	NM_031407	NP_113584			HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69637642	69637642	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637642delT	uc004dyg.2	+						KIF4A_uc010nkw.2_Intron	NM_012310	NP_036442			kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
NONO	4841	broad.mit.edu	37	X	70518777	70518777	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70518777delT	uc004dzo.2	+						BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Intron|NONO_uc004dzp.2_Intron|NONO_uc011mpv.1_Intron|NONO_uc004dzq.2_Intron|ITGB1BP2_uc004dzr.1_5'Flank|ITGB1BP2_uc004dzs.1_5'Flank	NM_001145408	NP_001138880			non-POU domain containing, octamer-binding						DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)							T	TFE3	papillary renal cancer								---	---	---	---
BRWD3	254065	broad.mit.edu	37	X	79947491	79947491	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79947491delA	uc004edt.2	-						BRWD3_uc010nmi.1_Intron|BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984			bromodomain and WD repeat domain containing 3											ovary(4)	4																		---	---	---	---
APOOL	139322	broad.mit.edu	37	X	84309335	84309335	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84309335delT	uc004eem.2	+						APOOL_uc010nmp.2_Intron	NM_198450	NP_940852			apolipoprotein O-like precursor							extracellular region					0																		---	---	---	---
CUL4B	8450	broad.mit.edu	37	X	119695297	119695297	+	Intron	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119695297delG	uc004esw.2	-						CUL4B_uc004esv.2_5'Flank	NM_003588	NP_003579			cullin 4B isoform 1						cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
ARHGAP36	158763	broad.mit.edu	37	X	130219333	130219333	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130219333delA	uc004evz.2	+						ARHGAP36_uc004ewa.2_Intron|ARHGAP36_uc004ewb.2_Intron|ARHGAP36_uc004ewc.2_Intron	NM_144967	NP_659404			hypothetical protein LOC158763 precursor						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3																		---	---	---	---
FAM122C	159091	broad.mit.edu	37	X	133979590	133979590	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133979590delT	uc004exz.1	+						FAM122C_uc011mvq.1_Intron|FAM122C_uc004exy.1_Intron	NM_138819	NP_620174			hypothetical protein LOC159091												0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
TKTL1	8277	broad.mit.edu	37	X	153555803	153555803	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153555803delT	uc004fkg.2	+						TKTL1_uc011mzl.1_Intron|TKTL1_uc011mzm.1_Intron|TKTL1_uc004fkh.2_Intron	NM_012253	NP_036385			transketolase-like 1 isoform a						glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13538415	13538415	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13538415delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28687200	28687200	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28687200delT								None (None upstream) : None (None downstream)																																			---	---	---	---
EXOSC10	5394	broad.mit.edu	37	1	11150817	11150817	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11150817delT	uc001asa.2	-						EXOSC10_uc001asb.2_Intron|EXOSC10_uc009vmy.1_Intron	NM_001001998	NP_001001998			exosome component 10 isoform 1						CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17299014	17299014	+	3'UTR	DEL	A	-	-	rs6661019	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17299014delA	uc001azt.2	+	37					CROCC_uc001azu.2_3'UTR|CROCC_uc001azv.2_3'UTR	NM_014675	NP_055490			ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
HNRNPR	10236	broad.mit.edu	37	1	23660245	23660245	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23660245delA	uc001bgr.3	-						HNRNPR_uc001bgp.3_Intron|HNRNPR_uc009vqk.2_Intron|HNRNPR_uc001bgs.3_Intron|HNRNPR_uc010odw.1_Intron|HNRNPR_uc010odx.1_Intron|HNRNPR_uc009vql.2_Intron	NM_005826	NP_005817			heterogeneous nuclear ribonucleoprotein R							catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)														---	---	---	---
CCDC18	343099	broad.mit.edu	37	1	93721326	93721327	+	Intron	INS	-	GAAGAGGAA	GAAGAGGAA	rs138730379	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93721326_93721327insGAAGAGGAA	uc001dpq.2	+						CCDC18_uc001dpr.1_Intron	NM_206886	NP_996769			sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)														---	---	---	---
FNBP1L	54874	broad.mit.edu	37	1	93998820	93998820	+	Intron	DEL	A	-	-	rs35424674		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93998820delA	uc001dpw.2	+						FNBP1L_uc001dpv.2_Intron|FNBP1L_uc010otk.1_Intron	NM_001024948	NP_001020119			formin binding protein 1-like isoform 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)														---	---	---	---
SORT1	6272	broad.mit.edu	37	1	109883200	109883200	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109883200delA	uc001dxm.1	-						SORT1_uc010ovi.1_Intron	NM_002959	NP_002950			sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)														---	---	---	---
CSDE1	7812	broad.mit.edu	37	1	115279333	115279333	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115279333delA	uc001efk.2	-						CSDE1_uc001efi.2_Intron|CSDE1_uc001efj.2_Intron|CSDE1_uc001efl.2_Intron|CSDE1_uc001efm.2_Intron|CSDE1_uc009wgv.2_Intron|CSDE1_uc001efn.2_Intron	NM_001007553	NP_001007554			upstream of NRAS isoform 1						male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118514724	118514724	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118514724delA	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
PRUNE	58497	broad.mit.edu	37	1	150990220	150990220	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150990220delA	uc001ewh.1	+						PRUNE_uc001ewi.1_Intron|PRUNE_uc010pco.1_Intron|PRUNE_uc001ewj.1_Intron	NM_021222	NP_067045			prune							cytoplasm|focal adhesion|nucleus	inorganic diphosphatase activity|manganese ion binding|protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
KIAA0907	22889	broad.mit.edu	37	1	155886695	155886695	+	Intron	DEL	T	-	-	rs113079820		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155886695delT	uc001fmi.1	-						KIAA0907_uc001fmj.1_Intron|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_Intron	NM_014949	NP_055764			hypothetical protein LOC22889												0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)															---	---	---	---
NUF2	83540	broad.mit.edu	37	1	163324929	163324930	+	Intron	INS	-	T	T	rs144332216	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163324929_163324930insT	uc001gcq.1	+						NUF2_uc001gcr.1_Intron|NUF2_uc009wvc.1_Intron	NM_145697	NP_663735			NUF2, NDC80 kinetochore complex component						cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)																	---	---	---	---
NAV1	89796	broad.mit.edu	37	1	201724549	201724550	+	Intron	INS	-	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201724549_201724550insA	uc001gwu.2	+						NAV1_uc001gwv.1_Intron|NAV1_uc001gww.1_Intron|NAV1_uc001gwx.2_Intron	NM_020443	NP_065176			neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
LGTN	1939	broad.mit.edu	37	1	206766826	206766827	+	Intron	DEL	GA	-	-	rs113332386		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766826_206766827delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824			ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227213676	227213676	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227213676delA	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Intron|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron|CDC42BPA_uc001hqt.2_Intron|CDC42BPA_uc001hqu.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
MTR	4548	broad.mit.edu	37	1	237023370	237023379	+	Intron	DEL	CCCCCCCCCC	-	-	rs72541136		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237023370_237023379delCCCCCCCCCC	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
EML4	27436	broad.mit.edu	37	2	42508205	42508205	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42508205delA	uc002rsi.2	+						EML4_uc010fap.2_Intron	NM_019063	NP_061936			echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250								T	ALK	NSCLC								---	---	---	---
COX7A2L	9167	broad.mit.edu	37	2	42578275	42578275	+	3'UTR	DEL	A	-	-	rs71682791		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42578275delA	uc002rsk.2	-	3					COX7A2L_uc002rsl.2_RNA	NM_004718	NP_004709			cytochrome c oxidase subunit VIIa polypeptide 2						respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	45224046	45224046	+	IGR	DEL	A	-	-	rs34239087		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45224046delA								SIX3 (51656 upstream) : SIX2 (8279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132533457	132533458	+	IGR	INS	-	G	G	rs142741608		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132533457_132533458insG								C2orf27A (8480 upstream) : C2orf27B (19076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133020743	133020744	+	IGR	INS	-	T	T	rs137914230		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133020743_133020744insT								NCRNA00164 (5201 upstream) : GPR39 (153403 downstream)																																			---	---	---	---
DPP4	1803	broad.mit.edu	37	2	162903784	162903784	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162903784delA	uc002ubz.2	-						DPP4_uc010fpb.2_Intron|DPP4_uc002uca.1_Intron|DPP4_uc002ucb.1_Intron	NM_001935	NP_001926			dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)													---	---	---	---
COL4A3	1285	broad.mit.edu	37	2	228118589	228118589	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228118589delA	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082			alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)														---	---	---	---
PDE6D	5147	broad.mit.edu	37	2	232645702	232645702	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232645702delC	uc002vse.1	-						COPS7B_uc010fxy.1_5'Flank|PDE6D_uc002vsf.1_Intron|PDE6D_uc010fxx.1_Intron	NM_002601	NP_002592			phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1445212	1445212	+	3'UTR	DEL	A	-	-	rs74788015		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1445212delA	uc003boz.2	+	23					CNTN6_uc011asj.1_3'UTR|CNTN6_uc003bpa.2_3'UTR	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	30045474	30045474	+	3'UTR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30045474delT	uc003cel.2	+	15					RBMS3_uc003cem.2_3'UTR|RBMS3_uc010hfr.2_3'UTR	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52668500	52668500	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52668500delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
PDIA5	10954	broad.mit.edu	37	3	122821475	122821475	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122821475delT	uc003egc.1	+						PDIA5_uc003egd.1_Intron	NM_006810	NP_006801			protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)														---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130360601	130360601	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130360601delA	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078			collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	142895155	142895155	+	IGR	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142895155delC								CHST2 (53345 upstream) : SLC9A9 (88910 downstream)																																			---	---	---	---
OPA1	4976	broad.mit.edu	37	3	193366428	193366428	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193366428delA	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375			optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)														---	---	---	---
GAK	2580	broad.mit.edu	37	4	876980	876981	+	Intron	INS	-	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:876980_876981insA	uc003gbm.3	-						GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbl.3_Intron	NM_005255	NP_005246			cyclin G associated kinase						cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)														---	---	---	---
FBXL5	26234	broad.mit.edu	37	4	15632545	15632545	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15632545delT	uc003goc.1	-						FBXL5_uc010idw.1_Intron|FBXL5_uc003gob.1_Intron|FBXL5_uc010idx.1_Intron|FBXL5_uc003god.1_Intron|FBXL5_uc010idy.1_Intron	NM_012161	NP_036293			F-box and leucine-rich repeat protein 5 isoform						iron ion homeostasis|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|SCF ubiquitin ligase complex	iron ion binding|protein binding|ubiquitin-protein ligase activity				0																		---	---	---	---
USO1	8615	broad.mit.edu	37	4	76726517	76726517	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76726517delT	uc003hiu.2	+						USO1_uc003hiv.2_Intron|USO1_uc003hiw.2_Intron	NM_003715	NP_003706			USO1 homolog, vesicle docking protein						intracellular protein transport|vesicle fusion with Golgi apparatus	cytosol|Golgi membrane	protein binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
SYNPO2	171024	broad.mit.edu	37	4	119979267	119979268	+	3'UTR	DEL	AC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119979267_119979268delAC	uc010inb.2	+	5					SYNPO2_uc011cgh.1_3'UTR|SYNPO2_uc010inc.2_3'UTR	NM_133477	NP_597734			synaptopodin 2 isoform a							nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21502037	21502037	+	Intron	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21502037delG	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
NNT	23530	broad.mit.edu	37	5	43651679	43651680	+	Intron	INS	-	A	A	rs112687077		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43651679_43651680insA	uc003joe.2	+						NNT_uc003jof.2_Intron	NM_012343	NP_036475			nicotinamide nucleotide transhydrogenase						tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)													---	---	---	---
RASA1	5921	broad.mit.edu	37	5	86644899	86644899	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86644899delA	uc003kiw.2	+						RASA1_uc010jav.2_Intron|RASA1_uc003kix.2_Intron|RASA1_uc011ctv.1_Intron|RASA1_uc011ctw.1_Intron|RASA1_uc010jaw.2_Intron	NM_002890	NP_002881			RAS p21 protein activator 1 isoform 1						cytokinesis|embryo development|intracellular signal transduction|negative regulation of cell-matrix adhesion|negative regulation of neuron apoptosis|negative regulation of Ras protein signal transduction|positive regulation of anti-apoptosis|regulation of actin filament polymerization|regulation of cell shape|regulation of RNA metabolic process|vasculogenesis	cytosol|intrinsic to internal side of plasma membrane	glycoprotein binding|GTPase binding|potassium channel inhibitor activity|Ras GTPase activator activity|receptor binding			upper_aerodigestive_tract(3)|ovary(1)|lung(1)	5		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)														---	---	---	---
CHD1	1105	broad.mit.edu	37	5	98199049	98199050	+	Intron	DEL	AA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98199049_98199050delAA	uc003knf.2	-						CHD1_uc010jbn.2_Intron	NM_001270	NP_001261			chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)													---	---	---	---
AP3S1	1176	broad.mit.edu	37	5	115177668	115177669	+	5'UTR	INS	-	AGGC	AGGC	rs144226661	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115177668_115177669insAGGC	uc003krl.2	+	1					AP3S1_uc003krk.2_5'UTR|AP3S1_uc003krm.2_5'UTR|ATG12_uc003krh.2_5'Flank|ATG12_uc003kri.2_5'Flank|ATG12_uc003krj.2_5'Flank	NM_001284	NP_001275			adaptor-related protein complex 3, sigma 1						insulin receptor signaling pathway|intracellular protein transport|vesicle-mediated transport	AP-type membrane coat adaptor complex|cytoplasmic vesicle membrane|Golgi apparatus|transport vesicle	protein binding|protein transporter activity				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)														---	---	---	---
PRRC1	133619	broad.mit.edu	37	5	126866120	126866120	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126866120delT	uc003kuk.2	+						PRRC1_uc003kuj.3_Intron	NM_130809	NP_570721			proline-rich coiled-coil 1							Golgi apparatus					0		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)														---	---	---	---
HIST1H4K	8362	broad.mit.edu	37	6	27799470	27799470	+	5'Flank	DEL	A	-	-	rs71559051		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27799470delA	uc003njr.2	-							NM_003541	NP_003532			histone cluster 1, H4k						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0																		---	---	---	---
PHF3	23469	broad.mit.edu	37	6	64419319	64419319	+	Intron	DEL	T	-	-	rs34108196		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64419319delT	uc003pep.1	+						PHF3_uc003pen.2_Intron|PHF3_uc011dxs.1_Intron	NM_015153	NP_055968			PHD finger protein 3						multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)															---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75801416	75801417	+	Intron	DEL	TC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75801416_75801417delTC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
RRAGD	58528	broad.mit.edu	37	6	90121645	90121647	+	In_Frame_Del	DEL	TCC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90121645_90121647delTCC	uc003pnd.3	-	1	349_351	c.66_68delGGA	c.(64-69)GAGGAT>GAT	p.E22del	RRAGD_uc010kcc.2_Translation_Start_Site	NM_021244	NP_067067	Q9NQL2	RRAGD_HUMAN	Ras-related GTP binding D	22					cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade	lysosome|nucleus	GTP binding|protein heterodimerization activity			ovary(2)|central_nervous_system(1)	3		all_cancers(76;7.01e-07)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00139)		BRCA - Breast invasive adenocarcinoma(108;0.0144)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	126964717	126964717	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126964717delC	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
NOX3	50508	broad.mit.edu	37	6	155718238	155718238	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155718238delT	uc003qqm.2	-							NM_015718	NP_056533			NADPH oxidase 3								electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)														---	---	---	---
NUDT1	4521	broad.mit.edu	37	7	2290259	2290260	+	Intron	INS	-	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2290259_2290260insT	uc003slp.1	+						NUDT1_uc003slq.1_Intron|NUDT1_uc003slr.1_Intron|NUDT1_uc003sls.1_Intron|NUDT1_uc003slt.1_Intron|NUDT1_uc003slu.1_Intron|NUDT1_uc003slv.1_Intron	NM_198949	NP_945187			nudix-type motif 1 isoform p22						DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)									Direct_reversal_of_damage|Modulation_of_nucleotide_pools					---	---	---	---
TMEM195	392636	broad.mit.edu	37	7	15565517	15565518	+	Intron	DEL	CT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15565517_15565518delCT	uc003stb.1	-							NM_001004320	NP_001004320			transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0																		---	---	---	---
FAM188B	84182	broad.mit.edu	37	7	30921989	30921990	+	Intron	INS	-	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30921989_30921990insC	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron|AQP1_uc011kac.1_Intron|FAM188B_uc003tbu.2_Intron	NM_032222	NP_115598			hypothetical protein LOC84182												0																		---	---	---	---
STAG3L4	64940	broad.mit.edu	37	7	66767611	66767611	+	5'Flank	DEL	T	-	-	rs12531701	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66767611delT	uc003tvt.3	+						PMS2L4_uc003tvo.2_5'Flank|PMS2L4_uc003tvq.2_5'Flank|PMS2L4_uc003tvr.3_5'Flank|PMS2L4_uc003tvs.3_5'Flank|STAG3L4_uc010laj.2_5'Flank	NM_022906	NP_075057			stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)																---	---	---	---
MLXIPL	51085	broad.mit.edu	37	7	73008884	73008884	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73008884delT	uc003tyn.1	-						MLXIPL_uc003tyj.1_Intron|MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569			Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
ANKIB1	54467	broad.mit.edu	37	7	92000724	92000724	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92000724delT	uc003ulw.2	+						ANKIB1_uc010lew.1_5'Flank	NM_019004	NP_061877			ankyrin repeat and IBR domain containing 1								protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)															---	---	---	---
ST7	7982	broad.mit.edu	37	7	116772156	116772156	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116772156delT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron|ST7OT2_uc003viw.2_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
SLC7A2	6542	broad.mit.edu	37	8	17406521	17406521	+	Intron	DEL	A	-	-	rs149187417		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17406521delA	uc011kyc.1	+						SLC7A2_uc011kyd.1_Intron|SLC7A2_uc011kye.1_Intron|SLC7A2_uc011kyf.1_Intron	NM_001008539	NP_001008539			solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
STC1	6781	broad.mit.edu	37	8	23709570	23709571	+	Intron	DEL	TG	-	-	rs113294965		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23709570_23709571delTG	uc003xdw.1	-							NM_003155	NP_003146			stanniocalcin 1 precursor						cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)														---	---	---	---
POLB	5423	broad.mit.edu	37	8	42228944	42228944	+	Intron	DEL	T	-	-	rs79893094		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42228944delT	uc003xoz.1	+						POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Intron	NM_002690	NP_002681			DNA-directed DNA polymerase beta						DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)								DNA_polymerases_(catalytic_subunits)					---	---	---	---
OSGIN2	734	broad.mit.edu	37	8	90936586	90936586	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90936586delT	uc003yeg.2	+						OSGIN2_uc003yeh.2_Intron	NM_004337	NP_004328			oxidative stress induced growth inhibitor family						germ cell development|meiosis						0			BRCA - Breast invasive adenocarcinoma(11;0.0344)															---	---	---	---
POP1	10940	broad.mit.edu	37	8	99148630	99148631	+	Intron	DEL	AA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99148630_99148631delAA	uc003yij.3	+						POP1_uc011lgv.1_Intron|POP1_uc003yik.2_Intron	NM_001145860	NP_001139332			processing of precursor 1						tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)															---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108315770	108315770	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108315770delA	uc003ymn.2	-						ANGPT1_uc011lhv.1_Intron|ANGPT1_uc003ymo.2_Intron|ANGPT1_uc003ymp.3_Intron	NM_001146	NP_001137			angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
WDYHV1	55093	broad.mit.edu	37	8	124442120	124442120	+	Intron	DEL	A	-	-	rs71843155		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124442120delA	uc003yqn.1	+						WDYHV1_uc011lij.1_Intron|WDYHV1_uc003yqo.1_5'Flank	NM_018024	NP_060494			WDYHV motif containing 1						protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2																		---	---	---	---
NAA35	60560	broad.mit.edu	37	9	88576799	88576799	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88576799delT	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911			corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3																		---	---	---	---
SUSD3	203328	broad.mit.edu	37	9	95838023	95838026	+	Intron	DEL	CCCC	-	-	rs56653934		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95838023_95838026delCCCC	uc004atb.2	+						SUSD3_uc004atc.2_Intron	NM_145006	NP_659443			sushi domain containing 3							integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6																		---	---	---	---
TMEFF1	8577	broad.mit.edu	37	9	103323954	103323954	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103323954delA	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683			transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)																---	---	---	---
ROD1	9991	broad.mit.edu	37	9	114985985	114985985	+	3'UTR	DEL	T	-	-	rs10817292	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114985985delT	uc004bfw.2	-	15					ROD1_uc004bfv.2_3'UTR|ROD1_uc004bfx.2_3'UTR|ROD1_uc011lwu.1_3'UTR|ROD1_uc004bfy.2_3'UTR|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147			ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
C9orf98	158067	broad.mit.edu	37	9	135690206	135690206	+	Intron	DEL	A	-	-	rs140406073		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135690206delA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785			putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137709530	137709531	+	Intron	DEL	CA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137709530_137709531delCA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69750213	69750214	+	Intron	INS	-	A	A	rs71468901		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69750213_69750214insA	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
POLR3A	11128	broad.mit.edu	37	10	79770063	79770063	+	Intron	DEL	A	-	-	rs3832673		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770063delA	uc001jzn.2	-							NM_007055	NP_008986			polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)															---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100995712	100995713	+	5'Flank	DEL	CT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100995712_100995713delCT	uc001kpn.1	-						HPSE2_uc009xwc.1_5'Flank|HPSE2_uc001kpo.1_5'Flank|HPSE2_uc009xwd.1_5'Flank	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
ADAM8	101	broad.mit.edu	37	10	135080379	135080379	+	Intron	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135080379delG	uc010qva.1	-						ADAM8_uc010quz.1_Intron|ADAM8_uc009ybi.2_Intron					SubName: Full=cDNA FLJ50704, highly similar to ADAM 8 (EC 3.4.24.-) (A disintegrinand metalloproteinase domain 8);						integrin-mediated signaling pathway|proteolysis		metalloendopeptidase activity			large_intestine(2)|central_nervous_system(1)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)														---	---	---	---
PKP3	11187	broad.mit.edu	37	11	399184	399184	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:399184delA	uc001lpc.2	+	5	1337	c.1261delA	c.(1261-1263)AAAfs	p.K421fs		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	421	ARM 3.				cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
MUC2	4583	broad.mit.edu	37	11	1078985	1078986	+	Intron	INS	-	GTG	GTG	rs72168941		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1078985_1078986insGTG	uc001lsx.1	+							NM_002457	NP_002448			mucin 2 precursor							inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)													---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3727549	3727549	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3727549delT	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyg.2_Intron	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
GTF2H1	2965	broad.mit.edu	37	11	18379447	18379447	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18379447delA	uc001moi.2	+						GTF2H1_uc001moh.2_Intron|GTF2H1_uc009yhm.2_Intron|GTF2H1_uc001moj.2_Intron	NM_001142307	NP_001135779			general transcription factor IIH, polypeptide 1,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0													NER					---	---	---	---
Unknown	0	broad.mit.edu	37	11	33455633	33455633	+	IGR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33455633delA								HIPK3 (79694 upstream) : C11orf41 (108244 downstream)																																			---	---	---	---
CAT	847	broad.mit.edu	37	11	34490058	34490058	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34490058delA	uc001mvm.2	+						CAT_uc001mvn.2_Intron	NM_001752	NP_001743			catalase						hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)													---	---	---	---
PZP	5858	broad.mit.edu	37	12	9316490	9316490	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9316490delA	uc001qvl.2	-						PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_Intron|PZP_uc009zgm.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	9391909	9391909	+	5'Flank	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9391909delT	uc001qvm.1	+											Homo sapiens cDNA FLJ44260 fis, clone TLIVE2000979.																														---	---	---	---
SLCO1B3	28234	broad.mit.edu	37	12	21242745	21242746	+	Intron	INS	-	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21242745_21242746insT	uc010sil.1	+						LST-3TM12_uc010sim.1_Intron|LST-3TM12_uc010sin.1_Intron					SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)																	---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94697470	94697473	+	Intron	DEL	TTTT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94697470_94697473delTTTT	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_Intron	NM_005761	NP_005752			plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
SETD8	387893	broad.mit.edu	37	12	123889739	123889740	+	Intron	INS	-	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123889739_123889740insT	uc001uew.2	+						SETD8_uc001uex.2_Intron	NM_020382	NP_065115			SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)														---	---	---	---
MED4	29079	broad.mit.edu	37	13	48651536	48651536	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48651536delT	uc001vby.1	-						MED4_uc010tge.1_Intron|MED4_uc010tgf.1_Intron	NM_014166	NP_054885			mediator complex subunit 4						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)														---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67799412	67799412	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67799412delT	uc001vik.2	-						PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron|PCDH9_uc001vin.3_3'UTR	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77713625	77713625	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77713625delA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872			MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
DNAL1	83544	broad.mit.edu	37	14	74153808	74153808	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74153808delA	uc001xoq.3	+						DNAL1_uc010aru.2_Intron|DNAL1_uc010arv.2_Intron	NM_031427	NP_113615			axonemal dynein light chain 1												0				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	90203668	90203668	+	IGR	DEL	C	-	-	rs12897726		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90203668delC								FOXN3 (118174 upstream) : C14orf143 (59803 downstream)																																			---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95657758	95657759	+	3'UTR	INS	-	C	C	rs60112171		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95657758_95657759insC	uc001yef.2	-	13						NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
HSP90AA1	3320	broad.mit.edu	37	14	102548312	102548312	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102548312delA	uc001yku.3	-						HSP90AA1_uc001ykv.3_Intron	NM_005348	NP_005339			heat shock 90kDa protein 1, alpha isoform 2						axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---
CATSPER2	117155	broad.mit.edu	37	15	43950663	43950663	+	Intron	DEL	C	-	-	rs67805714		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43950663delC	uc001zsl.1	-											Homo sapiens putative ion channel protein CATSPER2 variant 1 mRNA, complete cds.						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)														---	---	---	---
ITGA11	22801	broad.mit.edu	37	15	68609861	68609869	+	Intron	DEL	CCCCAGAGG	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68609861_68609869delCCCCAGAGG	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439			integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)													---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72120536	72120537	+	Intron	INS	-	A	A	rs139814275	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72120536_72120537insA	uc002atl.3	-						MYO9A_uc002atj.2_Intron|MYO9A_uc002atk.2_Intron	NM_006901	NP_008832			myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81611436	81611436	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81611436delA	uc002bgm.2	-						STARD5_uc002bgn.2_Intron	NM_181900	NP_871629			StAR-related lipid transfer protein 5						C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
FAM18A	780776	broad.mit.edu	37	16	10865686	10865686	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10865686delT	uc010buo.1	-						FAM18A_uc010uyr.1_Intron|FAM18A_uc010uys.1_Intron|FAM18A_uc010uyt.1_Intron|FAM18A_uc010bun.2_Intron|FAM18A_uc010uyu.1_Intron|FAM18A_uc002dad.3_Intron|FAM18A_uc002daf.1_Intron|FAM18A_uc002dae.1_Intron	NM_001079512	NP_001072980			hypothetical protein LOC780776							integral to membrane					0																		---	---	---	---
MAZ	4150	broad.mit.edu	37	16	29819823	29819823	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29819823delC	uc002dty.2	+						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAZ_uc002dtv.1_Intron|MAZ_uc010vdx.1_Intron|MAZ_uc002dtw.2_Intron|MAZ_uc002dtx.2_Intron|MAZ_uc010bzg.2_Intron|MAZ_uc002dtz.1_3'UTR|MAZ_uc002dua.2_Intron|MAZ_uc010vdy.1_Intron	NM_002383	NP_002374			MYC-associated zinc finger protein isoform 1						regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription|transcription initiation from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	57355179	57355179	+	IGR	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57355179delG								PLLP (36608 upstream) : CCL22 (37539 downstream)																																			---	---	---	---
DULLARD	23399	broad.mit.edu	37	17	7150790	7150790	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7150790delT	uc002gfd.2	-						DULLARD_uc002gfe.2_Intron|DULLARD_uc002gff.2_Intron|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247			dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	17360190	17360190	+	IGR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17360190delA								NT5M (109215 upstream) : MED9 (20110 downstream)																																			---	---	---	---
KLHL10	317719	broad.mit.edu	37	17	39994521	39994522	+	Intron	DEL	TT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39994521_39994522delTT	uc010cxr.2	+						NT5C3L_uc002hyb.3_5'Flank|NT5C3L_uc002hyc.3_5'Flank|NT5C3L_uc002hyd.3_5'Flank|NT5C3L_uc002hxy.3_5'Flank|NT5C3L_uc002hxz.3_5'Flank|NT5C3L_uc002hya.3_5'Flank|KLHL10_uc010wfv.1_Intron|KLHL10_uc010wfw.1_Intron	NM_152467	NP_689680			kelch-like 10							cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)																---	---	---	---
ATP6V0A1	535	broad.mit.edu	37	17	40647391	40647391	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40647391delT	uc002hzr.2	+						ATP6V0A1_uc002hzq.2_Intron|ATP6V0A1_uc002hzs.2_Intron|ATP6V0A1_uc010wgj.1_Intron|ATP6V0A1_uc010wgk.1_Intron|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Intron	NM_001130021	NP_001123493			ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	44321386	44321386	+	IGR	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44321386delC								KIAA1267 (18669 upstream) : ARL17B (42477 downstream)																																			---	---	---	---
KPNB1	3837	broad.mit.edu	37	17	45729935	45729935	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45729935delA	uc002ilt.1	+						KPNB1_uc010wkw.1_Intron	NM_002265	NP_002256			karyopherin beta 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TRIM37	4591	broad.mit.edu	37	17	57141686	57141686	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57141686delA	uc002iwy.3	-						TRIM37_uc002iwz.3_Intron|TRIM37_uc002ixa.3_Intron|TRIM37_uc010woc.1_Intron	NM_001005207	NP_001005207			tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)													Mulibrey_Nanism				---	---	---	---
TBC1D3P2	440452	broad.mit.edu	37	17	60347260	60347260	+	Intron	DEL	T	-	-	rs71934275		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60347260delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_Intron|uc010wpa.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0																		---	---	---	---
ABCA8	10351	broad.mit.edu	37	17	66918336	66918363	+	Intron	DEL	TTTTTTTTTTTTTTTTTTTTTTTTTTTT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66918336_66918363delTTTTTTTTTTTTTTTTTTTTTTTTTTTT	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron|ABCA8_uc010wqr.1_Intron|ABCA8_uc002jhr.2_Intron	NM_007168	NP_009099			ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)																	---	---	---	---
KIAA1012	22878	broad.mit.edu	37	18	29489050	29489050	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29489050delA	uc002kxc.3	-						KIAA1012_uc002kxb.3_Intron|KIAA1012_uc002kxd.3_Intron|KIAA1012_uc002kxe.2_Intron	NM_014939	NP_055754			hypothetical protein LOC22878						ER to Golgi vesicle-mediated transport	cis-Golgi network					0																		---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2585102	2585125	+	Intron	DEL	GAAGGAAGGAAAGAAGGTAGGAAT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2585102_2585125delGAAGGAAGGAAAGAAGGTAGGAAT	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZFR2	23217	broad.mit.edu	37	19	3871979	3871980	+	5'Flank	INS	-	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3871979_3871980insA	uc002lyw.2	-						ZFR2_uc010xhx.1_5'Flank|ZFR2_uc002lyx.3_5'Flank|ZFR2_uc010xhy.1_5'Flank	NM_015174	NP_055989			zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)														---	---	---	---
MPND	84954	broad.mit.edu	37	19	4348250	4348251	+	Intron	DEL	TC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4348250_4348251delTC	uc002mae.2	+						MPND_uc010dtx.2_Intron|MPND_uc002mag.2_Intron|MPND_uc002maf.2_Intron|MPND_uc002mah.2_Intron|MPND_uc002mai.2_Intron	NM_032868	NP_116257			MPN domain containing isoform 1								peptidase activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
KLHL26	55295	broad.mit.edu	37	19	18775397	18775397	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18775397delT	uc002njz.1	+							NM_018316	NP_060786			kelch-like 26											ovary(1)	1																		---	---	---	---
MCM8	84515	broad.mit.edu	37	20	5952840	5952841	+	Intron	DEL	TT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5952840_5952841delTT	uc002wmi.2	+						MCM8_uc002wmj.2_Intron|MCM8_uc002wmk.2_Intron|MCM8_uc002wml.2_Intron|MCM8_uc010gbp.2_Intron|MCM8_uc002wmm.2_5'UTR	NM_032485	NP_115874			minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	22713371	22713371	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22713371delT								FOXA2 (147270 upstream) : SSTR4 (302686 downstream)																																			---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074492	62074494	+	Intron	DEL	CAC	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074492_62074494delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	21112407	21112408	+	IGR	DEL	GA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21112407_21112408delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
IL10RB	3588	broad.mit.edu	37	21	34660708	34660711	+	Intron	DEL	ACAG	-	-	rs67118950		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34660708_34660711delACAG	uc002yrk.1	+						IL10RB_uc002yrl.1_Intron	NM_000628	NP_000619			interleukin 10 receptor, beta precursor						immune response|inflammatory response	interleukin-28 receptor complex	protein binding|receptor activity				0																		---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46911299	46911300	+	Intron	INS	-	C	C	rs148502711	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46911299_46911300insC	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
OSBP2	23762	broad.mit.edu	37	22	31298113	31298114	+	Intron	INS	-	A	A	rs58650554		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298113_31298114insA	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385			oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2																		---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	39994293	39994294	+	Intron	INS	-	GCCCT	GCCCT	rs148307297	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39994293_39994294insGCCCT	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
DHRSX	207063	broad.mit.edu	37	X	2232507	2232510	+	Intron	DEL	GGGA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2232507_2232510delGGGA	uc004cqf.3	-							NM_145177	NP_660160			dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	36229987	36229987	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36229987delT								CXorf59 (66800 upstream) : CXorf30 (24064 downstream)																																			---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47034512	47034512	+	Intron	DEL	C	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47034512delC	uc004dhf.2	+						RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Intron|RBM10_uc004dhh.2_Intron|RBM10_uc010nhq.2_Intron|RBM10_uc004dhi.2_Intron	NM_005676	NP_005667			RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5																		---	---	---	---
HDAC6	10013	broad.mit.edu	37	X	48681900	48681901	+	Frame_Shift_Ins	INS	-	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48681900_48681901insC	uc011mmi.1	+	25	3186_3187	c.3091_3092insC	c.(3091-3093)ACCfs	p.T1031fs	HDAC6_uc004dks.1_Frame_Shift_Ins_p.T1031fs|HDAC6_uc010nig.1_Frame_Shift_Ins_p.T879fs|HDAC6_uc004dkt.1_Frame_Shift_Ins_p.T1031fs|HDAC6_uc011mmk.1_Frame_Shift_Ins_p.T1012fs|HDAC6_uc004dkv.1_Frame_Shift_Ins_p.T679fs|HDAC6_uc004dkw.1_Frame_Shift_Ins_p.T679fs|HDAC6_uc004dkx.1_Frame_Shift_Ins_p.T394fs	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1031					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)													---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53560237	53560237	+	3'UTR	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53560237delA	uc004dsp.2	-	84					HUWE1_uc004dsn.2_3'UTR	NM_031407	NP_113584			HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69637642	69637642	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637642delT	uc004dyg.2	+						KIF4A_uc010nkw.2_Intron	NM_012310	NP_036442			kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
NONO	4841	broad.mit.edu	37	X	70518777	70518777	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70518777delT	uc004dzo.2	+						BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Intron|NONO_uc004dzp.2_Intron|NONO_uc011mpv.1_Intron|NONO_uc004dzq.2_Intron|ITGB1BP2_uc004dzr.1_5'Flank|ITGB1BP2_uc004dzs.1_5'Flank	NM_001145408	NP_001138880			non-POU domain containing, octamer-binding						DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)							T	TFE3	papillary renal cancer								---	---	---	---
TAF1	6872	broad.mit.edu	37	X	70639873	70639874	+	Intron	DEL	TT	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70639873_70639874delTT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278			TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---
BRWD3	254065	broad.mit.edu	37	X	79947491	79947491	+	Intron	DEL	A	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79947491delA	uc004edt.2	-						BRWD3_uc010nmi.1_Intron|BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984			bromodomain and WD repeat domain containing 3											ovary(4)	4																		---	---	---	---
CUL4B	8450	broad.mit.edu	37	X	119695297	119695297	+	Intron	DEL	G	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119695297delG	uc004esw.2	-						CUL4B_uc004esv.2_5'Flank	NM_003588	NP_003579			cullin 4B isoform 1						cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
BCORL1	63035	broad.mit.edu	37	X	129190011	129190011	+	Frame_Shift_Del	DEL	C	-	-	rs137862942		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129190011delC	uc004evb.1	+	13	5150	c.5036delC	c.(5035-5037)TCCfs	p.S1679fs	BCORL1_uc004evc.1_Frame_Shift_Del_p.S515fs	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	1679					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7																		---	---	---	---
TKTL1	8277	broad.mit.edu	37	X	153555803	153555803	+	Intron	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153555803delT	uc004fkg.2	+						TKTL1_uc011mzl.1_Intron|TKTL1_uc011mzm.1_Intron|TKTL1_uc004fkh.2_Intron	NM_012253	NP_036385			transketolase-like 1 isoform a						glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13538415	13538415	+	IGR	DEL	T	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13538415delT								None (None upstream) : None (None downstream)																																			---	---	---	---
UTY	7404	broad.mit.edu	37	Y	15399420	15399421	+	Intron	DEL	AA	-	-			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:15399420_15399421delAA	uc004fsx.1	-						UTY_uc004fsw.1_Intron|UTY_uc010nwx.1_Intron	NM_007125	NP_009056			tetratricopeptide repeat protein isoform 3						chromatin modification	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
AGRN	375790	broad.mit.edu	37	1	979010	979010	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:979010G>A	uc001ack.1	+	9	1746	c.1696G>A	c.(1696-1698)GTG>ATG	p.V566M		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	566	Kazal-like 6.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)														---	---	---	---
PER3	8863	broad.mit.edu	37	1	7887631	7887631	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7887631C>T	uc001aoo.2	+	17	2793	c.2618C>T	c.(2617-2619)GCG>GTG	p.A873V	PER3_uc009vmg.1_Missense_Mutation_p.A881V|PER3_uc009vmh.1_Missense_Mutation_p.A874V|PER3_uc001aop.2_Missense_Mutation_p.A881V|PER3_uc010nzw.1_Missense_Mutation_p.A562V	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	873	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TNFRSF9	3604	broad.mit.edu	37	1	7995117	7995117	+	Missense_Mutation	SNP	G	A	A	rs145966863	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7995117G>A	uc001aot.2	-	6	628	c.500C>T	c.(499-501)CCG>CTG	p.P167L		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	167	Extracellular (Potential).				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ZBTB17	7709	broad.mit.edu	37	1	16268919	16268919	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16268919C>T	uc001axl.3	-						ZBTB17_uc010obq.1_Intron|ZBTB17_uc010obr.1_Missense_Mutation_p.A686T|ZBTB17_uc010obs.1_Intron	NM_003443	NP_003434			zinc finger and BTB domain containing 17						negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ARHGEF10L	55160	broad.mit.edu	37	1	17952451	17952451	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17952451C>T	uc001ban.2	+	14	1477	c.1318C>T	c.(1318-1320)CGA>TGA	p.R440*	ARHGEF10L_uc009vpe.1_Nonsense_Mutation_p.R401*|ARHGEF10L_uc001bao.2_Nonsense_Mutation_p.R401*|ARHGEF10L_uc001bap.2_Nonsense_Mutation_p.R401*|ARHGEF10L_uc010ocr.1_Nonsense_Mutation_p.R198*|ARHGEF10L_uc001baq.2_Nonsense_Mutation_p.R206*|ARHGEF10L_uc010ocs.1_Nonsense_Mutation_p.R218*|ARHGEF10L_uc001bar.2_Intron|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	440	DH.				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)														---	---	---	---
ZBTB40	9923	broad.mit.edu	37	1	22848916	22848916	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22848916G>A	uc001bft.2	+	17	3769	c.3258G>A	c.(3256-3258)ACG>ACA	p.T1086T	ZBTB40_uc001bfu.2_Silent_p.T1086T|ZBTB40_uc009vqi.1_Silent_p.T974T	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1086	C2H2-type 10.				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)														---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26360246	26360246	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26360246G>A	uc001blf.2	+	9	2445	c.1578G>A	c.(1576-1578)ACG>ACA	p.T526T		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	526	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CATSPER4	378807	broad.mit.edu	37	1	26524487	26524487	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26524487C>A	uc010oez.1	+	5	597	c.597C>A	c.(595-597)CCC>CCA	p.P199P	CATSPER4_uc010oey.1_Silent_p.P21P|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	199	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27099008	27099008	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27099008C>T	uc001bmv.1	+	13	3797	c.3424C>T	c.(3424-3426)CAG>TAG	p.Q1142*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1142*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1142*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q759*|ARID1A_uc001bmx.1_5'UTR|ARID1A_uc009vsm.1_5'Flank|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1142					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27106861	27106861	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106861C>T	uc001bmv.1	+	20	6845	c.6472C>T	c.(6472-6474)CGA>TGA	p.R2158*	ARID1A_uc001bmu.1_Nonsense_Mutation_p.R1941*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.R1004*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.R486*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.R400*	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2158					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	p.R2158*(1)		ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
FAM46B	115572	broad.mit.edu	37	1	27332693	27332693	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27332693G>A	uc010ofj.1	-	2	1192	c.1020C>T	c.(1018-1020)TAC>TAT	p.Y340Y		NM_052943	NP_443175	Q96A09	FA46B_HUMAN	hypothetical protein LOC115572	340										central_nervous_system(1)	1		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
TAF12	6883	broad.mit.edu	37	1	28948573	28948573	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28948573T>C	uc001bqw.2	-	1	114	c.21A>G	c.(19-21)TCA>TCG	p.S7S	TAF12_uc001bqx.2_Silent_p.S7S|TAF12_uc001bqy.2_Silent_p.S7S|TAF12_uc009vti.2_Silent_p.S7S	NM_005644	NP_005635	Q16514	TAF12_HUMAN	TAF12 RNA polymerase II, TATA box binding	7					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	PCAF complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Renal(390;0.00121)|Breast(348;0.00502)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)		Colorectal(126;3.21e-08)|COAD - Colon adenocarcinoma(152;1.74e-06)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(1967;0.0109)|BRCA - Breast invasive adenocarcinoma(304;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
NKAIN1	79570	broad.mit.edu	37	1	31655387	31655387	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31655387C>A	uc010ogd.1	-	5	528	c.522G>T	c.(520-522)GAG>GAT	p.E174D	NKAIN1_uc001bsn.2_Missense_Mutation_p.E130D|NKAIN1_uc010ogc.1_Missense_Mutation_p.E103D	NM_024522	NP_078798	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	174	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)														---	---	---	---
BAI2	576	broad.mit.edu	37	1	32201998	32201998	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32201998G>A	uc001btn.2	-						BAI2_uc001btm.2_5'Flank|BAI2_uc001btp.1_5'UTR|BAI2_uc010ogn.1_Intron|BAI2_uc010ogo.1_Intron|BAI2_uc010ogp.1_Intron|BAI2_uc010ogq.1_Intron|BAI2_uc001bto.2_Intron	NM_001703	NP_001694			brain-specific angiogenesis inhibitor 2						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)														---	---	---	---
RNF19B	127544	broad.mit.edu	37	1	33411121	33411121	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33411121T>C	uc010oho.1	-	5	1258	c.1258A>G	c.(1258-1260)AGT>GGT	p.S420G	RNF19B_uc001bwm.3_Missense_Mutation_p.S419G|RNF19B_uc010ohp.1_Missense_Mutation_p.S419G	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	420	Helical; (Potential).					integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34554619	34554619	+	Silent	SNP	C	T	T	rs141030168		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34554619C>T	uc001bxn.1	-	2	272	c.243G>A	c.(241-243)TCG>TCA	p.S81S	CSMD2_uc001bxm.1_Silent_p.S121S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	81	CUB 1.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
CCDC30	728621	broad.mit.edu	37	1	43119565	43119565	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43119565G>A	uc009vwk.1	+	16	2328	c.2218G>A	c.(2218-2220)GCA>ACA	p.A740T	CCDC30_uc001chm.2_Missense_Mutation_p.A438T|CCDC30_uc001chn.2_Missense_Mutation_p.A529T	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	740											0																		---	---	---	---
IPO13	9670	broad.mit.edu	37	1	44426892	44426892	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44426892T>A	uc001ckx.2	+	14	3097	c.2302T>A	c.(2302-2304)TTC>ATC	p.F768I		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	768					protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)																---	---	---	---
CYP4Z1	199974	broad.mit.edu	37	1	47560306	47560306	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47560306C>T	uc001cqu.1	+	7	844	c.841C>T	c.(841-843)CGC>TGC	p.R281C		NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1	281	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1																		---	---	---	---
MYSM1	114803	broad.mit.edu	37	1	59132821	59132821	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59132821G>T	uc009wab.1	-	16	1943	c.1920C>A	c.(1918-1920)GCC>GCA	p.A640A	MYSM1_uc009waa.1_Silent_p.A46A|MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	640	MPN.				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)																	---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65851439	65851439	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65851439G>A	uc001dcd.1	+	7	838	c.674G>A	c.(673-675)CGC>CAC	p.R225H	DNAJC6_uc001dcc.1_Missense_Mutation_p.R256H|DNAJC6_uc010opc.1_Missense_Mutation_p.R212H|DNAJC6_uc001dce.1_Missense_Mutation_p.R282H	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	225					cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
WDR78	79819	broad.mit.edu	37	1	67313177	67313177	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67313177A>G	uc001dcx.2	-	8	1337	c.1281T>C	c.(1279-1281)CCT>CCC	p.P427P	WDR78_uc001dcy.2_Silent_p.P427P|WDR78_uc009waw.2_Silent_p.P173P|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	427										ovary(2)	2																		---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94480241	94480241	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94480241G>A	uc001dqh.2	-	38	5422	c.5318C>T	c.(5317-5319)GCG>GTG	p.A1773V	ABCA4_uc009wdp.1_Missense_Mutation_p.A41V	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1773	Helical; (Potential).				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107867388	107867388	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107867388A>G	uc001dvh.3	+	3	1449	c.731A>G	c.(730-732)TAC>TGC	p.Y244C	NTNG1_uc001dvf.3_Missense_Mutation_p.Y244C|NTNG1_uc010out.1_Missense_Mutation_p.Y244C|NTNG1_uc001dvc.3_Missense_Mutation_p.Y244C|NTNG1_uc001dvd.1_Missense_Mutation_p.Y244C	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	244	Laminin N-terminal.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108417623	108417623	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108417623T>C	uc001dvk.1	-	2	275	c.221A>G	c.(220-222)AAC>AGC	p.N74S	VAV3_uc010ouw.1_Missense_Mutation_p.N74S|VAV3_uc001dvl.1_5'UTR|VAV3_uc010oux.1_Missense_Mutation_p.N74S	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	74	CH.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
AMPD2	271	broad.mit.edu	37	1	110168017	110168017	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110168017C>T	uc009wfh.1	+	3	888	c.346C>T	c.(346-348)CGC>TGC	p.R116C	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.R35C|AMPD2_uc001dyc.1_Missense_Mutation_p.R116C|AMPD2_uc010ovr.1_Intron|AMPD2_uc010ovs.1_5'UTR|AMPD2_uc001dyd.1_5'Flank	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	116					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)														---	---	---	---
KCND3	3752	broad.mit.edu	37	1	112318756	112318756	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112318756G>A	uc001ebu.1	-	8	2391	c.1911C>T	c.(1909-1911)GGC>GGT	p.G637G	KCND3_uc001ebv.1_Silent_p.G618G	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	637	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
PTGFRN	5738	broad.mit.edu	37	1	117509774	117509774	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117509774C>T	uc001egv.1	+	6	2018	c.1881C>T	c.(1879-1881)GGC>GGT	p.G627G		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	627	Ig-like C2-type 5.|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)														---	---	---	---
MAN1A2	10905	broad.mit.edu	37	1	117944904	117944904	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117944904T>C	uc001ehd.1	+	2	1120	c.399T>C	c.(397-399)ATT>ATC	p.I133I	MAN1A2_uc009whg.1_Intron	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	133	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)														---	---	---	---
THEM4	117145	broad.mit.edu	37	1	151849482	151849482	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151849482G>A	uc001ezj.1	-	5	856	c.677C>T	c.(676-678)GCG>GTG	p.A226V	THEM4_uc001ezk.1_RNA	NM_053055	NP_444283	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	226					insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane					0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152283959	152283959	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283959T>C	uc001ezu.1	-	3	3439	c.3403A>G	c.(3403-3405)AGG>GGG	p.R1135G	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1135	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FLG	2312	broad.mit.edu	37	1	152284170	152284170	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284170C>T	uc001ezu.1	-	3	3228	c.3192G>A	c.(3190-3192)TGG>TGA	p.W1064*	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1064	Filaggrin 6.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FCRL5	83416	broad.mit.edu	37	1	157497672	157497672	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157497672G>A	uc001fqu.2	-	9	1853	c.1695C>T	c.(1693-1695)CGC>CGT	p.R565R	FCRL5_uc009wsm.2_Silent_p.R565R|FCRL5_uc010phv.1_Silent_p.R565R|FCRL5_uc010phw.1_Silent_p.R480R	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	565	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity	p.R565H(1)		ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)																---	---	---	---
OR10Z1	128368	broad.mit.edu	37	1	158576516	158576516	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158576516C>T	uc010pio.1	+	1	288	c.288C>T	c.(286-288)GGC>GGT	p.G96G		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)																	---	---	---	---
ATP1A4	480	broad.mit.edu	37	1	160129326	160129326	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160129326G>A	uc001fve.3	+						ATP1A4_uc001fvf.3_Intron	NM_144699	NP_653300			Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
ADAMTS4	9507	broad.mit.edu	37	1	161163166	161163166	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161163166C>T	uc001fyt.3	-	7	2176	c.1748G>A	c.(1747-1749)CGC>CAC	p.R583H		NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	583	Cys-rich.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)															---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178411966	178411966	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178411966G>A	uc001glr.2	+	6	765	c.640G>A	c.(640-642)GAA>AAA	p.E214K	RASAL2_uc001glq.2_Missense_Mutation_p.E362K	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	214	C2.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
QSOX1	5768	broad.mit.edu	37	1	180135652	180135652	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180135652G>A	uc001gnz.2	+	2	367	c.292G>A	c.(292-294)GCC>ACC	p.A98T	QSOX1_uc001gny.2_Missense_Mutation_p.A98T|QSOX1_uc001goa.2_Missense_Mutation_p.A98T	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	98	Thioredoxin.				cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PRG4	10216	broad.mit.edu	37	1	186280649	186280649	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186280649A>T	uc001gru.3	+	10	3765	c.3714A>T	c.(3712-3714)GGA>GGT	p.G1238G	PRG4_uc001grt.3_Silent_p.G1197G|PRG4_uc009wyl.2_Silent_p.G1145G|PRG4_uc009wym.2_Silent_p.G1104G|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1238	Hemopexin-like 2.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
F13B	2165	broad.mit.edu	37	1	197009701	197009701	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197009701G>A	uc001gtt.1	-	11	1947	c.1903C>T	c.(1903-1905)CAA>TAA	p.Q635*		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	635	Sushi 10.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
PPFIA4	8497	broad.mit.edu	37	1	203026010	203026010	+	Missense_Mutation	SNP	G	A	A	rs142427146	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203026010G>A	uc001gyz.2	+	6	1414	c.821G>A	c.(820-822)GGC>GAC	p.G274D	PPFIA4_uc009xaj.2_Missense_Mutation_p.G905D|PPFIA4_uc010pqf.1_Missense_Mutation_p.G487D|PPFIA4_uc001gza.2_Missense_Mutation_p.G274D|PPFIA4_uc001gzb.1_5'UTR	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	274					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
ZC3H11A	9877	broad.mit.edu	37	1	203798733	203798733	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203798733G>A	uc001hac.2	+	8	1069	c.453G>A	c.(451-453)ACG>ACA	p.T151T	ZC3H11A_uc001had.2_Silent_p.T151T|ZC3H11A_uc001hae.2_Silent_p.T151T|ZC3H11A_uc001haf.2_Silent_p.T151T|ZC3H11A_uc010pqm.1_Silent_p.T97T|ZC3H11A_uc001hag.1_Silent_p.T151T	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	151							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
CR1	1378	broad.mit.edu	37	1	207737304	207737304	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207737304C>T	uc001hfy.2	+	14	2472	c.2332C>T	c.(2332-2334)CCC>TCC	p.P778S	CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Missense_Mutation_p.P1228S|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	778	Sushi 12.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
SERTAD4	56256	broad.mit.edu	37	1	210415495	210415495	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210415495G>A	uc001hhy.2	+	4	1063	c.884G>A	c.(883-885)GGC>GAC	p.G295D	SERTAD4_uc009xcw.2_Missense_Mutation_p.G295D	NM_019605	NP_062551	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	295							protein binding			ovary(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)														---	---	---	---
DTL	51514	broad.mit.edu	37	1	212220516	212220516	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212220516G>A	uc009xdc.2	+	4	615	c.301G>A	c.(301-303)GTC>ATC	p.V101I	DTL_uc010ptb.1_Missense_Mutation_p.V59I|DTL_uc001hiz.3_5'UTR	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN	denticleless homolog	101	WD 2.				DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
VASH2	79805	broad.mit.edu	37	1	213146075	213146075	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213146075C>T	uc001hjy.2	+	5	855	c.651C>T	c.(649-651)GAC>GAT	p.D217D	VASH2_uc001hjv.2_RNA|VASH2_uc001hjx.2_Silent_p.D152D|VASH2_uc010ptn.1_Silent_p.D113D|VASH2_uc001hjw.2_Silent_p.D173D	NM_001136475	NP_001129947	Q86V25	VASH2_HUMAN	vasohibin 2 isoform 3	217					positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)														---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237804199	237804199	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237804199A>G	uc001hyl.1	+	47	7238	c.7118A>G	c.(7117-7119)GAC>GGC	p.D2373G		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2373	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248458331	248458331	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458331G>A	uc010pzj.1	-	1	550	c.550C>T	c.(550-552)CGT>TGT	p.R184C		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
OR2T34	127068	broad.mit.edu	37	1	248737709	248737709	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737709A>C	uc001iep.1	-	1	350	c.350T>G	c.(349-351)GTT>GGT	p.V117G		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
PQLC3	130814	broad.mit.edu	37	2	11315100	11315100	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11315100T>C	uc002rbc.2	+	6	615	c.482T>C	c.(481-483)ATA>ACA	p.I161T	PQLC3_uc010yjk.1_Intron	NM_152391	NP_689604	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3 precursor	161						integral to membrane					0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)														---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11742628	11742628	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11742628G>A	uc002rbk.1	+	17	2926	c.2626G>A	c.(2626-2628)GAT>AAT	p.D876N	GREB1_uc002rbo.1_Missense_Mutation_p.D510N	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	876						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
C2orf84	653140	broad.mit.edu	37	2	24398452	24398452	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24398452C>T	uc002rfc.2	+						C2orf84_uc010eyc.2_Intron	NM_001040710	NP_001035800			hypothetical protein LOC653140												0																		---	---	---	---
FBXO11	80204	broad.mit.edu	37	2	48046138	48046138	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48046138C>T	uc010fbl.2	-	15	1739	c.1625G>A	c.(1624-1626)AGC>AAC	p.S542N	FBXO11_uc002rwe.2_Missense_Mutation_p.S542N|FBXO11_uc002rwf.2_Missense_Mutation_p.S542N|FBXO11_uc002rwg.1_Missense_Mutation_p.S542N|FBXO11_uc010fbk.2_Missense_Mutation_p.S50N	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1	626	PbH1 11.				ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
MTIF2	4528	broad.mit.edu	37	2	55476523	55476523	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55476523G>A	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369			mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
USP34	9736	broad.mit.edu	37	2	61430387	61430387	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61430387G>A	uc002sbe.2	-	75	9418	c.9396C>T	c.(9394-9396)GAC>GAT	p.D3132D	USP34_uc002sbd.2_Intron	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	3132					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
HSPC159	29094	broad.mit.edu	37	2	64683599	64683599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64683599G>T	uc002scy.3	+	4	728	c.375G>T	c.(373-375)AGG>AGT	p.R125S		NM_014181	NP_054900	Q3ZCW2	LEGL_HUMAN	galectin-related protein	125	Galectin.					intracellular	sugar binding				0																		---	---	---	---
FBXO41	150726	broad.mit.edu	37	2	73491512	73491512	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73491512C>A	uc002sjb.1	-	6	1883	c.1883G>T	c.(1882-1884)CGC>CTC	p.R628L		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	567						intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3																		---	---	---	---
MOGS	7841	broad.mit.edu	37	2	74689823	74689823	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74689823C>T	uc010ffj.2	-	4	1256	c.1093G>A	c.(1093-1095)GCT>ACT	p.A365T	MOGS_uc010ffh.2_Missense_Mutation_p.A90T|MOGS_uc010yrt.1_Missense_Mutation_p.A246T|MOGS_uc010ffi.2_Missense_Mutation_p.A259T	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	365	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0																		---	---	---	---
HTRA2	27429	broad.mit.edu	37	2	74760069	74760069	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74760069G>A	uc002smi.1	+	8	1936	c.1334G>A	c.(1333-1335)CGA>CAA	p.R445Q	HTRA2_uc002smj.1_Missense_Mutation_p.R348Q|HTRA2_uc002smk.1_Missense_Mutation_p.R423Q|HTRA2_uc002sml.1_Missense_Mutation_p.R413Q|HTRA2_uc002smm.1_Missense_Mutation_p.R186Q|HTRA2_uc002smn.1_Missense_Mutation_p.R186Q|LOXL3_uc002smo.1_3'UTR|LOXL3_uc010ffm.1_3'UTR|LOXL3_uc002smp.1_3'UTR|LOXL3_uc002smq.1_3'UTR	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein	445	PDZ.				apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
PTCD3	55037	broad.mit.edu	37	2	86354439	86354439	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86354439G>A	uc002sqw.2	+						PTCD3_uc002sqx.1_Intron	NM_017952	NP_060422			pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1																		---	---	---	---
PROM2	150696	broad.mit.edu	37	2	95954315	95954315	+	Missense_Mutation	SNP	C	T	T	rs35884217	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95954315C>T	uc002suh.1	+	22	2552	c.2419C>T	c.(2419-2421)CGT>TGT	p.R807C	PROM2_uc002sui.2_Missense_Mutation_p.R807C|PROM2_uc002suj.2_Missense_Mutation_p.R461C|PROM2_uc002suk.2_Missense_Mutation_p.R807C|PROM2_uc002sul.2_Missense_Mutation_p.R333C|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	807	Cytoplasmic (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1																		---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97784159	97784159	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97784159G>A	uc010yva.1	+	3	635	c.391G>A	c.(391-393)GGA>AGA	p.G131R	ANKRD36_uc002sxn.2_Missense_Mutation_p.G131R|ANKRD36_uc010yuz.1_RNA|ANKRD36_uc010fic.2_5'UTR|ANKRD36_uc002sxo.2_Missense_Mutation_p.G131R|ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	131	ANK 4.										0																		---	---	---	---
GPR45	11250	broad.mit.edu	37	2	105858611	105858611	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105858611G>A	uc002tco.1	+	1	412	c.296G>A	c.(295-297)CGC>CAC	p.R99H		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	99	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
TGFBRAP1	9392	broad.mit.edu	37	2	105886050	105886050	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105886050C>T	uc002tcq.2	-	11	2169	c.2085G>A	c.(2083-2085)GCG>GCA	p.A695A	TGFBRAP1_uc010fjc.2_Silent_p.A464A|TGFBRAP1_uc002tcr.3_Silent_p.A695A	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	695					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
C2orf40	84417	broad.mit.edu	37	2	106694342	106694342	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106694342G>A	uc010fjf.2	+	4	515	c.407G>A	c.(406-408)GGC>GAC	p.G136D		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	136						extracellular region|transport vesicle					0																		---	---	---	---
TTL	150465	broad.mit.edu	37	2	113277874	113277874	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113277874C>T	uc002thu.2	+	6	1070	c.891C>T	c.(889-891)AGC>AGT	p.S297S	TTL_uc010fkm.1_Intron	NM_153712	NP_714923	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	297	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity				0		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)				T	ETV6	ALL								---	---	---	---
YSK4	80122	broad.mit.edu	37	2	135738842	135738842	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135738842G>A	uc002tue.1	-	9	3500	c.3469C>T	c.(3469-3471)CCA>TCA	p.P1157S	YSK4_uc002tuf.1_Missense_Mutation_p.P339S|YSK4_uc010fnc.1_Missense_Mutation_p.P291S|YSK4_uc010fnd.1_Missense_Mutation_p.P1044S|YSK4_uc010zbg.1_Missense_Mutation_p.P289S|YSK4_uc002tuh.3_Missense_Mutation_p.P885S|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1157	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136473119	136473119	+	Splice_Site	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136473119G>T	uc002tuo.2	+	23	3002	c.2632_splice	c.e23-1	p.H878_splice	R3HDM1_uc010fni.2_Splice_Site_p.H877_splice|R3HDM1_uc002tup.2_Splice_Site_p.H823_splice|R3HDM1_uc010zbh.1_Splice_Site_p.H626_splice	NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
HNMT	3176	broad.mit.edu	37	2	138771371	138771371	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138771371A>G	uc002tvc.2	+	7	698	c.550A>G	c.(550-552)AAA>GAA	p.K184E	HNMT_uc002tvf.2_Missense_Mutation_p.K184E	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1	184					respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)													---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154996962	154996962	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154996962T>C	uc002tyr.3	+	4	822	c.255T>C	c.(253-255)CTT>CTC	p.L85L	GALNT13_uc002tyt.3_Silent_p.L85L|GALNT13_uc010foc.1_5'UTR	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	85	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170101424	170101424	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170101424G>A	uc002ues.2	-	22	3422	c.3209C>T	c.(3208-3210)TCG>TTG	p.S1070L	LRP2_uc010zdf.1_Missense_Mutation_p.S933L	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1070	LDL-receptor class A 9.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
TTC30A	92104	broad.mit.edu	37	2	178482139	178482139	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178482139C>T	uc002ulo.2	-	1	1556	c.1291G>A	c.(1291-1293)GCA>ACA	p.A431T		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	431	TPR 6.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)															---	---	---	---
TTC30A	92104	broad.mit.edu	37	2	178483032	178483032	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178483032C>T	uc002ulo.2	-	1	663	c.398G>A	c.(397-399)AGG>AAG	p.R133K		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	133					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179423360	179423360	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179423360T>G	uc010zfg.1	-	276	79346	c.79122A>C	c.(79120-79122)AAA>AAC	p.K26374N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K20069N|TTN_uc010zfi.1_Missense_Mutation_p.K20002N|TTN_uc010zfj.1_Missense_Mutation_p.K19877N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27301							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179439680	179439680	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179439680G>A	uc010zfg.1	-	275	63699	c.63475C>T	c.(63475-63477)CCA>TCA	p.P21159S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P14854S|TTN_uc010zfi.1_Missense_Mutation_p.P14787S|TTN_uc010zfj.1_Missense_Mutation_p.P14662S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22086							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179447097	179447097	+	Missense_Mutation	SNP	C	T	T	rs72646868		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179447097C>T	uc010zfg.1	-	263	58606	c.58382G>A	c.(58381-58383)CGT>CAT	p.R19461H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R13156H|TTN_uc010zfi.1_Missense_Mutation_p.R13089H|TTN_uc010zfj.1_Missense_Mutation_p.R12964H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20388							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179499969	179499969	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499969T>C	uc010zfg.1	-	177	34467	c.34243A>G	c.(34243-34245)AGC>GGC	p.S11415G	TTN_uc010zfh.1_Missense_Mutation_p.S5110G|TTN_uc010zfi.1_Missense_Mutation_p.S5043G|TTN_uc010zfj.1_Missense_Mutation_p.S4918G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12342							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179501128	179501128	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179501128C>A	uc010zfg.1	-	174	33846	c.33622G>T	c.(33622-33624)GAA>TAA	p.E11208*	TTN_uc010zfh.1_Nonsense_Mutation_p.E4903*|TTN_uc010zfi.1_Nonsense_Mutation_p.E4836*|TTN_uc010zfj.1_Nonsense_Mutation_p.E4711*|TTN_uc010fre.1_Nonsense_Mutation_p.E1069*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12135							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198950517	198950517	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950517C>T	uc010fsp.2	+	2	2567	c.2276C>T	c.(2275-2277)GCG>GTG	p.A759V	PLCL1_uc002uuv.3_Missense_Mutation_p.A680V	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	759	C2.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
ALS2	57679	broad.mit.edu	37	2	202587823	202587823	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202587823G>A	uc002uyo.2	-	23	4001	c.3645C>T	c.(3643-3645)TCC>TCT	p.S1215S	ALS2_uc002uyp.3_Silent_p.S1215S|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	1215	MORN 7.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7																		---	---	---	---
ABI2	10152	broad.mit.edu	37	2	204267383	204267383	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204267383G>A	uc002vaa.2	+	9	1353	c.1118G>A	c.(1117-1119)CGC>CAC	p.R373H	ABI2_uc002uzz.2_Missense_Mutation_p.R306H|ABI2_uc010zih.1_Missense_Mutation_p.R21H|ABI2_uc010zii.1_Missense_Mutation_p.R367H|ABI2_uc010zij.1_Missense_Mutation_p.R250H|ABI2_uc002vab.2_Missense_Mutation_p.R261H|ABI2_uc010zik.1_Missense_Mutation_p.R98H|ABI2_uc010zil.1_Missense_Mutation_p.R208H|ABI2_uc010zim.1_Missense_Mutation_p.R159H|ABI2_uc002vac.2_Missense_Mutation_p.R159H|ABI2_uc010zin.1_Missense_Mutation_p.R21H	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2	373	Pro-rich.				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0																		---	---	---	---
FASTKD2	22868	broad.mit.edu	37	2	207651571	207651571	+	Silent	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207651571T>A	uc002vbu.2	+	8	1952	c.1542T>A	c.(1540-1542)GCT>GCA	p.A514A	FASTKD2_uc002vbv.2_Silent_p.A514A|FASTKD2_uc002vbx.2_Silent_p.A514A|FASTKD2_uc002vbw.1_Silent_p.A514A	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	514					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|skin(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)														---	---	---	---
MREG	55686	broad.mit.edu	37	2	216809668	216809668	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216809668C>T	uc002vfo.2	-	5	859	c.563G>A	c.(562-564)CGA>CAA	p.R188Q	MREG_uc002vfq.2_RNA	NM_018000	NP_060470	Q8N565	MREG_HUMAN	whn-dependent transcript 2	188						apical plasma membrane					0		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)														---	---	---	---
TMEM169	92691	broad.mit.edu	37	2	216964784	216964784	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216964784C>A	uc010zjr.1	+	4	739	c.413C>A	c.(412-414)TCA>TAA	p.S138*	TMEM169_uc010zjs.1_Nonsense_Mutation_p.S138*|TMEM169_uc002vfw.2_Nonsense_Mutation_p.S138*|TMEM169_uc002vfv.3_Nonsense_Mutation_p.S138*	NM_001142310	NP_001135782	Q96HH4	TM169_HUMAN	transmembrane protein 169	138	Extracellular (Potential).					integral to membrane				ovary(1)	1		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218683363	218683363	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218683363G>A	uc002vgt.2	-	24	3778	c.3380C>T	c.(3379-3381)GCC>GTC	p.A1127V	TNS1_uc002vgr.2_Missense_Mutation_p.A1114V|TNS1_uc002vgs.2_Missense_Mutation_p.A1106V|TNS1_uc010zjv.1_Missense_Mutation_p.A1106V	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1127	Ser-rich.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)														---	---	---	---
TTLL4	9654	broad.mit.edu	37	2	219603187	219603187	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219603187C>T	uc002viy.2	+	3	1158	c.788C>T	c.(787-789)CCG>CTG	p.P263L	TTLL4_uc010zkl.1_Missense_Mutation_p.P98L|TTLL4_uc010fvx.2_Missense_Mutation_p.P263L	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	263					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)														---	---	---	---
TRIP12	9320	broad.mit.edu	37	2	230672480	230672480	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230672480G>A	uc002vpw.1	-	16	2405	c.2296C>T	c.(2296-2298)CGT>TGT	p.R766C	TRIP12_uc002vpx.1_Missense_Mutation_p.R814C|TRIP12_uc002vpy.1_Missense_Mutation_p.R469C|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Missense_Mutation_p.R772C	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	766	WWE.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)														---	---	---	---
ECEL1	9427	broad.mit.edu	37	2	233350780	233350780	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233350780C>T	uc002vsv.2	-	2	789	c.584G>A	c.(583-585)CGA>CAA	p.R195Q	ECEL1_uc010fya.1_Missense_Mutation_p.R195Q|ECEL1_uc010fyb.1_5'UTR	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	195	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)														---	---	---	---
CHRNG	1146	broad.mit.edu	37	2	233407735	233407735	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233407735G>A	uc002vsx.1	+	7	769	c.748G>A	c.(748-750)GCC>ACC	p.A250T	CHRNG_uc010fye.1_Missense_Mutation_p.A198T	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	250	Helical; (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)														---	---	---	---
GIGYF2	26058	broad.mit.edu	37	2	233652024	233652024	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233652024C>T	uc002vti.3	+	11	1034	c.697C>T	c.(697-699)CGA>TGA	p.R233*	GIGYF2_uc010zmj.1_Nonsense_Mutation_p.R233*|GIGYF2_uc002vtg.2_Nonsense_Mutation_p.R233*|GIGYF2_uc002vtj.3_Nonsense_Mutation_p.R255*|GIGYF2_uc002vtk.3_Nonsense_Mutation_p.R233*|GIGYF2_uc002vth.3_Nonsense_Mutation_p.R233*|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Nonsense_Mutation_p.R64*	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	233	Arg-rich.				cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)														---	---	---	---
GPC1	2817	broad.mit.edu	37	2	241402004	241402004	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241402004G>A	uc002vyw.3	+							NM_002081	NP_002072			glypican 1 precursor						axon guidance	anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)														---	---	---	---
CAMK1	8536	broad.mit.edu	37	3	9802450	9802450	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9802450A>G	uc003bst.2	-	8	813	c.635T>C	c.(634-636)CTC>CCC	p.L212P	OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA|CAMK1_uc003bss.2_5'Flank|uc003bsv.1_RNA	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	212	Protein kinase.				cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)														---	---	---	---
CAND2	23066	broad.mit.edu	37	3	12858445	12858445	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12858445A>G	uc003bxk.2	+	10	2063	c.2014A>G	c.(2014-2016)ACA>GCA	p.T672A	CAND2_uc003bxj.2_Missense_Mutation_p.T579A	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	672	HEAT 14.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4																		---	---	---	---
C3orf20	84077	broad.mit.edu	37	3	14744719	14744719	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14744719C>T	uc003byy.2	+	6	1232	c.828C>T	c.(826-828)AGC>AGT	p.S276S	C3orf20_uc003byz.2_Silent_p.S154S|C3orf20_uc003bza.2_Silent_p.S154S|C3orf20_uc003byx.1_Silent_p.S276S	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	276						cytoplasm|integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16237382	16237382	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16237382C>T	uc003car.3	+	2	1130	c.655C>T	c.(655-657)CCC>TCC	p.P219S	GALNTL2_uc003caq.3_5'UTR	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	219	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17208253	17208253	+	Intron	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17208253C>A	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20113953	20113953	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20113953T>C	uc003cbq.2	+	2	876	c.430_splice	c.e2+2	p.A144_splice		NM_003884	NP_003875			K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
GPD1L	23171	broad.mit.edu	37	3	32181857	32181857	+	Silent	SNP	C	T	T	rs139369157	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32181857C>T	uc003cew.2	+	4	564	c.504C>T	c.(502-504)ATC>ATT	p.I168I		NM_015141	NP_055956	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	168					glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity				0																		---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38592731	38592731	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592731G>A	uc003cio.2	-	28	5326	c.5132C>T	c.(5131-5133)GCC>GTC	p.A1711V	SCN5A_uc003cin.2_Missense_Mutation_p.A1710V|SCN5A_uc003cil.3_Missense_Mutation_p.A1711V|SCN5A_uc010hhi.2_Missense_Mutation_p.A1693V|SCN5A_uc010hhk.2_Missense_Mutation_p.A1678V|SCN5A_uc011ayr.1_Missense_Mutation_p.A1657V	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1711					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
XIRP1	165904	broad.mit.edu	37	3	39227701	39227701	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39227701C>T	uc003cjk.1	-	2	3457	c.3236G>A	c.(3235-3237)GGC>GAC	p.G1079D	XIRP1_uc003cji.2_Missense_Mutation_p.G1079D|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1079							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)														---	---	---	---
RPL14	9045	broad.mit.edu	37	3	40499484	40499484	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40499484T>C	uc003ckg.2	+	2	156	c.105_splice	c.e2+2	p.R35_splice	RPL14_uc003ckh.2_Splice_Site_p.R35_splice|RPL14_uc003cki.2_Splice_Site	NM_003973	NP_003964			ribosomal protein L14						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)														---	---	---	---
EXOSC7	23016	broad.mit.edu	37	3	45038710	45038710	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45038710G>A	uc003coi.2	+	4	415	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	EXOSC7_uc003coh.1_Missense_Mutation_p.R64Q|EXOSC7_uc011bae.1_Missense_Mutation_p.R129Q|EXOSC7_uc010his.1_Missense_Mutation_p.R48Q|EXOSC7_uc003coj.2_Missense_Mutation_p.R129Q	NM_015004	NP_055819	Q15024	EXOS7_HUMAN	exosome component 7	129					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48602300	48602300	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48602300A>G	uc003ctz.2	-	117	8735	c.8734T>C	c.(8734-8736)TGT>CGT	p.C2912R	UCN2_uc003cty.1_5'Flank	NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2912	Nonhelical region (NC2).|BPTI/Kunitz inhibitor.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
RHOA	387	broad.mit.edu	37	3	49412922	49412922	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49412922T>C	uc003cwu.2	-	2	377	c.101A>G	c.(100-102)TAT>TGT	p.Y34C	RHOA_uc010hku.2_5'UTR	NM_001664	NP_001655	P61586	RHOA_HUMAN	ras homolog gene family, member A precursor	34	Effector region (Potential).			Y->F: Abolishes AMPylation by Haemophilus IbpA.|Y->A: Abolishes interaction with DGKQ.	axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
CDHR4	389118	broad.mit.edu	37	3	49836453	49836453	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49836453T>C	uc010hkz.2	-	3	386	c.377A>G	c.(376-378)CAG>CGG	p.Q126R	CDHR4_uc003cxp.2_Missense_Mutation_p.Q126R|CDHR4_uc011bcw.1_Missense_Mutation_p.Q126R	NM_001007540	NP_001007541	A6H8M9	CDHR4_HUMAN	cadherin-like 29 precursor	126	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51196730	51196730	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51196730G>A	uc011bds.1	+	11	907	c.884G>A	c.(883-885)CGA>CAA	p.R295Q		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	295						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52649388	52649388	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649388C>T	uc003des.2	-	15	1915	c.1903G>A	c.(1903-1905)GCT>ACT	p.A635T	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.A635T|PBRM1_uc003der.2_Missense_Mutation_p.A603T|PBRM1_uc003det.2_Missense_Mutation_p.A650T|PBRM1_uc003deu.2_Missense_Mutation_p.A650T|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.A635T|PBRM1_uc010hmk.1_Missense_Mutation_p.A635T|PBRM1_uc003dey.2_Missense_Mutation_p.A635T|PBRM1_uc003dez.1_Missense_Mutation_p.A635T|PBRM1_uc003dfb.1_Missense_Mutation_p.A548T|PBRM1_uc003dfc.2_Missense_Mutation_p.A2T	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	635					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
TMEM110	375346	broad.mit.edu	37	3	52883877	52883877	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52883877C>T	uc003dge.2	-	4	439	c.358G>A	c.(358-360)GTG>ATG	p.V120M	TMEM110_uc003dgc.3_Missense_Mutation_p.V120M	NM_198563	NP_940965	Q86TL2	TM110_HUMAN	transmembrane protein 110	120	Helical; (Potential).					integral to membrane				large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)														---	---	---	---
CACNA1D	776	broad.mit.edu	37	3	53700399	53700399	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53700399C>T	uc003dgv.3	+	7	1116	c.953C>T	c.(952-954)GCG>GTG	p.A318V	CACNA1D_uc003dgu.3_Missense_Mutation_p.A318V|CACNA1D_uc003dgy.3_Missense_Mutation_p.A318V|CACNA1D_uc003dgw.3_5'UTR	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	318	Extracellular (Potential).|I.				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)													---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56044541	56044541	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56044541C>T	uc003dhr.1	-	9	2112	c.1856G>A	c.(1855-1857)CGA>CAA	p.R619Q	ERC2_uc003dht.1_Missense_Mutation_p.R90Q	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	619	Potential.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ATXN7	6314	broad.mit.edu	37	3	63965643	63965643	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63965643A>G	uc003dlw.3	+	6	1105	c.552A>G	c.(550-552)TCA>TCG	p.S184S	ATXN7_uc003dlv.2_Silent_p.S184S|ATXN7_uc010hnv.2_Silent_p.S184S|ATXN7_uc010hnw.2_Silent_p.S39S|ATXN7_uc011bfn.1_Silent_p.S39S	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	184	Ser-rich.				cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)														---	---	---	---
PDZRN3	23024	broad.mit.edu	37	3	73433966	73433966	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433966G>T	uc003dpl.1	-	10	1847	c.1751C>A	c.(1750-1752)TCG>TAG	p.S584*	PDZRN3_uc011bgh.1_Nonsense_Mutation_p.S241*|PDZRN3_uc010hoe.1_Nonsense_Mutation_p.S282*|PDZRN3_uc011bgf.1_Nonsense_Mutation_p.S301*|PDZRN3_uc011bgg.1_Nonsense_Mutation_p.S304*	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	584							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)														---	---	---	---
CNTN3	5067	broad.mit.edu	37	3	74474047	74474047	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74474047G>A	uc003dpm.1	-	4	483	c.403C>T	c.(403-405)CGT>TGT	p.R135C		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	135	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78649287	78649287	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78649287T>C	uc003dqe.2	-	30	5125	c.4917A>G	c.(4915-4917)GGA>GGG	p.G1639G	ROBO1_uc003dqb.2_Silent_p.G1600G|ROBO1_uc003dqc.2_Silent_p.G1539G|ROBO1_uc003dqd.2_Silent_p.G1594G|ROBO1_uc010hoh.2_Silent_p.G831G	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1639	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96962894	96962894	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96962894C>G	uc010how.1	+	5	1412	c.1369C>G	c.(1369-1371)CTC>GTC	p.L457V	EPHA6_uc003drp.1_Missense_Mutation_p.L457V	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	362	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
OR5AC2	81050	broad.mit.edu	37	3	97806749	97806749	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806749G>A	uc011bgs.1	+	1	733	c.733G>A	c.(733-735)GCC>ACC	p.A245T		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
HHLA2	11148	broad.mit.edu	37	3	108072517	108072517	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108072517A>G	uc003dwy.3	+	4	475	c.308A>G	c.(307-309)AAT>AGT	p.N103S	HHLA2_uc011bhl.1_Intron|HHLA2_uc010hpu.2_Missense_Mutation_p.N103S|HHLA2_uc003dwz.2_Missense_Mutation_p.N103S	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	103	Ig-like V-type 1.					integral to membrane				ovary(1)	1																		---	---	---	---
KIAA1524	57650	broad.mit.edu	37	3	108298166	108298166	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108298166A>T	uc003dxb.3	-	7	1049	c.780T>A	c.(778-780)GAT>GAA	p.D260E	KIAA1524_uc003dxc.1_Missense_Mutation_p.D101E|KIAA1524_uc010hpw.1_Missense_Mutation_p.D101E	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	260						cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108407750	108407750	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108407750C>A	uc003dxd.2	+	31	3917	c.3495C>A	c.(3493-3495)TGC>TGA	p.C1165*	DZIP3_uc003dxf.1_Nonsense_Mutation_p.C1165*|DZIP3_uc011bhm.1_Nonsense_Mutation_p.C616*	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	1165	RING-type; atypical.				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CCDC80	151887	broad.mit.edu	37	3	112324517	112324517	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112324517A>C	uc003dzf.2	-	8	2818	c.2600T>G	c.(2599-2601)CTT>CGT	p.L867R	CCDC80_uc011bhv.1_Missense_Mutation_p.L840R|CCDC80_uc003dzg.2_Missense_Mutation_p.L867R	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	867										ovary(2)	2																		---	---	---	---
SIDT1	54847	broad.mit.edu	37	3	113320434	113320434	+	Splice_Site	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113320434G>T	uc003eak.2	+	11	1697	c.1046_splice	c.e11-1	p.G349_splice	SIDT1_uc011bif.1_Splice_Site|SIDT1_uc003eaj.1_Splice_Site_p.G349_splice|SIDT1_uc011big.1_Splice_Site_p.G102_splice|SIDT1_uc011bih.1_5'Flank	NM_017699	NP_060169			SID1 transmembrane family, member 1 precursor							integral to membrane				ovary(3)|pancreas(1)|skin(1)	5																		---	---	---	---
SLC12A8	84561	broad.mit.edu	37	3	124829094	124829094	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124829094C>T	uc003ehv.3	-	9	1109	c.998G>A	c.(997-999)CGC>CAC	p.R333H	SLC12A8_uc003ehw.3_Missense_Mutation_p.R362H|SLC12A8_uc003eht.3_Missense_Mutation_p.R134H|SLC12A8_uc003ehu.3_Missense_Mutation_p.R86H|SLC12A8_uc010hry.2_Missense_Mutation_p.R86H	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	333					potassium ion transport	integral to membrane	symporter activity				0																		---	---	---	---
TF	7018	broad.mit.edu	37	3	133486949	133486949	+	Silent	SNP	C	T	T	rs34657694		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133486949C>T	uc003epu.1	+	18	3291	c.1563C>T	c.(1561-1563)GGC>GGT	p.G521G	TF_uc011blt.1_Silent_p.G394G|TF_uc003epw.1_Intron|TF_uc003epv.1_Silent_p.G521G	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	521	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)													---	---	---	---
CHST2	9435	broad.mit.edu	37	3	142840554	142840554	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142840554G>A	uc003evm.2	+	2	1785	c.896G>A	c.(895-897)CGC>CAC	p.R299H		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	299	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3																		---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149290705	149290705	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149290705C>T	uc003exe.2	-	2	530	c.514G>A	c.(514-516)GTC>ATC	p.V172I	WWTR1_uc003exf.2_Missense_Mutation_p.V172I|WWTR1_uc011bns.1_Missense_Mutation_p.V172I|WWTR1_uc003exh.2_Missense_Mutation_p.V172I	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	172					hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
FAM194A	131831	broad.mit.edu	37	3	150403619	150403619	+	Silent	SNP	G	A	A	rs149996868		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150403619G>A	uc003eyg.2	-	6	750	c.693C>T	c.(691-693)TTC>TTT	p.F231F	FAM194A_uc003eyh.2_Silent_p.F85F	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831	231										skin(2)|ovary(1)	3																		---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155199080	155199080	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199080G>A	uc011bok.1	-	23	5036	c.4759C>T	c.(4759-4761)CGC>TGC	p.R1587C	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.R1549C	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1587					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155203278	155203278	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203278G>A	uc011bok.1	-	22	3142	c.2865C>T	c.(2863-2865)GGC>GGT	p.G955G	PLCH1_uc011boj.1_Silent_p.G955G|PLCH1_uc011bol.1_Silent_p.G917G	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	955					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
TNFSF10	8743	broad.mit.edu	37	3	172241098	172241098	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172241098A>C	uc003fid.2	-	1	172	c.77T>G	c.(76-78)CTG>CGG	p.L26R	TNFSF10_uc003fie.2_Missense_Mutation_p.L26R|TNFSF10_uc010hwu.1_RNA	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	26	Helical; Signal-anchor for type II membrane protein; (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	G	G	rs121913274		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936092A>G	uc003fjk.2	+	10	1791	c.1634A>G	c.(1633-1635)GAG>GGG	p.E545G		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545A(AGS_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
USP13	8975	broad.mit.edu	37	3	179478997	179478997	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179478997C>T	uc003fkh.2	+	17	2127	c.2046C>T	c.(2044-2046)GGC>GGT	p.G682G		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	682	UBA 1.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
EIF4G1	1981	broad.mit.edu	37	3	184038434	184038434	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184038434C>T	uc003fnp.2	+	8	752	c.554C>T	c.(553-555)CCA>CTA	p.P185L	EIF4G1_uc003fno.1_Missense_Mutation_p.P126L|EIF4G1_uc010hxw.1_Missense_Mutation_p.P21L|EIF4G1_uc003fnt.2_5'UTR|EIF4G1_uc003fnq.2_Missense_Mutation_p.P98L|EIF4G1_uc003fnr.2_Missense_Mutation_p.P21L|EIF4G1_uc010hxx.2_Missense_Mutation_p.P192L|EIF4G1_uc003fns.2_Missense_Mutation_p.P145L|EIF4G1_uc010hxy.2_Missense_Mutation_p.P192L|EIF4G1_uc010hxz.1_Missense_Mutation_p.P98L|EIF4G1_uc003fnv.3_Missense_Mutation_p.P185L|EIF4G1_uc003fnu.3_Missense_Mutation_p.P185L|EIF4G1_uc003fnw.2_Missense_Mutation_p.P192L|EIF4G1_uc003fnx.2_5'UTR|EIF4G1_uc003fny.3_5'UTR	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	185	PABPC1-binding.			DPNQ->AAAA: Loss of PABPC1 binding; when associated with 174-AAAAA-178.	insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
EIF4G1	1981	broad.mit.edu	37	3	184044360	184044360	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184044360C>T	uc003fnp.2	+	22	3466	c.3268C>T	c.(3268-3270)CGA>TGA	p.R1090*	EIF4G1_uc003fnt.2_Nonsense_Mutation_p.R801*|EIF4G1_uc003fnq.2_Nonsense_Mutation_p.R1003*|EIF4G1_uc003fnr.2_Nonsense_Mutation_p.R926*|EIF4G1_uc010hxx.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fns.2_Nonsense_Mutation_p.R1050*|EIF4G1_uc010hxy.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fnv.3_Nonsense_Mutation_p.R1091*|EIF4G1_uc003fnu.3_Nonsense_Mutation_p.R1090*|EIF4G1_uc003fnw.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fnx.2_Nonsense_Mutation_p.R895*|EIF4G1_uc003fny.3_Nonsense_Mutation_p.R894*|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1090					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
EPHB3	2049	broad.mit.edu	37	3	184297328	184297328	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184297328G>A	uc003foz.2	+	10	2302	c.1865G>A	c.(1864-1866)CGG>CAG	p.R622Q		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	622	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)															---	---	---	---
TP63	8626	broad.mit.edu	37	3	189604248	189604248	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189604248T>C	uc003fry.2	+	11	1504	c.1415T>C	c.(1414-1416)ATG>ACG	p.M472T	TP63_uc003frz.2_Missense_Mutation_p.M472T|TP63_uc010hzc.1_Missense_Mutation_p.M472T|TP63_uc003fsc.2_Missense_Mutation_p.M378T|TP63_uc003fsd.2_Missense_Mutation_p.M378T|TP63_uc010hzd.1_Missense_Mutation_p.M293T	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	472					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
LRRC15	131578	broad.mit.edu	37	3	194081221	194081221	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194081221G>A	uc003ftu.2	-	2	638	c.552C>T	c.(550-552)AGC>AGT	p.S184S	LRRC15_uc003ftt.2_Silent_p.S190S	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	184	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195480005	195480005	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195480005T>C	uc011bto.1	-	21	15501	c.15041A>G	c.(15040-15042)CAG>CGG	p.Q5014R	MUC4_uc010hzq.2_5'UTR|MUC4_uc003fuz.2_Missense_Mutation_p.Q740R|MUC4_uc003fva.2_Missense_Mutation_p.Q622R|MUC4_uc003fvb.2_Missense_Mutation_p.Q658R|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.Q658R|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.Q622R|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.Q706R|MUC4_uc011bti.1_Missense_Mutation_p.Q706R|MUC4_uc011btj.1_Missense_Mutation_p.Q883R|MUC4_uc011btk.1_Missense_Mutation_p.Q622R|MUC4_uc011btl.1_Missense_Mutation_p.Q651R|MUC4_uc011btm.1_Missense_Mutation_p.Q831R|MUC4_uc011btn.1_Missense_Mutation_p.Q622R|MUC4_uc003fvo.2_Missense_Mutation_p.Q906R|MUC4_uc003fvp.2_Missense_Mutation_p.Q855R	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1899	EGF-like 1.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
KIAA1530	57654	broad.mit.edu	37	4	1343557	1343557	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1343557G>A	uc003gde.3	+	3	791	c.344G>A	c.(343-345)CGG>CAG	p.R115Q		NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	115											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)															---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6080672	6080672	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6080672C>T	uc003giu.3	-	8	1572	c.1296G>A	c.(1294-1296)CCG>CCA	p.P432P	JAKMIP1_uc010idb.1_Silent_p.P432P|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Silent_p.P432P|JAKMIP1_uc011bwc.1_Silent_p.P267P|JAKMIP1_uc003giv.3_Silent_p.P432P|JAKMIP1_uc010ide.2_Silent_p.P432P	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	432	Mediates interaction with TYK2 and GABBR1.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
CPZ	8532	broad.mit.edu	37	4	8613861	8613861	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8613861C>T	uc003glm.2	+	8	1461	c.1335C>T	c.(1333-1335)AAC>AAT	p.N445N	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.N308N|CPZ_uc003glo.2_Silent_p.N434N|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	445					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
SEL1L3	23231	broad.mit.edu	37	4	25849011	25849011	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25849011C>T	uc003gru.3	-	2	790	c.638G>A	c.(637-639)CGC>CAC	p.R213H		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	213						integral to membrane	binding				0																		---	---	---	---
GRXCR1	389207	broad.mit.edu	37	4	42965093	42965093	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42965093G>A	uc003gwt.2	+	2	569	c.569G>A	c.(568-570)CGA>CAA	p.R190Q		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	190	Glutaredoxin.				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
ATP10D	57205	broad.mit.edu	37	4	47593216	47593216	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47593216T>A	uc003gxk.1	+	23	4263	c.4099T>A	c.(4099-4101)TCA>ACA	p.S1367T	ATP10D_uc003gxl.1_Missense_Mutation_p.S615T	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1367	Cytoplasmic (Potential).|ATP (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3																		---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48545898	48545898	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48545898G>C	uc003gyh.1	-	44	6123	c.5518C>G	c.(5518-5520)CTC>GTC	p.L1840V	FRYL_uc003gyg.1_Missense_Mutation_p.L536V|FRYL_uc003gyi.1_Missense_Mutation_p.L728V|FRYL_uc003gyj.1_Missense_Mutation_p.L135V	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1840					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
SRD5A3	79644	broad.mit.edu	37	4	56233814	56233814	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56233814A>G	uc003hau.2	+	4	717	c.622A>G	c.(622-624)ATG>GTG	p.M208V	uc003hav.1_Intron|uc003haw.1_Intron	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	208	Helical; (Potential).				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)															---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62445335	62445335	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62445335T>C	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62845287	62845287	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62845287G>T	uc010ihh.2	+	15	2781	c.2608G>T	c.(2608-2610)GAT>TAT	p.D870Y	LPHN3_uc003hcq.3_Missense_Mutation_p.D870Y|LPHN3_uc003hct.2_Missense_Mutation_p.D263Y	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	857	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
BMP2K	55589	broad.mit.edu	37	4	79832739	79832739	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79832739G>A	uc003hlk.2	+	16	3204	c.3038G>A	c.(3037-3039)CGC>CAC	p.R1013H	PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|uc010ijm.1_5'Flank	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	1013						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1																		---	---	---	---
AFF1	4299	broad.mit.edu	37	4	88035905	88035905	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88035905C>T	uc003hqj.3	+	11	2306	c.1899C>T	c.(1897-1899)GGC>GGT	p.G633G	AFF1_uc011ccz.1_Silent_p.G640G|AFF1_uc003hqk.3_Silent_p.G633G|AFF1_uc011cda.1_Silent_p.G271G	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	633						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
DSPP	1834	broad.mit.edu	37	4	88535421	88535421	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88535421A>G	uc003hqu.2	+	5	1727	c.1607A>G	c.(1606-1608)GAC>GGC	p.D536G		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	536	Asp/Ser-rich.				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)														---	---	---	---
UGT8	7368	broad.mit.edu	37	4	115544174	115544174	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115544174C>T	uc003ibs.2	+	2	660	c.138C>T	c.(136-138)CAC>CAT	p.H46H	UGT8_uc003ibt.2_Silent_p.H46H|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	46					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)														---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119176867	119176867	+	Nonstop_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119176867G>T	uc003ibx.2	+	14	3025	c.2622G>T	c.(2620-2622)TAG>TAT	p.*874Y		NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	874						Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123229133	123229133	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123229133G>A	uc003ieh.2	+	56	9916	c.9871G>A	c.(9871-9873)GCC>ACC	p.A3291T	KIAA1109_uc003iel.1_Missense_Mutation_p.A1226T	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3291					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126389938	126389938	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126389938A>T	uc003ifj.3	+	11	12171	c.12171A>T	c.(12169-12171)GGA>GGT	p.G4057G	FAT4_uc011cgp.1_Silent_p.G2320G|FAT4_uc003ifi.1_Silent_p.G1535G	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4057	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
POU4F2	5458	broad.mit.edu	37	4	147561536	147561536	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147561536G>A	uc003ikv.2	+	2	1054	c.806G>A	c.(805-807)CGC>CAC	p.R269H		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	269	POU-specific.				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)																	---	---	---	---
SFRP2	6423	broad.mit.edu	37	4	154709838	154709838	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154709838G>A	uc003inv.1	-	1	391	c.150C>T	c.(148-150)TGC>TGT	p.C50C		NM_003013	NP_003004	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2 precursor	50	FZ.				brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)																---	---	---	---
KLHL2	11275	broad.mit.edu	37	4	166159922	166159922	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166159922T>C	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron	NM_007246	NP_009177			kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)														---	---	---	---
DDX60	55601	broad.mit.edu	37	4	169227857	169227857	+	Silent	SNP	C	T	T	rs140161501		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169227857C>T	uc003irp.2	-	5	571	c.279G>A	c.(277-279)GCG>GCA	p.A93A		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	93							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)														---	---	---	---
C4orf41	60684	broad.mit.edu	37	4	184622881	184622881	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184622881A>G	uc003ivx.2	+	26	3059	c.2883A>G	c.(2881-2883)GAA>GAG	p.E961E	C4orf41_uc003ivw.2_Silent_p.E961E|C4orf41_uc010isc.2_Silent_p.E305E|C4orf41_uc003ivy.2_Silent_p.E567E	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	961											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)														---	---	---	---
LPCAT1	79888	broad.mit.edu	37	5	1489881	1489881	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1489881A>G	uc003jcm.2	-	4	703	c.586T>C	c.(586-588)TCC>CCC	p.S196P		NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	196	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)														---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19571802	19571802	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19571802G>C	uc003jgc.2	-	7	1516	c.1139C>G	c.(1138-1140)CCA>CGA	p.P380R	CDH18_uc003jgd.2_Missense_Mutation_p.P380R|CDH18_uc011cnm.1_Missense_Mutation_p.P380R	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	380	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
RXFP3	51289	broad.mit.edu	37	5	33938026	33938026	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33938026G>A	uc003jic.1	+	1	1538	c.1181G>A	c.(1180-1182)CGC>CAC	p.R394H		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	394	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
UGT3A2	167127	broad.mit.edu	37	5	36049272	36049272	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36049272G>A	uc003jjz.1	-	4	655	c.562C>T	c.(562-564)CGT>TGT	p.R188C	UGT3A2_uc011cos.1_Missense_Mutation_p.R154C|UGT3A2_uc011cot.1_Intron	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	188	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	37006531	37006531	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37006531G>A	uc003jkl.3	+	17	4427	c.3928G>A	c.(3928-3930)GCT>ACT	p.A1310T	NIPBL_uc003jkk.3_Missense_Mutation_p.A1310T	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1310					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
NUP155	9631	broad.mit.edu	37	5	37314427	37314427	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37314427G>T	uc003jku.1	-	22	2427	c.2309C>A	c.(2308-2310)GCT>GAT	p.A770D	NUP155_uc003jkt.1_Missense_Mutation_p.A711D|NUP155_uc010iuz.1_Missense_Mutation_p.A770D	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	770					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
CARTPT	9607	broad.mit.edu	37	5	71016450	71016450	+	3'UTR	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71016450T>C	uc003kbv.1	+	3						NM_004291	NP_004282			cocaine- and amphetamine-regulated transcript						activation of MAPKK activity|adult feeding behavior|cellular glucose homeostasis|cellular response to starvation|circadian regulation of gene expression|negative regulation of appetite|negative regulation of bone resorption|negative regulation of osteoclast differentiation|neuropeptide signaling pathway|positive regulation of blood pressure|positive regulation of epinephrine secretion|positive regulation of transmission of nerve impulse|synaptic transmission	extracellular space				ovary(1)	1		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)													---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73205302	73205302	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73205302C>T	uc011csq.1	+	33	4238	c.4227C>T	c.(4225-4227)GGC>GGT	p.G1409G	RGNEF_uc003kcx.2_Silent_p.G1409G|RGNEF_uc010izf.2_Silent_p.G1409G|RGNEF_uc011csr.1_Silent_p.G1096G|RGNEF_uc003kcz.3_Silent_p.G373G|RGNEF_uc003kda.3_Silent_p.G329G	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	1409					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
F2RL2	2151	broad.mit.edu	37	5	75914009	75914009	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75914009C>T	uc003kem.2	-	2	708	c.523G>A	c.(523-525)GGC>AGC	p.G175S	IQGAP2_uc003kek.2_Intron|IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron|F2RL2_uc011csw.1_Missense_Mutation_p.G153S	NM_004101	NP_004092	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	175	Helical; Name=3; (Potential).				platelet activation	extracellular region|integral to plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|thrombin receptor activity			skin(2)|ovary(1)	3		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90074728	90074728	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90074728G>A	uc003kju.2	+	64	12992	c.12896G>A	c.(12895-12897)CGA>CAA	p.R4299Q	GPR98_uc003kjt.2_Missense_Mutation_p.R2005Q|GPR98_uc003kjw.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4299	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
NR2F1	7025	broad.mit.edu	37	5	92921019	92921019	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92921019A>G	uc003kkj.2	+	1	1977	c.290A>G	c.(289-291)CAC>CGC	p.H97R		NM_005654	NP_005645	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	97	NR C4-type.|Nuclear receptor.				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			urinary_tract(1)|ovary(1)|lung(1)	3		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)														---	---	---	---
LNPEP	4012	broad.mit.edu	37	5	96341852	96341852	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96341852G>A	uc003kmv.1	+	10	2375	c.1861G>A	c.(1861-1863)GTT>ATT	p.V621I	LNPEP_uc003kmw.1_Missense_Mutation_p.V607I	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	621	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)														---	---	---	---
AQPEP	206338	broad.mit.edu	37	5	115339034	115339034	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115339034T>C	uc003kro.2	+	12	2158	c.1994T>C	c.(1993-1995)TTA>TCA	p.L665S	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	665	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0																		---	---	---	---
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905707	139905707	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905707G>A	uc003lfs.1	+	26	4743	c.4619G>A	c.(4618-4620)AGC>AAC	p.S1540N	ANKHD1_uc003lfr.2_Missense_Mutation_p.S1540N|ANKHD1_uc003lfu.1_Missense_Mutation_p.S1020N|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.S279N|ANKHD1_uc003lfw.2_Missense_Mutation_p.S178N|ANKHD1_uc010jfl.2_5'UTR|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1540						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139909045	139909045	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139909045G>T	uc003lfs.1	+	29	6638	c.6514G>T	c.(6514-6516)GGC>TGC	p.G2172C	ANKHD1_uc003lfr.2_Missense_Mutation_p.G2172C|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.G911C|ANKHD1_uc003lfw.2_Missense_Mutation_p.G810C|ANKHD1_uc010jfl.2_Missense_Mutation_p.G607C|ANKHD1-EIF4EBP3_uc003lfx.1_Missense_Mutation_p.G309C	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	2172						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
IK	3550	broad.mit.edu	37	5	140039372	140039372	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140039372C>A	uc003lgq.2	+	14	1337	c.1227C>A	c.(1225-1227)TCC>TCA	p.S409S		NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein	409					cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB6	56130	broad.mit.edu	37	5	140531705	140531705	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531705C>T	uc003lir.2	+	1	1867	c.1867C>T	c.(1867-1869)CGC>TGC	p.R623C	PCDHB6_uc011dah.1_Missense_Mutation_p.R487C	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	623	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
FBXO38	81545	broad.mit.edu	37	5	147803681	147803681	+	Splice_Site	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147803681G>A	uc003lpf.1	+	13	1858	c.1738_splice	c.e13+1	p.G580_splice	FBXO38_uc003lpg.1_Splice_Site_p.G580_splice|FBXO38_uc003lph.2_Splice_Site_p.G580_splice	NM_205836	NP_995308			F-box protein 38 isoform b							cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
FABP6	2172	broad.mit.edu	37	5	159659135	159659135	+	Missense_Mutation	SNP	G	A	A	rs17856662		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159659135G>A	uc003lya.1	+	2	226	c.98G>A	c.(97-99)CGC>CAC	p.R33H	FABP6_uc003lxx.1_Missense_Mutation_p.R82H|FABP6_uc003lxz.1_Missense_Mutation_p.R82H	NM_001445	NP_001436	P51161	FABP6_HUMAN	gastrotropin isoform 2	33					bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
GABRG2	2566	broad.mit.edu	37	5	161578728	161578728	+	Intron	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161578728A>C	uc003lyz.3	+						GABRG2_uc010jjc.2_Intron|GABRG2_uc003lyy.3_Intron|GABRG2_uc011dej.1_Intron	NM_000816	NP_000807			gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)														---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169174437	169174437	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169174437T>A	uc003maf.2	+	23	2385	c.2305T>A	c.(2305-2307)TCC>ACC	p.S769T	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.S261T	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	769					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170336775	170336775	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170336775T>C	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron|RANBP17_uc003maw.2_Silent_p.S200S|RANBP17_uc011dew.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
UIMC1	51720	broad.mit.edu	37	5	176333041	176333041	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176333041G>A	uc011dfp.1	-	14	2087	c.1920C>T	c.(1918-1920)GAC>GAT	p.D640D	UIMC1_uc003mfc.1_Silent_p.D517D|UIMC1_uc003mfd.1_Silent_p.D270D	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	640					double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	177482894	177482894	+	IGR	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177482894G>T								FAM153C (6806 upstream) : N4BP3 (57662 downstream)																																			---	---	---	---
FOXF2	2295	broad.mit.edu	37	6	1391336	1391336	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1391336C>A	uc003mtm.2	+	1	1268	c.1154C>A	c.(1153-1155)GCT>GAT	p.A385D	FOXF2_uc003mtn.2_Missense_Mutation_p.A385D	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2	385					epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)														---	---	---	---
F13A1	2162	broad.mit.edu	37	6	6266932	6266932	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6266932G>A	uc003mwv.2	-	4	553	c.430C>T	c.(430-432)CGG>TGG	p.R144W	F13A1_uc011dib.1_Missense_Mutation_p.R81W	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	144					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---
HIVEP1	3096	broad.mit.edu	37	6	12122709	12122709	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12122709G>A	uc003nac.2	+	4	2860	c.2681G>A	c.(2680-2682)CGT>CAT	p.R894H	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	894					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)																---	---	---	---
GFOD1	54438	broad.mit.edu	37	6	13486905	13486905	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13486905G>A	uc003nat.1	-	1	883	c.218C>T	c.(217-219)CCG>CTG	p.P73L	GFOD1_uc003nas.1_5'Flank|C6orf114_uc003nav.2_5'Flank	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	73						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)															---	---	---	---
TRIM26	7726	broad.mit.edu	37	6	30166571	30166571	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30166571G>A	uc003npr.2	-	3	519	c.310C>T	c.(310-312)CGA>TGA	p.R104*	TRIM26_uc003nps.2_Nonsense_Mutation_p.R104*|TRIM26_uc010jry.2_5'UTR|TRIM26_uc003npt.2_Nonsense_Mutation_p.R104*|TRIM26_uc003npu.1_Nonsense_Mutation_p.R104*	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	104	B box-type.						DNA binding|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
MDC1	9656	broad.mit.edu	37	6	30670948	30670948	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30670948C>T	uc003nrg.3	-	12	6238	c.5798G>A	c.(5797-5799)CGG>CAG	p.R1933Q	MDC1_uc003nrf.3_Missense_Mutation_p.R564Q	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1933	BRCT 1.|Required for nuclear localization (NLS2).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4													Other_conserved_DNA_damage_response_genes					---	---	---	---
HLA-DPB1	3115	broad.mit.edu	37	6	33052994	33052994	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33052994T>C	uc003ocu.1	+	3	691	c.632T>C	c.(631-633)GTC>GCC	p.V211A	HLA-DPB1_uc011dqo.1_RNA|HLA-DPB1_uc011dqp.1_Missense_Mutation_p.V210A|HLA-DPB1_uc011dqq.1_Missense_Mutation_p.V107A	NM_002121	NP_002112	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP	211	Beta-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex				ovary(1)	1																		---	---	---	---
ZBTB22	9278	broad.mit.edu	37	6	33283621	33283621	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33283621A>G	uc003oeb.2	-	2	1225	c.1073T>C	c.(1072-1074)ATA>ACA	p.I358T	TAPBP_uc003odx.1_5'Flank|TAPBP_uc010jus.1_5'Flank|TAPBP_uc003ody.2_5'Flank|TAPBP_uc003odz.2_5'Flank|TAPBP_uc010jut.1_5'Flank|TAPBP_uc011drc.1_5'Flank|ZBTB22_uc010juu.2_Missense_Mutation_p.I358T	NM_005453	NP_005444	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	358					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
SYNGAP1	8831	broad.mit.edu	37	6	33411173	33411173	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33411173C>T	uc011dri.1	+	15	3039	c.2844C>T	c.(2842-2844)GGC>GGT	p.G948G	SYNGAP1_uc010juy.2_Silent_p.G919G|SYNGAP1_uc010juz.2_Silent_p.G660G	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	948					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4																		---	---	---	---
ITPR3	3710	broad.mit.edu	37	6	33631536	33631536	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33631536C>T	uc011drk.1	+	11	1246	c.1027C>T	c.(1027-1029)CGC>TGC	p.R343C		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	343	MIR 4.|Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19																		---	---	---	---
FGD2	221472	broad.mit.edu	37	6	36982747	36982747	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36982747T>A	uc010jwp.1	+	8	1133	c.962T>A	c.(961-963)CTC>CAC	p.L321H	FGD2_uc003ong.2_Missense_Mutation_p.L43H|FGD2_uc011dtv.1_5'UTR|FGD2_uc003oni.1_Missense_Mutation_p.L127H	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	321	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3																		---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42204045	42204045	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42204045C>A	uc003osd.2	-	16	3527	c.2964G>T	c.(2962-2964)GAG>GAT	p.E988D	TRERF1_uc011duq.1_Missense_Mutation_p.E905D|TRERF1_uc003osb.2_Missense_Mutation_p.E744D|TRERF1_uc003osc.2_Missense_Mutation_p.E744D|TRERF1_uc003ose.2_Missense_Mutation_p.E1008D	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	988	Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
KLHDC3	116138	broad.mit.edu	37	6	42985306	42985306	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42985306G>A	uc003otl.2	+	3	373	c.204G>A	c.(202-204)GGG>GGA	p.G68G	KLHDC3_uc003otm.2_RNA|KLHDC3_uc010jyf.2_Silent_p.G68G|KLHDC3_uc003otn.2_5'UTR|KLHDC3_uc003oto.2_Intron	NM_057161	NP_476502	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	68	Kelch 1.				reciprocal meiotic recombination	cytoplasm|nuclear chromatin	chromatin binding|protein binding			upper_aerodigestive_tract(1)	1			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)															---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45917038	45917038	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45917038A>G	uc003oxv.3	-	3	837	c.731T>C	c.(730-732)GTC>GCC	p.V244A	CLIC5_uc003oxu.3_Missense_Mutation_p.V85A|CLIC5_uc003oxx.2_Missense_Mutation_p.V85A	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	244					female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
GPR116	221395	broad.mit.edu	37	6	46828548	46828548	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46828548A>G	uc003oyo.3	-	16	2572	c.2283T>C	c.(2281-2283)CAT>CAC	p.H761H	GPR116_uc011dwj.1_Silent_p.H316H|GPR116_uc011dwk.1_Silent_p.H190H|GPR116_uc003oyp.3_Silent_p.H619H|GPR116_uc003oyq.3_Silent_p.H761H|GPR116_uc010jzi.1_Silent_p.H433H	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	761	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)															---	---	---	---
GPR110	266977	broad.mit.edu	37	6	46977701	46977701	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46977701A>C	uc003oyt.2	-	11	1669	c.1470T>G	c.(1468-1470)ATT>ATG	p.I490M	GPR110_uc011dwl.1_Missense_Mutation_p.I178M	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	490	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54212228	54212228	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54212228A>G	uc003pcj.2	+	6	958	c.812A>G	c.(811-813)CAG>CGG	p.Q271R	TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	271					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82936995	82936995	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82936995C>T	uc003pjl.1	-	5	1095	c.568G>A	c.(568-570)GTG>ATG	p.V190M	IBTK_uc011dyv.1_Missense_Mutation_p.V190M|IBTK_uc011dyw.1_Missense_Mutation_p.V190M|IBTK_uc010kbi.1_Translation_Start_Site|IBTK_uc003pjm.2_Missense_Mutation_p.V190M	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	190	RCC1 1.				negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---
ZNF292	23036	broad.mit.edu	37	6	87953265	87953265	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87953265G>A	uc003plm.3	+	6	855	c.814G>A	c.(814-816)GCT>ACT	p.A272T		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)														---	---	---	---
FUT9	10690	broad.mit.edu	37	6	96651800	96651800	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96651800C>A	uc003pop.3	+	3	1110	c.769C>A	c.(769-771)CTA>ATA	p.L257I		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	257	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)														---	---	---	---
PRDM13	59336	broad.mit.edu	37	6	100062155	100062155	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100062155G>A	uc003pqg.1	+	4	1905	c.1644G>A	c.(1642-1644)CCG>CCA	p.P548P		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	548					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)														---	---	---	---
RNF217	154214	broad.mit.edu	37	6	125366443	125366443	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125366443G>A	uc003pzs.2	+	4	431	c.93G>A	c.(91-93)ACG>ACA	p.T31T	RNF217_uc003pzr.2_Silent_p.T88T|RNF217_uc003pzt.2_RNA	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217	31					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)														---	---	---	---
HECA	51696	broad.mit.edu	37	6	139487805	139487805	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139487805C>A	uc003qin.2	+	2	941	c.656C>A	c.(655-657)GCG>GAG	p.A219E		NM_016217	NP_057301	Q9UBI9	HDC_HUMAN	headcase	219					respiratory tube development						0				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144812155	144812155	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144812155G>A	uc003qkt.2	+	31	4446	c.4354G>A	c.(4354-4356)GAT>AAT	p.D1452N		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1452	Spectrin 10.|Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
SNX9	51429	broad.mit.edu	37	6	158349643	158349643	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158349643C>T	uc003qqv.1	+	12	1370	c.1197C>T	c.(1195-1197)TGC>TGT	p.C399C		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	399	BAR.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)														---	---	---	---
SLC22A1	6580	broad.mit.edu	37	6	160543054	160543054	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160543054G>A	uc003qtc.2	+	1	192	c.87G>A	c.(85-87)TCG>TCA	p.S29S	SLC22A1_uc003qtd.2_Silent_p.S29S	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	29	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)														---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166844007	166844007	+	Silent	SNP	C	T	T	rs140163975		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166844007C>T	uc003qvb.1	-	16	1734	c.1515G>A	c.(1513-1515)TCG>TCA	p.S505S	RPS6KA2_uc011ego.1_Silent_p.S416S|RPS6KA2_uc010kkl.1_Silent_p.S416S|RPS6KA2_uc003qvc.1_Silent_p.S513S|RPS6KA2_uc003qvd.1_Silent_p.S530S	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	505	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168281130	168281130	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168281130C>A	uc003qwd.2	+	6	969	c.827C>A	c.(826-828)GCT>GAT	p.A276D	MLLT4_uc003qwb.1_Missense_Mutation_p.A276D|MLLT4_uc003qwc.1_Missense_Mutation_p.A277D|MLLT4_uc003qwf.2_Translation_Start_Site	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	277	Ras-associating 2.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
PAPOLB	56903	broad.mit.edu	37	7	4900547	4900547	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4900547G>A	uc003snk.2	-	1	1079	c.895C>T	c.(895-897)CCT>TCT	p.P299S	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	298					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)														---	---	---	---
RNF216	54476	broad.mit.edu	37	7	5752387	5752387	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5752387G>A	uc003soy.1	-	12	1960	c.1770C>T	c.(1768-1770)GCC>GCT	p.A590A	RNF216_uc010ksz.1_Silent_p.A212A|RNF216_uc010kta.1_Silent_p.A212A|RNF216_uc011jwj.1_Silent_p.A212A|RNF216_uc003sox.1_Silent_p.A647A	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	590	IBR-type.				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)														---	---	---	---
AIMP2	7965	broad.mit.edu	37	7	6057478	6057478	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6057478G>A	uc003spo.2	+	3	489	c.376G>A	c.(376-378)GCA>ACA	p.A126T		NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	126	Interaction with PARK2.				apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1																		---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20201455	20201455	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20201455A>G	uc003sus.3	-	4	340	c.31T>C	c.(31-33)TCA>CCA	p.S11P	MACC1_uc010kug.2_Missense_Mutation_p.S11P	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	11					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94056959	94056959	+	Silent	SNP	C	T	T	rs149097024		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94056959C>T	uc003ung.1	+	49	3759	c.3288C>T	c.(3286-3288)GGC>GGT	p.G1096G	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1096			Missing (in OI4).|G -> A (in OI3).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
PTCD1	26024	broad.mit.edu	37	7	99017660	99017660	+	Missense_Mutation	SNP	C	T	T	rs150466149		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99017660C>T	uc003uqh.2	-	8	2164	c.2033G>A	c.(2032-2034)CGG>CAG	p.R678Q	PTCD1_uc011kiw.1_Missense_Mutation_p.R727Q	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	678										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100682329	100682329	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682329T>C	uc003uxp.1	+	3	7685	c.7632T>C	c.(7630-7632)AGT>AGC	p.S2544S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2544	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|41.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
DNAJC2	27000	broad.mit.edu	37	7	102953432	102953432	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102953432G>A	uc003vbo.2	-	16	2004	c.1753C>T	c.(1753-1755)CCT>TCT	p.P585S	PMPCB_uc003vbl.2_3'UTR|PMPCB_uc003vbm.2_3'UTR|PMPCB_uc010liv.2_3'UTR|PMPCB_uc010liw.2_3'UTR|PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Missense_Mutation_p.P210S|DNAJC2_uc010lix.2_Missense_Mutation_p.P532S|DNAJC2_uc003vbp.2_Missense_Mutation_p.P210S	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	585	SANT 2.				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1																		---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107577640	107577640	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107577640C>T	uc003vew.2	-	26	4179	c.3844G>A	c.(3844-3846)GCC>ACC	p.A1282T	LAMB1_uc003vev.2_Missense_Mutation_p.A1306T	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1282	Potential.|Domain II.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
TMEM168	64418	broad.mit.edu	37	7	112423832	112423832	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112423832C>T	uc003vgn.2	-	2	1441	c.1049G>A	c.(1048-1050)CGC>CAC	p.R350H	TMEM168_uc010lju.2_Missense_Mutation_p.R350H|TMEM168_uc011kmr.1_Intron	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	350						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SPAM1	6677	broad.mit.edu	37	7	123593630	123593630	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593630A>T	uc003vld.2	+	4	408	c.6A>T	c.(4-6)GGA>GGT	p.G2G	SPAM1_uc003vle.2_Silent_p.G2G|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Silent_p.G2G|SPAM1_uc010lku.2_Silent_p.G2G	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	2					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)													---	---	---	---
FLNC	2318	broad.mit.edu	37	7	128478651	128478651	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128478651C>T	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449			gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131866253	131866253	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131866253A>G	uc003vra.3	-	18	3608	c.3379T>C	c.(3379-3381)TCC>CCC	p.S1127P		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1127	Extracellular (Potential).|IPT/TIG 3.					integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
BPGM	669	broad.mit.edu	37	7	134346677	134346677	+	Missense_Mutation	SNP	C	T	T	rs141221644	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134346677C>T	uc003vrv.2	+	3	959	c.418C>T	c.(418-420)CGG>TGG	p.R140W	BPGM_uc003vrw.2_Missense_Mutation_p.R140W|BPGM_uc003vrx.2_Missense_Mutation_p.R140W	NM_199186	NP_954655	P07738	PMGE_HUMAN	bisphosphoglycerate mutase	140					glycolysis|respiratory gaseous exchange		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0																		---	---	---	---
CNOT4	4850	broad.mit.edu	37	7	135079001	135079001	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135079001C>T	uc003vsv.1	-	10	1603	c.1296G>A	c.(1294-1296)TCG>TCA	p.S432S	CNOT4_uc003vss.2_Silent_p.S429S|CNOT4_uc011kpz.1_Silent_p.S429S|CNOT4_uc003vst.2_Silent_p.S432S|CNOT4_uc003vsu.1_Silent_p.S429S|CNOT4_uc011kpy.1_Silent_p.S432S	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	432					nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
SVOPL	136306	broad.mit.edu	37	7	138312915	138312915	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138312915C>T	uc011kqh.1	-	10	1057	c.1057G>A	c.(1057-1059)GGT>AGT	p.G353S	SVOPL_uc003vue.2_Missense_Mutation_p.G201S	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	353	Helical; (Potential).					integral to membrane	transmembrane transporter activity				0																		---	---	---	---
ATP6V0A4	50617	broad.mit.edu	37	7	138437555	138437555	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138437555G>A	uc003vuf.2	-	10	1082	c.844C>T	c.(844-846)CAG>TAG	p.Q282*	ATP6V0A4_uc003vug.2_Nonsense_Mutation_p.Q282*|ATP6V0A4_uc003vuh.2_Nonsense_Mutation_p.Q282*	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	282	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1																		---	---	---	---
EPHB6	2051	broad.mit.edu	37	7	142566336	142566336	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142566336G>A	uc011kst.1	+	15	2912	c.2125G>A	c.(2125-2127)GCC>ACC	p.A709T	EPHB6_uc011ksu.1_Missense_Mutation_p.A709T|EPHB6_uc003wbs.2_Missense_Mutation_p.A417T|EPHB6_uc003wbt.2_Missense_Mutation_p.A183T|EPHB6_uc003wbu.2_Missense_Mutation_p.A417T|EPHB6_uc003wbv.2_Missense_Mutation_p.A93T	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	709	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)																	---	---	---	---
ZNF425	155054	broad.mit.edu	37	7	148802270	148802270	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148802270G>T	uc003wfj.2	-	4	766	c.693C>A	c.(691-693)TCC>TCA	p.S231S		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	231					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	148964046	148964046	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964046C>T	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																														---	---	---	---
KRBA1	84626	broad.mit.edu	37	7	149416733	149416733	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149416733C>T	uc003wfz.2	+	2	403	c.4C>T	c.(4-6)CGG>TGG	p.R2W	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	2										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
ZNF862	643641	broad.mit.edu	37	7	149547305	149547305	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149547305C>T	uc010lpn.2	+	5	1187	c.995C>T	c.(994-996)CCG>CTG	p.P332L	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	332					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1																		---	---	---	---
ESYT2	57488	broad.mit.edu	37	7	158560362	158560362	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158560362G>A	uc003wob.1	-	8	1117	c.1051C>T	c.(1051-1053)CGG>TGG	p.R351W	ESYT2_uc003woc.1_Missense_Mutation_p.R175W|ESYT2_uc003wod.1_Missense_Mutation_p.R351W	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain	379	C2 1.					integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3																		---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2092718	2092718	+	Missense_Mutation	SNP	C	T	T	rs147501499	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2092718C>T	uc003wpx.3	+	37	4349	c.4211C>T	c.(4210-4212)ACC>ATC	p.T1404I	MYOM2_uc011kwi.1_Missense_Mutation_p.T829I	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1404	Ig-like C2-type 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3087599	3087599	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3087599G>A	uc011kwk.1	-	27	4701	c.4311C>T	c.(4309-4311)AAC>AAT	p.N1437N	CSMD1_uc011kwj.1_Silent_p.N829N|CSMD1_uc003wqe.2_Silent_p.N593N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1437	Extracellular (Potential).|Sushi 8.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15519705	15519705	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15519705C>A	uc003wwt.2	+	5	818	c.608C>A	c.(607-609)GCT>GAT	p.A203D	TUSC3_uc003wwr.2_Missense_Mutation_p.A203D|TUSC3_uc003wws.2_Missense_Mutation_p.A203D|TUSC3_uc003wwu.2_Missense_Mutation_p.A203D|TUSC3_uc003wwv.2_Missense_Mutation_p.A203D|TUSC3_uc003www.2_Missense_Mutation_p.A203D|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.A203D	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	203	Helical; (Potential).				cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21767139	21767139	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21767139G>T	uc003wzy.1	-	5	1015	c.922C>A	c.(922-924)CGT>AGT	p.R308S	DOK2_uc003wzx.1_Missense_Mutation_p.R308S|DOK2_uc003wzz.1_Missense_Mutation_p.R154S|DOK2_uc010lth.1_Missense_Mutation_p.R154S	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2	308					blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
LOXL2	4017	broad.mit.edu	37	8	23167240	23167240	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23167240G>A	uc003xdh.1	-	10	2160	c.1821C>T	c.(1819-1821)GGC>GGT	p.G607G	LOXL2_uc010lty.1_Silent_p.G146G	NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor	607	Lysyl-oxidase like.				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)														---	---	---	---
DPYSL2	1808	broad.mit.edu	37	8	26492331	26492331	+	Silent	SNP	C	T	T	rs35621323	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26492331C>T	uc003xfb.1	+	8	1076	c.726C>T	c.(724-726)ATC>ATT	p.I242I	DPYSL2_uc003xfa.2_Silent_p.I347I|DPYSL2_uc011lag.1_Silent_p.I242I|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Silent_p.I206I	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	242					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)														---	---	---	---
RAB11FIP1	80223	broad.mit.edu	37	8	37756907	37756907	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37756907G>T	uc003xkm.1	-	1	97	c.53C>A	c.(52-54)ACC>AAC	p.T18N	RAB11FIP1_uc010lvz.1_5'UTR|RAB11FIP1_uc003xkn.1_Missense_Mutation_p.T18N	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	18	C2.				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)															---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38699879	38699879	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38699879G>A	uc010lwp.2	+	10	2414	c.2035G>A	c.(2035-2037)GCT>ACT	p.A679T	TACC1_uc003xma.2_Missense_Mutation_p.A117T|TACC1_uc003xlz.2_Missense_Mutation_p.A484T|TACC1_uc003xmc.3_Missense_Mutation_p.A483T|TACC1_uc011lbz.1_Missense_Mutation_p.A666T|TACC1_uc003xmb.3_Missense_Mutation_p.A605T|TACC1_uc003xmf.3_Missense_Mutation_p.A269T|TACC1_uc011lca.1_Missense_Mutation_p.A662T|TACC1_uc011lcb.1_Missense_Mutation_p.A455T|TACC1_uc011lcd.1_RNA|TACC1_uc003xmh.3_Missense_Mutation_p.A496T|TACC1_uc010lwq.2_Missense_Mutation_p.A495T	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing	679					cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
C8orf40	114926	broad.mit.edu	37	8	42407698	42407698	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42407698G>A	uc011lcv.1	+	4	320	c.271G>A	c.(271-273)GAC>AAC	p.D91N	C8orf40_uc003xph.2_Missense_Mutation_p.D91N|C8orf40_uc003xpg.2_Missense_Mutation_p.D91N|C8orf40_uc010lxo.2_Missense_Mutation_p.D91N	NM_001135676	NP_001129148	Q96E16	CH040_HUMAN	hypothetical protein LOC114926	91						cytoplasm|integral to membrane|nucleolus					0	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48625354	48625354	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48625354T>C	uc003xqd.2	+	15	2117	c.2108T>C	c.(2107-2109)GTG>GCG	p.V703A	KIAA0146_uc011ldb.1_Missense_Mutation_p.V703A|KIAA0146_uc010lxs.2_Missense_Mutation_p.V178A|KIAA0146_uc011ldc.1_Missense_Mutation_p.V633A|KIAA0146_uc011ldd.1_Missense_Mutation_p.V643A|KIAA0146_uc003xqe.2_Missense_Mutation_p.V178A|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Missense_Mutation_p.V392A|KIAA0146_uc010lxt.2_Missense_Mutation_p.V392A|KIAA0146_uc011ldf.1_Missense_Mutation_p.V208A|KIAA0146_uc011ldg.1_Missense_Mutation_p.V193A|KIAA0146_uc003xqg.1_5'Flank	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	703											0		Lung NSC(58;0.175)																---	---	---	---
DNAJC5B	85479	broad.mit.edu	37	8	66988980	66988980	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66988980G>A	uc003xvs.1	+	4	496	c.205G>A	c.(205-207)GCA>ACA	p.A69T	DNAJC5B_uc003xvt.1_RNA	NM_033105	NP_149096	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	69	J.				protein folding	membrane	heat shock protein binding|unfolded protein binding				0		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)															---	---	---	---
NCOA2	10499	broad.mit.edu	37	8	71071833	71071833	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71071833C>T	uc003xyn.1	-	10	1193	c.1031G>A	c.(1030-1032)GGC>GAC	p.G344D		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	344					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)					T	RUNXBP2	AML								---	---	---	---
LRRCC1	85444	broad.mit.edu	37	8	86042248	86042248	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86042248C>T	uc003ycw.2	+	11	1875	c.1721C>T	c.(1720-1722)GCG>GTG	p.A574V	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.A275V|LRRCC1_uc003ycx.2_Missense_Mutation_p.A481V|LRRCC1_uc003ycy.2_Missense_Mutation_p.A554V	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	574	Potential.				cell division|mitosis	centriole|nucleus					0																		---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885339	88885339	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885339T>C	uc003ydz.2	-	1	958	c.861A>G	c.(859-861)TCA>TCG	p.S287S		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	287	WD 1.									ovary(1)	1																		---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89339294	89339294	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89339294G>A	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
KIAA1429	25962	broad.mit.edu	37	8	95500956	95500956	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95500956T>C	uc003ygo.1	-	24	5430	c.5417A>G	c.(5416-5418)CAT>CGT	p.H1806R	KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1806					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)															---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101011627	101011627	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101011627A>C	uc003yjb.1	-	19	3007	c.2812T>G	c.(2812-2814)TGG>GGG	p.W938G	RGS22_uc003yja.1_Missense_Mutation_p.W757G|RGS22_uc003yjc.1_Missense_Mutation_p.W926G	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	938	RGS 1.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
SYBU	55638	broad.mit.edu	37	8	110587336	110587336	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110587336G>A	uc003ynj.3	-	7	1954	c.1791C>T	c.(1789-1791)GGC>GGT	p.G597G	SYBU_uc003yni.3_Silent_p.G594G|SYBU_uc003ynk.3_Silent_p.G478G|SYBU_uc010mco.2_Silent_p.G596G|SYBU_uc003ynl.3_Silent_p.G596G|SYBU_uc010mcp.2_Silent_p.G597G|SYBU_uc010mcq.2_Silent_p.G597G|SYBU_uc003yno.3_Silent_p.G478G|SYBU_uc010mcr.2_Silent_p.G597G|SYBU_uc003ynm.3_Silent_p.G596G|SYBU_uc003ynn.3_Silent_p.G596G|SYBU_uc010mcs.2_Silent_p.G478G|SYBU_uc010mct.2_Silent_p.G597G|SYBU_uc010mcu.2_Silent_p.G596G|SYBU_uc003ynp.3_Silent_p.G529G|SYBU_uc010mcv.2_Silent_p.G597G|SYBU_uc003ynh.3_Silent_p.G391G|SYBU_uc011lhw.1_Silent_p.G467G	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	597						cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125565501	125565501	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125565501C>T	uc003yrk.2	-	14	2534	c.2000G>A	c.(1999-2001)GGC>GAC	p.G667D	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_Missense_Mutation_p.G316D|MTSS1_uc011lin.1_Missense_Mutation_p.G441D|MTSS1_uc011lio.1_Missense_Mutation_p.G557D|MTSS1_uc003yri.2_Missense_Mutation_p.G385D|MTSS1_uc003yrj.2_Missense_Mutation_p.G642D|MTSS1_uc003yrl.2_Missense_Mutation_p.G671D	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	667	Pro-rich.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139163507	139163507	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139163507A>G	uc003yuy.2	-	13	3382	c.3211T>C	c.(3211-3213)TTG>CTG	p.L1071L	FAM135B_uc003yux.2_Silent_p.L972L|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.L633L|FAM135B_uc003yvb.2_Silent_p.L633L	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1071										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
FLJ43860	389690	broad.mit.edu	37	8	142500233	142500233	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142500233G>A	uc003ywi.2	-	5	762	c.681C>T	c.(679-681)GGC>GGT	p.G227G	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	227							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
RHPN1	114822	broad.mit.edu	37	8	144462879	144462879	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144462879G>A	uc003yyb.2	+	11	1470	c.1337G>A	c.(1336-1338)CGC>CAC	p.R446H		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	471	BRO1.				signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)															---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	414958	414958	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:414958G>A	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
AK3	50808	broad.mit.edu	37	9	4719182	4719182	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4719182C>T	uc003ziq.1	-	3	537	c.397G>A	c.(397-399)GCC>ACC	p.A133T	AK3_uc003zip.1_RNA|AK3_uc011lma.1_Missense_Mutation_p.A93T|AK3_uc003zir.1_Missense_Mutation_p.A63T	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3	133					blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6888045	6888045	+	Silent	SNP	T	C	C	rs35244873	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6888045T>C	uc003zkh.2	+	7	1345	c.765T>C	c.(763-765)TAT>TAC	p.Y255Y	KDM4C_uc010mhu.2_Silent_p.Y277Y|KDM4C_uc010mhw.2_Silent_p.Y255Y|KDM4C_uc011lmi.1_Silent_p.Y255Y|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Silent_p.Y255Y|KDM4C_uc011lmk.1_Silent_p.Y74Y	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	255	JmjC.				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
MPDZ	8777	broad.mit.edu	37	9	13143471	13143471	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13143471G>A	uc010mia.1	-	26	3891	c.3834C>T	c.(3832-3834)GCC>GCT	p.A1278A	MPDZ_uc010mhx.2_Intron|MPDZ_uc011lmm.1_Intron|MPDZ_uc003zkz.3_Intron|MPDZ_uc010mhy.2_Silent_p.A1278A|MPDZ_uc010mhz.2_Intron|MPDZ_uc011lmn.1_Intron|MPDZ_uc003zlb.3_Silent_p.A1278A	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1278					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)														---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14805124	14805124	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14805124C>T	uc003zlm.2	-	19	3891	c.3301G>A	c.(3301-3303)GCT>ACT	p.A1101T	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1101	CSPG 7.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18574213	18574213	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18574213T>C	uc003zne.3	+	4	550	c.423T>C	c.(421-423)GGT>GGC	p.G141G	ADAMTSL1_uc003znb.2_Silent_p.G141G|ADAMTSL1_uc003znc.3_Silent_p.G141G	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	141						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20874757	20874757	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20874757C>T	uc003zog.1	+	21	2631	c.2268C>T	c.(2266-2268)GGC>GGT	p.G756G	KIAA1797_uc003zoh.1_Silent_p.G192G	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	756						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
IFNA7	3444	broad.mit.edu	37	9	21202157	21202157	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21202157C>T	uc003zop.1	-	1	48	c.8G>A	c.(7-9)CGG>CAG	p.R3Q	IFNA14_uc003zoo.1_Intron	NM_021057	NP_066401	P01567	IFNA7_HUMAN	interferon, alpha 7 precursor	3					blood coagulation|cell-cell signaling|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35382432	35382432	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35382432C>T	uc003zwq.2	+	20	2779	c.2487C>T	c.(2485-2487)AAC>AAT	p.N829N	UNC13B_uc003zwr.2_Silent_p.N829N	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	829					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
FAM122A	116224	broad.mit.edu	37	9	71395740	71395740	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71395740C>T	uc004agw.1	+	1	777	c.660C>T	c.(658-660)GGC>GGT	p.G220G	PIP5K1B_uc004agu.2_Intron|PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_138333	NP_612206	Q96E09	F122A_HUMAN	hypothetical protein LOC116224	220											0																		---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82323671	82323671	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82323671T>C	uc004ald.2	+	14	2157	c.1308T>C	c.(1306-1308)GCT>GCC	p.A436A	TLE4_uc004alc.2_Silent_p.A411A|TLE4_uc010mpr.2_Silent_p.A290A|TLE4_uc004ale.2_Silent_p.A48A|TLE4_uc011lsq.1_Silent_p.A379A|TLE4_uc010mps.2_Silent_p.A335A|TLE4_uc004alf.2_Silent_p.A350A	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
CTSL3	392360	broad.mit.edu	37	9	90387899	90387899	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90387899G>A	uc004apm.1	+	1	70	c.64G>A	c.(64-66)GCC>ACC	p.A22T		NR_027917				RecName: Full=Putative cathepsin L-like protein 3;          Short=Cathepsin L-like protein; AltName: Full=HCTSL-s;											ovary(1)	1																		---	---	---	---
PTPDC1	138639	broad.mit.edu	37	9	96859844	96859844	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96859844G>T	uc004auf.1	+	7	1174	c.834G>T	c.(832-834)GAG>GAT	p.E278D	PTPDC1_uc004aug.1_Missense_Mutation_p.E278D|PTPDC1_uc004auh.1_Missense_Mutation_p.E330D|PTPDC1_uc010mrj.1_Missense_Mutation_p.E332D|PTPDC1_uc010mri.1_Missense_Mutation_p.E330D	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	278							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1																		---	---	---	---
ANKS6	203286	broad.mit.edu	37	9	101552786	101552786	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101552786G>A	uc004ayu.2	-	2	483	c.462C>T	c.(460-462)GGC>GGT	p.G154G	ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	154	ANK 4.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109687613	109687613	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109687613G>A	uc004bcz.2	+	3	1709	c.1420G>A	c.(1420-1422)GAA>AAA	p.E474K	ZNF462_uc010mto.2_Missense_Mutation_p.E322K|ZNF462_uc004bda.2_Missense_Mutation_p.E322K	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	474	C2H2-type 5.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
MUSK	4593	broad.mit.edu	37	9	113550073	113550073	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113550073G>A	uc004bey.2	+	13	1980	c.1882G>A	c.(1882-1884)GCC>ACC	p.A628T	MUSK_uc004bez.1_Missense_Mutation_p.A208T	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	628	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124530798	124530798	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124530798C>A	uc004bln.2	+	10	1770	c.1701C>A	c.(1699-1701)ATC>ATA	p.I567I	DAB2IP_uc004blo.2_Silent_p.I471I|DAB2IP_uc004blp.2_Silent_p.I22I	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	595					activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
NEK6	10783	broad.mit.edu	37	9	127089652	127089652	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127089652G>A	uc004bog.2	+	7	699	c.550G>A	c.(550-552)GGC>AGC	p.G184S	NEK6_uc004bof.2_Missense_Mutation_p.G202S|NEK6_uc004boh.2_Missense_Mutation_p.G218S|NEK6_uc010mwj.2_Missense_Mutation_p.G137S|NEK6_uc010mwk.2_Missense_Mutation_p.G184S|NEK6_uc004boi.2_Missense_Mutation_p.G184S	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2	184	Protein kinase.				apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3																		---	---	---	---
GOLGA1	2800	broad.mit.edu	37	9	127644063	127644063	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127644063C>A	uc004bpc.2	-	21	2478	c.2136G>T	c.(2134-2136)GAG>GAT	p.E712D	GOLGA1_uc010mws.2_RNA	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	712	GRIP.					Golgi cisterna membrane				ovary(1)	1																		---	---	---	---
FPGS	2356	broad.mit.edu	37	9	130572387	130572387	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130572387T>C	uc004bsg.1	+	13	1337	c.1287_splice	c.e13+2	p.Q429_splice	FPGS_uc004bsh.1_Splice_Site_p.Q246_splice|FPGS_uc011mal.1_Splice_Site_p.Q403_splice|FPGS_uc004bsi.1_Splice_Site_p.Q379_splice	NM_004957	NP_004948			folylpolyglutamate synthase isoform a precursor						folic acid metabolic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)													---	---	---	---
C9orf119	375757	broad.mit.edu	37	9	131038469	131038469	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131038469C>A	uc004bup.2	+	1	45	c.45C>A	c.(43-45)AGC>AGA	p.S15R	GOLGA2_uc011maw.1_5'Flank|GOLGA2_uc010mxw.2_5'Flank|GOLGA2_uc004bul.1_5'Flank|C9orf119_uc010mxx.1_Missense_Mutation_p.S15R	NM_001040011	NP_001035100	Q1ZZU3	SWI5_HUMAN	hypothetical protein LOC375757	15					double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0																		---	---	---	---
TOR1A	1861	broad.mit.edu	37	9	132585059	132585059	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132585059G>A	uc004byl.2	-	2	322	c.245C>T	c.(244-246)GCC>GTC	p.A82V	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.A82V	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	82					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)																---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134459791	134459791	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134459791C>T	uc004cbc.2	-	21	2893	c.2763G>A	c.(2761-2763)CGG>CGA	p.R921R	RAPGEF1_uc004cbb.2_Silent_p.R939R	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	921	Ras-GEF.				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
RALGDS	5900	broad.mit.edu	37	9	135977061	135977061	+	Missense_Mutation	SNP	G	A	A	rs143871051	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135977061G>A	uc004cco.2	-	16	2320	c.2300C>T	c.(2299-2301)ACG>ATG	p.T767M	RALGDS_uc004cct.1_5'Flank|RALGDS_uc004ccn.2_Translation_Start_Site|RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Missense_Mutation_p.T755M|RALGDS_uc004ccr.2_Missense_Mutation_p.T766M|RALGDS_uc011mcv.1_Missense_Mutation_p.T738M|RALGDS_uc004ccs.2_Missense_Mutation_p.T712M|RALGDS_uc011mcw.1_Missense_Mutation_p.T838M|RALGDS_uc004ccv.1_Silent_p.H594H|RALGDS_uc004ccu.1_Missense_Mutation_p.T536M	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	767					nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)				T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
KCNT1	57582	broad.mit.edu	37	9	138650317	138650317	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138650317A>G	uc011mdq.1	+	10	891	c.817A>G	c.(817-819)ATC>GTC	p.I273V	KCNT1_uc011mdr.1_Missense_Mutation_p.I100V|KCNT1_uc010nbf.2_Missense_Mutation_p.I225V|KCNT1_uc004cgo.1_Missense_Mutation_p.I22V	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	273						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)														---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	435950	435950	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:435950C>A	uc001ifp.2	-	13	1668	c.1578G>T	c.(1576-1578)CAG>CAT	p.Q526H	DIP2C_uc009xhj.1_Missense_Mutation_p.Q222H	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	526						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
WDR37	22884	broad.mit.edu	37	10	1170951	1170951	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1170951G>A	uc001igf.1	+	13	1513	c.1340G>A	c.(1339-1341)CGG>CAG	p.R447Q	WDR37_uc009xhm.1_Missense_Mutation_p.R448Q|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	447											0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)														---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7608006	7608006	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608006G>A	uc001ijq.2	-	13	2593	c.2514C>T	c.(2512-2514)TGC>TGT	p.C838C	ITIH5_uc001ijp.2_Silent_p.C624C	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	838					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
TAF3	83860	broad.mit.edu	37	10	8055710	8055710	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8055710G>A	uc010qbd.1	+	6	2585	c.2585G>A	c.(2584-2586)GGC>GAC	p.G862D		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	862					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15726071	15726071	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15726071G>T	uc001ioc.1	-	4	500	c.500C>A	c.(499-501)CCA>CAA	p.P167Q	ITGA8_uc010qcb.1_Missense_Mutation_p.P167Q	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	167	Extracellular (Potential).|FG-GAP 2.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16867001	16867001	+	Silent	SNP	G	A	A	rs146137990		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16867001G>A	uc001ioo.2	-	67	10897	c.10845C>T	c.(10843-10845)TCC>TCT	p.S3615S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3615	CUB 27.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16911739	16911739	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911739C>T	uc001ioo.2	-	59	9402	c.9350G>A	c.(9349-9351)CGC>CAC	p.R3117H	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.R473H	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3117	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
ARMC3	219681	broad.mit.edu	37	10	23244766	23244766	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23244766T>G	uc001irm.3	+	4	280	c.197T>G	c.(196-198)CTT>CGT	p.L66R	ARMC3_uc010qcv.1_Missense_Mutation_p.L66R|ARMC3_uc010qcw.1_5'UTR|ARMC3_uc001irn.1_5'UTR	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	66	ARM 2.						binding				0																		---	---	---	---
ITGB1	3688	broad.mit.edu	37	10	33209310	33209310	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33209310G>T	uc001iws.3	-	10	1268	c.1132C>A	c.(1132-1134)CTT>ATT	p.L378I	ITGB1_uc001iwp.3_Missense_Mutation_p.L378I|ITGB1_uc001iwq.3_Missense_Mutation_p.L378I|ITGB1_uc001iwr.3_Missense_Mutation_p.L378I|ITGB1_uc001iwt.3_Missense_Mutation_p.L378I|ITGB1_uc001iwu.1_Missense_Mutation_p.L378I	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	378	Extracellular (Potential).|VWFA.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)																---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33475246	33475246	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33475246G>A	uc001iwx.3	-	14	2756	c.2233C>T	c.(2233-2235)CCA>TCA	p.P745S	NRP1_uc001iwv.3_Missense_Mutation_p.P745S|NRP1_uc009xlz.2_Missense_Mutation_p.P739S|NRP1_uc001iww.3_Missense_Mutation_p.P557S|NRP1_uc001iwy.3_Missense_Mutation_p.P738S	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	745	Extracellular (Potential).|MAM.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43292065	43292065	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292065A>C	uc001jaj.2	+	10	1731	c.1373A>C	c.(1372-1374)AAC>ACC	p.N458T		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	458					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
ZNF32	7580	broad.mit.edu	37	10	44139887	44139887	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44139887G>A	uc001jbb.2	-	3	622	c.433C>T	c.(433-435)CGA>TGA	p.R145*	uc001jba.2_Intron|ZNF32_uc001jbc.2_Nonsense_Mutation_p.R145*	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32	145	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)														---	---	---	---
GDF2	2658	broad.mit.edu	37	10	48416403	48416403	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48416403C>T	uc001jfa.1	-	1	454	c.291G>A	c.(289-291)ACG>ACA	p.T97T		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	97					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55582247	55582247	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582247G>T	uc001jju.1	-	33	5634	c.5239C>A	c.(5239-5241)CTT>ATT	p.L1747I	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.L1744I|PCDH15_uc010qhw.1_Missense_Mutation_p.L1707I|PCDH15_uc010qhx.1_Missense_Mutation_p.L1678I|PCDH15_uc010qhy.1_Missense_Mutation_p.L1754I|PCDH15_uc010qhz.1_Missense_Mutation_p.L1749I|PCDH15_uc010qia.1_Missense_Mutation_p.L1727I|PCDH15_uc010qib.1_Missense_Mutation_p.L1724I	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1747	Poly-Pro.|Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
CHST3	9469	broad.mit.edu	37	10	73766924	73766924	+	Intron	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73766924T>G	uc001jsn.2	+							NM_004273	NP_004264			chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0																		---	---	---	---
LRIT2	340745	broad.mit.edu	37	10	85981787	85981787	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85981787C>T	uc001kcy.2	-	3	1550	c.1542G>A	c.(1540-1542)CCG>CCA	p.P514P	LRIT2_uc010qmc.1_Silent_p.P524P	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	514						integral to membrane				ovary(2)	2																		---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88230820	88230820	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88230820G>A	uc001kdo.2	-	8	2513	c.2071C>T	c.(2071-2073)CGA>TGA	p.R691*	WAPAL_uc009xsv.2_Nonsense_Mutation_p.R5*|WAPAL_uc001kdn.2_Nonsense_Mutation_p.R728*|WAPAL_uc009xsw.2_Nonsense_Mutation_p.R685*	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	691	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
CYP2C19	1557	broad.mit.edu	37	10	96484237	96484237	+	Translation_Start_Site	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96484237C>A	uc010qny.1	+	5	765	c.-93C>A	c.(-95--91)ACCTG>ACATG		CYP2C18_uc001kjv.3_Missense_Mutation_p.L366M|CYP2C18_uc001kjw.3_Missense_Mutation_p.L307M|CYP2C19_uc009xus.1_Intron	NM_000769	NP_000760			cytochrome P450, family 2, subfamily C,						exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)													---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98742860	98742860	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98742860G>T	uc001kmv.2	+	1	1820	c.1713G>T	c.(1711-1713)GAG>GAT	p.E571D		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	571										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
ENTPD7	57089	broad.mit.edu	37	10	101458568	101458568	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101458568C>T	uc001kqa.3	+	10	1466	c.1288C>T	c.(1288-1290)CGC>TGC	p.R430C	ENTPD7_uc009xwl.2_Missense_Mutation_p.R432C	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	430	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)														---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104264032	104264032	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104264032C>T	uc001kvy.1	+	1	269	c.123C>T	c.(121-123)TGC>TGT	p.C41C	SUFU_uc001kvw.1_Silent_p.C41C|SUFU_uc001kvx.2_Silent_p.C41C|ACTR1A_uc001kvv.2_5'Flank|ACTR1A_uc010qqn.1_5'Flank|ACTR1A_uc010qqo.1_5'Flank	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	41					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
TRIM8	81603	broad.mit.edu	37	10	104415901	104415901	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104415901T>C	uc001kvz.2	+							NM_030912	NP_112174			tripartite motif-containing 8							cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108338937	108338937	+	Intron	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108338937A>G	uc001kym.2	-						SORCS1_uc001kyl.2_Silent_p.S1148S|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Silent_p.S1148S|SORCS1_uc001kyo.2_3'UTR	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
WDR11	55717	broad.mit.edu	37	10	122625206	122625206	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122625206G>A	uc010qtf.1	+	7	1182	c.944G>A	c.(943-945)CGT>CAT	p.R315H	WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Translation_Start_Site	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	315						integral to membrane					0																		---	---	---	---
HMX2	3167	broad.mit.edu	37	10	124908090	124908090	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124908090T>G	uc001lhc.1	+	1	453	c.196T>G	c.(196-198)TTC>GTC	p.F66V		NM_005519	NP_005510	A2RU54	HMX2_HUMAN	H6 family homeobox 2	66					cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)														---	---	---	---
BUB3	9184	broad.mit.edu	37	10	124921806	124921806	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124921806A>C	uc001lhe.2	+	6	873	c.631A>C	c.(631-633)AGC>CGC	p.S211R	BUB3_uc009yah.2_Missense_Mutation_p.S163R|BUB3_uc001lhf.3_Missense_Mutation_p.S211R|BUB3_uc001lhd.2_Missense_Mutation_p.S211R|BUB3_uc010qud.1_Missense_Mutation_p.S131R	NM_004725	NP_004716	O43684	BUB3_HUMAN	budding uninhibited by benzimidazoles 3 isoform	211					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|attachment of spindle microtubules to kinetochore|cell division|meiosis|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	condensed chromosome kinetochore|cytosol|nucleus	protein binding			ovary(1)	1		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)																---	---	---	---
EBF3	253738	broad.mit.edu	37	10	131757263	131757263	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131757263G>T	uc001lki.1	-	5	479	c.420C>A	c.(418-420)GTC>GTA	p.V140V		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	140					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)														---	---	---	---
B4GALNT4	338707	broad.mit.edu	37	11	373264	373264	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:373264T>C	uc001lpb.2	+	6	618	c.609T>C	c.(607-609)GCT>GCC	p.A203A		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	203	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1267503	1267503	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267503G>A	uc009ycr.1	+	49	11268	c.11142G>A	c.(11140-11142)ACG>ACA	p.T3714T	MUC5B_uc001ltb.2_Silent_p.T3134T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3131	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
TRPM5	29850	broad.mit.edu	37	11	2428999	2428999	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2428999C>T	uc001lwm.3	-	19	2935	c.2926G>A	c.(2926-2928)GCC>ACC	p.A976T	TRPM5_uc010qxl.1_Missense_Mutation_p.A976T|TRPM5_uc009ydn.2_Missense_Mutation_p.A978T	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,	976	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)														---	---	---	---
OR52I2	143502	broad.mit.edu	37	11	4608096	4608096	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4608096T>C	uc010qyh.1	+	1	54	c.54T>C	c.(52-54)ATT>ATC	p.I18I		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR51F2	119694	broad.mit.edu	37	11	4843262	4843262	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4843262C>T	uc010qyn.1	+	1	647	c.647C>T	c.(646-648)GCG>GTG	p.A216V		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
UBQLN3	50613	broad.mit.edu	37	11	5529610	5529610	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5529610G>A	uc001may.1	-	2	1265	c.1179C>T	c.(1177-1179)GGC>GGT	p.G393G	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	393										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR2AG1	144125	broad.mit.edu	37	11	6806831	6806831	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806831C>T	uc001mer.1	+	1	563	c.563C>T	c.(562-564)GCC>GTC	p.A188V		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---
ZNF214	7761	broad.mit.edu	37	11	7021534	7021534	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7021534A>G	uc001mfa.2	-	3	1683	c.1380T>C	c.(1378-1380)CAT>CAC	p.H460H	ZNF214_uc010ray.1_Silent_p.H460H|ZNF214_uc009yfh.1_Silent_p.H460H	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	460	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)														---	---	---	---
ARNTL	406	broad.mit.edu	37	11	13393740	13393740	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13393740G>T	uc001mkr.2	+	13	1259	c.851G>T	c.(850-852)AGC>ATC	p.S284I	ARNTL_uc001mko.2_Missense_Mutation_p.S240I|ARNTL_uc001mkp.2_Missense_Mutation_p.S283I|ARNTL_uc001mkq.2_Missense_Mutation_p.S283I|ARNTL_uc001mks.2_Missense_Mutation_p.S241I|ARNTL_uc001mkt.2_Missense_Mutation_p.S284I|ARNTL_uc001mku.2_RNA|ARNTL_uc009ygm.1_Intron|ARNTL_uc001mkv.1_Missense_Mutation_p.S241I|ARNTL_uc001mkw.2_Missense_Mutation_p.S241I|ARNTL_uc001mkx.2_Missense_Mutation_p.S282I	NM_001178	NP_001169	O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear	284					circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)														---	---	---	---
PIK3C2A	5286	broad.mit.edu	37	11	17190440	17190440	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17190440A>G	uc001mmq.3	-	1	915	c.849T>C	c.(847-849)AAT>AAC	p.N283N	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Silent_p.N283N|PIK3C2A_uc009ygv.1_Silent_p.N283N	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	283					cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)													---	---	---	---
E2F8	79733	broad.mit.edu	37	11	19251862	19251862	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19251862C>A	uc001mpm.2	-	9	1806	c.1284G>T	c.(1282-1284)CAG>CAT	p.Q428H	E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Missense_Mutation_p.Q428H	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	428					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20907060	20907060	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20907060C>T	uc001mqe.2	+	5	730	c.577C>T	c.(577-579)CGC>TGC	p.R193C	NELL1_uc001mqf.2_Missense_Mutation_p.R193C|NELL1_uc009yid.2_Missense_Mutation_p.R221C|NELL1_uc010rdo.1_Missense_Mutation_p.R136C|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	193	TSP N-terminal.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
SLC17A6	57084	broad.mit.edu	37	11	22387116	22387116	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22387116A>G	uc001mqk.2	+	7	1185	c.772A>G	c.(772-774)ATG>GTG	p.M258V		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	258	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4																		---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33596423	33596423	+	Intron	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33596423A>C	uc001mup.3	+						C11orf41_uc001mun.1_Intron	NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
NAT10	55226	broad.mit.edu	37	11	34133754	34133754	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34133754G>C	uc001mvk.2	+	4	600	c.356G>C	c.(355-357)GGC>GCC	p.G119A	NAT10_uc010ren.1_Missense_Mutation_p.G47A	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 isoform a	119						nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)																---	---	---	---
TRAF6	7189	broad.mit.edu	37	11	36520142	36520142	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36520142A>T	uc001mwr.1	-	4	685	c.345T>A	c.(343-345)AAT>AAA	p.N115K	TRAF6_uc001mws.1_Missense_Mutation_p.N115K	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	115	Interaction with TAX1BP1.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
MED19	219541	broad.mit.edu	37	11	57472562	57472562	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57472562A>G	uc001nla.1	-	2	379	c.357T>C	c.(355-357)CCT>CCC	p.P119P	MED19_uc001nlb.2_Silent_p.P119P	NM_153450	NP_703151	A0JLT2	MED19_HUMAN	mediator complex subunit 19	119					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		p.P119L(1)		ovary(2)	2																		---	---	---	---
TMEM132A	54972	broad.mit.edu	37	11	60697990	60697990	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60697990T>C	uc001nqj.2	+	5	1068	c.875T>C	c.(874-876)GTG>GCG	p.V292A	TMEM132A_uc001nqi.2_Missense_Mutation_p.V292A|TMEM132A_uc001nqk.2_Missense_Mutation_p.V305A|TMEM132A_uc001nql.1_Missense_Mutation_p.V305A	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	292	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1																		---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61071397	61071397	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61071397G>A	uc001nrc.3	-	22	2998	c.2772C>T	c.(2770-2772)GGC>GGT	p.G924G	DDB1_uc010rle.1_Silent_p.G235G|DDB1_uc010rlf.1_Silent_p.G924G	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	924	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
FLRT1	23769	broad.mit.edu	37	11	63884259	63884259	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63884259G>A	uc001nyi.1	+	2	861	c.520G>A	c.(520-522)GCC>ACC	p.A174T	MACROD1_uc001nyh.2_Intron	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	146	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64428414	64428414	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64428414G>A	uc001oar.2	-	11	2435	c.1996C>T	c.(1996-1998)CGT>TGT	p.R666C	NRXN2_uc001oas.2_Missense_Mutation_p.R635C|NRXN2_uc001oaq.2_Missense_Mutation_p.R333C	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
NAALADL1	10004	broad.mit.edu	37	11	64824840	64824840	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64824840C>T	uc001ocn.2	-						NAALADL1_uc010rnw.1_Intron	NM_005468	NP_005459			N-acetylated alpha-linked acidic						proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0																		---	---	---	---
TIGD3	220359	broad.mit.edu	37	11	65124144	65124144	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65124144G>A	uc001odo.3	+	2	1028	c.865G>A	c.(865-867)GCC>ACC	p.A289T		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	289	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0																		---	---	---	---
EFEMP2	30008	broad.mit.edu	37	11	65637592	65637592	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65637592C>T	uc001ofy.3	-	6	801	c.607G>A	c.(607-609)GAT>AAT	p.D203N	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.D203N	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	203	EGF-like 4; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)														---	---	---	---
CTSF	8722	broad.mit.edu	37	11	66332220	66332220	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66332220C>T	uc001oip.2	-	10	1313	c.1223G>A	c.(1222-1224)GGC>GAC	p.G408D		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	408					proteolysis	lysosome	cysteine-type endopeptidase activity				0																		---	---	---	---
RCE1	9986	broad.mit.edu	37	11	66613485	66613485	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66613485G>A	uc001ojk.1	+	8	953	c.909G>A	c.(907-909)ACG>ACA	p.T303T	RCE1_uc001ojl.1_Silent_p.T199T	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN	prenyl protein peptidase RCE1 isoform 1	303	Helical; (Potential).				proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity			ovary(1)|breast(1)	2																		---	---	---	---
RHOD	29984	broad.mit.edu	37	11	66838974	66838974	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66838974C>T	uc001ojv.2	+	5	619	c.534C>T	c.(532-534)AAC>AAT	p.N178N		NM_014578	NP_055393	O00212	RHOD_HUMAN	ras homolog D precursor	178					regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
CARNS1	57571	broad.mit.edu	37	11	67187277	67187277	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67187277C>T	uc009yrp.2	+	6	1164	c.712C>T	c.(712-714)CGG>TGG	p.R238W	PPP1CA_uc001okx.1_Intron|CARNS1_uc010rpr.1_Missense_Mutation_p.R361W|CARNS1_uc001olc.3_Missense_Mutation_p.R377W	NM_020811	NP_065862	A5YM72	CRNS1_HUMAN	ATP-grasp domain containing 1	238					carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding				0																		---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70189942	70189942	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70189942G>A	uc001opo.2	+	15	2073	c.1875G>A	c.(1873-1875)GCG>GCA	p.A625A	PPFIA1_uc001opn.1_Silent_p.A625A|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	625	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---
FOLH1B	219595	broad.mit.edu	37	11	89424639	89424639	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424639A>C	uc001pda.2	+	12	1515	c.989A>C	c.(988-990)AAT>ACT	p.N330T		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	330					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
KIAA1826	84437	broad.mit.edu	37	11	105880396	105880396	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880396G>A	uc001piy.2	-	3	1077	c.904C>T	c.(904-906)CGA>TGA	p.R302*	KIAA1826_uc001piz.2_Nonsense_Mutation_p.R302*	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	302	Potential.					nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)														---	---	---	---
ATM	472	broad.mit.edu	37	11	108164110	108164110	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108164110T>C	uc001pkb.1	+	31	5067	c.4682T>C	c.(4681-4683)CTT>CCT	p.L1561P	ATM_uc009yxr.1_Missense_Mutation_p.L1561P|ATM_uc001pke.1_Missense_Mutation_p.L213P|ATM_uc001pkf.2_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1561					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)				D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			---	---	---	---
PHLDB1	23187	broad.mit.edu	37	11	118516454	118516454	+	Missense_Mutation	SNP	G	A	A	rs137998974		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118516454G>A	uc001ptr.1	+	18	3771	c.3418G>A	c.(3418-3420)GCG>ACG	p.A1140T	PHLDB1_uc001pts.2_Missense_Mutation_p.A1140T|PHLDB1_uc001ptt.2_Missense_Mutation_p.A1093T|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Missense_Mutation_p.A955T|PHLDB1_uc001ptw.1_Missense_Mutation_p.A495T|PHLDB1_uc009zai.1_Missense_Mutation_p.A176T|PHLDB1_uc001ptx.1_Missense_Mutation_p.A176T|PHLDB1_uc010ryi.1_3'UTR	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	1140											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)														---	---	---	---
POU2F3	25833	broad.mit.edu	37	11	120176450	120176450	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120176450T>C	uc001pxc.2	+	8	827	c.725T>C	c.(724-726)ATG>ACG	p.M242T	POU2F3_uc010rzk.1_Missense_Mutation_p.M196T|POU2F3_uc010rzl.1_Missense_Mutation_p.M172T|POU2F3_uc001pxe.1_Missense_Mutation_p.M27T	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	242	POU-specific.				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120833350	120833350	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120833350C>T	uc001pxn.2	+	18	2513	c.2226C>T	c.(2224-2226)GGC>GGT	p.G742G	GRIK4_uc009zav.1_Silent_p.G742G|GRIK4_uc009zaw.1_Silent_p.G742G|GRIK4_uc009zax.1_Silent_p.G742G	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	742	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
TECTA	7007	broad.mit.edu	37	11	120976660	120976660	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120976660A>G	uc010rzo.1	+	2	185	c.185A>G	c.(184-186)TAC>TGC	p.Y62C		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	62					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)														---	---	---	---
SORL1	6653	broad.mit.edu	37	11	121448108	121448108	+	Silent	SNP	C	T	T	rs138407235		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121448108C>T	uc001pxx.2	+	25	3659	c.3579C>T	c.(3577-3579)ACC>ACT	p.T1193T	SORL1_uc010rzp.1_Silent_p.T39T	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	1193	Extracellular (Potential).|LDL-receptor class A 3.				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124120777	124120777	+	IGR	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124120777G>A								OR8G2 (24467 upstream) : OR8D1 (58960 downstream)																																			---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126294613	126294613	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126294613G>A	uc001qea.2	-	17	2560	c.2199C>T	c.(2197-2199)AGC>AGT	p.S733S	KIRREL3_uc001qeb.2_Silent_p.S721S|ST3GAL4_uc001qdx.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	733	Cytoplasmic (Potential).|Ser-rich.				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
WNK1	65125	broad.mit.edu	37	12	1005427	1005427	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1005427C>T	uc001qio.3	+	24	6281	c.5774C>T	c.(5773-5775)GCC>GTC	p.A1925V	WNK1_uc001qip.3_Missense_Mutation_p.A1677V|WNK1_uc001qir.3_Missense_Mutation_p.A1098V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1925					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
NTF3	4908	broad.mit.edu	37	12	5603459	5603459	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5603459C>T	uc001qnl.3	+	1	162	c.79C>T	c.(79-81)CCA>TCA	p.P27S	NTF3_uc001qnk.3_Missense_Mutation_p.P40S	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	27					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1																		---	---	---	---
NTF3	4908	broad.mit.edu	37	12	5603725	5603725	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5603725G>A	uc001qnl.3	+	1	428	c.345G>A	c.(343-345)CCG>CCA	p.P115P	NTF3_uc001qnk.3_Silent_p.P128P	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	115					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1																		---	---	---	---
CD4	920	broad.mit.edu	37	12	6925311	6925311	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6925311A>T	uc001qqv.1	+	6	942	c.697A>T	c.(697-699)ACG>TCG	p.T233S	CD4_uc009zez.1_3'UTR|CD4_uc009zfa.1_RNA|CD4_uc009zfb.1_RNA|CD4_uc010sfj.1_5'UTR|CD4_uc009zfc.1_Missense_Mutation_p.T54S|CD4_uc010sfk.1_5'UTR|CD4_uc010sfl.1_5'UTR|CD4_uc010sfm.1_5'UTR	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	233	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)																---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7527225	7527225	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7527225A>G	uc001qsy.2	-	13	3248	c.3222T>C	c.(3220-3222)TGT>TGC	p.C1074C	CD163L1_uc010sge.1_Silent_p.C1084C	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1074	SRCR 10.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7531592	7531592	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7531592C>T	uc001qsy.2	-	9	2379	c.2353G>A	c.(2353-2355)GCA>ACA	p.A785T	CD163L1_uc010sge.1_Missense_Mutation_p.A795T	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	785	SRCR 7.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
SLC2A14	144195	broad.mit.edu	37	12	7981304	7981304	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7981304C>T	uc001qtk.2	-	11	1534	c.741G>A	c.(739-741)ACG>ACA	p.T247T	SLC2A14_uc001qtl.2_Silent_p.T224T|SLC2A14_uc001qtm.2_Silent_p.T224T|SLC2A14_uc010sgg.1_Silent_p.T138T|SLC2A14_uc001qtn.2_Silent_p.T247T|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Silent_p.T262T	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	247	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)														---	---	---	---
GOLT1B	51026	broad.mit.edu	37	12	21665273	21665273	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21665273T>C	uc001rez.2	+	4	500	c.341T>C	c.(340-342)GTC>GCC	p.V114A	GOLT1B_uc009zis.2_RNA|GOLT1B_uc009zit.2_RNA|GOLT1B_uc009ziu.2_RNA	NM_016072	NP_057156	Q9Y3E0	GOT1B_HUMAN	golgi transport 1 homolog B	114	Cytoplasmic (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport|vesicle-mediated transport	endoplasmic reticulum|Golgi membrane|integral to membrane	signal transducer activity				0																		---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22035726	22035726	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22035726C>T	uc001rfi.1	-	14	2013	c.1993G>A	c.(1993-1995)GCA>ACA	p.A665T	ABCC9_uc001rfh.2_Missense_Mutation_p.A665T|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	665	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	A	A	rs121913530		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25398285C>A	uc001rgp.1	-	2	215	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26784907	26784907	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26784907G>A	uc001rhg.2	-	22	3243	c.2826C>T	c.(2824-2826)AGC>AGT	p.S942S		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	942	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26839488	26839488	+	Silent	SNP	C	T	T	rs117349764	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26839488C>T	uc001rhg.2	-	11	1491	c.1074G>A	c.(1072-1074)CCG>CCA	p.P358P		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	358	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
MED21	9412	broad.mit.edu	37	12	27181274	27181274	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27181274G>T	uc001rhp.1	+	4	345	c.315G>T	c.(313-315)GAG>GAT	p.E105D	MED21_uc009zjh.1_RNA	NM_004264	NP_004255	Q13503	MED21_HUMAN	mediator complex subunit 21	105					positive regulation of transcription from RNA polymerase II promoter	mediator complex	DNA-directed RNA polymerase activity|transcription coactivator activity				0	Colorectal(261;0.0847)																	---	---	---	---
SYT10	341359	broad.mit.edu	37	12	33579288	33579288	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579288C>T	uc001rll.1	-	2	591	c.294G>A	c.(292-294)CAG>CAA	p.Q98Q	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	98	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)																	---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40672043	40672043	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40672043G>T	uc001rmg.3	+	18	2342	c.2221G>T	c.(2221-2223)GGA>TGA	p.G741*	LRRK2_uc001rmh.1_Nonsense_Mutation_p.G363*	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	741					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
PDZRN4	29951	broad.mit.edu	37	12	41967251	41967251	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41967251G>A	uc010skn.1	+	10	2141	c.2073G>A	c.(2071-2073)AAG>AAA	p.K691K	PDZRN4_uc001rmq.3_Silent_p.K632K|PDZRN4_uc009zjz.2_Silent_p.K630K|PDZRN4_uc001rmr.2_Silent_p.K517K	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	890							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)																---	---	---	---
GXYLT1	283464	broad.mit.edu	37	12	42491296	42491296	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42491296T>C	uc001rms.3	-	7	1334	c.1109A>G	c.(1108-1110)TAC>TGC	p.Y370C	GXYLT1_uc001rmt.3_Missense_Mutation_p.Y339C	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3	370	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0																		---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46246350	46246350	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46246350C>T	uc001ros.1	+	15	4444	c.4444C>T	c.(4444-4446)CAA>TAA	p.Q1482*	ARID2_uc001ror.2_Nonsense_Mutation_p.Q1482*|ARID2_uc009zkg.1_Nonsense_Mutation_p.Q938*|ARID2_uc009zkh.1_Nonsense_Mutation_p.Q1109*|ARID2_uc001rou.1_Nonsense_Mutation_p.Q816*	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1482					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
CCNT1	904	broad.mit.edu	37	12	49087792	49087792	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49087792G>A	uc001rse.1	-	9	1528	c.1205C>T	c.(1204-1206)GCC>GTC	p.A402V	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.A117V	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	402	Potential.				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6																		---	---	---	---
PRPF40B	25766	broad.mit.edu	37	12	50029022	50029022	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50029022G>A	uc001rur.1	+	12	1140	c.1076G>A	c.(1075-1077)CGC>CAC	p.R359H	PRPF40B_uc001rup.1_Missense_Mutation_p.R381H|PRPF40B_uc001ruq.1_Missense_Mutation_p.R353H|PRPF40B_uc001rus.1_Missense_Mutation_p.R302H	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	359					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5																		---	---	---	---
KRT1	3848	broad.mit.edu	37	12	53069130	53069130	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53069130G>A	uc001sau.1	-	9	1841	c.1782C>T	c.(1780-1782)GGC>GGT	p.G594G	KRT1_uc001sav.1_Silent_p.G587G	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	594	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2																		---	---	---	---
AVPR1A	552	broad.mit.edu	37	12	63544484	63544484	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544484C>T	uc001sro.1	-	1	2107	c.133G>A	c.(133-135)GTG>ATG	p.V45M		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	45	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)													---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812728A>G	uc001ssb.2	+	6	769	c.343A>G	c.(343-345)ACA>GCA	p.T115A	XPOT_uc009zqm.1_Missense_Mutation_p.T25A	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65609822	65609822	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65609822A>G	uc001ssl.1	+	3	1632	c.1626A>G	c.(1624-1626)GCA>GCG	p.A542A	LEMD3_uc009zqo.1_Silent_p.A541A	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	542					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
CAND1	55832	broad.mit.edu	37	12	67696401	67696401	+	Intron	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67696401T>G	uc001stn.2	+						CAND1_uc001sto.2_Intron	NM_018448	NP_060918			TIP120 protein						cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)														---	---	---	---
ELK3	2004	broad.mit.edu	37	12	96641453	96641453	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96641453G>A	uc001teo.1	+	3	1222	c.943G>A	c.(943-945)GCC>ACC	p.A315T		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	315					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)																	---	---	---	---
FICD	11153	broad.mit.edu	37	12	108912784	108912784	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108912784C>T	uc001tmx.1	+	3	1055	c.909C>T	c.(907-909)CCC>CCT	p.P303P		NM_007076	NP_009007	Q9BVA6	FICD_HUMAN	Huntingtin interacting protein E	303	Fido.				negative regulation of Rho GTPase activity	integral to membrane	binding|protein adenylyltransferase activity				0																		---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113733856	113733856	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113733856G>A	uc001tuw.2	+	28	2723	c.2426G>A	c.(2425-2427)CGC>CAC	p.R809H	TPCN1_uc001tux.2_Missense_Mutation_p.R881H|TPCN1_uc010syu.1_RNA	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	809	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
RPLP0	6175	broad.mit.edu	37	12	120636391	120636391	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120636391A>G	uc001txp.2	-	6	854	c.617T>C	c.(616-618)ATC>ACC	p.I206T	RPLP0_uc001txq.2_Missense_Mutation_p.I206T|RPLP0_uc001txr.2_Intron|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	206					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131476867	131476867	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131476867A>G	uc001uit.3	+	8	1455	c.896A>G	c.(895-897)TAC>TGC	p.Y299C	GPR133_uc010tbm.1_Missense_Mutation_p.Y331C	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	299	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133254218	133254218	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133254218G>A	uc001uks.1	-	7	710	c.666C>T	c.(664-666)CGC>CGT	p.R222R	POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Silent_p.R195R	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	222					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
KL	9365	broad.mit.edu	37	13	33591184	33591184	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33591184C>T	uc001uus.2	+	1	614	c.606C>T	c.(604-606)GAC>GAT	p.D202D	KL_uc001uur.1_Intron	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	202	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)														---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43918697	43918697	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43918697G>A	uc001uza.3	-	9	1313	c.1013C>T	c.(1012-1014)GCC>GTC	p.A338V	ENOX1_uc001uzb.3_Missense_Mutation_p.A338V|ENOX1_uc001uzc.3_Missense_Mutation_p.A338V|ENOX1_uc001uyz.3_5'UTR|ENOX1_uc010tfm.1_Missense_Mutation_p.A151V	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	338	Potential.				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79191059	79191059	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79191059G>A	uc001vkw.1	-	6	896	c.837C>T	c.(835-837)GGC>GGT	p.G279G	uc001vku.1_RNA|RNF219_uc010afb.1_Silent_p.G89G|RNF219_uc010afc.2_Intron	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219	279							zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)														---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99449686	99449686	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99449686G>A	uc001vnt.2	-	53	6074	c.6019C>T	c.(6019-6021)CGA>TGA	p.R2007*	DOCK9_uc001vnw.2_Nonsense_Mutation_p.R2006*|DOCK9_uc001vnq.2_Nonsense_Mutation_p.R554*|DOCK9_uc001vnr.2_Nonsense_Mutation_p.R636*|DOCK9_uc010tin.1_Nonsense_Mutation_p.R625*|DOCK9_uc001vns.2_Nonsense_Mutation_p.R542*|DOCK9_uc010tio.1_Nonsense_Mutation_p.R662*|DOCK9_uc010tip.1_Nonsense_Mutation_p.R703*	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	2007	DHR-2.				blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
KDELC1	79070	broad.mit.edu	37	13	103443452	103443452	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103443452C>T	uc001vpq.3	-	6	1266	c.882G>A	c.(880-882)ACG>ACA	p.T294T	KDELC1_uc001vpr.3_Silent_p.T75T	NM_024089	NP_076994	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1 precursor	294						endoplasmic reticulum lumen				ovary(1)	1	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)																	---	---	---	---
F7	2155	broad.mit.edu	37	13	113771902	113771902	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113771902C>T	uc001vsv.2	+	8	848	c.797C>T	c.(796-798)GCG>GTG	p.A266V	F7_uc001vsw.2_Missense_Mutation_p.A244V|F7_uc010tjt.1_Missense_Mutation_p.A197V	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor	266	Peptidase S1.		A -> T (in FA7D).		anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)													---	---	---	---
LRRC16B	90668	broad.mit.edu	37	14	24532580	24532580	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24532580C>T	uc001wlj.2	+	31	2974	c.2817C>T	c.(2815-2817)ATC>ATT	p.I939I	LRRC16B_uc001wlk.2_Silent_p.I35I	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	939										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36159176	36159176	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36159176G>A	uc001wti.2	-	17	2691	c.2300C>T	c.(2299-2301)ACT>ATT	p.T767I	RALGAPA1_uc001wtj.2_Missense_Mutation_p.T767I|RALGAPA1_uc010tpv.1_Missense_Mutation_p.T767I|RALGAPA1_uc010tpw.1_Missense_Mutation_p.T814I|RALGAPA1_uc001wtk.1_Missense_Mutation_p.T665I	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	767					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36194349	36194349	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36194349G>A	uc001wti.2	-	14	2138	c.1747C>T	c.(1747-1749)CTG>TTG	p.L583L	RALGAPA1_uc001wtj.2_Silent_p.L583L|RALGAPA1_uc010tpv.1_Silent_p.L583L|RALGAPA1_uc010tpw.1_Silent_p.L583L|RALGAPA1_uc001wtk.1_Silent_p.L434L	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	583					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	38296552	38296552	+	Intron	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38296552A>G	uc001wug.2	+						uc001wuh.2_Missense_Mutation_p.H393R|uc001wui.2_RNA|uc001wuj.2_Missense_Mutation_p.H490R					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																														---	---	---	---
SSTR1	6751	broad.mit.edu	37	14	38679601	38679601	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38679601G>A	uc001wul.1	+	3	1624	c.1007G>A	c.(1006-1008)CGC>CAC	p.R336H	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	336	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)													---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64630227	64630227	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64630227G>A	uc001xgm.2	+	89	16637	c.16407G>A	c.(16405-16407)CCG>CCA	p.P5469P	SYNE2_uc001xgl.2_Silent_p.P5469P|SYNE2_uc010apy.2_Silent_p.P1854P|SYNE2_uc001xgn.2_Silent_p.P431P|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5469	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72054698	72054698	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72054698C>T	uc001xms.2	+	2	457	c.109C>T	c.(109-111)CGG>TGG	p.R37W	SIPA1L1_uc001xmt.2_Missense_Mutation_p.R37W|SIPA1L1_uc001xmu.2_Missense_Mutation_p.R37W|SIPA1L1_uc001xmv.2_Missense_Mutation_p.R37W	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	37					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	73029132	73029132	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73029132C>T	uc001xna.3	+	17	1899	c.1376C>T	c.(1375-1377)TCG>TTG	p.S459L	RGS6_uc010ttn.1_Missense_Mutation_p.S477L|RGS6_uc001xmx.3_Missense_Mutation_p.S459L|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.S477L|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	459					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
PAPLN	89932	broad.mit.edu	37	14	73718470	73718470	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73718470C>T	uc010ttx.1	+	8	932	c.769C>T	c.(769-771)CGG>TGG	p.R257W	PAPLN_uc001xnw.3_Missense_Mutation_p.R230W|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.R257W	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	257						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)														---	---	---	---
C14orf43	91748	broad.mit.edu	37	14	74205491	74205491	+	Silent	SNP	C	T	T	rs142510283		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74205491C>T	uc001xot.2	-	2	2004	c.1221G>A	c.(1219-1221)TCG>TCA	p.S407S	C14orf43_uc001xou.2_Silent_p.S407S|C14orf43_uc010tud.1_Silent_p.S407S|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	407					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)														---	---	---	---
TMED8	283578	broad.mit.edu	37	14	77808279	77808279	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77808279A>T	uc001xto.1	-	6	813	c.813T>A	c.(811-813)GGT>GGA	p.G271G	TMED8_uc010ast.1_RNA|TMED8_uc001xtn.1_Silent_p.G115G	NM_213601	NP_998766	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain	271	GOLD.				transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)														---	---	---	---
FAM181A	90050	broad.mit.edu	37	14	94395003	94395003	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94395003G>A	uc001ybz.1	+	3	865	c.558G>A	c.(556-558)CAG>CAA	p.Q186Q	C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.Q124Q|FAM181A_uc001yca.1_Silent_p.Q124Q	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	186											0																		---	---	---	---
KIAA0284	283638	broad.mit.edu	37	14	105349144	105349144	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105349144C>A	uc010axb.2	+	7	776	c.552C>A	c.(550-552)GCC>GCA	p.A184A	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Silent_p.A114A|KIAA0284_uc001yps.2_Silent_p.A90A	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	184						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)														---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105411774	105411774	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105411774C>T	uc010axc.1	-	7	10134	c.10014G>A	c.(10012-10014)GCG>GCA	p.A3338A	AHNAK2_uc001ypx.2_Silent_p.A3238A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3338						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106471382	106471382	+	RNA	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106471382G>T	uc010tyt.1	-	1891		c.36727C>A								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33873841	33873841	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33873841C>T	uc001zhi.2	+	14	1640	c.1570C>T	c.(1570-1572)CTG>TTG	p.L524L	RYR3_uc010bar.2_Silent_p.L524L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	524	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
TP53BP1	7158	broad.mit.edu	37	15	43714236	43714236	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43714236T>G	uc001zrs.2	-	19	4050	c.3902A>C	c.(3901-3903)GAT>GCT	p.D1301A	TP53BP1_uc010udp.1_Missense_Mutation_p.D1301A|TP53BP1_uc001zrq.3_Missense_Mutation_p.D1306A|TP53BP1_uc001zrr.3_Missense_Mutation_p.D1306A|TP53BP1_uc010udq.1_Missense_Mutation_p.D1306A	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	1301					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)									Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
FGF7	2252	broad.mit.edu	37	15	49776672	49776672	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49776672G>A	uc001zxn.2	+	4	1085	c.556G>A	c.(556-558)GCC>ACC	p.A186T	C15orf33_uc001zxl.2_Intron|C15orf33_uc001zxm.2_Intron	NM_002009	NP_002000	P21781	FGF7_HUMAN	fibroblast growth factor 7 precursor	186					actin cytoskeleton reorganization|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization at cell surface|secretion by lung epithelial cell involved in lung growth		chemoattractant activity|growth factor activity				0		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)	Palifermin(DB00039)													---	---	---	---
CYP19A1	1588	broad.mit.edu	37	15	51514616	51514616	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51514616G>A	uc001zyz.3	-	6	809	c.558C>T	c.(556-558)GAC>GAT	p.D186D	CYP19A1_uc001zza.3_Silent_p.D186D|CYP19A1_uc001zzb.2_Silent_p.D186D|CYP19A1_uc001zzd.2_Silent_p.D186D|CYP19A1_uc010bey.1_Silent_p.D186D	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	186					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)													---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51783923	51783923	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51783923G>T	uc002abf.2	-	20	5030	c.4805C>A	c.(4804-4806)GCC>GAC	p.A1602D	DMXL2_uc010ufy.1_Missense_Mutation_p.A1602D|DMXL2_uc010bfa.2_Missense_Mutation_p.A966D	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1602						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
TLN2	83660	broad.mit.edu	37	15	63040619	63040619	+	Silent	SNP	C	T	T	rs151024322	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63040619C>T	uc002alb.3	+	30	4095	c.4095C>T	c.(4093-4095)TGC>TGT	p.C1365C	TLN2_uc002alc.3_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1365					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	p.C1365C(1)		ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11																		---	---	---	---
TLN2	83660	broad.mit.edu	37	15	63069014	63069014	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63069014G>A	uc002alb.3	+	40	5419	c.5419G>A	c.(5419-5421)GCC>ACC	p.A1807T	TLN2_uc002alc.3_Missense_Mutation_p.A200T|TLN2_uc002ald.2_Missense_Mutation_p.A200T	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1807					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11																		---	---	---	---
CILP	8483	broad.mit.edu	37	15	65489719	65489719	+	Nonsense_Mutation	SNP	G	A	A	rs150946463		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65489719G>A	uc002aon.2	-	9	3086	c.2905C>T	c.(2905-2907)CGA>TGA	p.R969*		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	969					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7																		---	---	---	---
C15orf44	81556	broad.mit.edu	37	15	65871779	65871779	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65871779C>T	uc002apd.2	-	12	1860	c.1524G>A	c.(1522-1524)ACG>ACA	p.T508T	C15orf44_uc010uix.1_Silent_p.T544T|C15orf44_uc010uiz.1_Silent_p.T472T|C15orf44_uc010uja.1_Silent_p.T458T|C15orf44_uc010ujb.1_Silent_p.T429T|C15orf44_uc002ape.3_Silent_p.T508T|C15orf44_uc010uiy.1_Silent_p.T429T	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	508										ovary(1)	1																		---	---	---	---
C15orf44	81556	broad.mit.edu	37	15	65891302	65891302	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65891302G>A	uc002apd.2	-	5	849	c.513C>T	c.(511-513)TGC>TGT	p.C171C	C15orf44_uc010uix.1_Silent_p.C207C|C15orf44_uc010uiz.1_Silent_p.C135C|C15orf44_uc010uja.1_Silent_p.C122C|C15orf44_uc010ujb.1_Silent_p.C92C|C15orf44_uc002ape.3_Silent_p.C171C|C15orf44_uc010uiy.1_Silent_p.C92C	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	171	VWFA.									ovary(1)	1																		---	---	---	---
FEM1B	10116	broad.mit.edu	37	15	68582994	68582994	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68582994T>C	uc002arg.2	+	2	1913	c.1298T>C	c.(1297-1299)GTC>GCC	p.V433A	FEM1B_uc002arh.2_Missense_Mutation_p.V353A	NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	433					apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	72020961	72020961	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72020961C>T	uc002atb.1	+	8	1510	c.1431C>T	c.(1429-1431)GGC>GGT	p.G477G	THSD4_uc002atd.1_Silent_p.G151G|THSD4_uc010ukg.1_Silent_p.G117G|THSD4_uc002ate.2_Silent_p.G117G	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	477						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
GOLGA6B	55889	broad.mit.edu	37	15	72956779	72956779	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72956779G>A	uc010uks.1	+	13	1469	c.1428G>A	c.(1426-1428)GAG>GAA	p.E476E	uc002aux.1_5'Flank	NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	476	Potential.										0																		---	---	---	---
PML	5371	broad.mit.edu	37	15	74315644	74315644	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74315644C>T	uc002awv.2	+	3	1218	c.1078C>T	c.(1078-1080)CGC>TGC	p.R360C	PML_uc002awm.2_Missense_Mutation_p.R360C|PML_uc002awl.2_Missense_Mutation_p.R360C|PML_uc002awj.1_Missense_Mutation_p.R360C|PML_uc002awk.2_Missense_Mutation_p.R360C|PML_uc002awn.2_Missense_Mutation_p.R360C|PML_uc002awo.2_Missense_Mutation_p.R360C|PML_uc002awp.2_Missense_Mutation_p.R360C|PML_uc002awq.2_Missense_Mutation_p.R360C|PML_uc002awr.2_Missense_Mutation_p.R360C|PML_uc002aws.2_Missense_Mutation_p.R360C|PML_uc002awt.2_Missense_Mutation_p.R360C|PML_uc002awu.2_Missense_Mutation_p.R360C|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.R275C|PML_uc002awx.2_Missense_Mutation_p.R118C|PML_uc002awy.2_5'Flank	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	360					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5								T	RARA|PAX5	APL|ALL								---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86261259	86261259	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86261259A>G	uc002blv.1	+	22	6040	c.5870A>G	c.(5869-5871)GAA>GGA	p.E1957G	AKAP13_uc002blu.1_Missense_Mutation_p.E1961G|AKAP13_uc010bnf.1_Missense_Mutation_p.E578G|AKAP13_uc002blw.1_Missense_Mutation_p.E422G|AKAP13_uc002blx.1_Missense_Mutation_p.E202G	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1957	Interaction with ESR1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
HAPLN3	145864	broad.mit.edu	37	15	89424594	89424594	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89424594G>T	uc002bnc.2	-	3	615	c.487C>A	c.(487-489)CTG>ATG	p.L163M	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Missense_Mutation_p.L225M	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	163	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)																	---	---	---	---
C15orf42	90381	broad.mit.edu	37	15	90125982	90125982	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90125982C>T	uc002boe.2	+	2	720	c.720C>T	c.(718-720)GGC>GGT	p.G240G		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	240					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90335567	90335567	+	Intron	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90335567G>T	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
MAN2A2	4122	broad.mit.edu	37	15	91454123	91454123	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91454123G>T	uc010bnz.2	+	12	1922	c.1807G>T	c.(1807-1809)GCC>TCC	p.A603S	MAN2A2_uc010boa.2_Missense_Mutation_p.A645S|MAN2A2_uc002bqc.2_Missense_Mutation_p.A603S|MAN2A2_uc010uql.1_Missense_Mutation_p.A265S|MAN2A2_uc010uqm.1_Missense_Mutation_p.A182S|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	603	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)															---	---	---	---
MPG	4350	broad.mit.edu	37	16	133266	133266	+	Intron	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:133266C>A	uc002cfn.2	+						MPG_uc002cfm.2_Intron|MPG_uc010bqp.2_Nonsense_Mutation_p.C160*|MPG_uc002cfo.2_Intron	NM_002434	NP_002425			N-methylpurine-DNA glycosylase isoform a						depurination|DNA dealkylation involved in DNA repair	nucleoplasm	alkylbase DNA N-glycosylase activity|damaged DNA binding|identical protein binding			ovary(1)|skin(1)	2		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)											BER_DNA_glycosylases					---	---	---	---
RPUSD1	113000	broad.mit.edu	37	16	836929	836929	+	Splice_Site	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:836929C>A	uc002cka.2	-	4	644	c.410_splice	c.e4-1	p.G137_splice	RPUSD1_uc002ckb.2_Splice_Site_p.G137_splice|RPUSD1_uc002ckc.2_Splice_Site_p.G8_splice|RPUSD1_uc002ckd.2_Splice_Site_p.V103_splice|CHTF18_uc010uus.1_5'Flank|CHTF18_uc010bre.1_5'Flank|CHTF18_uc002cke.3_5'Flank|CHTF18_uc002ckf.3_5'Flank|CHTF18_uc010brf.2_5'Flank|CHTF18_uc002ckg.3_5'Flank	NM_058192	NP_478072			RNA pseudouridylate synthase domain containing						pseudouridine synthesis		pseudouridine synthase activity|RNA binding				0		Hepatocellular(780;0.00335)																---	---	---	---
CCNF	899	broad.mit.edu	37	16	2499405	2499405	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2499405C>T	uc002cqd.1	+	12	1429	c.1341C>T	c.(1339-1341)TAC>TAT	p.Y447Y	CCNF_uc002cqe.1_Silent_p.Y139Y	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	447					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)																---	---	---	---
CPPED1	55313	broad.mit.edu	37	16	12875064	12875064	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12875064G>A	uc002dca.3	-	2	378	c.267C>T	c.(265-267)GGC>GGT	p.G89G	CPPED1_uc002dcb.3_Silent_p.G89G	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	89							hydrolase activity|metal ion binding				0																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16218650	16218650	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16218650C>T	uc010bvi.2	+	25	3770	c.3595C>T	c.(3595-3597)CTG>TTG	p.L1199L	ABCC1_uc010bvj.2_Silent_p.L1140L|ABCC1_uc010bvk.2_Silent_p.L1143L|ABCC1_uc010bvl.2_Silent_p.L1199L|ABCC1_uc010bvm.2_Silent_p.L1084L|ABCC1_uc002del.3_Silent_p.L1093L	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1199	Cytoplasmic.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22144335	22144335	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22144335G>A	uc010vbq.1	+	20	2083	c.1987G>A	c.(1987-1989)GCC>ACC	p.A663T	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.A671T	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	663	VWFA 1.					extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24802619	24802619	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24802619G>A	uc002dmm.2	+	6	2770	c.2656G>A	c.(2656-2658)GGT>AGT	p.G886S	TNRC6A_uc010bxs.2_Missense_Mutation_p.G633S|TNRC6A_uc010vcc.1_Missense_Mutation_p.G633S|TNRC6A_uc002dmn.2_Missense_Mutation_p.G633S|TNRC6A_uc002dmo.2_Missense_Mutation_p.G633S	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	886	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
ZNF629	23361	broad.mit.edu	37	16	30794465	30794465	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30794465G>A	uc002dzs.1	-	3	1392	c.1184C>T	c.(1183-1185)ACG>ATG	p.T395M		NM_001080417	NP_001073886	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	395	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)															---	---	---	---
N4BP1	9683	broad.mit.edu	37	16	48594880	48594880	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594880G>A	uc002efp.2	-	2	1911	c.1674C>T	c.(1672-1674)TGC>TGT	p.C558C		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	558					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)																---	---	---	---
CBLN1	869	broad.mit.edu	37	16	49315161	49315161	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49315161G>A	uc002efq.2	-	1	555	c.216C>T	c.(214-216)CAC>CAT	p.H72H		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	72	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)																---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53191220	53191220	+	Missense_Mutation	SNP	G	A	A	rs147266259	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53191220G>A	uc002ehb.2	+	1	1383	c.1219G>A	c.(1219-1221)GAG>AAG	p.E407K	CHD9_uc002egy.2_Missense_Mutation_p.E407K|CHD9_uc002egz.1_Missense_Mutation_p.E407K|CHD9_uc002eha.1_Missense_Mutation_p.E407K|CHD9_uc002ehc.2_Missense_Mutation_p.E407K	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	407					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)																---	---	---	---
C16orf80	29105	broad.mit.edu	37	16	58149340	58149340	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58149340G>A	uc002enb.1	-	4	575	c.298C>T	c.(298-300)CGT>TGT	p.R100C		NM_013242	NP_037374	Q9Y6A4	CP080_HUMAN	transcription factor IIB	100					multicellular organismal development						0																		---	---	---	---
DPEP3	64180	broad.mit.edu	37	16	68013621	68013621	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68013621A>G	uc002evc.3	-	2	504	c.410T>C	c.(409-411)CTT>CCT	p.L137P	DPEP3_uc010cex.2_Missense_Mutation_p.L137P	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN	dipeptidase 3 isoform a	112					meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)														---	---	---	---
DUS2L	54920	broad.mit.edu	37	16	68110548	68110548	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68110548G>A	uc002evi.2	+	15	1245	c.1096G>A	c.(1096-1098)GCC>ACC	p.A366T	DUS2L_uc002evj.2_Missense_Mutation_p.A366T|DUS2L_uc010vkk.1_Missense_Mutation_p.A331T|DUS2L_uc010cez.2_Missense_Mutation_p.A279T	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog	366					tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)														---	---	---	---
PLA2G15	23659	broad.mit.edu	37	16	68283238	68283238	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68283238C>A	uc002evr.2	+	2	256	c.173C>A	c.(172-174)CCG>CAG	p.P58Q	PLA2G15_uc010vld.1_Missense_Mutation_p.P58Q|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)	58					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1																		---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69964094	69964094	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69964094C>T	uc002exu.1	+	14	1467	c.1378C>T	c.(1378-1380)CGA>TGA	p.R460*	WWP2_uc002exv.1_Nonsense_Mutation_p.R460*|WWP2_uc010vlm.1_Nonsense_Mutation_p.R344*|WWP2_uc010vln.1_Nonsense_Mutation_p.R78*|WWP2_uc002exw.1_Nonsense_Mutation_p.R21*|uc002exx.1_5'Flank|MIR140_hsa-mir-140|MI0000456_5'Flank	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	460	WW 4.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																OREG0023910	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70708342	70708342	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70708342T>C	uc002ezj.2	-	11	1180	c.920A>G	c.(919-921)TAC>TGC	p.Y307C		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	307	Ser-rich.				filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
PMFBP1	83449	broad.mit.edu	37	16	72158677	72158677	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72158677C>T	uc002fcc.3	-	17	2765	c.2593G>A	c.(2593-2595)GAC>AAC	p.D865N	PMFBP1_uc002fcd.2_Missense_Mutation_p.D860N|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.D715N|PMFBP1_uc010cgo.1_Missense_Mutation_p.D156N	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	865	Potential.									ovary(2)	2		Ovarian(137;0.179)														OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MLYCD	23417	broad.mit.edu	37	16	83933108	83933108	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83933108C>T	uc002fgz.2	+	1	379	c.359C>T	c.(358-360)GCG>GTG	p.A120V		NM_012213	NP_036345	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase precursor	120					acyl-CoA metabolic process|fatty acid biosynthetic process	mitochondrion|peroxisome	malonyl-CoA decarboxylase activity|methylmalonyl-CoA decarboxylase activity				0																		---	---	---	---
SLC38A8	146167	broad.mit.edu	37	16	84050219	84050219	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84050219G>A	uc002fhg.1	-	8	1067	c.1067C>T	c.(1066-1068)ACC>ATC	p.T356I		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	356	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane					0																		---	---	---	---
ATP2C2	9914	broad.mit.edu	37	16	84485577	84485577	+	Missense_Mutation	SNP	C	A	A	rs146513346	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84485577C>A	uc002fhx.2	+	18	1800	c.1711C>A	c.(1711-1713)CTT>ATT	p.L571I	ATP2C2_uc010chj.2_Missense_Mutation_p.L571I|ATP2C2_uc002fhy.2_Missense_Mutation_p.L588I|ATP2C2_uc002fhz.2_Missense_Mutation_p.L420I	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	571	Extracellular (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
KLHL36	79786	broad.mit.edu	37	16	84691319	84691319	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84691319C>T	uc002fig.2	+	3	1047	c.906C>T	c.(904-906)GGC>GGT	p.G302G	KLHL36_uc010chl.2_Silent_p.G301G	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	302	Kelch 1.									skin(2)	2																		---	---	---	---
COX4I1	1327	broad.mit.edu	37	16	85839401	85839401	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85839401A>G	uc002fje.2	+	4	468	c.304A>G	c.(304-306)ACG>GCG	p.T102A	COX4I1_uc002fjf.2_3'UTR|COX4I1_uc002fjg.1_Missense_Mutation_p.T102A|COX4I1_uc010vom.1_Missense_Mutation_p.T69A	NM_001861	NP_001852	P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	102					respiratory electron transport chain	mitochondrial inner membrane|nucleus	cytochrome-c oxidase activity|protein binding			lung(1)	1		Renal(780;0.228)																---	---	---	---
RPA1	6117	broad.mit.edu	37	17	1783866	1783866	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1783866C>T	uc002fto.2	+	12	1237	c.1122C>T	c.(1120-1122)CCC>CCT	p.P374P		NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1	374					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0													NER					---	---	---	---
PITPNM3	83394	broad.mit.edu	37	17	6376029	6376029	+	Silent	SNP	G	A	A	rs143785279		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6376029G>A	uc002gdd.3	-	11	1528	c.1377C>T	c.(1375-1377)AGC>AGT	p.S459S	PITPNM3_uc010cln.2_Silent_p.S423S|PITPNM3_uc010clm.2_5'UTR|PITPNM3_uc002gdc.3_Silent_p.S50S	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	459	DDHD.				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)														---	---	---	---
DNAH2	146754	broad.mit.edu	37	17	7707688	7707688	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7707688G>T	uc002giu.1	+	58	9101	c.9087G>T	c.(9085-9087)GAG>GAT	p.E3029D	DNAH2_uc010cnm.1_Missense_Mutation_p.E6D	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3029	Potential.|Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---
KDM6B	23135	broad.mit.edu	37	17	7753402	7753402	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7753402C>T	uc002giw.1	+	13	3956	c.3580C>T	c.(3580-3582)CGG>TGG	p.R1194W	KDM6B_uc002gix.2_Missense_Mutation_p.R496W	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1194					inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8216372	8216372	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8216372G>A	uc002glc.2	+	3	855	c.734G>A	c.(733-735)CGG>CAG	p.R245Q	ARHGEF15_uc002glb.1_3'UTR|ARHGEF15_uc002gld.2_Missense_Mutation_p.R245Q|ARHGEF15_uc010vuw.1_Intron	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	245					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8218457	8218457	+	Silent	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8218457T>G	uc002glc.2	+	6	1243	c.1122T>G	c.(1120-1122)CCT>CCG	p.P374P	ARHGEF15_uc002gld.2_Silent_p.P374P|ARHGEF15_uc010vuw.1_Silent_p.P263P	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	374					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
MFSD6L	162387	broad.mit.edu	37	17	8701217	8701217	+	Missense_Mutation	SNP	C	T	T	rs143056359	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8701217C>T	uc002glp.1	-	1	1370	c.1222G>A	c.(1222-1224)GCC>ACC	p.A408T		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	408	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1																		---	---	---	---
ELAC2	60528	broad.mit.edu	37	17	12919158	12919158	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12919158G>A	uc002gnz.3	-						ELAC2_uc010vvo.1_5'Flank|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597			elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0														Hereditary_Prostate_Cancer				---	---	---	---
CDRT15	146822	broad.mit.edu	37	17	14139301	14139301	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14139301G>A	uc010vvu.1	-	3	439	c.439C>T	c.(439-441)CTG>TTG	p.L147L	CDRT15_uc010coq.2_RNA	NM_001007530	NP_001007531	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	147											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)														---	---	---	---
SSH2	85464	broad.mit.edu	37	17	27958581	27958581	+	Missense_Mutation	SNP	C	T	T	rs144293105	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958581C>T	uc002heo.1	-	15	3550	c.3550G>A	c.(3550-3552)GCA>ACA	p.A1184T	SSH2_uc010wbh.1_Missense_Mutation_p.A1211T	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1184					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31618768	31618768	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31618768G>A	uc002hhu.2	-						ACCN1_uc002hht.2_Silent_p.R122R	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34094866	34094866	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34094866T>A	uc002hjy.1	-	9	1332	c.1073A>T	c.(1072-1074)GAG>GTG	p.E358V	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	358	Hemopexin-like 1.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
CCL23	6368	broad.mit.edu	37	17	34340329	34340329	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34340329G>A	uc002hkt.1	-	4	342	c.271C>T	c.(271-273)CGA>TGA	p.R91*	CCL23_uc002hks.1_Nonsense_Mutation_p.R108*	NM_145898	NP_665905	P55773	CCL23_HUMAN	small inducible cytokine A23 isoform CKbeta8	91					cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	Treprostinil(DB00374)													---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37879658	37879658	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37879658G>A	uc002hso.2	+	17	2271	c.2033G>A	c.(2032-2034)CGG>CAG	p.R678Q	ERBB2_uc002hsm.2_Missense_Mutation_p.R648Q|ERBB2_uc010cwa.2_Missense_Mutation_p.R663Q|ERBB2_uc002hsp.2_Missense_Mutation_p.R481Q|ERBB2_uc010cwb.2_Missense_Mutation_p.R678Q|ERBB2_uc010wek.1_Missense_Mutation_p.R402Q	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	678	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			---	---	---	---
KRT32	3882	broad.mit.edu	37	17	39623484	39623484	+	Missense_Mutation	SNP	G	A	A	rs149170177	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39623484G>A	uc002hwr.2	-	1	155	c.94C>T	c.(94-96)CGG>TGG	p.R32W		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	32	Head.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)																---	---	---	---
SOST	50964	broad.mit.edu	37	17	41832889	41832889	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41832889G>A	uc002iec.1	-	2	510	c.463C>T	c.(463-465)CGC>TGC	p.R155C		NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor	155	CTCK.				negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)														---	---	---	---
HOXB9	3219	broad.mit.edu	37	17	46703515	46703515	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46703515C>T	uc002inx.2	-	1	321	c.117G>A	c.(115-117)CCG>CCA	p.P39P		NM_024017	NP_076922	P17482	HXB9_HUMAN	homeobox B9	39					canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48603504	48603504	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48603504G>A	uc010wmr.1	+	14	2336	c.2174G>A	c.(2173-2175)CGG>CAG	p.R725Q	MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	688					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13069103	13069103	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13069103G>A	uc010xac.1	+	26	5058	c.4978G>A	c.(4978-4980)GCC>ACC	p.A1660T	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.A1185T|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.A82T|CEP192_uc002krw.2_5'Flank	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1660										ovary(4)|pancreas(1)	5																		---	---	---	---
C18orf19	125228	broad.mit.edu	37	18	13671878	13671878	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13671878C>T	uc010dlh.2	-	4	1000	c.568G>A	c.(568-570)GCA>ACA	p.A190T	C18orf19_uc010dlg.2_Intron|C18orf19_uc010dli.2_Missense_Mutation_p.A190T|C18orf19_uc002ksj.3_Missense_Mutation_p.A190T|C18orf19_uc010dlj.2_Intron	NM_001098801	NP_001092271	Q96ND0	CR019_HUMAN	hypothetical protein LOC125228	190	DUF1279.					integral to membrane				breast(2)	2																		---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24035755	24035755	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24035755C>T	uc002kvw.2	-	5	1286	c.726G>A	c.(724-726)ACG>ACA	p.T242T	KCTD1_uc010xbj.1_Silent_p.T850T|KCTD1_uc010xbk.1_Silent_p.T242T|KCTD1_uc002kvy.2_3'UTR	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain	242					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25572682	25572682	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25572682A>G	uc002kwg.2	-	9	1740	c.1281T>C	c.(1279-1281)CCT>CCC	p.P427P	CDH2_uc010xbn.1_Silent_p.P396P	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	427	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
C18orf34	374864	broad.mit.edu	37	18	30554568	30554568	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30554568C>T	uc002kxn.2	-	21	2608	c.2466G>A	c.(2464-2466)AGG>AGA	p.R822R	C18orf34_uc010xbq.1_RNA|C18orf34_uc010dme.1_Silent_p.R286R|C18orf34_uc010xbr.1_Silent_p.R846R|C18orf34_uc010dmf.1_Silent_p.R142R|C18orf34_uc002kxo.2_Silent_p.R784R|C18orf34_uc002kxp.2_Silent_p.R822R	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	822										ovary(1)	1																		---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43262295	43262295	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43262295G>A	uc010dnj.2	+	21	2895	c.2574G>A	c.(2572-2574)CCG>CCA	p.P858P	SLC14A2_uc002lbe.2_Silent_p.P858P	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	858	Helical; (Potential).					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67425047	67425047	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67425047G>A	uc002lkl.2	+	7	984	c.794G>A	c.(793-795)CGC>CAC	p.R265H		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	265	DKFBH motif.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
GALR1	2587	broad.mit.edu	37	18	74963015	74963015	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74963015G>A	uc002lms.3	+	1	1008	c.511G>A	c.(511-513)GCC>ACC	p.A171T		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	171	Helical; Name=4; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)														---	---	---	---
SALL3	27164	broad.mit.edu	37	18	76757125	76757125	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76757125G>A	uc002lmt.2	+	3	3706	c.3706G>A	c.(3706-3708)GGC>AGC	p.G1236S	SALL3_uc010dra.2_Missense_Mutation_p.G771S	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)														---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	76870408	76870408	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76870408G>A	uc002lmx.2	+	3	361	c.347G>A	c.(346-348)CGC>CAC	p.R116H	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Missense_Mutation_p.R116H|ATP9B_uc002lmy.1_RNA|ATP9B_uc002lmz.1_5'Flank|ATP9B_uc002lmu.2_Missense_Mutation_p.R116H	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	116	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)														---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2415849	2415849	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2415849G>A	uc010xgx.1	+							NM_182973	NP_892018			transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
C19orf28	126321	broad.mit.edu	37	19	3546376	3546376	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3546376C>A	uc002lxz.2	-	7	1241	c.1071G>T	c.(1069-1071)TGG>TGT	p.W357C	C19orf28_uc002lxw.2_Missense_Mutation_p.W357C|C19orf28_uc002lxx.2_Missense_Mutation_p.W357C|C19orf28_uc002lxy.2_Missense_Mutation_p.W348C	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	357	Helical; (Potential).				transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
PLIN4	729359	broad.mit.edu	37	19	4504766	4504766	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4504766C>T	uc002mar.1	-	6	3779	c.3779G>A	c.(3778-3780)TGC>TAC	p.C1260Y	PLIN4_uc010dub.1_Missense_Mutation_p.C284Y	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	1260						lipid particle|plasma membrane					0																		---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5240270	5240270	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5240270C>T	uc002mbv.2	-	12	1878	c.1644G>A	c.(1642-1644)CCG>CCA	p.P548P	PTPRS_uc002mbu.1_Silent_p.P535P|PTPRS_uc010xin.1_Silent_p.P535P|PTPRS_uc002mbw.2_Silent_p.P535P|PTPRS_uc002mbx.2_Silent_p.P539P|PTPRS_uc002mby.2_Silent_p.P535P	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	548	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
SLC25A23	79085	broad.mit.edu	37	19	6441978	6441978	+	3'UTR	SNP	C	T	T	rs111515970		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6441978C>T	uc002mex.1	-	10					SLC25A23_uc010duu.1_Intron|SLC25A23_uc002meu.2_Intron|SLC25A23_uc002mev.2_Intron|SLC25A23_uc002mew.1_Intron|SLC25A23_uc010xjd.1_3'UTR	NM_024103	NP_077008			solute carrier family 25, member 23						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
EMR1	2015	broad.mit.edu	37	19	6924840	6924840	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6924840C>T	uc002mfw.2	+	15	1981	c.1943C>T	c.(1942-1944)GCG>GTG	p.A648V	EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Missense_Mutation_p.A596V|EMR1_uc010xji.1_Missense_Mutation_p.A507V|EMR1_uc010xjj.1_Missense_Mutation_p.A471V	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	648	Helical; Name=2; (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)																	---	---	---	---
PNPLA6	10908	broad.mit.edu	37	19	7607530	7607530	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7607530G>A	uc010xjq.1	+	13	1558	c.1363G>A	c.(1363-1365)GGG>AGG	p.G455R	PNPLA6_uc002mgq.1_Missense_Mutation_p.G407R|PNPLA6_uc010xjp.1_Missense_Mutation_p.G407R|PNPLA6_uc002mgr.1_Missense_Mutation_p.G407R|PNPLA6_uc002mgs.2_Missense_Mutation_p.G446R	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	446	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9085173	9085173	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085173A>G	uc002mkp.2	-	1	6846	c.6642T>C	c.(6640-6642)AAT>AAC	p.N2214N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2214	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9090794	9090794	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090794C>T	uc002mkp.2	-	1	1225	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	341	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
LPPR2	64748	broad.mit.edu	37	19	11468409	11468409	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11468409C>T	uc002mre.1	+	3	397	c.60C>T	c.(58-60)TTC>TTT	p.F20F	LPPR2_uc002mrf.1_Silent_p.F20F|LPPR2_uc010dxy.1_5'Flank	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type	20	Helical; (Potential).					integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1																		---	---	---	---
CIB3	117286	broad.mit.edu	37	19	16284237	16284237	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16284237T>C	uc002nds.2	-	1	50	c.50A>G	c.(49-51)CAG>CGG	p.Q17R	CIB3_uc010eae.2_5'UTR|CIB3_uc010eaf.2_RNA|CIB3_uc010eag.2_Missense_Mutation_p.Q17R	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic	17							calcium ion binding			ovary(1)	1																		---	---	---	---
PIK3R2	5296	broad.mit.edu	37	19	18273240	18273240	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18273240C>T	uc002nia.1	+	9	1545	c.1033C>T	c.(1033-1035)CGG>TGG	p.R345W	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	345	SH2 1.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19337381	19337381	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19337381G>A	uc002nlz.2	+	7	1258	c.1159G>A	c.(1159-1161)GTT>ATT	p.V387I	NCAN_uc010ecc.1_5'UTR	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	387					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
CILP2	148113	broad.mit.edu	37	19	19656302	19656302	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19656302G>A	uc002nmv.3	+	8	3033	c.2948G>A	c.(2947-2949)CGT>CAT	p.R983H	CILP2_uc002nmw.3_Missense_Mutation_p.R989H	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	983						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1																		---	---	---	---
ZNF85	7639	broad.mit.edu	37	19	21117776	21117776	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21117776A>C	uc002npg.3	+	3	279	c.152A>C	c.(151-153)GAC>GCC	p.D51A	ZNF85_uc002npf.2_RNA|ZNF85_uc002nph.1_RNA|ZNF85_uc010ecn.2_Intron|ZNF85_uc010eco.2_5'Flank|ZNF85_uc002npi.2_5'Flank	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	51	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
GAPDHS	26330	broad.mit.edu	37	19	36033284	36033284	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36033284C>T	uc002oaf.1	+	5	629	c.513C>T	c.(511-513)GGC>GGT	p.G171G	uc010eec.1_Intron|uc002oag.2_Intron	NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,	171					gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)													---	---	---	---
ZNF567	163081	broad.mit.edu	37	19	37211245	37211245	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37211245A>G	uc010xtl.1	+	6	1841	c.1619A>G	c.(1618-1620)AAG>AGG	p.K540R	ZNF567_uc002oeo.1_Missense_Mutation_p.K540R|ZNF567_uc010xtk.1_Missense_Mutation_p.K540R|ZNF567_uc002oep.3_Missense_Mutation_p.K509R|ZNF567_uc002oeq.1_Missense_Mutation_p.K509R	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	540	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)															---	---	---	---
LGALS14	56891	broad.mit.edu	37	19	40197860	40197860	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40197860T>C	uc002omg.2	+	3	358	c.135T>C	c.(133-135)GAT>GAC	p.D45D	LGALS14_uc002omf.2_Silent_p.D74D	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform	45	Galectin.					nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)															---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40434210	40434210	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40434210A>G	uc002omp.3	-	2	67	c.59T>C	c.(58-60)TTG>TCG	p.L20S		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	20						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
CIC	23152	broad.mit.edu	37	19	42791717	42791717	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42791717G>A	uc002otf.1	+	5	643	c.603G>A	c.(601-603)CGG>CGA	p.R201R		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	201	HMG box.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)						T	DUX4	soft tissue sarcoma								---	---	---	---
BCAM	4059	broad.mit.edu	37	19	45317997	45317997	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45317997C>T	uc002ozu.2	+	8	1102	c.1058C>T	c.(1057-1059)ACG>ATG	p.T353M	BCAM_uc002ozt.1_Missense_Mutation_p.T353M	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	353	Extracellular (Potential).|Ig-like C2-type 1.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)																---	---	---	---
GEMIN7	79760	broad.mit.edu	37	19	45593386	45593386	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45593386T>C	uc002pap.1	+	3	165	c.14T>C	c.(13-15)GTG>GCG	p.V5A	uc002pas.2_5'Flank|GEMIN7_uc002paq.1_Missense_Mutation_p.V5A|GEMIN7_uc002par.1_Missense_Mutation_p.V5A	NM_001007270	NP_001007271	Q9H840	GEMI7_HUMAN	gemin 7	5					ncRNA metabolic process|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)														---	---	---	---
TRPM4	54795	broad.mit.edu	37	19	49713591	49713591	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49713591G>A	uc002pmw.2	+	21	3329	c.3257G>A	c.(3256-3258)CGC>CAC	p.R1086H	TRPM4_uc010emu.2_Missense_Mutation_p.R941H|TRPM4_uc010yak.1_Missense_Mutation_p.R550H|TRPM4_uc002pmx.2_Missense_Mutation_p.R912H|TRPM4_uc010emv.2_Missense_Mutation_p.R971H|TRPM4_uc010yal.1_Missense_Mutation_p.R732H|TRPM4_uc002pmy.2_Missense_Mutation_p.R428H	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	1086	Cytoplasmic (Potential).|Calmodulin-binding.				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)														---	---	---	---
PRMT1	3276	broad.mit.edu	37	19	50185189	50185189	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50185189G>A	uc010enf.1	+	4	257	c.215G>A	c.(214-216)CGC>CAC	p.R72H	PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Missense_Mutation_p.R48H|PRMT1_uc002ppe.2_Missense_Mutation_p.R54H|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Missense_Mutation_p.R19H|PRMT1_uc010yba.1_RNA	NM_001536	NP_001527	Q8WUW5	Q8WUW5_HUMAN	HMT1 hnRNP methyltransferase-like 2 isoform 1	53						cytoplasm	protein methyltransferase activity			ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)														---	---	---	---
TSKS	60385	broad.mit.edu	37	19	50266392	50266392	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50266392C>A	uc002ppm.2	-	1	124	c.113G>T	c.(112-114)AGG>ATG	p.R38M		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	38							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)														---	---	---	---
PTOV1	53635	broad.mit.edu	37	19	50360277	50360277	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50360277G>A	uc002pqf.1	+	6	774	c.604G>A	c.(604-606)GTG>ATG	p.V202M	PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_Missense_Mutation_p.V170M|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	202	Interaction with FLOT1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)														---	---	---	---
NR1H2	7376	broad.mit.edu	37	19	50882274	50882274	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50882274G>A	uc010enw.2	+	8	1042	c.766G>A	c.(766-768)GCA>ACA	p.A256T	NR1H2_uc002prv.3_Intron|NR1H2_uc002prz.3_Intron|NR1H2_uc002psa.3_Missense_Mutation_p.A158T	NM_007121	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	255	Ligand-binding (Potential).				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)														---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50905604	50905604	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50905604C>T	uc002psb.3	+	6	788	c.732C>T	c.(730-732)TAC>TAT	p.Y244Y	POLD1_uc002psc.3_Silent_p.Y244Y|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Silent_p.Y244Y	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	244					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
IGLON5	402665	broad.mit.edu	37	19	51826934	51826934	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51826934C>T	uc002pwc.2	+	3	177	c.177C>T	c.(175-177)CAC>CAT	p.H59H		NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor	59	Ig-like C2-type 1.					extracellular region					0																		---	---	---	---
ZNF480	147657	broad.mit.edu	37	19	52825647	52825647	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52825647C>T	uc010ydl.1	+	5	1214	c.1144C>T	c.(1144-1146)CAA>TAA	p.Q382*	ZNF480_uc002pyv.2_Nonsense_Mutation_p.Q305*|ZNF480_uc010ydm.1_Nonsense_Mutation_p.Q339*|ZNF480_uc010epn.2_Nonsense_Mutation_p.Q213*|uc002pyw.1_Intron	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN	zinc finger protein 480	382	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)														---	---	---	---
MIR518A2	574491	broad.mit.edu	37	19	54242600	54242600	+	RNA	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54242600G>A	hsa-mir-518a-2|MI0003173	+			c.14G>A			MIR517C_hsa-mir-517c|MI0003174_5'Flank																	0																		---	---	---	---
EPN1	29924	broad.mit.edu	37	19	56203248	56203248	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56203248C>T	uc002qlw.2	+	7	1233	c.891C>T	c.(889-891)GGC>GGT	p.G297G	EPN1_uc002qlv.2_Silent_p.G272G|EPN1_uc010etd.2_Silent_p.G297G|EPN1_uc002qlx.2_Silent_p.G383G	NM_001130072	NP_001123544	Q9Y6I3	EPN1_HUMAN	epsin 1 isoform b	297	Ala/Gly/Pro-rich.|8 X 3 AA repeats of [ED]-P-W.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding				0		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)														---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56539649	56539649	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539649A>C	uc002qmj.2	+	7	2050	c.2050A>C	c.(2050-2052)ACC>CCC	p.T684P	NLRP5_uc002qmi.2_Missense_Mutation_p.T665P	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	684						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
ZNF583	147949	broad.mit.edu	37	19	56935314	56935314	+	Silent	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56935314T>G	uc010ygl.1	+	5	1452	c.1287T>G	c.(1285-1287)GTT>GTG	p.V429V	ZNF583_uc002qnc.2_Silent_p.V429V|ZNF583_uc010ygm.1_Silent_p.V429V	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	429	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)														---	---	---	---
GPCPD1	56261	broad.mit.edu	37	20	5574004	5574004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5574004C>T	uc002wme.3	-	4	413	c.200G>A	c.(199-201)CGC>CAC	p.R67H		NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN	hypothetical protein LOC56261	67	CBM20.				glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0																		---	---	---	---
KIF16B	55614	broad.mit.edu	37	20	16488691	16488691	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16488691G>A	uc002wpg.1	-	7	769	c.611C>T	c.(610-612)GCG>GTG	p.A204V	KIF16B_uc010gch.1_Missense_Mutation_p.A204V|KIF16B_uc010gci.1_Missense_Mutation_p.A204V|KIF16B_uc010gcj.1_Missense_Mutation_p.A204V	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	204	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8																		---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35060650	35060650	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35060650G>A	uc002xff.2	+	3	965	c.530G>A	c.(529-531)GGC>GAC	p.G177D	DLGAP4_uc010zvp.1_Missense_Mutation_p.G177D	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	177					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
TTPAL	79183	broad.mit.edu	37	20	43108886	43108886	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43108886C>T	uc002xmc.1	+	3	371	c.247C>T	c.(247-249)CGC>TGC	p.R83C	TTPAL_uc002xmd.1_Missense_Mutation_p.R83C|TTPAL_uc010ggr.1_5'UTR	NM_024331	NP_077307	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	83						intracellular	transporter activity			breast(1)	1																		---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	45004410	45004410	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45004410C>T	uc002xrt.1	-	12	1037	c.827G>A	c.(826-828)CGC>CAC	p.R276H	ELMO2_uc010zxq.1_Missense_Mutation_p.R8H|ELMO2_uc002xrs.1_Missense_Mutation_p.R23H|ELMO2_uc002xru.1_Missense_Mutation_p.R276H|ELMO2_uc010zxr.1_Missense_Mutation_p.R288H|ELMO2_uc010zxs.1_Missense_Mutation_p.R93H|ELMO2_uc002xrv.1_5'UTR|ELMO2_uc002xrw.2_Missense_Mutation_p.R93H|ELMO2_uc002xrx.1_Missense_Mutation_p.R276H	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	276					apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC9A8	23315	broad.mit.edu	37	20	48503379	48503379	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48503379G>A	uc002xuv.1	+	15	1792	c.1582G>A	c.(1582-1584)GTG>ATG	p.V528M	SLC9A8_uc010zym.1_Missense_Mutation_p.V228M|SLC9A8_uc010gid.2_Missense_Mutation_p.V152M	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	528						Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)															---	---	---	---
SLC17A9	63910	broad.mit.edu	37	20	61598711	61598711	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61598711C>T	uc002yea.3	+	13	1354	c.1170C>T	c.(1168-1170)GGC>GGT	p.G390G	SLC17A9_uc002ydz.3_Silent_p.G384G|SLC17A9_uc011aap.1_3'UTR	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	390					exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
KRTAP21-1	337977	broad.mit.edu	37	21	32127620	32127620	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127620C>G	uc011adi.1	-	1	77	c.77G>C	c.(76-78)TGT>TCT	p.C26S		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	26						intermediate filament				breast(1)	1																		---	---	---	---
C21orf45	54069	broad.mit.edu	37	21	33651281	33651281	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33651281G>A	uc002ypi.2	-	1	96	c.45C>T	c.(43-45)GGC>GGT	p.G15G	C21orf45_uc011adn.1_Silent_p.G15G	NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45	15					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0																		---	---	---	---
MRAP	56246	broad.mit.edu	37	21	33679016	33679016	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33679016C>T	uc002ypj.2	+	4	359	c.172C>T	c.(172-174)CTC>TTC	p.L58F	MRAP_uc002ypk.2_Missense_Mutation_p.L58F|MRAP_uc011ado.1_5'UTR|MRAP_uc002ypl.2_Missense_Mutation_p.L58F|uc002ypm.2_RNA	NM_178817	NP_848932	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	58	Helical; (Potential).				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding				0																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37572809	37572809	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37572809C>T	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37665815	37665815	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37665815A>T	uc002yvg.2	+	37	6922	c.6843A>T	c.(6841-6843)TTA>TTT	p.L2281F	DOPEY2_uc011aeb.1_Missense_Mutation_p.L2230F	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	2281					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DYRK1A	1859	broad.mit.edu	37	21	38862544	38862544	+	Missense_Mutation	SNP	C	G	G	rs1049784		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38862544C>G	uc002ywk.2	+	6	807	c.732C>G	c.(730-732)AAC>AAG	p.N244K	DYRK1A_uc002ywi.2_Missense_Mutation_p.N244K|DYRK1A_uc002ywj.2_Missense_Mutation_p.N235K|DYRK1A_uc002ywl.2_Missense_Mutation_p.N244K|DYRK1A_uc002ywm.2_Missense_Mutation_p.N244K|DYRK1A_uc011aei.1_Missense_Mutation_p.N5K	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	244	Protein kinase.				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4																		---	---	---	---
UBASH3A	53347	broad.mit.edu	37	21	43833294	43833294	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43833294C>T	uc002zbe.2	+	4	552	c.516C>T	c.(514-516)TTC>TTT	p.F172F	UBASH3A_uc002zbf.2_Silent_p.F172F|UBASH3A_uc010gpc.2_RNA|UBASH3A_uc010gpd.2_RNA|UBASH3A_uc010gpe.2_Silent_p.F172F	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	172						cytosol|nucleus				ovary(3)	3																		---	---	---	---
RSPH1	89765	broad.mit.edu	37	21	43906511	43906511	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43906511G>A	uc002zbg.2	-	4	440	c.335C>T	c.(334-336)ACC>ATC	p.T112I		NM_080860	NP_543136	Q8WYR4	RSPH1_HUMAN	testis-specific gene A2	112	MORN 4.				meiosis	cytosol|nucleus				ovary(1)	1																		---	---	---	---
ITGB2	3689	broad.mit.edu	37	21	46308725	46308725	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46308725T>G	uc002zgd.2	-	13	2007	c.1963A>C	c.(1963-1965)AAC>CAC	p.N655H	ITGB2_uc002zge.2_Missense_Mutation_p.N655H|ITGB2_uc002zgf.3_Missense_Mutation_p.N655H|ITGB2_uc011afl.1_Missense_Mutation_p.N577H|ITGB2_uc010gpw.2_Missense_Mutation_p.N598H|ITGB2_uc002zgg.2_Missense_Mutation_p.N655H	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	655	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)													---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47423388	47423388	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47423388C>T	uc002zhu.1	+	35	2650	c.2548C>T	c.(2548-2550)CGC>TGC	p.R850C	COL6A1_uc010gqd.1_Missense_Mutation_p.R181C|COL6A1_uc002zhv.1_Missense_Mutation_p.R181C|COL6A1_uc002zhw.1_5'UTR	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	850	C-terminal globular domain.|VWFA 3.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
COL6A2	1292	broad.mit.edu	37	21	47549166	47549166	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47549166C>T	uc002zia.1	+						COL6A2_uc002zhy.1_3'UTR|COL6A2_uc002zhz.1_Missense_Mutation_p.P840S|COL6A2_uc002zib.1_Intron|COL6A2_uc002zic.1_Intron|COL6A2_uc010gqe.1_5'Flank	NM_001849	NP_001840			alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
ADRBK2	157	broad.mit.edu	37	22	26118420	26118420	+	3'UTR	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26118420C>A	uc003abx.3	+	21					ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151			beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)													---	---	---	---
CHEK2	11200	broad.mit.edu	37	22	29121017	29121017	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29121017G>T	uc003adu.1	-	4	612	c.540C>A	c.(538-540)CGC>CGA	p.R180R	CHEK2_uc003ads.1_Intron|CHEK2_uc010gvh.1_Intron|CHEK2_uc010gvi.1_Silent_p.R180R|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.R223R|CHEK2_uc003adv.1_Silent_p.R180R|CHEK2_uc003adw.1_Silent_p.R180R|CHEK2_uc003adx.1_5'UTR|CHEK2_uc003ady.1_Silent_p.R180R|CHEK2_uc003adz.1_Intron	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	180			R -> C (in prostate cancer; somatic mutation).|R -> H (in prostate cancer; somatic mutation).		cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20								F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				---	---	---	---
ZNRF3	84133	broad.mit.edu	37	22	29444405	29444405	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29444405G>A	uc003aeg.2	+	7	806	c.641G>A	c.(640-642)CGG>CAG	p.R214Q	ZNRF3_uc003aeh.1_Missense_Mutation_p.R214Q	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	314	RING-type; atypical.|Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1																		---	---	---	---
ASCC2	84164	broad.mit.edu	37	22	30218382	30218382	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30218382G>A	uc003agr.2	-	5	588	c.483C>T	c.(481-483)ATC>ATT	p.I161I	ASCC2_uc003ags.2_RNA|ASCC2_uc003agt.2_Silent_p.I161I|ASCC2_uc011akr.1_Silent_p.I85I	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	161					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)															---	---	---	---
MPST	4357	broad.mit.edu	37	22	37420785	37420785	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37420785C>T	uc003aqj.2	+	3	941	c.529C>T	c.(529-531)CGC>TGC	p.R177C	MPST_uc003aqi.1_Missense_Mutation_p.R177C|MPST_uc003aqm.2_Missense_Mutation_p.R177C|MPST_uc011amu.1_Missense_Mutation_p.R197C|MPST_uc003aql.2_Missense_Mutation_p.R177C|MPST_uc003aqn.2_Missense_Mutation_p.R177C|MPST_uc003aqo.2_Missense_Mutation_p.R177C	NM_001130517	NP_001123989	P25325	THTM_HUMAN	mercaptopyruvate sulfurtransferase isoform 2	177	Rhodanese 2.				cyanate catabolic process|response to toxin		3-mercaptopyruvate sulfurtransferase activity|thiosulfate sulfurtransferase activity				0																		---	---	---	---
SH3BP1	23616	broad.mit.edu	37	22	38046564	38046564	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38046564T>C	uc003ati.2	+	16	1541	c.1430T>C	c.(1429-1431)GTG>GCG	p.V477A	SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_3'UTR|SH3BP1_uc003ath.1_Missense_Mutation_p.V477A|SH3BP1_uc003atj.1_Missense_Mutation_p.V413A|SH3BP1_uc003atk.1_Missense_Mutation_p.V391A|uc003atl.1_RNA	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	477					signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
GCAT	23464	broad.mit.edu	37	22	38209628	38209628	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38209628C>T	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106			glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	38421886	38421886	+	IGR	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38421886G>A								POLR2F (37545 upstream) : PICK1 (31376 downstream)																																			---	---	---	---
RANGAP1	5905	broad.mit.edu	37	22	41676938	41676938	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41676938A>G	uc003azs.2	-	1	1581	c.111T>C	c.(109-111)GAT>GAC	p.D37D	RANGAP1_uc003azt.2_Silent_p.D37D|RANGAP1_uc003azu.2_Silent_p.D37D|RANGAP1_uc011aoz.1_5'Flank	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	37					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0																		---	---	---	---
PARVB	29780	broad.mit.edu	37	22	44514998	44514998	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44514998C>T	uc003ben.2	+	4	406	c.354C>T	c.(352-354)GGC>GGT	p.G118G	PARVB_uc003bem.2_Silent_p.G151G|PARVB_uc010gzn.2_Silent_p.G66G|PARVB_uc003beo.2_Silent_p.G81G	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b	118	CH 1.				cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---
PLXNB2	23654	broad.mit.edu	37	22	50726198	50726198	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50726198C>T	uc003bkv.3	-	7	1612	c.1506G>A	c.(1504-1506)CCG>CCA	p.P502P		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	502	Extracellular (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
LMF2	91289	broad.mit.edu	37	22	50944598	50944598	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50944598C>T	uc003blp.2	-	5	671	c.640G>A	c.(640-642)GCC>ACC	p.A214T	LMF2_uc010hba.2_Missense_Mutation_p.A36T|LMF2_uc003blo.2_Missense_Mutation_p.A189T|NCAPH2_uc003blq.3_5'Flank|NCAPH2_uc003blv.2_5'Flank|NCAPH2_uc003blr.3_5'Flank|NCAPH2_uc010hbb.2_5'Flank|NCAPH2_uc003blu.3_5'Flank|NCAPH2_uc003bls.3_5'Flank|NCAPH2_uc003blt.3_5'Flank|NCAPH2_uc003blw.3_5'Flank|NCAPH2_uc003blx.3_5'Flank|NCAPH2_uc003bly.3_5'Flank	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	214						endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
PPP2R3B	28227	broad.mit.edu	37	X	295141	295141	+	Silent	SNP	G	A	A	rs144810281		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:295141G>A	uc004cpg.2	-	13	1890	c.1689C>T	c.(1687-1689)TAC>TAT	p.Y563Y	PPP2R3B_uc004cpf.2_Silent_p.Y164Y	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',	563					cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
PIGA	5277	broad.mit.edu	37	X	15349629	15349629	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15349629C>T	uc004cwr.2	-	2	524	c.424G>A	c.(424-426)GCC>ACC	p.A142T	PIGA_uc004cwq.2_Intron|PIGA_uc010nev.2_Intron|PIGA_uc004cws.2_Intron|PIGA_uc011miq.1_Intron|PIGA_uc010new.1_Intron	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol	142	Cytoplasmic (Potential).				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)																	---	---	---	---
MAGEB16	139604	broad.mit.edu	37	X	35821242	35821242	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35821242C>T	uc010ngt.1	+	2	1208	c.929C>T	c.(928-930)GCG>GTG	p.A310V		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	310	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7																		---	---	---	---
CASK	8573	broad.mit.edu	37	X	41379720	41379720	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41379720G>A	uc004dfl.3	-	27	2765	c.2719C>T	c.(2719-2721)CTC>TTC	p.L907F	CASK_uc004dfj.3_Missense_Mutation_p.L452F|CASK_uc004dfk.3_Missense_Mutation_p.L727F|CASK_uc004dfm.3_Missense_Mutation_p.L884F|CASK_uc004dfn.3_Missense_Mutation_p.L883F	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein	912					cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6																		---	---	---	---
SUV39H1	6839	broad.mit.edu	37	X	48564698	48564698	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48564698G>T	uc004dkn.2	+	4	916	c.871G>T	c.(871-873)GAC>TAC	p.D291Y	SUV39H1_uc011mmf.1_Missense_Mutation_p.D302Y|SUV39H1_uc011mmg.1_RNA	NM_003173	NP_003164	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1	291	Mediates interaction with MECOM (By similarity).|SET.				cell cycle|cell differentiation|chromatin silencing at rDNA|interspecies interaction between organisms|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|chromosome, centromeric region|condensed nuclear chromosome|rDNA heterochromatin	chromatin binding|histone methyltransferase activity (H3-K9 specific)|protein N-terminus binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	51150887	51150887	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51150887C>T	uc004dpj.2	+	1	1121	c.1019C>T	c.(1018-1020)ACG>ATG	p.T340M		NM_203407	NP_981952			hypothetical protein LOC340602																														---	---	---	---
WNK3	65267	broad.mit.edu	37	X	54276024	54276024	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54276024C>A	uc004dtd.1	-	17	3196	c.2757G>T	c.(2755-2757)TTG>TTT	p.L919F	WNK3_uc004dtc.1_Missense_Mutation_p.L919F	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	919					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11																		---	---	---	---
UBQLN2	29978	broad.mit.edu	37	X	56591820	56591820	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56591820T>C	uc004dus.2	+	1	1749	c.1514T>C	c.(1513-1515)GTC>GCC	p.V505A	UBQLN2_uc011moq.1_Intron	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	505	5.|12 X 3 AA tandem repeats of P-X-X.					cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2																		---	---	---	---
LAS1L	81887	broad.mit.edu	37	X	64753482	64753482	+	Intron	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64753482G>T	uc004dwa.1	-						LAS1L_uc004dwc.1_Intron|LAS1L_uc004dwd.1_Intron	NM_031206	NP_112483			LAS1-like							MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
RGAG4	340526	broad.mit.edu	37	X	71351350	71351350	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71351350G>A	uc010nlh.1	-	1	402	c.41C>T	c.(40-42)GCG>GTG	p.A14V	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank|NHSL2_uc010nli.2_5'Flank	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	14										ovary(2)|skin(1)	3	Renal(35;0.156)																	---	---	---	---
ERCC6L	54821	broad.mit.edu	37	X	71427426	71427426	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427426C>T	uc004eaq.1	-	2	1288	c.1191G>A	c.(1189-1191)ACG>ACA	p.T397T	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.T274T	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	397					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)																	---	---	---	---
CDX4	1046	broad.mit.edu	37	X	72674374	72674374	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72674374C>T	uc011mqk.1	+	3	808	c.808C>T	c.(808-810)CGT>TGT	p.R270C		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	270						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)																	---	---	---	---
SATL1	340562	broad.mit.edu	37	X	84363384	84363384	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84363384G>A	uc011mqx.1	-	1	591	c.591C>T	c.(589-591)GGC>GGT	p.G197G	SATL1_uc004een.2_Silent_p.G197G	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	10	Gln-rich.						N-acetyltransferase activity			breast(2)	2																		---	---	---	---
TRMT2B	79979	broad.mit.edu	37	X	100274338	100274338	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100274338A>G	uc004egq.2	-	11	1522	c.1223T>C	c.(1222-1224)CTG>CCG	p.L408P	TRMT2B_uc004egp.2_RNA|TRMT2B_uc004egr.2_Missense_Mutation_p.L408P|TRMT2B_uc004egs.2_Missense_Mutation_p.L408P|TRMT2B_uc004egt.2_Missense_Mutation_p.L408P|TRMT2B_uc004egu.2_Missense_Mutation_p.L289P|TRMT2B_uc004egv.2_Missense_Mutation_p.L363P	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B	408							tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1																		---	---	---	---
TCEAL6	158931	broad.mit.edu	37	X	101396155	101396155	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101396155G>T	uc004eiq.2	-	3	310	c.149C>A	c.(148-150)GCT>GAT	p.A50D		NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	50	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1																		---	---	---	---
AGRN	375790	broad.mit.edu	37	1	979010	979010	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:979010G>A	uc001ack.1	+	9	1746	c.1696G>A	c.(1696-1698)GTG>ATG	p.V566M		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	566	Kazal-like 6.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)														---	---	---	---
PER3	8863	broad.mit.edu	37	1	7887631	7887631	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7887631C>T	uc001aoo.2	+	17	2793	c.2618C>T	c.(2617-2619)GCG>GTG	p.A873V	PER3_uc009vmg.1_Missense_Mutation_p.A881V|PER3_uc009vmh.1_Missense_Mutation_p.A874V|PER3_uc001aop.2_Missense_Mutation_p.A881V|PER3_uc010nzw.1_Missense_Mutation_p.A562V	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	873	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TNFRSF9	3604	broad.mit.edu	37	1	7995117	7995117	+	Missense_Mutation	SNP	G	A	A	rs145966863	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7995117G>A	uc001aot.2	-	6	628	c.500C>T	c.(499-501)CCG>CTG	p.P167L		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	167	Extracellular (Potential).				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ZBTB17	7709	broad.mit.edu	37	1	16268919	16268919	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16268919C>T	uc001axl.3	-						ZBTB17_uc010obq.1_Intron|ZBTB17_uc010obr.1_Missense_Mutation_p.A686T|ZBTB17_uc010obs.1_Intron	NM_003443	NP_003434			zinc finger and BTB domain containing 17						negative regulation of cell cycle	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ARHGEF10L	55160	broad.mit.edu	37	1	17952451	17952451	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17952451C>T	uc001ban.2	+	14	1477	c.1318C>T	c.(1318-1320)CGA>TGA	p.R440*	ARHGEF10L_uc009vpe.1_Nonsense_Mutation_p.R401*|ARHGEF10L_uc001bao.2_Nonsense_Mutation_p.R401*|ARHGEF10L_uc001bap.2_Nonsense_Mutation_p.R401*|ARHGEF10L_uc010ocr.1_Nonsense_Mutation_p.R198*|ARHGEF10L_uc001baq.2_Nonsense_Mutation_p.R206*|ARHGEF10L_uc010ocs.1_Nonsense_Mutation_p.R218*|ARHGEF10L_uc001bar.2_Intron|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	440	DH.				regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)														---	---	---	---
ZBTB40	9923	broad.mit.edu	37	1	22848916	22848916	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22848916G>A	uc001bft.2	+	17	3769	c.3258G>A	c.(3256-3258)ACG>ACA	p.T1086T	ZBTB40_uc001bfu.2_Silent_p.T1086T|ZBTB40_uc009vqi.1_Silent_p.T974T	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1086	C2H2-type 10.				bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)														---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26360246	26360246	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26360246G>A	uc001blf.2	+	9	2445	c.1578G>A	c.(1576-1578)ACG>ACA	p.T526T		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	526	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CATSPER4	378807	broad.mit.edu	37	1	26524487	26524487	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26524487C>A	uc010oez.1	+	5	597	c.597C>A	c.(595-597)CCC>CCA	p.P199P	CATSPER4_uc010oey.1_Silent_p.P21P|CATSPER4_uc009vsf.2_RNA	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	199	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27099008	27099008	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27099008C>T	uc001bmv.1	+	13	3797	c.3424C>T	c.(3424-3426)CAG>TAG	p.Q1142*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.Q1142*|ARID1A_uc001bmu.1_Nonsense_Mutation_p.Q1142*|ARID1A_uc001bmw.1_Nonsense_Mutation_p.Q759*|ARID1A_uc001bmx.1_5'UTR|ARID1A_uc009vsm.1_5'Flank|ARID1A_uc009vsn.1_5'Flank	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1142					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
ARID1A	8289	broad.mit.edu	37	1	27106861	27106861	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106861C>T	uc001bmv.1	+	20	6845	c.6472C>T	c.(6472-6474)CGA>TGA	p.R2158*	ARID1A_uc001bmu.1_Nonsense_Mutation_p.R1941*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.R1004*|ARID1A_uc009vsm.1_Nonsense_Mutation_p.R486*|ARID1A_uc009vsn.1_Nonsense_Mutation_p.R400*	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	2158					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	p.R2158*(1)		ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)				Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								---	---	---	---
FAM46B	115572	broad.mit.edu	37	1	27332693	27332693	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27332693G>A	uc010ofj.1	-	2	1192	c.1020C>T	c.(1018-1020)TAC>TAT	p.Y340Y		NM_052943	NP_443175	Q96A09	FA46B_HUMAN	hypothetical protein LOC115572	340										central_nervous_system(1)	1		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
TAF12	6883	broad.mit.edu	37	1	28948573	28948573	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28948573T>C	uc001bqw.2	-	1	114	c.21A>G	c.(19-21)TCA>TCG	p.S7S	TAF12_uc001bqx.2_Silent_p.S7S|TAF12_uc001bqy.2_Silent_p.S7S|TAF12_uc009vti.2_Silent_p.S7S	NM_005644	NP_005635	Q16514	TAF12_HUMAN	TAF12 RNA polymerase II, TATA box binding	7					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	PCAF complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Renal(390;0.00121)|Breast(348;0.00502)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)		Colorectal(126;3.21e-08)|COAD - Colon adenocarcinoma(152;1.74e-06)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(1967;0.0109)|BRCA - Breast invasive adenocarcinoma(304;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
NKAIN1	79570	broad.mit.edu	37	1	31655387	31655387	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31655387C>A	uc010ogd.1	-	5	528	c.522G>T	c.(520-522)GAG>GAT	p.E174D	NKAIN1_uc001bsn.2_Missense_Mutation_p.E130D|NKAIN1_uc010ogc.1_Missense_Mutation_p.E103D	NM_024522	NP_078798	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1	174	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)														---	---	---	---
BAI2	576	broad.mit.edu	37	1	32201998	32201998	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32201998G>A	uc001btn.2	-						BAI2_uc001btm.2_5'Flank|BAI2_uc001btp.1_5'UTR|BAI2_uc010ogn.1_Intron|BAI2_uc010ogo.1_Intron|BAI2_uc010ogp.1_Intron|BAI2_uc010ogq.1_Intron|BAI2_uc001bto.2_Intron	NM_001703	NP_001694			brain-specific angiogenesis inhibitor 2						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(5)|breast(4)|ovary(2)|central_nervous_system(1)|skin(1)	13		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)														---	---	---	---
RNF19B	127544	broad.mit.edu	37	1	33411121	33411121	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33411121T>C	uc010oho.1	-	5	1258	c.1258A>G	c.(1258-1260)AGT>GGT	p.S420G	RNF19B_uc001bwm.3_Missense_Mutation_p.S419G|RNF19B_uc010ohp.1_Missense_Mutation_p.S419G	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	420	Helical; (Potential).					integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34554619	34554619	+	Silent	SNP	C	T	T	rs141030168		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34554619C>T	uc001bxn.1	-	2	272	c.243G>A	c.(241-243)TCG>TCA	p.S81S	CSMD2_uc001bxm.1_Silent_p.S121S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	81	CUB 1.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
CCDC30	728621	broad.mit.edu	37	1	43119565	43119565	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43119565G>A	uc009vwk.1	+	16	2328	c.2218G>A	c.(2218-2220)GCA>ACA	p.A740T	CCDC30_uc001chm.2_Missense_Mutation_p.A438T|CCDC30_uc001chn.2_Missense_Mutation_p.A529T	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	740											0																		---	---	---	---
IPO13	9670	broad.mit.edu	37	1	44426892	44426892	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44426892T>A	uc001ckx.2	+	14	3097	c.2302T>A	c.(2302-2304)TTC>ATC	p.F768I		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	768					protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)																---	---	---	---
CYP4Z1	199974	broad.mit.edu	37	1	47560306	47560306	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47560306C>T	uc001cqu.1	+	7	844	c.841C>T	c.(841-843)CGC>TGC	p.R281C		NM_178134	NP_835235	Q86W10	CP4Z1_HUMAN	cytochrome P450 4Z1	281	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			skin(1)	1																		---	---	---	---
MYSM1	114803	broad.mit.edu	37	1	59132821	59132821	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59132821G>T	uc009wab.1	-	16	1943	c.1920C>A	c.(1918-1920)GCC>GCA	p.A640A	MYSM1_uc009waa.1_Silent_p.A46A|MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	640	MPN.				histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)																	---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65851439	65851439	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65851439G>A	uc001dcd.1	+	7	838	c.674G>A	c.(673-675)CGC>CAC	p.R225H	DNAJC6_uc001dcc.1_Missense_Mutation_p.R256H|DNAJC6_uc010opc.1_Missense_Mutation_p.R212H|DNAJC6_uc001dce.1_Missense_Mutation_p.R282H	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	225					cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
WDR78	79819	broad.mit.edu	37	1	67313177	67313177	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67313177A>G	uc001dcx.2	-	8	1337	c.1281T>C	c.(1279-1281)CCT>CCC	p.P427P	WDR78_uc001dcy.2_Silent_p.P427P|WDR78_uc009waw.2_Silent_p.P173P|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	427										ovary(2)	2																		---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94480241	94480241	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94480241G>A	uc001dqh.2	-	38	5422	c.5318C>T	c.(5317-5319)GCG>GTG	p.A1773V	ABCA4_uc009wdp.1_Missense_Mutation_p.A41V	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1773	Helical; (Potential).				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107867388	107867388	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107867388A>G	uc001dvh.3	+	3	1449	c.731A>G	c.(730-732)TAC>TGC	p.Y244C	NTNG1_uc001dvf.3_Missense_Mutation_p.Y244C|NTNG1_uc010out.1_Missense_Mutation_p.Y244C|NTNG1_uc001dvc.3_Missense_Mutation_p.Y244C|NTNG1_uc001dvd.1_Missense_Mutation_p.Y244C	NM_001113226	NP_001106697	Q9Y2I2	NTNG1_HUMAN	netrin G1 isoform 1	244	Laminin N-terminal.				axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108417623	108417623	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108417623T>C	uc001dvk.1	-	2	275	c.221A>G	c.(220-222)AAC>AGC	p.N74S	VAV3_uc010ouw.1_Missense_Mutation_p.N74S|VAV3_uc001dvl.1_5'UTR|VAV3_uc010oux.1_Missense_Mutation_p.N74S	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	74	CH.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
AMPD2	271	broad.mit.edu	37	1	110168017	110168017	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110168017C>T	uc009wfh.1	+	3	888	c.346C>T	c.(346-348)CGC>TGC	p.R116C	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.R35C|AMPD2_uc001dyc.1_Missense_Mutation_p.R116C|AMPD2_uc010ovr.1_Intron|AMPD2_uc010ovs.1_5'UTR|AMPD2_uc001dyd.1_5'Flank	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	116					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)														---	---	---	---
KCND3	3752	broad.mit.edu	37	1	112318756	112318756	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112318756G>A	uc001ebu.1	-	8	2391	c.1911C>T	c.(1909-1911)GGC>GGT	p.G637G	KCND3_uc001ebv.1_Silent_p.G618G	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	637	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
PTGFRN	5738	broad.mit.edu	37	1	117509774	117509774	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117509774C>T	uc001egv.1	+	6	2018	c.1881C>T	c.(1879-1881)GGC>GGT	p.G627G		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	627	Ig-like C2-type 5.|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)														---	---	---	---
MAN1A2	10905	broad.mit.edu	37	1	117944904	117944904	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117944904T>C	uc001ehd.1	+	2	1120	c.399T>C	c.(397-399)ATT>ATC	p.I133I	MAN1A2_uc009whg.1_Intron	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	133	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)														---	---	---	---
THEM4	117145	broad.mit.edu	37	1	151849482	151849482	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151849482G>A	uc001ezj.1	-	5	856	c.677C>T	c.(676-678)GCG>GTG	p.A226V	THEM4_uc001ezk.1_RNA	NM_053055	NP_444283	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	226					insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane					0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152284170	152284170	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284170C>T	uc001ezu.1	-	3	3228	c.3192G>A	c.(3190-3192)TGG>TGA	p.W1064*	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1064	Filaggrin 6.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FLG	2312	broad.mit.edu	37	1	152284172	152284172	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284172A>G	uc001ezu.1	-	3	3226	c.3190T>C	c.(3190-3192)TGG>CGG	p.W1064R	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1064	Filaggrin 6.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
FCRL5	83416	broad.mit.edu	37	1	157497672	157497672	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157497672G>A	uc001fqu.2	-	9	1853	c.1695C>T	c.(1693-1695)CGC>CGT	p.R565R	FCRL5_uc009wsm.2_Silent_p.R565R|FCRL5_uc010phv.1_Silent_p.R565R|FCRL5_uc010phw.1_Silent_p.R480R	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	565	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity	p.R565H(1)		ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)																---	---	---	---
OR10Z1	128368	broad.mit.edu	37	1	158576516	158576516	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158576516C>T	uc010pio.1	+	1	288	c.288C>T	c.(286-288)GGC>GGT	p.G96G		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)																	---	---	---	---
ATP1A4	480	broad.mit.edu	37	1	160129326	160129326	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160129326G>A	uc001fve.3	+						ATP1A4_uc001fvf.3_Intron	NM_144699	NP_653300			Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
ADAMTS4	9507	broad.mit.edu	37	1	161163166	161163166	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161163166C>T	uc001fyt.3	-	7	2176	c.1748G>A	c.(1747-1749)CGC>CAC	p.R583H		NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	583	Cys-rich.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)															---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178411966	178411966	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178411966G>A	uc001glr.2	+	6	765	c.640G>A	c.(640-642)GAA>AAA	p.E214K	RASAL2_uc001glq.2_Missense_Mutation_p.E362K	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	214	C2.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
QSOX1	5768	broad.mit.edu	37	1	180135652	180135652	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180135652G>A	uc001gnz.2	+	2	367	c.292G>A	c.(292-294)GCC>ACC	p.A98T	QSOX1_uc001gny.2_Missense_Mutation_p.A98T|QSOX1_uc001goa.2_Missense_Mutation_p.A98T	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	98	Thioredoxin.				cell redox homeostasis|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PRG4	10216	broad.mit.edu	37	1	186280649	186280649	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186280649A>T	uc001gru.3	+	10	3765	c.3714A>T	c.(3712-3714)GGA>GGT	p.G1238G	PRG4_uc001grt.3_Silent_p.G1197G|PRG4_uc009wyl.2_Silent_p.G1145G|PRG4_uc009wym.2_Silent_p.G1104G|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	1238	Hemopexin-like 2.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
F13B	2165	broad.mit.edu	37	1	197009701	197009701	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197009701G>A	uc001gtt.1	-	11	1947	c.1903C>T	c.(1903-1905)CAA>TAA	p.Q635*		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	635	Sushi 10.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
PPFIA4	8497	broad.mit.edu	37	1	203026010	203026010	+	Missense_Mutation	SNP	G	A	A	rs142427146	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203026010G>A	uc001gyz.2	+	6	1414	c.821G>A	c.(820-822)GGC>GAC	p.G274D	PPFIA4_uc009xaj.2_Missense_Mutation_p.G905D|PPFIA4_uc010pqf.1_Missense_Mutation_p.G487D|PPFIA4_uc001gza.2_Missense_Mutation_p.G274D|PPFIA4_uc001gzb.1_5'UTR	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	274					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
ZC3H11A	9877	broad.mit.edu	37	1	203798733	203798733	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203798733G>A	uc001hac.2	+	8	1069	c.453G>A	c.(451-453)ACG>ACA	p.T151T	ZC3H11A_uc001had.2_Silent_p.T151T|ZC3H11A_uc001hae.2_Silent_p.T151T|ZC3H11A_uc001haf.2_Silent_p.T151T|ZC3H11A_uc010pqm.1_Silent_p.T97T|ZC3H11A_uc001hag.1_Silent_p.T151T	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	151							nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
CR1	1378	broad.mit.edu	37	1	207737304	207737304	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207737304C>T	uc001hfy.2	+	14	2472	c.2332C>T	c.(2332-2334)CCC>TCC	p.P778S	CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Missense_Mutation_p.P1228S|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	778	Sushi 12.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
SERTAD4	56256	broad.mit.edu	37	1	210415495	210415495	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210415495G>A	uc001hhy.2	+	4	1063	c.884G>A	c.(883-885)GGC>GAC	p.G295D	SERTAD4_uc009xcw.2_Missense_Mutation_p.G295D	NM_019605	NP_062551	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	295							protein binding			ovary(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)														---	---	---	---
DTL	51514	broad.mit.edu	37	1	212220516	212220516	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212220516G>A	uc009xdc.2	+	4	615	c.301G>A	c.(301-303)GTC>ATC	p.V101I	DTL_uc010ptb.1_Missense_Mutation_p.V59I|DTL_uc001hiz.3_5'UTR	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN	denticleless homolog	101	WD 2.				DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
VASH2	79805	broad.mit.edu	37	1	213146075	213146075	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213146075C>T	uc001hjy.2	+	5	855	c.651C>T	c.(649-651)GAC>GAT	p.D217D	VASH2_uc001hjv.2_RNA|VASH2_uc001hjx.2_Silent_p.D152D|VASH2_uc010ptn.1_Silent_p.D113D|VASH2_uc001hjw.2_Silent_p.D173D	NM_001136475	NP_001129947	Q86V25	VASH2_HUMAN	vasohibin 2 isoform 3	217					positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)														---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237804199	237804199	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237804199A>G	uc001hyl.1	+	47	7238	c.7118A>G	c.(7117-7119)GAC>GGC	p.D2373G		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2373	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248458331	248458331	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458331G>A	uc010pzj.1	-	1	550	c.550C>T	c.(550-552)CGT>TGT	p.R184C		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
OR2T34	127068	broad.mit.edu	37	1	248737709	248737709	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737709A>C	uc001iep.1	-	1	350	c.350T>G	c.(349-351)GTT>GGT	p.V117G		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
PQLC3	130814	broad.mit.edu	37	2	11315100	11315100	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11315100T>C	uc002rbc.2	+	6	615	c.482T>C	c.(481-483)ATA>ACA	p.I161T	PQLC3_uc010yjk.1_Intron	NM_152391	NP_689604	Q8N755	PQLC3_HUMAN	PQ loop repeat containing 3 precursor	161						integral to membrane					0	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0978)|OV - Ovarian serous cystadenocarcinoma(76;0.132)														---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11742628	11742628	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11742628G>A	uc002rbk.1	+	17	2926	c.2626G>A	c.(2626-2628)GAT>AAT	p.D876N	GREB1_uc002rbo.1_Missense_Mutation_p.D510N	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	876						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
C2orf84	653140	broad.mit.edu	37	2	24398452	24398452	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24398452C>T	uc002rfc.2	+						C2orf84_uc010eyc.2_Intron	NM_001040710	NP_001035800			hypothetical protein LOC653140												0																		---	---	---	---
FBXO11	80204	broad.mit.edu	37	2	48046138	48046138	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48046138C>T	uc010fbl.2	-	15	1739	c.1625G>A	c.(1624-1626)AGC>AAC	p.S542N	FBXO11_uc002rwe.2_Missense_Mutation_p.S542N|FBXO11_uc002rwf.2_Missense_Mutation_p.S542N|FBXO11_uc002rwg.1_Missense_Mutation_p.S542N|FBXO11_uc010fbk.2_Missense_Mutation_p.S50N	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1	626	PbH1 11.				ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
MTIF2	4528	broad.mit.edu	37	2	55476523	55476523	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55476523G>A	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369			mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
USP34	9736	broad.mit.edu	37	2	61430387	61430387	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61430387G>A	uc002sbe.2	-	75	9418	c.9396C>T	c.(9394-9396)GAC>GAT	p.D3132D	USP34_uc002sbd.2_Intron	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	3132					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
HSPC159	29094	broad.mit.edu	37	2	64683599	64683599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64683599G>T	uc002scy.3	+	4	728	c.375G>T	c.(373-375)AGG>AGT	p.R125S		NM_014181	NP_054900	Q3ZCW2	LEGL_HUMAN	galectin-related protein	125	Galectin.					intracellular	sugar binding				0																		---	---	---	---
FBXO41	150726	broad.mit.edu	37	2	73491512	73491512	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73491512C>A	uc002sjb.1	-	6	1883	c.1883G>T	c.(1882-1884)CGC>CTC	p.R628L		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	567						intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3																		---	---	---	---
MOGS	7841	broad.mit.edu	37	2	74689823	74689823	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74689823C>T	uc010ffj.2	-	4	1256	c.1093G>A	c.(1093-1095)GCT>ACT	p.A365T	MOGS_uc010ffh.2_Missense_Mutation_p.A90T|MOGS_uc010yrt.1_Missense_Mutation_p.A246T|MOGS_uc010ffi.2_Missense_Mutation_p.A259T	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	365	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0																		---	---	---	---
HTRA2	27429	broad.mit.edu	37	2	74760069	74760069	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74760069G>A	uc002smi.1	+	8	1936	c.1334G>A	c.(1333-1335)CGA>CAA	p.R445Q	HTRA2_uc002smj.1_Missense_Mutation_p.R348Q|HTRA2_uc002smk.1_Missense_Mutation_p.R423Q|HTRA2_uc002sml.1_Missense_Mutation_p.R413Q|HTRA2_uc002smm.1_Missense_Mutation_p.R186Q|HTRA2_uc002smn.1_Missense_Mutation_p.R186Q|LOXL3_uc002smo.1_3'UTR|LOXL3_uc010ffm.1_3'UTR|LOXL3_uc002smp.1_3'UTR|LOXL3_uc002smq.1_3'UTR	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein	445	PDZ.				apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
PTCD3	55037	broad.mit.edu	37	2	86354439	86354439	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86354439G>A	uc002sqw.2	+						PTCD3_uc002sqx.1_Intron	NM_017952	NP_060422			pentatricopeptide repeat domain 3 precursor							mitochondrion	protein binding			ovary(1)	1																		---	---	---	---
PROM2	150696	broad.mit.edu	37	2	95954315	95954315	+	Missense_Mutation	SNP	C	T	T	rs35884217	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95954315C>T	uc002suh.1	+	22	2552	c.2419C>T	c.(2419-2421)CGT>TGT	p.R807C	PROM2_uc002sui.2_Missense_Mutation_p.R807C|PROM2_uc002suj.2_Missense_Mutation_p.R461C|PROM2_uc002suk.2_Missense_Mutation_p.R807C|PROM2_uc002sul.2_Missense_Mutation_p.R333C|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	807	Cytoplasmic (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1																		---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97784159	97784159	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97784159G>A	uc010yva.1	+	3	635	c.391G>A	c.(391-393)GGA>AGA	p.G131R	ANKRD36_uc002sxn.2_Missense_Mutation_p.G131R|ANKRD36_uc010yuz.1_RNA|ANKRD36_uc010fic.2_5'UTR|ANKRD36_uc002sxo.2_Missense_Mutation_p.G131R|ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	131	ANK 4.										0																		---	---	---	---
GPR45	11250	broad.mit.edu	37	2	105858611	105858611	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105858611G>A	uc002tco.1	+	1	412	c.296G>A	c.(295-297)CGC>CAC	p.R99H		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	99	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
TGFBRAP1	9392	broad.mit.edu	37	2	105886050	105886050	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105886050C>T	uc002tcq.2	-	11	2169	c.2085G>A	c.(2083-2085)GCG>GCA	p.A695A	TGFBRAP1_uc010fjc.2_Silent_p.A464A|TGFBRAP1_uc002tcr.3_Silent_p.A695A	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	695					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
C2orf40	84417	broad.mit.edu	37	2	106694342	106694342	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106694342G>A	uc010fjf.2	+	4	515	c.407G>A	c.(406-408)GGC>GAC	p.G136D		NM_032411	NP_115787	Q9H1Z8	AUGN_HUMAN	esophageal cancer related gene 4 protein	136						extracellular region|transport vesicle					0																		---	---	---	---
TTL	150465	broad.mit.edu	37	2	113277874	113277874	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113277874C>T	uc002thu.2	+	6	1070	c.891C>T	c.(889-891)AGC>AGT	p.S297S	TTL_uc010fkm.1_Intron	NM_153712	NP_714923	Q8NG68	TTL_HUMAN	tubulin tyrosine ligase	297	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity				0		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)				T	ETV6	ALL								---	---	---	---
YSK4	80122	broad.mit.edu	37	2	135738842	135738842	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135738842G>A	uc002tue.1	-	9	3500	c.3469C>T	c.(3469-3471)CCA>TCA	p.P1157S	YSK4_uc002tuf.1_Missense_Mutation_p.P339S|YSK4_uc010fnc.1_Missense_Mutation_p.P291S|YSK4_uc010fnd.1_Missense_Mutation_p.P1044S|YSK4_uc010zbg.1_Missense_Mutation_p.P289S|YSK4_uc002tuh.3_Missense_Mutation_p.P885S|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1157	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136473119	136473119	+	Splice_Site	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136473119G>T	uc002tuo.2	+	23	3002	c.2632_splice	c.e23-1	p.H878_splice	R3HDM1_uc010fni.2_Splice_Site_p.H877_splice|R3HDM1_uc002tup.2_Splice_Site_p.H823_splice|R3HDM1_uc010zbh.1_Splice_Site_p.H626_splice	NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
HNMT	3176	broad.mit.edu	37	2	138771371	138771371	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138771371A>G	uc002tvc.2	+	7	698	c.550A>G	c.(550-552)AAA>GAA	p.K184E	HNMT_uc002tvf.2_Missense_Mutation_p.K184E	NM_006895	NP_008826	P50135	HNMT_HUMAN	histamine N-methyltransferase isoform 1	184					respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)													---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154996962	154996962	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154996962T>C	uc002tyr.3	+	4	822	c.255T>C	c.(253-255)CTT>CTC	p.L85L	GALNT13_uc002tyt.3_Silent_p.L85L|GALNT13_uc010foc.1_5'UTR	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	85	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170101424	170101424	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170101424G>A	uc002ues.2	-	22	3422	c.3209C>T	c.(3208-3210)TCG>TTG	p.S1070L	LRP2_uc010zdf.1_Missense_Mutation_p.S933L	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1070	LDL-receptor class A 9.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
TTC30A	92104	broad.mit.edu	37	2	178482139	178482139	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178482139C>T	uc002ulo.2	-	1	1556	c.1291G>A	c.(1291-1293)GCA>ACA	p.A431T		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	431	TPR 6.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)															---	---	---	---
TTC30A	92104	broad.mit.edu	37	2	178483032	178483032	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178483032C>T	uc002ulo.2	-	1	663	c.398G>A	c.(397-399)AGG>AAG	p.R133K		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	133					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179423360	179423360	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179423360T>G	uc010zfg.1	-	276	79346	c.79122A>C	c.(79120-79122)AAA>AAC	p.K26374N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K20069N|TTN_uc010zfi.1_Missense_Mutation_p.K20002N|TTN_uc010zfj.1_Missense_Mutation_p.K19877N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27301							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179439680	179439680	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179439680G>A	uc010zfg.1	-	275	63699	c.63475C>T	c.(63475-63477)CCA>TCA	p.P21159S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P14854S|TTN_uc010zfi.1_Missense_Mutation_p.P14787S|TTN_uc010zfj.1_Missense_Mutation_p.P14662S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22086							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179447097	179447097	+	Missense_Mutation	SNP	C	T	T	rs72646868		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179447097C>T	uc010zfg.1	-	263	58606	c.58382G>A	c.(58381-58383)CGT>CAT	p.R19461H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R13156H|TTN_uc010zfi.1_Missense_Mutation_p.R13089H|TTN_uc010zfj.1_Missense_Mutation_p.R12964H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20388							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179499969	179499969	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499969T>C	uc010zfg.1	-	177	34467	c.34243A>G	c.(34243-34245)AGC>GGC	p.S11415G	TTN_uc010zfh.1_Missense_Mutation_p.S5110G|TTN_uc010zfi.1_Missense_Mutation_p.S5043G|TTN_uc010zfj.1_Missense_Mutation_p.S4918G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12342							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179501128	179501128	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179501128C>A	uc010zfg.1	-	174	33846	c.33622G>T	c.(33622-33624)GAA>TAA	p.E11208*	TTN_uc010zfh.1_Nonsense_Mutation_p.E4903*|TTN_uc010zfi.1_Nonsense_Mutation_p.E4836*|TTN_uc010zfj.1_Nonsense_Mutation_p.E4711*|TTN_uc010fre.1_Nonsense_Mutation_p.E1069*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12135							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198950517	198950517	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198950517C>T	uc010fsp.2	+	2	2567	c.2276C>T	c.(2275-2277)GCG>GTG	p.A759V	PLCL1_uc002uuv.3_Missense_Mutation_p.A680V	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	759	C2.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
ALS2	57679	broad.mit.edu	37	2	202587823	202587823	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202587823G>A	uc002uyo.2	-	23	4001	c.3645C>T	c.(3643-3645)TCC>TCT	p.S1215S	ALS2_uc002uyp.3_Silent_p.S1215S|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	1215	MORN 7.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7																		---	---	---	---
ABI2	10152	broad.mit.edu	37	2	204267383	204267383	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204267383G>A	uc002vaa.2	+	9	1353	c.1118G>A	c.(1117-1119)CGC>CAC	p.R373H	ABI2_uc002uzz.2_Missense_Mutation_p.R306H|ABI2_uc010zih.1_Missense_Mutation_p.R21H|ABI2_uc010zii.1_Missense_Mutation_p.R367H|ABI2_uc010zij.1_Missense_Mutation_p.R250H|ABI2_uc002vab.2_Missense_Mutation_p.R261H|ABI2_uc010zik.1_Missense_Mutation_p.R98H|ABI2_uc010zil.1_Missense_Mutation_p.R208H|ABI2_uc010zim.1_Missense_Mutation_p.R159H|ABI2_uc002vac.2_Missense_Mutation_p.R159H|ABI2_uc010zin.1_Missense_Mutation_p.R21H	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2	373	Pro-rich.				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0																		---	---	---	---
FASTKD2	22868	broad.mit.edu	37	2	207651571	207651571	+	Silent	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207651571T>A	uc002vbu.2	+	8	1952	c.1542T>A	c.(1540-1542)GCT>GCA	p.A514A	FASTKD2_uc002vbv.2_Silent_p.A514A|FASTKD2_uc002vbx.2_Silent_p.A514A|FASTKD2_uc002vbw.1_Silent_p.A514A	NM_001136193	NP_001129665	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	514					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|skin(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)														---	---	---	---
MREG	55686	broad.mit.edu	37	2	216809668	216809668	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216809668C>T	uc002vfo.2	-	5	859	c.563G>A	c.(562-564)CGA>CAA	p.R188Q	MREG_uc002vfq.2_RNA	NM_018000	NP_060470	Q8N565	MREG_HUMAN	whn-dependent transcript 2	188						apical plasma membrane					0		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)														---	---	---	---
TMEM169	92691	broad.mit.edu	37	2	216964784	216964784	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216964784C>A	uc010zjr.1	+	4	739	c.413C>A	c.(412-414)TCA>TAA	p.S138*	TMEM169_uc010zjs.1_Nonsense_Mutation_p.S138*|TMEM169_uc002vfw.2_Nonsense_Mutation_p.S138*|TMEM169_uc002vfv.3_Nonsense_Mutation_p.S138*	NM_001142310	NP_001135782	Q96HH4	TM169_HUMAN	transmembrane protein 169	138	Extracellular (Potential).					integral to membrane				ovary(1)	1		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
TNS1	7145	broad.mit.edu	37	2	218683363	218683363	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218683363G>A	uc002vgt.2	-	24	3778	c.3380C>T	c.(3379-3381)GCC>GTC	p.A1127V	TNS1_uc002vgr.2_Missense_Mutation_p.A1114V|TNS1_uc002vgs.2_Missense_Mutation_p.A1106V|TNS1_uc010zjv.1_Missense_Mutation_p.A1106V	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	1127	Ser-rich.					cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)														---	---	---	---
TTLL4	9654	broad.mit.edu	37	2	219603187	219603187	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219603187C>T	uc002viy.2	+	3	1158	c.788C>T	c.(787-789)CCG>CTG	p.P263L	TTLL4_uc010zkl.1_Missense_Mutation_p.P98L|TTLL4_uc010fvx.2_Missense_Mutation_p.P263L	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	263					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)														---	---	---	---
TRIP12	9320	broad.mit.edu	37	2	230672480	230672480	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230672480G>A	uc002vpw.1	-	16	2405	c.2296C>T	c.(2296-2298)CGT>TGT	p.R766C	TRIP12_uc002vpx.1_Missense_Mutation_p.R814C|TRIP12_uc002vpy.1_Missense_Mutation_p.R469C|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Missense_Mutation_p.R772C	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	766	WWE.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)														---	---	---	---
ECEL1	9427	broad.mit.edu	37	2	233350780	233350780	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233350780C>T	uc002vsv.2	-	2	789	c.584G>A	c.(583-585)CGA>CAA	p.R195Q	ECEL1_uc010fya.1_Missense_Mutation_p.R195Q|ECEL1_uc010fyb.1_5'UTR	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	195	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)														---	---	---	---
CHRNG	1146	broad.mit.edu	37	2	233407735	233407735	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233407735G>A	uc002vsx.1	+	7	769	c.748G>A	c.(748-750)GCC>ACC	p.A250T	CHRNG_uc010fye.1_Missense_Mutation_p.A198T	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	250	Helical; (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)														---	---	---	---
GIGYF2	26058	broad.mit.edu	37	2	233652024	233652024	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233652024C>T	uc002vti.3	+	11	1034	c.697C>T	c.(697-699)CGA>TGA	p.R233*	GIGYF2_uc010zmj.1_Nonsense_Mutation_p.R233*|GIGYF2_uc002vtg.2_Nonsense_Mutation_p.R233*|GIGYF2_uc002vtj.3_Nonsense_Mutation_p.R255*|GIGYF2_uc002vtk.3_Nonsense_Mutation_p.R233*|GIGYF2_uc002vth.3_Nonsense_Mutation_p.R233*|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Nonsense_Mutation_p.R64*	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	233	Arg-rich.				cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)														---	---	---	---
GPC1	2817	broad.mit.edu	37	2	241402004	241402004	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241402004G>A	uc002vyw.3	+							NM_002081	NP_002072			glypican 1 precursor						axon guidance	anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)														---	---	---	---
CAMK1	8536	broad.mit.edu	37	3	9802450	9802450	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9802450A>G	uc003bst.2	-	8	813	c.635T>C	c.(634-636)CTC>CCC	p.L212P	OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA|CAMK1_uc003bss.2_5'Flank|uc003bsv.1_RNA	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	212	Protein kinase.				cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)														---	---	---	---
CAND2	23066	broad.mit.edu	37	3	12858445	12858445	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12858445A>G	uc003bxk.2	+	10	2063	c.2014A>G	c.(2014-2016)ACA>GCA	p.T672A	CAND2_uc003bxj.2_Missense_Mutation_p.T579A	NM_001162499	NP_001155971	O75155	CAND2_HUMAN	TBP-interacting protein isoform 1	672	HEAT 14.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4																		---	---	---	---
C3orf20	84077	broad.mit.edu	37	3	14744719	14744719	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14744719C>T	uc003byy.2	+	6	1232	c.828C>T	c.(826-828)AGC>AGT	p.S276S	C3orf20_uc003byz.2_Silent_p.S154S|C3orf20_uc003bza.2_Silent_p.S154S|C3orf20_uc003byx.1_Silent_p.S276S	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	276						cytoplasm|integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16237382	16237382	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16237382C>T	uc003car.3	+	2	1130	c.655C>T	c.(655-657)CCC>TCC	p.P219S	GALNTL2_uc003caq.3_5'UTR	NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	219	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17208253	17208253	+	Intron	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17208253C>A	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20113953	20113953	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20113953T>C	uc003cbq.2	+	2	876	c.430_splice	c.e2+2	p.A144_splice		NM_003884	NP_003875			K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
GPD1L	23171	broad.mit.edu	37	3	32181857	32181857	+	Silent	SNP	C	T	T	rs139369157	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32181857C>T	uc003cew.2	+	4	564	c.504C>T	c.(502-504)ATC>ATT	p.I168I		NM_015141	NP_055956	Q8N335	GPD1L_HUMAN	glycerol-3-phosphate dehydrogenase 1-like	168					glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity				0																		---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38592731	38592731	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592731G>A	uc003cio.2	-	28	5326	c.5132C>T	c.(5131-5133)GCC>GTC	p.A1711V	SCN5A_uc003cin.2_Missense_Mutation_p.A1710V|SCN5A_uc003cil.3_Missense_Mutation_p.A1711V|SCN5A_uc010hhi.2_Missense_Mutation_p.A1693V|SCN5A_uc010hhk.2_Missense_Mutation_p.A1678V|SCN5A_uc011ayr.1_Missense_Mutation_p.A1657V	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1711					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
XIRP1	165904	broad.mit.edu	37	3	39227701	39227701	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39227701C>T	uc003cjk.1	-	2	3457	c.3236G>A	c.(3235-3237)GGC>GAC	p.G1079D	XIRP1_uc003cji.2_Missense_Mutation_p.G1079D|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1079							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)														---	---	---	---
RPL14	9045	broad.mit.edu	37	3	40499484	40499484	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40499484T>C	uc003ckg.2	+	2	156	c.105_splice	c.e2+2	p.R35_splice	RPL14_uc003ckh.2_Splice_Site_p.R35_splice|RPL14_uc003cki.2_Splice_Site	NM_003973	NP_003964			ribosomal protein L14						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)														---	---	---	---
EXOSC7	23016	broad.mit.edu	37	3	45038710	45038710	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45038710G>A	uc003coi.2	+	4	415	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	EXOSC7_uc003coh.1_Missense_Mutation_p.R64Q|EXOSC7_uc011bae.1_Missense_Mutation_p.R129Q|EXOSC7_uc010his.1_Missense_Mutation_p.R48Q|EXOSC7_uc003coj.2_Missense_Mutation_p.R129Q	NM_015004	NP_055819	Q15024	EXOS7_HUMAN	exosome component 7	129					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus	3'-5'-exoribonuclease activity|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48602300	48602300	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48602300A>G	uc003ctz.2	-	117	8735	c.8734T>C	c.(8734-8736)TGT>CGT	p.C2912R	UCN2_uc003cty.1_5'Flank	NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2912	Nonhelical region (NC2).|BPTI/Kunitz inhibitor.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
RHOA	387	broad.mit.edu	37	3	49412922	49412922	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49412922T>C	uc003cwu.2	-	2	377	c.101A>G	c.(100-102)TAT>TGT	p.Y34C	RHOA_uc010hku.2_5'UTR	NM_001664	NP_001655	P61586	RHOA_HUMAN	ras homolog gene family, member A precursor	34	Effector region (Potential).			Y->F: Abolishes AMPylation by Haemophilus IbpA.|Y->A: Abolishes interaction with DGKQ.	axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
CDHR4	389118	broad.mit.edu	37	3	49836453	49836453	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49836453T>C	uc010hkz.2	-	3	386	c.377A>G	c.(376-378)CAG>CGG	p.Q126R	CDHR4_uc003cxp.2_Missense_Mutation_p.Q126R|CDHR4_uc011bcw.1_Missense_Mutation_p.Q126R	NM_001007540	NP_001007541	A6H8M9	CDHR4_HUMAN	cadherin-like 29 precursor	126	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51196730	51196730	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51196730G>A	uc011bds.1	+	11	907	c.884G>A	c.(883-885)CGA>CAA	p.R295Q		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	295						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52649388	52649388	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52649388C>T	uc003des.2	-	15	1915	c.1903G>A	c.(1903-1905)GCT>ACT	p.A635T	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.A635T|PBRM1_uc003der.2_Missense_Mutation_p.A603T|PBRM1_uc003det.2_Missense_Mutation_p.A650T|PBRM1_uc003deu.2_Missense_Mutation_p.A650T|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.A635T|PBRM1_uc010hmk.1_Missense_Mutation_p.A635T|PBRM1_uc003dey.2_Missense_Mutation_p.A635T|PBRM1_uc003dez.1_Missense_Mutation_p.A635T|PBRM1_uc003dfb.1_Missense_Mutation_p.A548T|PBRM1_uc003dfc.2_Missense_Mutation_p.A2T	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	635					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
TMEM110	375346	broad.mit.edu	37	3	52883877	52883877	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52883877C>T	uc003dge.2	-	4	439	c.358G>A	c.(358-360)GTG>ATG	p.V120M	TMEM110_uc003dgc.3_Missense_Mutation_p.V120M	NM_198563	NP_940965	Q86TL2	TM110_HUMAN	transmembrane protein 110	120	Helical; (Potential).					integral to membrane				large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)														---	---	---	---
CACNA1D	776	broad.mit.edu	37	3	53700399	53700399	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53700399C>T	uc003dgv.3	+	7	1116	c.953C>T	c.(952-954)GCG>GTG	p.A318V	CACNA1D_uc003dgu.3_Missense_Mutation_p.A318V|CACNA1D_uc003dgy.3_Missense_Mutation_p.A318V|CACNA1D_uc003dgw.3_5'UTR	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	318	Extracellular (Potential).|I.				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)													---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56044541	56044541	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56044541C>T	uc003dhr.1	-	9	2112	c.1856G>A	c.(1855-1857)CGA>CAA	p.R619Q	ERC2_uc003dht.1_Missense_Mutation_p.R90Q	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	619	Potential.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ATXN7	6314	broad.mit.edu	37	3	63965643	63965643	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63965643A>G	uc003dlw.3	+	6	1105	c.552A>G	c.(550-552)TCA>TCG	p.S184S	ATXN7_uc003dlv.2_Silent_p.S184S|ATXN7_uc010hnv.2_Silent_p.S184S|ATXN7_uc010hnw.2_Silent_p.S39S|ATXN7_uc011bfn.1_Silent_p.S39S	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	184	Ser-rich.				cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)														---	---	---	---
PDZRN3	23024	broad.mit.edu	37	3	73433966	73433966	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433966G>T	uc003dpl.1	-	10	1847	c.1751C>A	c.(1750-1752)TCG>TAG	p.S584*	PDZRN3_uc011bgh.1_Nonsense_Mutation_p.S241*|PDZRN3_uc010hoe.1_Nonsense_Mutation_p.S282*|PDZRN3_uc011bgf.1_Nonsense_Mutation_p.S301*|PDZRN3_uc011bgg.1_Nonsense_Mutation_p.S304*	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	584							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)														---	---	---	---
CNTN3	5067	broad.mit.edu	37	3	74474047	74474047	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74474047G>A	uc003dpm.1	-	4	483	c.403C>T	c.(403-405)CGT>TGT	p.R135C		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	135	Ig-like C2-type 2.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78649287	78649287	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78649287T>C	uc003dqe.2	-	30	5125	c.4917A>G	c.(4915-4917)GGA>GGG	p.G1639G	ROBO1_uc003dqb.2_Silent_p.G1600G|ROBO1_uc003dqc.2_Silent_p.G1539G|ROBO1_uc003dqd.2_Silent_p.G1594G|ROBO1_uc010hoh.2_Silent_p.G831G	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1639	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	96962894	96962894	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96962894C>G	uc010how.1	+	5	1412	c.1369C>G	c.(1369-1371)CTC>GTC	p.L457V	EPHA6_uc003drp.1_Missense_Mutation_p.L457V	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	362	Fibronectin type-III 1.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
OR5AC2	81050	broad.mit.edu	37	3	97806749	97806749	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806749G>A	uc011bgs.1	+	1	733	c.733G>A	c.(733-735)GCC>ACC	p.A245T		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
HHLA2	11148	broad.mit.edu	37	3	108072517	108072517	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108072517A>G	uc003dwy.3	+	4	475	c.308A>G	c.(307-309)AAT>AGT	p.N103S	HHLA2_uc011bhl.1_Intron|HHLA2_uc010hpu.2_Missense_Mutation_p.N103S|HHLA2_uc003dwz.2_Missense_Mutation_p.N103S	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	103	Ig-like V-type 1.					integral to membrane				ovary(1)	1																		---	---	---	---
KIAA1524	57650	broad.mit.edu	37	3	108298166	108298166	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108298166A>T	uc003dxb.3	-	7	1049	c.780T>A	c.(778-780)GAT>GAA	p.D260E	KIAA1524_uc003dxc.1_Missense_Mutation_p.D101E|KIAA1524_uc010hpw.1_Missense_Mutation_p.D101E	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	260						cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108407750	108407750	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108407750C>A	uc003dxd.2	+	31	3917	c.3495C>A	c.(3493-3495)TGC>TGA	p.C1165*	DZIP3_uc003dxf.1_Nonsense_Mutation_p.C1165*|DZIP3_uc011bhm.1_Nonsense_Mutation_p.C616*	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	1165	RING-type; atypical.				protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CCDC80	151887	broad.mit.edu	37	3	112324517	112324517	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112324517A>C	uc003dzf.2	-	8	2818	c.2600T>G	c.(2599-2601)CTT>CGT	p.L867R	CCDC80_uc011bhv.1_Missense_Mutation_p.L840R|CCDC80_uc003dzg.2_Missense_Mutation_p.L867R	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	867										ovary(2)	2																		---	---	---	---
SIDT1	54847	broad.mit.edu	37	3	113320434	113320434	+	Splice_Site	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113320434G>T	uc003eak.2	+	11	1697	c.1046_splice	c.e11-1	p.G349_splice	SIDT1_uc011bif.1_Splice_Site|SIDT1_uc003eaj.1_Splice_Site_p.G349_splice|SIDT1_uc011big.1_Splice_Site_p.G102_splice|SIDT1_uc011bih.1_5'Flank	NM_017699	NP_060169			SID1 transmembrane family, member 1 precursor							integral to membrane				ovary(3)|pancreas(1)|skin(1)	5																		---	---	---	---
SLC12A8	84561	broad.mit.edu	37	3	124829094	124829094	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124829094C>T	uc003ehv.3	-	9	1109	c.998G>A	c.(997-999)CGC>CAC	p.R333H	SLC12A8_uc003ehw.3_Missense_Mutation_p.R362H|SLC12A8_uc003eht.3_Missense_Mutation_p.R134H|SLC12A8_uc003ehu.3_Missense_Mutation_p.R86H|SLC12A8_uc010hry.2_Missense_Mutation_p.R86H	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	333					potassium ion transport	integral to membrane	symporter activity				0																		---	---	---	---
TF	7018	broad.mit.edu	37	3	133486949	133486949	+	Silent	SNP	C	T	T	rs34657694		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133486949C>T	uc003epu.1	+	18	3291	c.1563C>T	c.(1561-1563)GGC>GGT	p.G521G	TF_uc011blt.1_Silent_p.G394G|TF_uc003epw.1_Intron|TF_uc003epv.1_Silent_p.G521G	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	521	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)													---	---	---	---
CHST2	9435	broad.mit.edu	37	3	142840554	142840554	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142840554G>A	uc003evm.2	+	2	1785	c.896G>A	c.(895-897)CGC>CAC	p.R299H		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	299	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3																		---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149290705	149290705	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149290705C>T	uc003exe.2	-	2	530	c.514G>A	c.(514-516)GTC>ATC	p.V172I	WWTR1_uc003exf.2_Missense_Mutation_p.V172I|WWTR1_uc011bns.1_Missense_Mutation_p.V172I|WWTR1_uc003exh.2_Missense_Mutation_p.V172I	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	172					hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
FAM194A	131831	broad.mit.edu	37	3	150403619	150403619	+	Silent	SNP	G	A	A	rs149996868		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150403619G>A	uc003eyg.2	-	6	750	c.693C>T	c.(691-693)TTC>TTT	p.F231F	FAM194A_uc003eyh.2_Silent_p.F85F	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831	231										skin(2)|ovary(1)	3																		---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155199080	155199080	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199080G>A	uc011bok.1	-	23	5036	c.4759C>T	c.(4759-4761)CGC>TGC	p.R1587C	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.R1549C	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1587					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155203278	155203278	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155203278G>A	uc011bok.1	-	22	3142	c.2865C>T	c.(2863-2865)GGC>GGT	p.G955G	PLCH1_uc011boj.1_Silent_p.G955G|PLCH1_uc011bol.1_Silent_p.G917G	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	955					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
TNFSF10	8743	broad.mit.edu	37	3	172241098	172241098	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172241098A>C	uc003fid.2	-	1	172	c.77T>G	c.(76-78)CTG>CGG	p.L26R	TNFSF10_uc003fie.2_Missense_Mutation_p.L26R|TNFSF10_uc010hwu.1_RNA	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	26	Helical; Signal-anchor for type II membrane protein; (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)															---	---	---	---
PIK3CA	5290	broad.mit.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	G	G	rs121913274		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936092A>G	uc003fjk.2	+	10	1791	c.1634A>G	c.(1633-1635)GAG>GGG	p.E545G		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545A(AGS_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			---	---	---	---
USP13	8975	broad.mit.edu	37	3	179478997	179478997	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179478997C>T	uc003fkh.2	+	17	2127	c.2046C>T	c.(2044-2046)GGC>GGT	p.G682G		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	682	UBA 1.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
EIF4G1	1981	broad.mit.edu	37	3	184038434	184038434	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184038434C>T	uc003fnp.2	+	8	752	c.554C>T	c.(553-555)CCA>CTA	p.P185L	EIF4G1_uc003fno.1_Missense_Mutation_p.P126L|EIF4G1_uc010hxw.1_Missense_Mutation_p.P21L|EIF4G1_uc003fnt.2_5'UTR|EIF4G1_uc003fnq.2_Missense_Mutation_p.P98L|EIF4G1_uc003fnr.2_Missense_Mutation_p.P21L|EIF4G1_uc010hxx.2_Missense_Mutation_p.P192L|EIF4G1_uc003fns.2_Missense_Mutation_p.P145L|EIF4G1_uc010hxy.2_Missense_Mutation_p.P192L|EIF4G1_uc010hxz.1_Missense_Mutation_p.P98L|EIF4G1_uc003fnv.3_Missense_Mutation_p.P185L|EIF4G1_uc003fnu.3_Missense_Mutation_p.P185L|EIF4G1_uc003fnw.2_Missense_Mutation_p.P192L|EIF4G1_uc003fnx.2_5'UTR|EIF4G1_uc003fny.3_5'UTR	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	185	PABPC1-binding.			DPNQ->AAAA: Loss of PABPC1 binding; when associated with 174-AAAAA-178.	insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
EIF4G1	1981	broad.mit.edu	37	3	184044360	184044360	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184044360C>T	uc003fnp.2	+	22	3466	c.3268C>T	c.(3268-3270)CGA>TGA	p.R1090*	EIF4G1_uc003fnt.2_Nonsense_Mutation_p.R801*|EIF4G1_uc003fnq.2_Nonsense_Mutation_p.R1003*|EIF4G1_uc003fnr.2_Nonsense_Mutation_p.R926*|EIF4G1_uc010hxx.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fns.2_Nonsense_Mutation_p.R1050*|EIF4G1_uc010hxy.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fnv.3_Nonsense_Mutation_p.R1091*|EIF4G1_uc003fnu.3_Nonsense_Mutation_p.R1090*|EIF4G1_uc003fnw.2_Nonsense_Mutation_p.R1097*|EIF4G1_uc003fnx.2_Nonsense_Mutation_p.R895*|EIF4G1_uc003fny.3_Nonsense_Mutation_p.R894*|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1090					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
EPHB3	2049	broad.mit.edu	37	3	184297328	184297328	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184297328G>A	uc003foz.2	+	10	2302	c.1865G>A	c.(1864-1866)CGG>CAG	p.R622Q		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	622	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)															---	---	---	---
TP63	8626	broad.mit.edu	37	3	189604248	189604248	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189604248T>C	uc003fry.2	+	11	1504	c.1415T>C	c.(1414-1416)ATG>ACG	p.M472T	TP63_uc003frz.2_Missense_Mutation_p.M472T|TP63_uc010hzc.1_Missense_Mutation_p.M472T|TP63_uc003fsc.2_Missense_Mutation_p.M378T|TP63_uc003fsd.2_Missense_Mutation_p.M378T|TP63_uc010hzd.1_Missense_Mutation_p.M293T	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	472					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
LRRC15	131578	broad.mit.edu	37	3	194081221	194081221	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194081221G>A	uc003ftu.2	-	2	638	c.552C>T	c.(550-552)AGC>AGT	p.S184S	LRRC15_uc003ftt.2_Silent_p.S190S	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b	184	Extracellular (Potential).|LRR 6.					integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195480005	195480005	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195480005T>C	uc011bto.1	-	21	15501	c.15041A>G	c.(15040-15042)CAG>CGG	p.Q5014R	MUC4_uc010hzq.2_5'UTR|MUC4_uc003fuz.2_Missense_Mutation_p.Q740R|MUC4_uc003fva.2_Missense_Mutation_p.Q622R|MUC4_uc003fvb.2_Missense_Mutation_p.Q658R|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.Q658R|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.Q622R|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.Q706R|MUC4_uc011bti.1_Missense_Mutation_p.Q706R|MUC4_uc011btj.1_Missense_Mutation_p.Q883R|MUC4_uc011btk.1_Missense_Mutation_p.Q622R|MUC4_uc011btl.1_Missense_Mutation_p.Q651R|MUC4_uc011btm.1_Missense_Mutation_p.Q831R|MUC4_uc011btn.1_Missense_Mutation_p.Q622R|MUC4_uc003fvo.2_Missense_Mutation_p.Q906R|MUC4_uc003fvp.2_Missense_Mutation_p.Q855R	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1899	EGF-like 1.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
KIAA1530	57654	broad.mit.edu	37	4	1343557	1343557	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1343557G>A	uc003gde.3	+	3	791	c.344G>A	c.(343-345)CGG>CAG	p.R115Q		NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	115											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)															---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6080672	6080672	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6080672C>T	uc003giu.3	-	8	1572	c.1296G>A	c.(1294-1296)CCG>CCA	p.P432P	JAKMIP1_uc010idb.1_Silent_p.P432P|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Silent_p.P432P|JAKMIP1_uc011bwc.1_Silent_p.P267P|JAKMIP1_uc003giv.3_Silent_p.P432P|JAKMIP1_uc010ide.2_Silent_p.P432P	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	432	Mediates interaction with TYK2 and GABBR1.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
CPZ	8532	broad.mit.edu	37	4	8613861	8613861	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8613861C>T	uc003glm.2	+	8	1461	c.1335C>T	c.(1333-1335)AAC>AAT	p.N445N	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Silent_p.N308N|CPZ_uc003glo.2_Silent_p.N434N|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	445					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---
SEL1L3	23231	broad.mit.edu	37	4	25849011	25849011	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25849011C>T	uc003gru.3	-	2	790	c.638G>A	c.(637-639)CGC>CAC	p.R213H		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	213						integral to membrane	binding				0																		---	---	---	---
GRXCR1	389207	broad.mit.edu	37	4	42965093	42965093	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42965093G>A	uc003gwt.2	+	2	569	c.569G>A	c.(568-570)CGA>CAA	p.R190Q		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	190	Glutaredoxin.				cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
ATP10D	57205	broad.mit.edu	37	4	47593216	47593216	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47593216T>A	uc003gxk.1	+	23	4263	c.4099T>A	c.(4099-4101)TCA>ACA	p.S1367T	ATP10D_uc003gxl.1_Missense_Mutation_p.S615T	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1367	Cytoplasmic (Potential).|ATP (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3																		---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48545898	48545898	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48545898G>C	uc003gyh.1	-	44	6123	c.5518C>G	c.(5518-5520)CTC>GTC	p.L1840V	FRYL_uc003gyg.1_Missense_Mutation_p.L536V|FRYL_uc003gyi.1_Missense_Mutation_p.L728V|FRYL_uc003gyj.1_Missense_Mutation_p.L135V	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1840					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
SRD5A3	79644	broad.mit.edu	37	4	56233814	56233814	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56233814A>G	uc003hau.2	+	4	717	c.622A>G	c.(622-624)ATG>GTG	p.M208V	uc003hav.1_Intron|uc003haw.1_Intron	NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	208	Helical; (Potential).				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)															---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62445335	62445335	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62445335T>C	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62845287	62845287	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62845287G>T	uc010ihh.2	+	15	2781	c.2608G>T	c.(2608-2610)GAT>TAT	p.D870Y	LPHN3_uc003hcq.3_Missense_Mutation_p.D870Y|LPHN3_uc003hct.2_Missense_Mutation_p.D263Y	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	857	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
BMP2K	55589	broad.mit.edu	37	4	79832739	79832739	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79832739G>A	uc003hlk.2	+	16	3204	c.3038G>A	c.(3037-3039)CGC>CAC	p.R1013H	PAQR3_uc003hlm.2_Intron|PAQR3_uc003hln.2_Intron|uc010ijm.1_5'Flank	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	1013						nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1																		---	---	---	---
AFF1	4299	broad.mit.edu	37	4	88035905	88035905	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88035905C>T	uc003hqj.3	+	11	2306	c.1899C>T	c.(1897-1899)GGC>GGT	p.G633G	AFF1_uc011ccz.1_Silent_p.G640G|AFF1_uc003hqk.3_Silent_p.G633G|AFF1_uc011cda.1_Silent_p.G271G	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	633						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
DSPP	1834	broad.mit.edu	37	4	88535421	88535421	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88535421A>G	uc003hqu.2	+	5	1727	c.1607A>G	c.(1606-1608)GAC>GGC	p.D536G		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	536	Asp/Ser-rich.				biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)														---	---	---	---
UGT8	7368	broad.mit.edu	37	4	115544174	115544174	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115544174C>T	uc003ibs.2	+	2	660	c.138C>T	c.(136-138)CAC>CAT	p.H46H	UGT8_uc003ibt.2_Silent_p.H46H|UGT8_uc011cge.1_RNA	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8	46					central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)														---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119176867	119176867	+	Nonstop_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119176867G>T	uc003ibx.2	+	14	3025	c.2622G>T	c.(2620-2622)TAG>TAT	p.*874Y		NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	874						Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
KIAA1109	84162	broad.mit.edu	37	4	123229133	123229133	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123229133G>A	uc003ieh.2	+	56	9916	c.9871G>A	c.(9871-9873)GCC>ACC	p.A3291T	KIAA1109_uc003iel.1_Missense_Mutation_p.A1226T	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3291					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126389938	126389938	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126389938A>T	uc003ifj.3	+	11	12171	c.12171A>T	c.(12169-12171)GGA>GGT	p.G4057G	FAT4_uc011cgp.1_Silent_p.G2320G|FAT4_uc003ifi.1_Silent_p.G1535G	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	4057	Laminin G-like 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
POU4F2	5458	broad.mit.edu	37	4	147561536	147561536	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147561536G>A	uc003ikv.2	+	2	1054	c.806G>A	c.(805-807)CGC>CAC	p.R269H		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	269	POU-specific.				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)																	---	---	---	---
SFRP2	6423	broad.mit.edu	37	4	154709838	154709838	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154709838G>A	uc003inv.1	-	1	391	c.150C>T	c.(148-150)TGC>TGT	p.C50C		NM_003013	NP_003004	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2 precursor	50	FZ.				brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)																---	---	---	---
KLHL2	11275	broad.mit.edu	37	4	166159922	166159922	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166159922T>C	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron	NM_007246	NP_009177			kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)														---	---	---	---
DDX60	55601	broad.mit.edu	37	4	169227857	169227857	+	Silent	SNP	C	T	T	rs140161501		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169227857C>T	uc003irp.2	-	5	571	c.279G>A	c.(277-279)GCG>GCA	p.A93A		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	93							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)														---	---	---	---
C4orf41	60684	broad.mit.edu	37	4	184622881	184622881	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184622881A>G	uc003ivx.2	+	26	3059	c.2883A>G	c.(2881-2883)GAA>GAG	p.E961E	C4orf41_uc003ivw.2_Silent_p.E961E|C4orf41_uc010isc.2_Silent_p.E305E|C4orf41_uc003ivy.2_Silent_p.E567E	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	961											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)														---	---	---	---
LPCAT1	79888	broad.mit.edu	37	5	1489881	1489881	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1489881A>G	uc003jcm.2	-	4	703	c.586T>C	c.(586-588)TCC>CCC	p.S196P		NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	196	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)														---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19571802	19571802	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19571802G>C	uc003jgc.2	-	7	1516	c.1139C>G	c.(1138-1140)CCA>CGA	p.P380R	CDH18_uc003jgd.2_Missense_Mutation_p.P380R|CDH18_uc011cnm.1_Missense_Mutation_p.P380R	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	380	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
RXFP3	51289	broad.mit.edu	37	5	33938026	33938026	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33938026G>A	uc003jic.1	+	1	1538	c.1181G>A	c.(1180-1182)CGC>CAC	p.R394H		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	394	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
UGT3A2	167127	broad.mit.edu	37	5	36049272	36049272	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36049272G>A	uc003jjz.1	-	4	655	c.562C>T	c.(562-564)CGT>TGT	p.R188C	UGT3A2_uc011cos.1_Missense_Mutation_p.R154C|UGT3A2_uc011cot.1_Intron	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	188	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
NIPBL	25836	broad.mit.edu	37	5	37006531	37006531	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37006531G>A	uc003jkl.3	+	17	4427	c.3928G>A	c.(3928-3930)GCT>ACT	p.A1310T	NIPBL_uc003jkk.3_Missense_Mutation_p.A1310T	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1310					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---
NUP155	9631	broad.mit.edu	37	5	37314427	37314427	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37314427G>T	uc003jku.1	-	22	2427	c.2309C>A	c.(2308-2310)GCT>GAT	p.A770D	NUP155_uc003jkt.1_Missense_Mutation_p.A711D|NUP155_uc010iuz.1_Missense_Mutation_p.A770D	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	770					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
CARTPT	9607	broad.mit.edu	37	5	71016450	71016450	+	3'UTR	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71016450T>C	uc003kbv.1	+	3						NM_004291	NP_004282			cocaine- and amphetamine-regulated transcript						activation of MAPKK activity|adult feeding behavior|cellular glucose homeostasis|cellular response to starvation|circadian regulation of gene expression|negative regulation of appetite|negative regulation of bone resorption|negative regulation of osteoclast differentiation|neuropeptide signaling pathway|positive regulation of blood pressure|positive regulation of epinephrine secretion|positive regulation of transmission of nerve impulse|synaptic transmission	extracellular space				ovary(1)	1		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)													---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73205302	73205302	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73205302C>T	uc011csq.1	+	33	4238	c.4227C>T	c.(4225-4227)GGC>GGT	p.G1409G	RGNEF_uc003kcx.2_Silent_p.G1409G|RGNEF_uc010izf.2_Silent_p.G1409G|RGNEF_uc011csr.1_Silent_p.G1096G|RGNEF_uc003kcz.3_Silent_p.G373G|RGNEF_uc003kda.3_Silent_p.G329G	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	1409					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
F2RL2	2151	broad.mit.edu	37	5	75914009	75914009	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75914009C>T	uc003kem.2	-	2	708	c.523G>A	c.(523-525)GGC>AGC	p.G175S	IQGAP2_uc003kek.2_Intron|IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron|F2RL2_uc011csw.1_Missense_Mutation_p.G153S	NM_004101	NP_004092	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	175	Helical; Name=3; (Potential).				platelet activation	extracellular region|integral to plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|thrombin receptor activity			skin(2)|ovary(1)	3		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90074728	90074728	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90074728G>A	uc003kju.2	+	64	12992	c.12896G>A	c.(12895-12897)CGA>CAA	p.R4299Q	GPR98_uc003kjt.2_Missense_Mutation_p.R2005Q|GPR98_uc003kjw.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4299	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
NR2F1	7025	broad.mit.edu	37	5	92921019	92921019	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92921019A>G	uc003kkj.2	+	1	1977	c.290A>G	c.(289-291)CAC>CGC	p.H97R		NM_005654	NP_005645	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	97	NR C4-type.|Nuclear receptor.				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			urinary_tract(1)|ovary(1)|lung(1)	3		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)														---	---	---	---
LNPEP	4012	broad.mit.edu	37	5	96341852	96341852	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96341852G>A	uc003kmv.1	+	10	2375	c.1861G>A	c.(1861-1863)GTT>ATT	p.V621I	LNPEP_uc003kmw.1_Missense_Mutation_p.V607I	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	621	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)														---	---	---	---
AQPEP	206338	broad.mit.edu	37	5	115339034	115339034	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115339034T>C	uc003kro.2	+	12	2158	c.1994T>C	c.(1993-1995)TTA>TCA	p.L665S	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	665	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0																		---	---	---	---
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905707	139905707	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905707G>A	uc003lfs.1	+	26	4743	c.4619G>A	c.(4618-4620)AGC>AAC	p.S1540N	ANKHD1_uc003lfr.2_Missense_Mutation_p.S1540N|ANKHD1_uc003lfu.1_Missense_Mutation_p.S1020N|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.S279N|ANKHD1_uc003lfw.2_Missense_Mutation_p.S178N|ANKHD1_uc010jfl.2_5'UTR|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1540						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139909045	139909045	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139909045G>T	uc003lfs.1	+	29	6638	c.6514G>T	c.(6514-6516)GGC>TGC	p.G2172C	ANKHD1_uc003lfr.2_Missense_Mutation_p.G2172C|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.G911C|ANKHD1_uc003lfw.2_Missense_Mutation_p.G810C|ANKHD1_uc010jfl.2_Missense_Mutation_p.G607C|ANKHD1-EIF4EBP3_uc003lfx.1_Missense_Mutation_p.G309C	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	2172						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
IK	3550	broad.mit.edu	37	5	140039372	140039372	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140039372C>A	uc003lgq.2	+	14	1337	c.1227C>A	c.(1225-1227)TCC>TCA	p.S409S		NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein	409					cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB6	56130	broad.mit.edu	37	5	140531705	140531705	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531705C>T	uc003lir.2	+	1	1867	c.1867C>T	c.(1867-1869)CGC>TGC	p.R623C	PCDHB6_uc011dah.1_Missense_Mutation_p.R487C	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	623	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
FBXO38	81545	broad.mit.edu	37	5	147803681	147803681	+	Splice_Site	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147803681G>A	uc003lpf.1	+	13	1858	c.1738_splice	c.e13+1	p.G580_splice	FBXO38_uc003lpg.1_Splice_Site_p.G580_splice|FBXO38_uc003lph.2_Splice_Site_p.G580_splice	NM_205836	NP_995308			F-box protein 38 isoform b							cytoplasm|nucleus				ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
FABP6	2172	broad.mit.edu	37	5	159659135	159659135	+	Missense_Mutation	SNP	G	A	A	rs17856662		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159659135G>A	uc003lya.1	+	2	226	c.98G>A	c.(97-99)CGC>CAC	p.R33H	FABP6_uc003lxx.1_Missense_Mutation_p.R82H|FABP6_uc003lxz.1_Missense_Mutation_p.R82H	NM_001445	NP_001436	P51161	FABP6_HUMAN	gastrotropin isoform 2	33					bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
GABRG2	2566	broad.mit.edu	37	5	161578728	161578728	+	Intron	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161578728A>C	uc003lyz.3	+						GABRG2_uc010jjc.2_Intron|GABRG2_uc003lyy.3_Intron|GABRG2_uc011dej.1_Intron	NM_000816	NP_000807			gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)														---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169174437	169174437	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169174437T>A	uc003maf.2	+	23	2385	c.2305T>A	c.(2305-2307)TCC>ACC	p.S769T	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.S261T	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	769					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170336775	170336775	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170336775T>C	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron|RANBP17_uc003maw.2_Silent_p.S200S|RANBP17_uc011dew.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
UIMC1	51720	broad.mit.edu	37	5	176333041	176333041	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176333041G>A	uc011dfp.1	-	14	2087	c.1920C>T	c.(1918-1920)GAC>GAT	p.D640D	UIMC1_uc003mfc.1_Silent_p.D517D|UIMC1_uc003mfd.1_Silent_p.D270D	NM_016290	NP_057374	Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	640					double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|negative regulation of transcription, DNA-dependent|positive regulation of DNA repair|response to ionizing radiation|transcription, DNA-dependent	BRCA1-A complex	histone binding|K63-linked polyubiquitin binding			ovary(3)|skin(1)	4	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	177482894	177482894	+	IGR	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177482894G>T								FAM153C (6806 upstream) : N4BP3 (57662 downstream)																																			---	---	---	---
FOXF2	2295	broad.mit.edu	37	6	1391336	1391336	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1391336C>A	uc003mtm.2	+	1	1268	c.1154C>A	c.(1153-1155)GCT>GAT	p.A385D	FOXF2_uc003mtn.2_Missense_Mutation_p.A385D	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2	385					epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)														---	---	---	---
F13A1	2162	broad.mit.edu	37	6	6266932	6266932	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6266932G>A	uc003mwv.2	-	4	553	c.430C>T	c.(430-432)CGG>TGG	p.R144W	F13A1_uc011dib.1_Missense_Mutation_p.R81W	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	144					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---
HIVEP1	3096	broad.mit.edu	37	6	12122709	12122709	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12122709G>A	uc003nac.2	+	4	2860	c.2681G>A	c.(2680-2682)CGT>CAT	p.R894H	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	894					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)																---	---	---	---
GFOD1	54438	broad.mit.edu	37	6	13486905	13486905	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13486905G>A	uc003nat.1	-	1	883	c.218C>T	c.(217-219)CCG>CTG	p.P73L	GFOD1_uc003nas.1_5'Flank|C6orf114_uc003nav.2_5'Flank	NM_018988	NP_061861	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain	73						extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)															---	---	---	---
TRIM26	7726	broad.mit.edu	37	6	30166571	30166571	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30166571G>A	uc003npr.2	-	3	519	c.310C>T	c.(310-312)CGA>TGA	p.R104*	TRIM26_uc003nps.2_Nonsense_Mutation_p.R104*|TRIM26_uc010jry.2_5'UTR|TRIM26_uc003npt.2_Nonsense_Mutation_p.R104*|TRIM26_uc003npu.1_Nonsense_Mutation_p.R104*	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	104	B box-type.						DNA binding|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
MDC1	9656	broad.mit.edu	37	6	30670948	30670948	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30670948C>T	uc003nrg.3	-	12	6238	c.5798G>A	c.(5797-5799)CGG>CAG	p.R1933Q	MDC1_uc003nrf.3_Missense_Mutation_p.R564Q	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1933	BRCT 1.|Required for nuclear localization (NLS2).				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4													Other_conserved_DNA_damage_response_genes					---	---	---	---
HLA-DPB1	3115	broad.mit.edu	37	6	33052994	33052994	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33052994T>C	uc003ocu.1	+	3	691	c.632T>C	c.(631-633)GTC>GCC	p.V211A	HLA-DPB1_uc011dqo.1_RNA|HLA-DPB1_uc011dqp.1_Missense_Mutation_p.V210A|HLA-DPB1_uc011dqq.1_Missense_Mutation_p.V107A	NM_002121	NP_002112	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP	211	Beta-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex				ovary(1)	1																		---	---	---	---
ZBTB22	9278	broad.mit.edu	37	6	33283621	33283621	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33283621A>G	uc003oeb.2	-	2	1225	c.1073T>C	c.(1072-1074)ATA>ACA	p.I358T	TAPBP_uc003odx.1_5'Flank|TAPBP_uc010jus.1_5'Flank|TAPBP_uc003ody.2_5'Flank|TAPBP_uc003odz.2_5'Flank|TAPBP_uc010jut.1_5'Flank|TAPBP_uc011drc.1_5'Flank|ZBTB22_uc010juu.2_Missense_Mutation_p.I358T	NM_005453	NP_005444	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	358					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
SYNGAP1	8831	broad.mit.edu	37	6	33411173	33411173	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33411173C>T	uc011dri.1	+	15	3039	c.2844C>T	c.(2842-2844)GGC>GGT	p.G948G	SYNGAP1_uc010juy.2_Silent_p.G919G|SYNGAP1_uc010juz.2_Silent_p.G660G	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	948					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4																		---	---	---	---
ITPR3	3710	broad.mit.edu	37	6	33631536	33631536	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33631536C>T	uc011drk.1	+	11	1246	c.1027C>T	c.(1027-1029)CGC>TGC	p.R343C		NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	343	MIR 4.|Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19																		---	---	---	---
FGD2	221472	broad.mit.edu	37	6	36982747	36982747	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36982747T>A	uc010jwp.1	+	8	1133	c.962T>A	c.(961-963)CTC>CAC	p.L321H	FGD2_uc003ong.2_Missense_Mutation_p.L43H|FGD2_uc011dtv.1_5'UTR|FGD2_uc003oni.1_Missense_Mutation_p.L127H	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	321	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3																		---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42204045	42204045	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42204045C>A	uc003osd.2	-	16	3527	c.2964G>T	c.(2962-2964)GAG>GAT	p.E988D	TRERF1_uc011duq.1_Missense_Mutation_p.E905D|TRERF1_uc003osb.2_Missense_Mutation_p.E744D|TRERF1_uc003osc.2_Missense_Mutation_p.E744D|TRERF1_uc003ose.2_Missense_Mutation_p.E1008D	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	988	Interacts with CREBBP.				cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
KLHDC3	116138	broad.mit.edu	37	6	42985306	42985306	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42985306G>A	uc003otl.2	+	3	373	c.204G>A	c.(202-204)GGG>GGA	p.G68G	KLHDC3_uc003otm.2_RNA|KLHDC3_uc010jyf.2_Silent_p.G68G|KLHDC3_uc003otn.2_5'UTR|KLHDC3_uc003oto.2_Intron	NM_057161	NP_476502	Q9BQ90	KLDC3_HUMAN	kelch domain containing 3	68	Kelch 1.				reciprocal meiotic recombination	cytoplasm|nuclear chromatin	chromatin binding|protein binding			upper_aerodigestive_tract(1)	1			Colorectal(64;0.00237)|all cancers(41;0.0034)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0539)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)															---	---	---	---
CLIC5	53405	broad.mit.edu	37	6	45917038	45917038	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45917038A>G	uc003oxv.3	-	3	837	c.731T>C	c.(730-732)GTC>GCC	p.V244A	CLIC5_uc003oxu.3_Missense_Mutation_p.V85A|CLIC5_uc003oxx.2_Missense_Mutation_p.V85A	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	244					female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2																		---	---	---	---
GPR116	221395	broad.mit.edu	37	6	46828548	46828548	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46828548A>G	uc003oyo.3	-	16	2572	c.2283T>C	c.(2281-2283)CAT>CAC	p.H761H	GPR116_uc011dwj.1_Silent_p.H316H|GPR116_uc011dwk.1_Silent_p.H190H|GPR116_uc003oyp.3_Silent_p.H619H|GPR116_uc003oyq.3_Silent_p.H761H|GPR116_uc010jzi.1_Silent_p.H433H	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	761	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)															---	---	---	---
GPR110	266977	broad.mit.edu	37	6	46977701	46977701	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46977701A>C	uc003oyt.2	-	11	1669	c.1470T>G	c.(1468-1470)ATT>ATG	p.I490M	GPR110_uc011dwl.1_Missense_Mutation_p.I178M	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	490	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54212228	54212228	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54212228A>G	uc003pcj.2	+	6	958	c.812A>G	c.(811-813)CAG>CGG	p.Q271R	TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	271					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82936995	82936995	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82936995C>T	uc003pjl.1	-	5	1095	c.568G>A	c.(568-570)GTG>ATG	p.V190M	IBTK_uc011dyv.1_Missense_Mutation_p.V190M|IBTK_uc011dyw.1_Missense_Mutation_p.V190M|IBTK_uc010kbi.1_Translation_Start_Site|IBTK_uc003pjm.2_Missense_Mutation_p.V190M	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	190	RCC1 1.				negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---
ZNF292	23036	broad.mit.edu	37	6	87953265	87953265	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87953265G>A	uc003plm.3	+	6	855	c.814G>A	c.(814-816)GCT>ACT	p.A272T		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)														---	---	---	---
FUT9	10690	broad.mit.edu	37	6	96651800	96651800	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96651800C>A	uc003pop.3	+	3	1110	c.769C>A	c.(769-771)CTA>ATA	p.L257I		NM_006581	NP_006572	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3)	257	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			skin(4)|ovary(1)	5		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)														---	---	---	---
PRDM13	59336	broad.mit.edu	37	6	100062155	100062155	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100062155G>A	uc003pqg.1	+	4	1905	c.1644G>A	c.(1642-1644)CCG>CCA	p.P548P		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	548					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)														---	---	---	---
RNF217	154214	broad.mit.edu	37	6	125366443	125366443	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125366443G>A	uc003pzs.2	+	4	431	c.93G>A	c.(91-93)ACG>ACA	p.T31T	RNF217_uc003pzr.2_Silent_p.T88T|RNF217_uc003pzt.2_RNA	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217	31					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)														---	---	---	---
HECA	51696	broad.mit.edu	37	6	139487805	139487805	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139487805C>A	uc003qin.2	+	2	941	c.656C>A	c.(655-657)GCG>GAG	p.A219E		NM_016217	NP_057301	Q9UBI9	HDC_HUMAN	headcase	219					respiratory tube development						0				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144812155	144812155	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144812155G>A	uc003qkt.2	+	31	4446	c.4354G>A	c.(4354-4356)GAT>AAT	p.D1452N		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1452	Spectrin 10.|Interaction with SYNM.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
SNX9	51429	broad.mit.edu	37	6	158349643	158349643	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158349643C>T	uc003qqv.1	+	12	1370	c.1197C>T	c.(1195-1197)TGC>TGT	p.C399C		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	399	BAR.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)														---	---	---	---
SLC22A1	6580	broad.mit.edu	37	6	160543054	160543054	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160543054G>A	uc003qtc.2	+	1	192	c.87G>A	c.(85-87)TCG>TCA	p.S29S	SLC22A1_uc003qtd.2_Silent_p.S29S	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	29	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)														---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	166844007	166844007	+	Silent	SNP	C	T	T	rs140163975		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166844007C>T	uc003qvb.1	-	16	1734	c.1515G>A	c.(1513-1515)TCG>TCA	p.S505S	RPS6KA2_uc011ego.1_Silent_p.S416S|RPS6KA2_uc010kkl.1_Silent_p.S416S|RPS6KA2_uc003qvc.1_Silent_p.S513S|RPS6KA2_uc003qvd.1_Silent_p.S530S	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	505	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
MLLT4	4301	broad.mit.edu	37	6	168281130	168281130	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168281130C>A	uc003qwd.2	+	6	969	c.827C>A	c.(826-828)GCT>GAT	p.A276D	MLLT4_uc003qwb.1_Missense_Mutation_p.A276D|MLLT4_uc003qwc.1_Missense_Mutation_p.A277D|MLLT4_uc003qwf.2_Translation_Start_Site	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	277	Ras-associating 2.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)				T	MLL	AL								---	---	---	---
PAPOLB	56903	broad.mit.edu	37	7	4900547	4900547	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4900547G>A	uc003snk.2	-	1	1079	c.895C>T	c.(895-897)CCT>TCT	p.P299S	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	298					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)														---	---	---	---
RNF216	54476	broad.mit.edu	37	7	5752387	5752387	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5752387G>A	uc003soy.1	-	12	1960	c.1770C>T	c.(1768-1770)GCC>GCT	p.A590A	RNF216_uc010ksz.1_Silent_p.A212A|RNF216_uc010kta.1_Silent_p.A212A|RNF216_uc011jwj.1_Silent_p.A212A|RNF216_uc003sox.1_Silent_p.A647A	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b	590	IBR-type.				apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)														---	---	---	---
AIMP2	7965	broad.mit.edu	37	7	6057478	6057478	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6057478G>A	uc003spo.2	+	3	489	c.376G>A	c.(376-378)GCA>ACA	p.A126T		NM_006303	NP_006294	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting	126	Interaction with PARK2.				apoptosis|cell differentiation|multicellular organismal development|tRNA aminoacylation for protein translation	cytosol|nucleus	protein binding			ovary(1)	1																		---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20201455	20201455	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20201455A>G	uc003sus.3	-	4	340	c.31T>C	c.(31-33)TCA>CCA	p.S11P	MACC1_uc010kug.2_Missense_Mutation_p.S11P	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	11					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
COL1A2	1278	broad.mit.edu	37	7	94056959	94056959	+	Silent	SNP	C	T	T	rs149097024		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94056959C>T	uc003ung.1	+	49	3759	c.3288C>T	c.(3286-3288)GGC>GGT	p.G1096G	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1096			Missing (in OI4).|G -> A (in OI3).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---
PTCD1	26024	broad.mit.edu	37	7	99017660	99017660	+	Missense_Mutation	SNP	C	T	T	rs150466149		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99017660C>T	uc003uqh.2	-	8	2164	c.2033G>A	c.(2032-2034)CGG>CAG	p.R678Q	PTCD1_uc011kiw.1_Missense_Mutation_p.R727Q	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	678										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100682329	100682329	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682329T>C	uc003uxp.1	+	3	7685	c.7632T>C	c.(7630-7632)AGT>AGC	p.S2544S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2544	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|41.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
DNAJC2	27000	broad.mit.edu	37	7	102953432	102953432	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102953432G>A	uc003vbo.2	-	16	2004	c.1753C>T	c.(1753-1755)CCT>TCT	p.P585S	PMPCB_uc003vbl.2_3'UTR|PMPCB_uc003vbm.2_3'UTR|PMPCB_uc010liv.2_3'UTR|PMPCB_uc010liw.2_3'UTR|PMPCB_uc011kll.1_Intron|DNAJC2_uc003vbn.2_Missense_Mutation_p.P210S|DNAJC2_uc010lix.2_Missense_Mutation_p.P532S|DNAJC2_uc003vbp.2_Missense_Mutation_p.P210S	NM_014377	NP_055192	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	585	SANT 2.				'de novo' cotranslational protein folding|chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nuclear membrane	chromatin binding|DNA binding|histone binding|Hsp70 protein binding|ubiquitin binding			kidney(1)	1																		---	---	---	---
LAMB1	3912	broad.mit.edu	37	7	107577640	107577640	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107577640C>T	uc003vew.2	-	26	4179	c.3844G>A	c.(3844-3846)GCC>ACC	p.A1282T	LAMB1_uc003vev.2_Missense_Mutation_p.A1306T	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1282	Potential.|Domain II.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
TMEM168	64418	broad.mit.edu	37	7	112423832	112423832	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112423832C>T	uc003vgn.2	-	2	1441	c.1049G>A	c.(1048-1050)CGC>CAC	p.R350H	TMEM168_uc010lju.2_Missense_Mutation_p.R350H|TMEM168_uc011kmr.1_Intron	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	350						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SPAM1	6677	broad.mit.edu	37	7	123593630	123593630	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593630A>T	uc003vld.2	+	4	408	c.6A>T	c.(4-6)GGA>GGT	p.G2G	SPAM1_uc003vle.2_Silent_p.G2G|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Silent_p.G2G|SPAM1_uc010lku.2_Silent_p.G2G	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	2					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)													---	---	---	---
FLNC	2318	broad.mit.edu	37	7	128478651	128478651	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128478651C>T	uc003vnz.3	+						FLNC_uc003voa.3_Intron	NM_001458	NP_001449			gamma filamin isoform a						cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131866253	131866253	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131866253A>G	uc003vra.3	-	18	3608	c.3379T>C	c.(3379-3381)TCC>CCC	p.S1127P		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1127	Extracellular (Potential).|IPT/TIG 3.					integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
BPGM	669	broad.mit.edu	37	7	134346677	134346677	+	Missense_Mutation	SNP	C	T	T	rs141221644	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134346677C>T	uc003vrv.2	+	3	959	c.418C>T	c.(418-420)CGG>TGG	p.R140W	BPGM_uc003vrw.2_Missense_Mutation_p.R140W|BPGM_uc003vrx.2_Missense_Mutation_p.R140W	NM_199186	NP_954655	P07738	PMGE_HUMAN	bisphosphoglycerate mutase	140					glycolysis|respiratory gaseous exchange		2,3-bisphospho-D-glycerate 2-phosphohydrolase activity|bisphosphoglycerate mutase activity|phosphoglycerate mutase activity				0																		---	---	---	---
CNOT4	4850	broad.mit.edu	37	7	135079001	135079001	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135079001C>T	uc003vsv.1	-	10	1603	c.1296G>A	c.(1294-1296)TCG>TCA	p.S432S	CNOT4_uc003vss.2_Silent_p.S429S|CNOT4_uc011kpz.1_Silent_p.S429S|CNOT4_uc003vst.2_Silent_p.S432S|CNOT4_uc003vsu.1_Silent_p.S429S|CNOT4_uc011kpy.1_Silent_p.S432S	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	432					nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
SVOPL	136306	broad.mit.edu	37	7	138312915	138312915	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138312915C>T	uc011kqh.1	-	10	1057	c.1057G>A	c.(1057-1059)GGT>AGT	p.G353S	SVOPL_uc003vue.2_Missense_Mutation_p.G201S	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	353	Helical; (Potential).					integral to membrane	transmembrane transporter activity				0																		---	---	---	---
ATP6V0A4	50617	broad.mit.edu	37	7	138437555	138437555	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138437555G>A	uc003vuf.2	-	10	1082	c.844C>T	c.(844-846)CAG>TAG	p.Q282*	ATP6V0A4_uc003vug.2_Nonsense_Mutation_p.Q282*|ATP6V0A4_uc003vuh.2_Nonsense_Mutation_p.Q282*	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	282	Cytoplasmic (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1																		---	---	---	---
EPHB6	2051	broad.mit.edu	37	7	142566336	142566336	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142566336G>A	uc011kst.1	+	15	2912	c.2125G>A	c.(2125-2127)GCC>ACC	p.A709T	EPHB6_uc011ksu.1_Missense_Mutation_p.A709T|EPHB6_uc003wbs.2_Missense_Mutation_p.A417T|EPHB6_uc003wbt.2_Missense_Mutation_p.A183T|EPHB6_uc003wbu.2_Missense_Mutation_p.A417T|EPHB6_uc003wbv.2_Missense_Mutation_p.A93T	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	709	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)																	---	---	---	---
ZNF425	155054	broad.mit.edu	37	7	148802270	148802270	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148802270G>T	uc003wfj.2	-	4	766	c.693C>A	c.(691-693)TCC>TCA	p.S231S		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	231					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	148964046	148964046	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148964046C>T	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																														---	---	---	---
KRBA1	84626	broad.mit.edu	37	7	149416733	149416733	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149416733C>T	uc003wfz.2	+	2	403	c.4C>T	c.(4-6)CGG>TGG	p.R2W	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	2										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
ZNF862	643641	broad.mit.edu	37	7	149547305	149547305	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149547305C>T	uc010lpn.2	+	5	1187	c.995C>T	c.(994-996)CCG>CTG	p.P332L	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	332					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1																		---	---	---	---
ESYT2	57488	broad.mit.edu	37	7	158560362	158560362	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158560362G>A	uc003wob.1	-	8	1117	c.1051C>T	c.(1051-1053)CGG>TGG	p.R351W	ESYT2_uc003woc.1_Missense_Mutation_p.R175W|ESYT2_uc003wod.1_Missense_Mutation_p.R351W	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain	379	C2 1.					integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3																		---	---	---	---
MYOM2	9172	broad.mit.edu	37	8	2092718	2092718	+	Missense_Mutation	SNP	C	T	T	rs147501499	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2092718C>T	uc003wpx.3	+	37	4349	c.4211C>T	c.(4210-4212)ACC>ATC	p.T1404I	MYOM2_uc011kwi.1_Missense_Mutation_p.T829I	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1404	Ig-like C2-type 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3087599	3087599	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3087599G>A	uc011kwk.1	-	27	4701	c.4311C>T	c.(4309-4311)AAC>AAT	p.N1437N	CSMD1_uc011kwj.1_Silent_p.N829N|CSMD1_uc003wqe.2_Silent_p.N593N	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1437	Extracellular (Potential).|Sushi 8.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15519705	15519705	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15519705C>A	uc003wwt.2	+	5	818	c.608C>A	c.(607-609)GCT>GAT	p.A203D	TUSC3_uc003wwr.2_Missense_Mutation_p.A203D|TUSC3_uc003wws.2_Missense_Mutation_p.A203D|TUSC3_uc003wwu.2_Missense_Mutation_p.A203D|TUSC3_uc003wwv.2_Missense_Mutation_p.A203D|TUSC3_uc003www.2_Missense_Mutation_p.A203D|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.A203D	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	203	Helical; (Potential).				cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21767139	21767139	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21767139G>T	uc003wzy.1	-	5	1015	c.922C>A	c.(922-924)CGT>AGT	p.R308S	DOK2_uc003wzx.1_Missense_Mutation_p.R308S|DOK2_uc003wzz.1_Missense_Mutation_p.R154S|DOK2_uc010lth.1_Missense_Mutation_p.R154S	NM_003974	NP_003965	O60496	DOK2_HUMAN	docking protein 2	308					blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
LOXL2	4017	broad.mit.edu	37	8	23167240	23167240	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23167240G>A	uc003xdh.1	-	10	2160	c.1821C>T	c.(1819-1821)GGC>GGT	p.G607G	LOXL2_uc010lty.1_Silent_p.G146G	NM_002318	NP_002309	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2 precursor	607	Lysyl-oxidase like.				aging|cell adhesion|protein modification process	extracellular space|membrane	copper ion binding|electron carrier activity|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor|scavenger receptor activity			breast(2)|ovary(1)	3		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)														---	---	---	---
DPYSL2	1808	broad.mit.edu	37	8	26492331	26492331	+	Silent	SNP	C	T	T	rs35621323	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26492331C>T	uc003xfb.1	+	8	1076	c.726C>T	c.(724-726)ATC>ATT	p.I242I	DPYSL2_uc003xfa.2_Silent_p.I347I|DPYSL2_uc011lag.1_Silent_p.I242I|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Silent_p.I206I	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	242					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)														---	---	---	---
RAB11FIP1	80223	broad.mit.edu	37	8	37756907	37756907	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37756907G>T	uc003xkm.1	-	1	97	c.53C>A	c.(52-54)ACC>AAC	p.T18N	RAB11FIP1_uc010lvz.1_5'UTR|RAB11FIP1_uc003xkn.1_Missense_Mutation_p.T18N	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	18	C2.				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)															---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38699879	38699879	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38699879G>A	uc010lwp.2	+	10	2414	c.2035G>A	c.(2035-2037)GCT>ACT	p.A679T	TACC1_uc003xma.2_Missense_Mutation_p.A117T|TACC1_uc003xlz.2_Missense_Mutation_p.A484T|TACC1_uc003xmc.3_Missense_Mutation_p.A483T|TACC1_uc011lbz.1_Missense_Mutation_p.A666T|TACC1_uc003xmb.3_Missense_Mutation_p.A605T|TACC1_uc003xmf.3_Missense_Mutation_p.A269T|TACC1_uc011lca.1_Missense_Mutation_p.A662T|TACC1_uc011lcb.1_Missense_Mutation_p.A455T|TACC1_uc011lcd.1_RNA|TACC1_uc003xmh.3_Missense_Mutation_p.A496T|TACC1_uc010lwq.2_Missense_Mutation_p.A495T	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing	679					cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
C8orf40	114926	broad.mit.edu	37	8	42407698	42407698	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42407698G>A	uc011lcv.1	+	4	320	c.271G>A	c.(271-273)GAC>AAC	p.D91N	C8orf40_uc003xph.2_Missense_Mutation_p.D91N|C8orf40_uc003xpg.2_Missense_Mutation_p.D91N|C8orf40_uc010lxo.2_Missense_Mutation_p.D91N	NM_001135676	NP_001129148	Q96E16	CH040_HUMAN	hypothetical protein LOC114926	91						cytoplasm|integral to membrane|nucleolus					0	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48625354	48625354	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48625354T>C	uc003xqd.2	+	15	2117	c.2108T>C	c.(2107-2109)GTG>GCG	p.V703A	KIAA0146_uc011ldb.1_Missense_Mutation_p.V703A|KIAA0146_uc010lxs.2_Missense_Mutation_p.V178A|KIAA0146_uc011ldc.1_Missense_Mutation_p.V633A|KIAA0146_uc011ldd.1_Missense_Mutation_p.V643A|KIAA0146_uc003xqe.2_Missense_Mutation_p.V178A|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc011lde.1_Missense_Mutation_p.V392A|KIAA0146_uc010lxt.2_Missense_Mutation_p.V392A|KIAA0146_uc011ldf.1_Missense_Mutation_p.V208A|KIAA0146_uc011ldg.1_Missense_Mutation_p.V193A|KIAA0146_uc003xqg.1_5'Flank	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	703											0		Lung NSC(58;0.175)																---	---	---	---
DNAJC5B	85479	broad.mit.edu	37	8	66988980	66988980	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66988980G>A	uc003xvs.1	+	4	496	c.205G>A	c.(205-207)GCA>ACA	p.A69T	DNAJC5B_uc003xvt.1_RNA	NM_033105	NP_149096	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	69	J.				protein folding	membrane	heat shock protein binding|unfolded protein binding				0		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)															---	---	---	---
NCOA2	10499	broad.mit.edu	37	8	71071833	71071833	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71071833C>T	uc003xyn.1	-	10	1193	c.1031G>A	c.(1030-1032)GGC>GAC	p.G344D		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	344					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)					T	RUNXBP2	AML								---	---	---	---
LRRCC1	85444	broad.mit.edu	37	8	86042248	86042248	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86042248C>T	uc003ycw.2	+	11	1875	c.1721C>T	c.(1720-1722)GCG>GTG	p.A574V	LRRCC1_uc010lzz.1_RNA|LRRCC1_uc010maa.1_Missense_Mutation_p.A275V|LRRCC1_uc003ycx.2_Missense_Mutation_p.A481V|LRRCC1_uc003ycy.2_Missense_Mutation_p.A554V	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	574	Potential.				cell division|mitosis	centriole|nucleus					0																		---	---	---	---
DCAF4L2	138009	broad.mit.edu	37	8	88885339	88885339	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885339T>C	uc003ydz.2	-	1	958	c.861A>G	c.(859-861)TCA>TCG	p.S287S		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	287	WD 1.									ovary(1)	1																		---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89339294	89339294	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89339294G>A	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
KIAA1429	25962	broad.mit.edu	37	8	95500956	95500956	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95500956T>C	uc003ygo.1	-	24	5430	c.5417A>G	c.(5416-5418)CAT>CGT	p.H1806R	KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1806					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)															---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101011627	101011627	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101011627A>C	uc003yjb.1	-	19	3007	c.2812T>G	c.(2812-2814)TGG>GGG	p.W938G	RGS22_uc003yja.1_Missense_Mutation_p.W757G|RGS22_uc003yjc.1_Missense_Mutation_p.W926G	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	938	RGS 1.				negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
SYBU	55638	broad.mit.edu	37	8	110587336	110587336	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110587336G>A	uc003ynj.3	-	7	1954	c.1791C>T	c.(1789-1791)GGC>GGT	p.G597G	SYBU_uc003yni.3_Silent_p.G594G|SYBU_uc003ynk.3_Silent_p.G478G|SYBU_uc010mco.2_Silent_p.G596G|SYBU_uc003ynl.3_Silent_p.G596G|SYBU_uc010mcp.2_Silent_p.G597G|SYBU_uc010mcq.2_Silent_p.G597G|SYBU_uc003yno.3_Silent_p.G478G|SYBU_uc010mcr.2_Silent_p.G597G|SYBU_uc003ynm.3_Silent_p.G596G|SYBU_uc003ynn.3_Silent_p.G596G|SYBU_uc010mcs.2_Silent_p.G478G|SYBU_uc010mct.2_Silent_p.G597G|SYBU_uc010mcu.2_Silent_p.G596G|SYBU_uc003ynp.3_Silent_p.G529G|SYBU_uc010mcv.2_Silent_p.G597G|SYBU_uc003ynh.3_Silent_p.G391G|SYBU_uc011lhw.1_Silent_p.G467G	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	597						cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1																		---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125565501	125565501	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125565501C>T	uc003yrk.2	-	14	2534	c.2000G>A	c.(1999-2001)GGC>GAC	p.G667D	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_Missense_Mutation_p.G316D|MTSS1_uc011lin.1_Missense_Mutation_p.G441D|MTSS1_uc011lio.1_Missense_Mutation_p.G557D|MTSS1_uc003yri.2_Missense_Mutation_p.G385D|MTSS1_uc003yrj.2_Missense_Mutation_p.G642D|MTSS1_uc003yrl.2_Missense_Mutation_p.G671D	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	667	Pro-rich.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139163507	139163507	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139163507A>G	uc003yuy.2	-	13	3382	c.3211T>C	c.(3211-3213)TTG>CTG	p.L1071L	FAM135B_uc003yux.2_Silent_p.L972L|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.L633L|FAM135B_uc003yvb.2_Silent_p.L633L	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1071										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
FLJ43860	389690	broad.mit.edu	37	8	142500233	142500233	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142500233G>A	uc003ywi.2	-	5	762	c.681C>T	c.(679-681)GGC>GGT	p.G227G	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	227							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
RHPN1	114822	broad.mit.edu	37	8	144462879	144462879	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144462879G>A	uc003yyb.2	+	11	1470	c.1337G>A	c.(1336-1338)CGC>CAC	p.R446H		NM_052924	NP_443156	Q8TCX5	RHPN1_HUMAN	rhophilin 1	471	BRO1.				signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)															---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	414958	414958	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:414958G>A	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
AK3	50808	broad.mit.edu	37	9	4719182	4719182	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4719182C>T	uc003ziq.1	-	3	537	c.397G>A	c.(397-399)GCC>ACC	p.A133T	AK3_uc003zip.1_RNA|AK3_uc011lma.1_Missense_Mutation_p.A93T|AK3_uc003zir.1_Missense_Mutation_p.A63T	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3	133					blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)														---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6888045	6888045	+	Silent	SNP	T	C	C	rs35244873	byFrequency;by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6888045T>C	uc003zkh.2	+	7	1345	c.765T>C	c.(763-765)TAT>TAC	p.Y255Y	KDM4C_uc010mhu.2_Silent_p.Y277Y|KDM4C_uc010mhw.2_Silent_p.Y255Y|KDM4C_uc011lmi.1_Silent_p.Y255Y|KDM4C_uc011lmj.1_RNA|KDM4C_uc003zkg.2_Silent_p.Y255Y|KDM4C_uc011lmk.1_Silent_p.Y74Y	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	255	JmjC.				positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
MPDZ	8777	broad.mit.edu	37	9	13143471	13143471	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13143471G>A	uc010mia.1	-	26	3891	c.3834C>T	c.(3832-3834)GCC>GCT	p.A1278A	MPDZ_uc010mhx.2_Intron|MPDZ_uc011lmm.1_Intron|MPDZ_uc003zkz.3_Intron|MPDZ_uc010mhy.2_Silent_p.A1278A|MPDZ_uc010mhz.2_Intron|MPDZ_uc011lmn.1_Intron|MPDZ_uc003zlb.3_Silent_p.A1278A	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1278					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)														---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14805124	14805124	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14805124C>T	uc003zlm.2	-	19	3891	c.3301G>A	c.(3301-3303)GCT>ACT	p.A1101T	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1101	CSPG 7.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18574213	18574213	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18574213T>C	uc003zne.3	+	4	550	c.423T>C	c.(421-423)GGT>GGC	p.G141G	ADAMTSL1_uc003znb.2_Silent_p.G141G|ADAMTSL1_uc003znc.3_Silent_p.G141G	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	141						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20874757	20874757	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20874757C>T	uc003zog.1	+	21	2631	c.2268C>T	c.(2266-2268)GGC>GGT	p.G756G	KIAA1797_uc003zoh.1_Silent_p.G192G	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	756						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
IFNA7	3444	broad.mit.edu	37	9	21202157	21202157	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21202157C>T	uc003zop.1	-	1	48	c.8G>A	c.(7-9)CGG>CAG	p.R3Q	IFNA14_uc003zoo.1_Intron	NM_021057	NP_066401	P01567	IFNA7_HUMAN	interferon, alpha 7 precursor	3					blood coagulation|cell-cell signaling|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)														---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35382432	35382432	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35382432C>T	uc003zwq.2	+	20	2779	c.2487C>T	c.(2485-2487)AAC>AAT	p.N829N	UNC13B_uc003zwr.2_Silent_p.N829N	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	829					excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
FAM122A	116224	broad.mit.edu	37	9	71395740	71395740	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71395740C>T	uc004agw.1	+	1	777	c.660C>T	c.(658-660)GGC>GGT	p.G220G	PIP5K1B_uc004agu.2_Intron|PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_138333	NP_612206	Q96E09	F122A_HUMAN	hypothetical protein LOC116224	220											0																		---	---	---	---
TLE4	7091	broad.mit.edu	37	9	82323671	82323671	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82323671T>C	uc004ald.2	+	14	2157	c.1308T>C	c.(1306-1308)GCT>GCC	p.A436A	TLE4_uc004alc.2_Silent_p.A411A|TLE4_uc010mpr.2_Silent_p.A290A|TLE4_uc004ale.2_Silent_p.A48A|TLE4_uc011lsq.1_Silent_p.A379A|TLE4_uc010mps.2_Silent_p.A335A|TLE4_uc004alf.2_Silent_p.A350A	NM_007005	NP_008936	O60756	BCE1_HUMAN	transducin-like enhancer protein 4	Error:Variant_position_missing_in_O60756_after_alignment										lung(2)|ovary(1)|breast(1)|skin(1)	5																		---	---	---	---
CTSL3	392360	broad.mit.edu	37	9	90387899	90387899	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90387899G>A	uc004apm.1	+	1	70	c.64G>A	c.(64-66)GCC>ACC	p.A22T		NR_027917				RecName: Full=Putative cathepsin L-like protein 3;          Short=Cathepsin L-like protein; AltName: Full=HCTSL-s;											ovary(1)	1																		---	---	---	---
PTPDC1	138639	broad.mit.edu	37	9	96859844	96859844	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96859844G>T	uc004auf.1	+	7	1174	c.834G>T	c.(832-834)GAG>GAT	p.E278D	PTPDC1_uc004aug.1_Missense_Mutation_p.E278D|PTPDC1_uc004auh.1_Missense_Mutation_p.E330D|PTPDC1_uc010mrj.1_Missense_Mutation_p.E332D|PTPDC1_uc010mri.1_Missense_Mutation_p.E330D	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	278							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1																		---	---	---	---
ANKS6	203286	broad.mit.edu	37	9	101552786	101552786	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101552786G>A	uc004ayu.2	-	2	483	c.462C>T	c.(460-462)GGC>GGT	p.G154G	ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	154	ANK 4.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109687613	109687613	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109687613G>A	uc004bcz.2	+	3	1709	c.1420G>A	c.(1420-1422)GAA>AAA	p.E474K	ZNF462_uc010mto.2_Missense_Mutation_p.E322K|ZNF462_uc004bda.2_Missense_Mutation_p.E322K	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	474	C2H2-type 5.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
MUSK	4593	broad.mit.edu	37	9	113550073	113550073	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113550073G>A	uc004bey.2	+	13	1980	c.1882G>A	c.(1882-1884)GCC>ACC	p.A628T	MUSK_uc004bez.1_Missense_Mutation_p.A208T	NM_005592	NP_005583	O15146	MUSK_HUMAN	skeletal muscle receptor tyrosine kinase	628	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124530798	124530798	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124530798C>A	uc004bln.2	+	10	1770	c.1701C>A	c.(1699-1701)ATC>ATA	p.I567I	DAB2IP_uc004blo.2_Silent_p.I471I|DAB2IP_uc004blp.2_Silent_p.I22I	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	595					activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
NEK6	10783	broad.mit.edu	37	9	127089652	127089652	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127089652G>A	uc004bog.2	+	7	699	c.550G>A	c.(550-552)GGC>AGC	p.G184S	NEK6_uc004bof.2_Missense_Mutation_p.G202S|NEK6_uc004boh.2_Missense_Mutation_p.G218S|NEK6_uc010mwj.2_Missense_Mutation_p.G137S|NEK6_uc010mwk.2_Missense_Mutation_p.G184S|NEK6_uc004boi.2_Missense_Mutation_p.G184S	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2	184	Protein kinase.				apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3																		---	---	---	---
GOLGA1	2800	broad.mit.edu	37	9	127644063	127644063	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127644063C>A	uc004bpc.2	-	21	2478	c.2136G>T	c.(2134-2136)GAG>GAT	p.E712D	GOLGA1_uc010mws.2_RNA	NM_002077	NP_002068	Q92805	GOGA1_HUMAN	golgin 97	712	GRIP.					Golgi cisterna membrane				ovary(1)	1																		---	---	---	---
FPGS	2356	broad.mit.edu	37	9	130572387	130572387	+	Splice_Site	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130572387T>C	uc004bsg.1	+	13	1337	c.1287_splice	c.e13+2	p.Q429_splice	FPGS_uc004bsh.1_Splice_Site_p.Q246_splice|FPGS_uc011mal.1_Splice_Site_p.Q403_splice|FPGS_uc004bsi.1_Splice_Site_p.Q379_splice	NM_004957	NP_004948			folylpolyglutamate synthase isoform a precursor						folic acid metabolic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)													---	---	---	---
C9orf119	375757	broad.mit.edu	37	9	131038469	131038469	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131038469C>A	uc004bup.2	+	1	45	c.45C>A	c.(43-45)AGC>AGA	p.S15R	GOLGA2_uc011maw.1_5'Flank|GOLGA2_uc010mxw.2_5'Flank|GOLGA2_uc004bul.1_5'Flank|C9orf119_uc010mxx.1_Missense_Mutation_p.S15R	NM_001040011	NP_001035100	Q1ZZU3	SWI5_HUMAN	hypothetical protein LOC375757	15					double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0																		---	---	---	---
TOR1A	1861	broad.mit.edu	37	9	132585059	132585059	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132585059G>A	uc004byl.2	-	2	322	c.245C>T	c.(244-246)GCC>GTC	p.A82V	TOR1A_uc004bym.2_RNA|TOR1A_uc004byn.2_Missense_Mutation_p.A82V	NM_000113	NP_000104	O14656	TOR1A_HUMAN	torsin A precursor	82					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen|nuclear membrane	ATP binding|serine-type endopeptidase activity|unfolded protein binding			central_nervous_system(1)	1		Ovarian(14;0.00556)																---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134459791	134459791	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134459791C>T	uc004cbc.2	-	21	2893	c.2763G>A	c.(2761-2763)CGG>CGA	p.R921R	RAPGEF1_uc004cbb.2_Silent_p.R939R	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	921	Ras-GEF.				activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
RALGDS	5900	broad.mit.edu	37	9	135977061	135977061	+	Missense_Mutation	SNP	G	A	A	rs143871051	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135977061G>A	uc004cco.2	-	16	2320	c.2300C>T	c.(2299-2301)ACG>ATG	p.T767M	RALGDS_uc004cct.1_5'Flank|RALGDS_uc004ccn.2_Translation_Start_Site|RALGDS_uc004ccp.2_RNA|RALGDS_uc004ccq.2_Missense_Mutation_p.T755M|RALGDS_uc004ccr.2_Missense_Mutation_p.T766M|RALGDS_uc011mcv.1_Missense_Mutation_p.T738M|RALGDS_uc004ccs.2_Missense_Mutation_p.T712M|RALGDS_uc011mcw.1_Missense_Mutation_p.T838M|RALGDS_uc004ccv.1_Silent_p.H594H|RALGDS_uc004ccu.1_Missense_Mutation_p.T536M	NM_006266	NP_006257	Q12967	GNDS_HUMAN	ral guanine nucleotide dissociation stimulator	767					nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)				T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
KCNT1	57582	broad.mit.edu	37	9	138650317	138650317	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138650317A>G	uc011mdq.1	+	10	891	c.817A>G	c.(817-819)ATC>GTC	p.I273V	KCNT1_uc011mdr.1_Missense_Mutation_p.I100V|KCNT1_uc010nbf.2_Missense_Mutation_p.I225V|KCNT1_uc004cgo.1_Missense_Mutation_p.I22V	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	273						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)														---	---	---	---
DIP2C	22982	broad.mit.edu	37	10	435950	435950	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:435950C>A	uc001ifp.2	-	13	1668	c.1578G>T	c.(1576-1578)CAG>CAT	p.Q526H	DIP2C_uc009xhj.1_Missense_Mutation_p.Q222H	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	526						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)														---	---	---	---
WDR37	22884	broad.mit.edu	37	10	1170951	1170951	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1170951G>A	uc001igf.1	+	13	1513	c.1340G>A	c.(1339-1341)CGG>CAG	p.R447Q	WDR37_uc009xhm.1_Missense_Mutation_p.R448Q|WDR37_uc009xhn.1_RNA|WDR37_uc001igg.1_RNA	NM_014023	NP_054742	Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	447											0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)														---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7608006	7608006	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608006G>A	uc001ijq.2	-	13	2593	c.2514C>T	c.(2512-2514)TGC>TGT	p.C838C	ITIH5_uc001ijp.2_Silent_p.C624C	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	838					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
TAF3	83860	broad.mit.edu	37	10	8055710	8055710	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8055710G>A	uc010qbd.1	+	6	2585	c.2585G>A	c.(2584-2586)GGC>GAC	p.G862D		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	862					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15726071	15726071	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15726071G>T	uc001ioc.1	-	4	500	c.500C>A	c.(499-501)CCA>CAA	p.P167Q	ITGA8_uc010qcb.1_Missense_Mutation_p.P167Q	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	167	Extracellular (Potential).|FG-GAP 2.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16867001	16867001	+	Silent	SNP	G	A	A	rs146137990		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16867001G>A	uc001ioo.2	-	67	10897	c.10845C>T	c.(10843-10845)TCC>TCT	p.S3615S		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3615	CUB 27.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16911739	16911739	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911739C>T	uc001ioo.2	-	59	9402	c.9350G>A	c.(9349-9351)CGC>CAC	p.R3117H	CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_Missense_Mutation_p.R473H	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3117	CUB 23.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
ARMC3	219681	broad.mit.edu	37	10	23244766	23244766	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23244766T>G	uc001irm.3	+	4	280	c.197T>G	c.(196-198)CTT>CGT	p.L66R	ARMC3_uc010qcv.1_Missense_Mutation_p.L66R|ARMC3_uc010qcw.1_5'UTR|ARMC3_uc001irn.1_5'UTR	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	66	ARM 2.						binding				0																		---	---	---	---
MPP7	143098	broad.mit.edu	37	10	28378673	28378673	+	Silent	SNP	G	A	A	rs150334793		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28378673G>A	uc001iua.1	-	14	1454	c.1050C>T	c.(1048-1050)GAC>GAT	p.D350D	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Silent_p.D350D|MPP7_uc009xla.2_Silent_p.D350D|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	350					establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1																		---	---	---	---
ITGB1	3688	broad.mit.edu	37	10	33209310	33209310	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33209310G>T	uc001iws.3	-	10	1268	c.1132C>A	c.(1132-1134)CTT>ATT	p.L378I	ITGB1_uc001iwp.3_Missense_Mutation_p.L378I|ITGB1_uc001iwq.3_Missense_Mutation_p.L378I|ITGB1_uc001iwr.3_Missense_Mutation_p.L378I|ITGB1_uc001iwt.3_Missense_Mutation_p.L378I|ITGB1_uc001iwu.1_Missense_Mutation_p.L378I	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	378	Extracellular (Potential).|VWFA.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)																---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33475246	33475246	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33475246G>A	uc001iwx.3	-	14	2756	c.2233C>T	c.(2233-2235)CCA>TCA	p.P745S	NRP1_uc001iwv.3_Missense_Mutation_p.P745S|NRP1_uc009xlz.2_Missense_Mutation_p.P739S|NRP1_uc001iww.3_Missense_Mutation_p.P557S|NRP1_uc001iwy.3_Missense_Mutation_p.P738S	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	745	Extracellular (Potential).|MAM.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
BMS1	9790	broad.mit.edu	37	10	43292065	43292065	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43292065A>C	uc001jaj.2	+	10	1731	c.1373A>C	c.(1372-1374)AAC>ACC	p.N458T		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	458					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
ZNF32	7580	broad.mit.edu	37	10	44139887	44139887	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44139887G>A	uc001jbb.2	-	3	622	c.433C>T	c.(433-435)CGA>TGA	p.R145*	uc001jba.2_Intron|ZNF32_uc001jbc.2_Nonsense_Mutation_p.R145*	NM_001005368	NP_001005368	P17041	ZNF32_HUMAN	zinc finger protein 32	145	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)														---	---	---	---
GDF2	2658	broad.mit.edu	37	10	48416403	48416403	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48416403C>T	uc001jfa.1	-	1	454	c.291G>A	c.(289-291)ACG>ACA	p.T97T		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	97					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55582247	55582247	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582247G>T	uc001jju.1	-	33	5634	c.5239C>A	c.(5239-5241)CTT>ATT	p.L1747I	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.L1744I|PCDH15_uc010qhw.1_Missense_Mutation_p.L1707I|PCDH15_uc010qhx.1_Missense_Mutation_p.L1678I|PCDH15_uc010qhy.1_Missense_Mutation_p.L1754I|PCDH15_uc010qhz.1_Missense_Mutation_p.L1749I|PCDH15_uc010qia.1_Missense_Mutation_p.L1727I|PCDH15_uc010qib.1_Missense_Mutation_p.L1724I	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1747	Poly-Pro.|Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
C10orf27	219793	broad.mit.edu	37	10	72538305	72538305	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72538305G>A	uc001jrj.1	-						C10orf27_uc010qjm.1_Intron|C10orf27_uc009xqh.1_Intron|C10orf27_uc010qjn.1_Intron|C10orf27_uc009xqi.1_Intron|C10orf27_uc010qjo.1_Intron|C10orf27_uc009xqj.1_3'UTR	NM_152710	NP_689923			stromal protein associated with thymii and lymph						cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1																		---	---	---	---
CHST3	9469	broad.mit.edu	37	10	73766924	73766924	+	Intron	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73766924T>G	uc001jsn.2	+							NM_004273	NP_004264			chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0																		---	---	---	---
LRIT2	340745	broad.mit.edu	37	10	85981787	85981787	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85981787C>T	uc001kcy.2	-	3	1550	c.1542G>A	c.(1540-1542)CCG>CCA	p.P514P	LRIT2_uc010qmc.1_Silent_p.P524P	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	514						integral to membrane				ovary(2)	2																		---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88230820	88230820	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88230820G>A	uc001kdo.2	-	8	2513	c.2071C>T	c.(2071-2073)CGA>TGA	p.R691*	WAPAL_uc009xsv.2_Nonsense_Mutation_p.R5*|WAPAL_uc001kdn.2_Nonsense_Mutation_p.R728*|WAPAL_uc009xsw.2_Nonsense_Mutation_p.R685*	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	691	WAPL.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
CYP2C19	1557	broad.mit.edu	37	10	96484237	96484237	+	Translation_Start_Site	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96484237C>A	uc010qny.1	+	5	765	c.-93C>A	c.(-95--91)ACCTG>ACATG		CYP2C18_uc001kjv.3_Missense_Mutation_p.L366M|CYP2C18_uc001kjw.3_Missense_Mutation_p.L307M|CYP2C19_uc009xus.1_Intron	NM_000769	NP_000760			cytochrome P450, family 2, subfamily C,						exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)													---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98742860	98742860	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98742860G>T	uc001kmv.2	+	1	1820	c.1713G>T	c.(1711-1713)GAG>GAT	p.E571D		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	571										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
ENTPD7	57089	broad.mit.edu	37	10	101458568	101458568	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101458568C>T	uc001kqa.3	+	10	1466	c.1288C>T	c.(1288-1290)CGC>TGC	p.R430C	ENTPD7_uc009xwl.2_Missense_Mutation_p.R432C	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase	430	Vesicular (Potential).					cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)														---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104264032	104264032	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104264032C>T	uc001kvy.1	+	1	269	c.123C>T	c.(121-123)TGC>TGT	p.C41C	SUFU_uc001kvw.1_Silent_p.C41C|SUFU_uc001kvx.2_Silent_p.C41C|ACTR1A_uc001kvv.2_5'Flank|ACTR1A_uc010qqn.1_5'Flank|ACTR1A_uc010qqo.1_5'Flank	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	41					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
TRIM8	81603	broad.mit.edu	37	10	104415901	104415901	+	Intron	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104415901T>C	uc001kvz.2	+							NM_030912	NP_112174			tripartite motif-containing 8							cytoplasm|PML body	ligase activity|protein homodimerization activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108338937	108338937	+	Intron	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108338937A>G	uc001kym.2	-						SORCS1_uc001kyl.2_Silent_p.S1148S|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Silent_p.S1148S|SORCS1_uc001kyo.2_3'UTR	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
WDR11	55717	broad.mit.edu	37	10	122625206	122625206	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122625206G>A	uc010qtf.1	+	7	1182	c.944G>A	c.(943-945)CGT>CAT	p.R315H	WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_Translation_Start_Site	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	315						integral to membrane					0																		---	---	---	---
HMX2	3167	broad.mit.edu	37	10	124908090	124908090	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124908090T>G	uc001lhc.1	+	1	453	c.196T>G	c.(196-198)TTC>GTC	p.F66V		NM_005519	NP_005510	A2RU54	HMX2_HUMAN	H6 family homeobox 2	66					cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)														---	---	---	---
BUB3	9184	broad.mit.edu	37	10	124921806	124921806	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124921806A>C	uc001lhe.2	+	6	873	c.631A>C	c.(631-633)AGC>CGC	p.S211R	BUB3_uc009yah.2_Missense_Mutation_p.S163R|BUB3_uc001lhf.3_Missense_Mutation_p.S211R|BUB3_uc001lhd.2_Missense_Mutation_p.S211R|BUB3_uc010qud.1_Missense_Mutation_p.S131R	NM_004725	NP_004716	O43684	BUB3_HUMAN	budding uninhibited by benzimidazoles 3 isoform	211					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|attachment of spindle microtubules to kinetochore|cell division|meiosis|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle	condensed chromosome kinetochore|cytosol|nucleus	protein binding			ovary(1)	1		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)																---	---	---	---
EBF3	253738	broad.mit.edu	37	10	131757263	131757263	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131757263G>T	uc001lki.1	-	5	479	c.420C>A	c.(418-420)GTC>GTA	p.V140V		NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3	140					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)														---	---	---	---
B4GALNT4	338707	broad.mit.edu	37	11	373264	373264	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:373264T>C	uc001lpb.2	+	6	618	c.609T>C	c.(607-609)GCT>GCC	p.A203A		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	203	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1267503	1267503	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267503G>A	uc009ycr.1	+	49	11268	c.11142G>A	c.(11140-11142)ACG>ACA	p.T3714T	MUC5B_uc001ltb.2_Silent_p.T3134T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3131	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
TRPM5	29850	broad.mit.edu	37	11	2428999	2428999	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2428999C>T	uc001lwm.3	-	19	2935	c.2926G>A	c.(2926-2928)GCC>ACC	p.A976T	TRPM5_uc010qxl.1_Missense_Mutation_p.A976T|TRPM5_uc009ydn.2_Missense_Mutation_p.A978T	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,	976	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)														---	---	---	---
OR52I2	143502	broad.mit.edu	37	11	4608096	4608096	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4608096T>C	uc010qyh.1	+	1	54	c.54T>C	c.(52-54)ATT>ATC	p.I18I		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR51F2	119694	broad.mit.edu	37	11	4843262	4843262	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4843262C>T	uc010qyn.1	+	1	647	c.647C>T	c.(646-648)GCG>GTG	p.A216V		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
UBQLN3	50613	broad.mit.edu	37	11	5529610	5529610	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5529610G>A	uc001may.1	-	2	1265	c.1179C>T	c.(1177-1179)GGC>GGT	p.G393G	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	393										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR2AG1	144125	broad.mit.edu	37	11	6806831	6806831	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806831C>T	uc001mer.1	+	1	563	c.563C>T	c.(562-564)GCC>GTC	p.A188V		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---
ZNF214	7761	broad.mit.edu	37	11	7021534	7021534	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7021534A>G	uc001mfa.2	-	3	1683	c.1380T>C	c.(1378-1380)CAT>CAC	p.H460H	ZNF214_uc010ray.1_Silent_p.H460H|ZNF214_uc009yfh.1_Silent_p.H460H	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	460	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)														---	---	---	---
ARNTL	406	broad.mit.edu	37	11	13393740	13393740	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13393740G>T	uc001mkr.2	+	13	1259	c.851G>T	c.(850-852)AGC>ATC	p.S284I	ARNTL_uc001mko.2_Missense_Mutation_p.S240I|ARNTL_uc001mkp.2_Missense_Mutation_p.S283I|ARNTL_uc001mkq.2_Missense_Mutation_p.S283I|ARNTL_uc001mks.2_Missense_Mutation_p.S241I|ARNTL_uc001mkt.2_Missense_Mutation_p.S284I|ARNTL_uc001mku.2_RNA|ARNTL_uc009ygm.1_Intron|ARNTL_uc001mkv.1_Missense_Mutation_p.S241I|ARNTL_uc001mkw.2_Missense_Mutation_p.S241I|ARNTL_uc001mkx.2_Missense_Mutation_p.S282I	NM_001178	NP_001169	O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear	284					circadian rhythm|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	aryl hydrocarbon receptor binding|DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0				Epithelial(150;0.0243)														---	---	---	---
PIK3C2A	5286	broad.mit.edu	37	11	17190440	17190440	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17190440A>G	uc001mmq.3	-	1	915	c.849T>C	c.(847-849)AAT>AAC	p.N283N	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Intron|PIK3C2A_uc001mmr.3_RNA|PIK3C2A_uc010rcx.1_Silent_p.N283N|PIK3C2A_uc009ygv.1_Silent_p.N283N	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	283					cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)													---	---	---	---
E2F8	79733	broad.mit.edu	37	11	19251862	19251862	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19251862C>A	uc001mpm.2	-	9	1806	c.1284G>T	c.(1282-1284)CAG>CAT	p.Q428H	E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Missense_Mutation_p.Q428H	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	428					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20907060	20907060	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20907060C>T	uc001mqe.2	+	5	730	c.577C>T	c.(577-579)CGC>TGC	p.R193C	NELL1_uc001mqf.2_Missense_Mutation_p.R193C|NELL1_uc009yid.2_Missense_Mutation_p.R221C|NELL1_uc010rdo.1_Missense_Mutation_p.R136C|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	193	TSP N-terminal.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
SLC17A6	57084	broad.mit.edu	37	11	22387116	22387116	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22387116A>G	uc001mqk.2	+	7	1185	c.772A>G	c.(772-774)ATG>GTG	p.M258V		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	258	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4																		---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33596423	33596423	+	Intron	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33596423A>C	uc001mup.3	+						C11orf41_uc001mun.1_Intron	NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
NAT10	55226	broad.mit.edu	37	11	34133754	34133754	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34133754G>C	uc001mvk.2	+	4	600	c.356G>C	c.(355-357)GGC>GCC	p.G119A	NAT10_uc010ren.1_Missense_Mutation_p.G47A	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 isoform a	119						nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)																---	---	---	---
TRAF6	7189	broad.mit.edu	37	11	36520142	36520142	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36520142A>T	uc001mwr.1	-	4	685	c.345T>A	c.(343-345)AAT>AAA	p.N115K	TRAF6_uc001mws.1_Missense_Mutation_p.N115K	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	115	Interaction with TAX1BP1.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)																---	---	---	---
MED19	219541	broad.mit.edu	37	11	57472562	57472562	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57472562A>G	uc001nla.1	-	2	379	c.357T>C	c.(355-357)CCT>CCC	p.P119P	MED19_uc001nlb.2_Silent_p.P119P	NM_153450	NP_703151	A0JLT2	MED19_HUMAN	mediator complex subunit 19	119					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex		p.P119L(1)		ovary(2)	2																		---	---	---	---
TMEM132A	54972	broad.mit.edu	37	11	60697990	60697990	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60697990T>C	uc001nqj.2	+	5	1068	c.875T>C	c.(874-876)GTG>GCG	p.V292A	TMEM132A_uc001nqi.2_Missense_Mutation_p.V292A|TMEM132A_uc001nqk.2_Missense_Mutation_p.V305A|TMEM132A_uc001nql.1_Missense_Mutation_p.V305A	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	292	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1																		---	---	---	---
DDB1	1642	broad.mit.edu	37	11	61071397	61071397	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61071397G>A	uc001nrc.3	-	22	2998	c.2772C>T	c.(2770-2772)GGC>GGT	p.G924G	DDB1_uc010rle.1_Silent_p.G235G|DDB1_uc010rlf.1_Silent_p.G924G	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	924	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4													NER					---	---	---	---
FLRT1	23769	broad.mit.edu	37	11	63884259	63884259	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63884259G>A	uc001nyi.1	+	2	861	c.520G>A	c.(520-522)GCC>ACC	p.A174T	MACROD1_uc001nyh.2_Intron	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein	146	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64428414	64428414	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64428414G>A	uc001oar.2	-	11	2435	c.1996C>T	c.(1996-1998)CGT>TGT	p.R666C	NRXN2_uc001oas.2_Missense_Mutation_p.R635C|NRXN2_uc001oaq.2_Missense_Mutation_p.R333C	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:Variant_position_missing_in_P58401_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
NAALADL1	10004	broad.mit.edu	37	11	64824840	64824840	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64824840C>T	uc001ocn.2	-						NAALADL1_uc010rnw.1_Intron	NM_005468	NP_005459			N-acetylated alpha-linked acidic						proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0																		---	---	---	---
TIGD3	220359	broad.mit.edu	37	11	65124144	65124144	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65124144G>A	uc001odo.3	+	2	1028	c.865G>A	c.(865-867)GCC>ACC	p.A289T		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	289	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0																		---	---	---	---
EFEMP2	30008	broad.mit.edu	37	11	65637592	65637592	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65637592C>T	uc001ofy.3	-	6	801	c.607G>A	c.(607-609)GAT>AAT	p.D203N	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.D203N	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	203	EGF-like 4; calcium-binding (Potential).				blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)														---	---	---	---
CTSF	8722	broad.mit.edu	37	11	66332220	66332220	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66332220C>T	uc001oip.2	-	10	1313	c.1223G>A	c.(1222-1224)GGC>GAC	p.G408D		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	408					proteolysis	lysosome	cysteine-type endopeptidase activity				0																		---	---	---	---
RCE1	9986	broad.mit.edu	37	11	66613485	66613485	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66613485G>A	uc001ojk.1	+	8	953	c.909G>A	c.(907-909)ACG>ACA	p.T303T	RCE1_uc001ojl.1_Silent_p.T199T	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN	prenyl protein peptidase RCE1 isoform 1	303	Helical; (Potential).				proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity			ovary(1)|breast(1)	2																		---	---	---	---
RHOD	29984	broad.mit.edu	37	11	66838974	66838974	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66838974C>T	uc001ojv.2	+	5	619	c.534C>T	c.(532-534)AAC>AAT	p.N178N		NM_014578	NP_055393	O00212	RHOD_HUMAN	ras homolog D precursor	178					regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
CARNS1	57571	broad.mit.edu	37	11	67187277	67187277	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67187277C>T	uc009yrp.2	+	6	1164	c.712C>T	c.(712-714)CGG>TGG	p.R238W	PPP1CA_uc001okx.1_Intron|CARNS1_uc010rpr.1_Missense_Mutation_p.R361W|CARNS1_uc001olc.3_Missense_Mutation_p.R377W	NM_020811	NP_065862	A5YM72	CRNS1_HUMAN	ATP-grasp domain containing 1	238					carnosine biosynthetic process		ATP binding|carnosine synthase activity|metal ion binding				0																		---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70189942	70189942	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70189942G>A	uc001opo.2	+	15	2073	c.1875G>A	c.(1873-1875)GCG>GCA	p.A625A	PPFIA1_uc001opn.1_Silent_p.A625A|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	625	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---
FOLH1B	219595	broad.mit.edu	37	11	89424639	89424639	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424639A>C	uc001pda.2	+	12	1515	c.989A>C	c.(988-990)AAT>ACT	p.N330T		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	330					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
KIAA1826	84437	broad.mit.edu	37	11	105880396	105880396	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880396G>A	uc001piy.2	-	3	1077	c.904C>T	c.(904-906)CGA>TGA	p.R302*	KIAA1826_uc001piz.2_Nonsense_Mutation_p.R302*	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	302	Potential.					nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)														---	---	---	---
ATM	472	broad.mit.edu	37	11	108164110	108164110	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108164110T>C	uc001pkb.1	+	31	5067	c.4682T>C	c.(4681-4683)CTT>CCT	p.L1561P	ATM_uc009yxr.1_Missense_Mutation_p.L1561P|ATM_uc001pke.1_Missense_Mutation_p.L213P|ATM_uc001pkf.2_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1561					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)				D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			---	---	---	---
PHLDB1	23187	broad.mit.edu	37	11	118516454	118516454	+	Missense_Mutation	SNP	G	A	A	rs137998974		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118516454G>A	uc001ptr.1	+	18	3771	c.3418G>A	c.(3418-3420)GCG>ACG	p.A1140T	PHLDB1_uc001pts.2_Missense_Mutation_p.A1140T|PHLDB1_uc001ptt.2_Missense_Mutation_p.A1093T|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Missense_Mutation_p.A955T|PHLDB1_uc001ptw.1_Missense_Mutation_p.A495T|PHLDB1_uc009zai.1_Missense_Mutation_p.A176T|PHLDB1_uc001ptx.1_Missense_Mutation_p.A176T|PHLDB1_uc010ryi.1_3'UTR	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	1140											0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)														---	---	---	---
POU2F3	25833	broad.mit.edu	37	11	120176450	120176450	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120176450T>C	uc001pxc.2	+	8	827	c.725T>C	c.(724-726)ATG>ACG	p.M242T	POU2F3_uc010rzk.1_Missense_Mutation_p.M196T|POU2F3_uc010rzl.1_Missense_Mutation_p.M172T|POU2F3_uc001pxe.1_Missense_Mutation_p.M27T	NM_014352	NP_055167	Q9UKI9	PO2F3_HUMAN	POU transcription factor	242	POU-specific.				negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)|skin(1)	2		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)														---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120833350	120833350	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120833350C>T	uc001pxn.2	+	18	2513	c.2226C>T	c.(2224-2226)GGC>GGT	p.G742G	GRIK4_uc009zav.1_Silent_p.G742G|GRIK4_uc009zaw.1_Silent_p.G742G|GRIK4_uc009zax.1_Silent_p.G742G	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor	742	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
TECTA	7007	broad.mit.edu	37	11	120976660	120976660	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120976660A>G	uc010rzo.1	+	2	185	c.185A>G	c.(184-186)TAC>TGC	p.Y62C		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	62					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)														---	---	---	---
SORL1	6653	broad.mit.edu	37	11	121448108	121448108	+	Silent	SNP	C	T	T	rs138407235		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121448108C>T	uc001pxx.2	+	25	3659	c.3579C>T	c.(3577-3579)ACC>ACT	p.T1193T	SORL1_uc010rzp.1_Silent_p.T39T	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	1193	Extracellular (Potential).|LDL-receptor class A 3.				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124120777	124120777	+	IGR	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124120777G>A								OR8G2 (24467 upstream) : OR8D1 (58960 downstream)																																			---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126294613	126294613	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126294613G>A	uc001qea.2	-	17	2560	c.2199C>T	c.(2197-2199)AGC>AGT	p.S733S	KIRREL3_uc001qeb.2_Silent_p.S721S|ST3GAL4_uc001qdx.1_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1	733	Cytoplasmic (Potential).|Ser-rich.				hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
WNK1	65125	broad.mit.edu	37	12	1005427	1005427	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1005427C>T	uc001qio.3	+	24	6281	c.5774C>T	c.(5773-5775)GCC>GTC	p.A1925V	WNK1_uc001qip.3_Missense_Mutation_p.A1677V|WNK1_uc001qir.3_Missense_Mutation_p.A1098V	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1925					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
NTF3	4908	broad.mit.edu	37	12	5603459	5603459	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5603459C>T	uc001qnl.3	+	1	162	c.79C>T	c.(79-81)CCA>TCA	p.P27S	NTF3_uc001qnk.3_Missense_Mutation_p.P40S	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	27					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1																		---	---	---	---
NTF3	4908	broad.mit.edu	37	12	5603725	5603725	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5603725G>A	uc001qnl.3	+	1	428	c.345G>A	c.(343-345)CCG>CCA	p.P115P	NTF3_uc001qnk.3_Silent_p.P128P	NM_002527	NP_002518	P20783	NTF3_HUMAN	neurotrophin 3 isoform 2 preproprotein	115					signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1																		---	---	---	---
CD4	920	broad.mit.edu	37	12	6925311	6925311	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6925311A>T	uc001qqv.1	+	6	942	c.697A>T	c.(697-699)ACG>TCG	p.T233S	CD4_uc009zez.1_3'UTR|CD4_uc009zfa.1_RNA|CD4_uc009zfb.1_RNA|CD4_uc010sfj.1_5'UTR|CD4_uc009zfc.1_Missense_Mutation_p.T54S|CD4_uc010sfk.1_5'UTR|CD4_uc010sfl.1_5'UTR|CD4_uc010sfm.1_5'UTR	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	233	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)																---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7527225	7527225	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7527225A>G	uc001qsy.2	-	13	3248	c.3222T>C	c.(3220-3222)TGT>TGC	p.C1074C	CD163L1_uc010sge.1_Silent_p.C1084C	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1074	SRCR 10.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CD163L1	283316	broad.mit.edu	37	12	7531592	7531592	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7531592C>T	uc001qsy.2	-	9	2379	c.2353G>A	c.(2353-2355)GCA>ACA	p.A785T	CD163L1_uc010sge.1_Missense_Mutation_p.A795T	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	785	SRCR 7.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11																		---	---	---	---
SLC2A14	144195	broad.mit.edu	37	12	7981304	7981304	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7981304C>T	uc001qtk.2	-	11	1534	c.741G>A	c.(739-741)ACG>ACA	p.T247T	SLC2A14_uc001qtl.2_Silent_p.T224T|SLC2A14_uc001qtm.2_Silent_p.T224T|SLC2A14_uc010sgg.1_Silent_p.T138T|SLC2A14_uc001qtn.2_Silent_p.T247T|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Silent_p.T262T	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	247	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)														---	---	---	---
GOLT1B	51026	broad.mit.edu	37	12	21665273	21665273	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21665273T>C	uc001rez.2	+	4	500	c.341T>C	c.(340-342)GTC>GCC	p.V114A	GOLT1B_uc009zis.2_RNA|GOLT1B_uc009zit.2_RNA|GOLT1B_uc009ziu.2_RNA	NM_016072	NP_057156	Q9Y3E0	GOT1B_HUMAN	golgi transport 1 homolog B	114	Cytoplasmic (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport|vesicle-mediated transport	endoplasmic reticulum|Golgi membrane|integral to membrane	signal transducer activity				0																		---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22035726	22035726	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22035726C>T	uc001rfi.1	-	14	2013	c.1993G>A	c.(1993-1995)GCA>ACA	p.A665T	ABCC9_uc001rfh.2_Missense_Mutation_p.A665T|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	665	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	A	A	rs121913530		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25398285C>A	uc001rgp.1	-	2	215	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26784907	26784907	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26784907G>A	uc001rhg.2	-	22	3243	c.2826C>T	c.(2824-2826)AGC>AGT	p.S942S		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	942	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26839488	26839488	+	Silent	SNP	C	T	T	rs117349764	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26839488C>T	uc001rhg.2	-	11	1491	c.1074G>A	c.(1072-1074)CCG>CCA	p.P358P		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	358	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
MED21	9412	broad.mit.edu	37	12	27181274	27181274	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27181274G>T	uc001rhp.1	+	4	345	c.315G>T	c.(313-315)GAG>GAT	p.E105D	MED21_uc009zjh.1_RNA	NM_004264	NP_004255	Q13503	MED21_HUMAN	mediator complex subunit 21	105					positive regulation of transcription from RNA polymerase II promoter	mediator complex	DNA-directed RNA polymerase activity|transcription coactivator activity				0	Colorectal(261;0.0847)																	---	---	---	---
SYT10	341359	broad.mit.edu	37	12	33579288	33579288	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579288C>T	uc001rll.1	-	2	591	c.294G>A	c.(292-294)CAG>CAA	p.Q98Q	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	98	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)																	---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40672043	40672043	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40672043G>T	uc001rmg.3	+	18	2342	c.2221G>T	c.(2221-2223)GGA>TGA	p.G741*	LRRK2_uc001rmh.1_Nonsense_Mutation_p.G363*	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	741					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
PDZRN4	29951	broad.mit.edu	37	12	41967251	41967251	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41967251G>A	uc010skn.1	+	10	2141	c.2073G>A	c.(2071-2073)AAG>AAA	p.K691K	PDZRN4_uc001rmq.3_Silent_p.K632K|PDZRN4_uc009zjz.2_Silent_p.K630K|PDZRN4_uc001rmr.2_Silent_p.K517K	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	890							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)																---	---	---	---
GXYLT1	283464	broad.mit.edu	37	12	42491296	42491296	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42491296T>C	uc001rms.3	-	7	1334	c.1109A>G	c.(1108-1110)TAC>TGC	p.Y370C	GXYLT1_uc001rmt.3_Missense_Mutation_p.Y339C	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3	370	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0																		---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46246350	46246350	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46246350C>T	uc001ros.1	+	15	4444	c.4444C>T	c.(4444-4446)CAA>TAA	p.Q1482*	ARID2_uc001ror.2_Nonsense_Mutation_p.Q1482*|ARID2_uc009zkg.1_Nonsense_Mutation_p.Q938*|ARID2_uc009zkh.1_Nonsense_Mutation_p.Q1109*|ARID2_uc001rou.1_Nonsense_Mutation_p.Q816*	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1482					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
CCNT1	904	broad.mit.edu	37	12	49087792	49087792	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49087792G>A	uc001rse.1	-	9	1528	c.1205C>T	c.(1204-1206)GCC>GTC	p.A402V	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.A117V	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	402	Potential.				cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6																		---	---	---	---
PRPF40B	25766	broad.mit.edu	37	12	50029022	50029022	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50029022G>A	uc001rur.1	+	12	1140	c.1076G>A	c.(1075-1077)CGC>CAC	p.R359H	PRPF40B_uc001rup.1_Missense_Mutation_p.R381H|PRPF40B_uc001ruq.1_Missense_Mutation_p.R353H|PRPF40B_uc001rus.1_Missense_Mutation_p.R302H	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	359					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5																		---	---	---	---
KRT1	3848	broad.mit.edu	37	12	53069130	53069130	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53069130G>A	uc001sau.1	-	9	1841	c.1782C>T	c.(1780-1782)GGC>GGT	p.G594G	KRT1_uc001sav.1_Silent_p.G587G	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	594	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2																		---	---	---	---
AVPR1A	552	broad.mit.edu	37	12	63544484	63544484	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544484C>T	uc001sro.1	-	1	2107	c.133G>A	c.(133-135)GTG>ATG	p.V45M		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	45	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)													---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812728A>G	uc001ssb.2	+	6	769	c.343A>G	c.(343-345)ACA>GCA	p.T115A	XPOT_uc009zqm.1_Missense_Mutation_p.T25A	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
XPOT	11260	broad.mit.edu	37	12	64812733	64812733	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812733G>A	uc001ssb.2	+	6	774	c.348G>A	c.(346-348)GAG>GAA	p.E116E	XPOT_uc009zqm.1_Silent_p.E26E	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	116	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)														---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65609822	65609822	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65609822A>G	uc001ssl.1	+	3	1632	c.1626A>G	c.(1624-1626)GCA>GCG	p.A542A	LEMD3_uc009zqo.1_Silent_p.A541A	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	542					negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
CAND1	55832	broad.mit.edu	37	12	67696401	67696401	+	Intron	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67696401T>G	uc001stn.2	+						CAND1_uc001sto.2_Intron	NM_018448	NP_060918			TIP120 protein						cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)														---	---	---	---
ELK3	2004	broad.mit.edu	37	12	96641453	96641453	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96641453G>A	uc001teo.1	+	3	1222	c.943G>A	c.(943-945)GCC>ACC	p.A315T		NM_005230	NP_005221	P41970	ELK3_HUMAN	ELK3 protein	315					negative regulation of transcription, DNA-dependent|signal transduction	mitochondrion	protein binding|purine-rich negative regulatory element binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	all_cancers(2;0.00173)																	---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100200253	100200253	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100200253G>A	uc001tge.1	-	4	1015	c.598C>T	c.(598-600)CTT>TTT	p.L200F	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Missense_Mutation_p.L200F	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	200	ANK 6.					Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
FICD	11153	broad.mit.edu	37	12	108912784	108912784	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108912784C>T	uc001tmx.1	+	3	1055	c.909C>T	c.(907-909)CCC>CCT	p.P303P		NM_007076	NP_009007	Q9BVA6	FICD_HUMAN	Huntingtin interacting protein E	303	Fido.				negative regulation of Rho GTPase activity	integral to membrane	binding|protein adenylyltransferase activity				0																		---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113733856	113733856	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113733856G>A	uc001tuw.2	+	28	2723	c.2426G>A	c.(2425-2427)CGC>CAC	p.R809H	TPCN1_uc001tux.2_Missense_Mutation_p.R881H|TPCN1_uc010syu.1_RNA	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	809	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
RPLP0	6175	broad.mit.edu	37	12	120636391	120636391	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120636391A>G	uc001txp.2	-	6	854	c.617T>C	c.(616-618)ATC>ACC	p.I206T	RPLP0_uc001txq.2_Missense_Mutation_p.I206T|RPLP0_uc001txr.2_Intron|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	206					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131476867	131476867	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131476867A>G	uc001uit.3	+	8	1455	c.896A>G	c.(895-897)TAC>TGC	p.Y299C	GPR133_uc010tbm.1_Missense_Mutation_p.Y331C	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	299	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
EP400	57634	broad.mit.edu	37	12	132547087	132547087	+	Silent	SNP	G	A	A	rs12366766		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547087G>A	uc001ujn.2	+	46	8210	c.8175G>A	c.(8173-8175)CAG>CAA	p.Q2725Q	EP400_uc001ujl.2_Silent_p.Q2724Q|EP400_uc001ujm.2_Silent_p.Q2644Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)														---	---	---	---
POLE	5426	broad.mit.edu	37	12	133254218	133254218	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133254218G>A	uc001uks.1	-	7	710	c.666C>T	c.(664-666)CGC>CGT	p.R222R	POLE_uc010tbq.1_RNA|POLE_uc009zyu.1_Silent_p.R195R	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon	222					base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)									DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
KL	9365	broad.mit.edu	37	13	33591184	33591184	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33591184C>T	uc001uus.2	+	1	614	c.606C>T	c.(604-606)GAC>GAT	p.D202D	KL_uc001uur.1_Intron	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	202	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)														---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43918697	43918697	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43918697G>A	uc001uza.3	-	9	1313	c.1013C>T	c.(1012-1014)GCC>GTC	p.A338V	ENOX1_uc001uzb.3_Missense_Mutation_p.A338V|ENOX1_uc001uzc.3_Missense_Mutation_p.A338V|ENOX1_uc001uyz.3_5'UTR|ENOX1_uc010tfm.1_Missense_Mutation_p.A151V	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	338	Potential.				electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
RNF219	79596	broad.mit.edu	37	13	79191059	79191059	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79191059G>A	uc001vkw.1	-	6	896	c.837C>T	c.(835-837)GGC>GGT	p.G279G	uc001vku.1_RNA|RNF219_uc010afb.1_Silent_p.G89G|RNF219_uc010afc.2_Intron	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219	279							zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)														---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99449686	99449686	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99449686G>A	uc001vnt.2	-	53	6074	c.6019C>T	c.(6019-6021)CGA>TGA	p.R2007*	DOCK9_uc001vnw.2_Nonsense_Mutation_p.R2006*|DOCK9_uc001vnq.2_Nonsense_Mutation_p.R554*|DOCK9_uc001vnr.2_Nonsense_Mutation_p.R636*|DOCK9_uc010tin.1_Nonsense_Mutation_p.R625*|DOCK9_uc001vns.2_Nonsense_Mutation_p.R542*|DOCK9_uc010tio.1_Nonsense_Mutation_p.R662*|DOCK9_uc010tip.1_Nonsense_Mutation_p.R703*	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a	2007	DHR-2.				blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
KDELC1	79070	broad.mit.edu	37	13	103443452	103443452	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103443452C>T	uc001vpq.3	-	6	1266	c.882G>A	c.(880-882)ACG>ACA	p.T294T	KDELC1_uc001vpr.3_Silent_p.T75T	NM_024089	NP_076994	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1 precursor	294						endoplasmic reticulum lumen				ovary(1)	1	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)																	---	---	---	---
F7	2155	broad.mit.edu	37	13	113771902	113771902	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113771902C>T	uc001vsv.2	+	8	848	c.797C>T	c.(796-798)GCG>GTG	p.A266V	F7_uc001vsw.2_Missense_Mutation_p.A244V|F7_uc010tjt.1_Missense_Mutation_p.A197V	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor	266	Peptidase S1.		A -> T (in FA7D).		anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)													---	---	---	---
LRRC16B	90668	broad.mit.edu	37	14	24532580	24532580	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24532580C>T	uc001wlj.2	+	31	2974	c.2817C>T	c.(2815-2817)ATC>ATT	p.I939I	LRRC16B_uc001wlk.2_Silent_p.I35I	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	939										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36159176	36159176	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36159176G>A	uc001wti.2	-	17	2691	c.2300C>T	c.(2299-2301)ACT>ATT	p.T767I	RALGAPA1_uc001wtj.2_Missense_Mutation_p.T767I|RALGAPA1_uc010tpv.1_Missense_Mutation_p.T767I|RALGAPA1_uc010tpw.1_Missense_Mutation_p.T814I|RALGAPA1_uc001wtk.1_Missense_Mutation_p.T665I	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	767					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36194349	36194349	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36194349G>A	uc001wti.2	-	14	2138	c.1747C>T	c.(1747-1749)CTG>TTG	p.L583L	RALGAPA1_uc001wtj.2_Silent_p.L583L|RALGAPA1_uc010tpv.1_Silent_p.L583L|RALGAPA1_uc010tpw.1_Silent_p.L583L|RALGAPA1_uc001wtk.1_Silent_p.L434L	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1	583					activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	38296552	38296552	+	Intron	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38296552A>G	uc001wug.2	+						uc001wuh.2_Missense_Mutation_p.H393R|uc001wui.2_RNA|uc001wuj.2_Missense_Mutation_p.H490R					Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																														---	---	---	---
SSTR1	6751	broad.mit.edu	37	14	38679601	38679601	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38679601G>A	uc001wul.1	+	3	1624	c.1007G>A	c.(1006-1008)CGC>CAC	p.R336H	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	336	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)													---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64630227	64630227	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64630227G>A	uc001xgm.2	+	89	16637	c.16407G>A	c.(16405-16407)CCG>CCA	p.P5469P	SYNE2_uc001xgl.2_Silent_p.P5469P|SYNE2_uc010apy.2_Silent_p.P1854P|SYNE2_uc001xgn.2_Silent_p.P431P|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_5'UTR	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5469	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72054698	72054698	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72054698C>T	uc001xms.2	+	2	457	c.109C>T	c.(109-111)CGG>TGG	p.R37W	SIPA1L1_uc001xmt.2_Missense_Mutation_p.R37W|SIPA1L1_uc001xmu.2_Missense_Mutation_p.R37W|SIPA1L1_uc001xmv.2_Missense_Mutation_p.R37W	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	37					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	73029132	73029132	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73029132C>T	uc001xna.3	+	17	1899	c.1376C>T	c.(1375-1377)TCG>TTG	p.S459L	RGS6_uc010ttn.1_Missense_Mutation_p.S477L|RGS6_uc001xmx.3_Missense_Mutation_p.S459L|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.S477L|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	459					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
PAPLN	89932	broad.mit.edu	37	14	73718470	73718470	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73718470C>T	uc010ttx.1	+	8	932	c.769C>T	c.(769-771)CGG>TGG	p.R257W	PAPLN_uc001xnw.3_Missense_Mutation_p.R230W|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Missense_Mutation_p.R257W	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	257						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)														---	---	---	---
C14orf43	91748	broad.mit.edu	37	14	74205491	74205491	+	Silent	SNP	C	T	T	rs142510283		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74205491C>T	uc001xot.2	-	2	2004	c.1221G>A	c.(1219-1221)TCG>TCA	p.S407S	C14orf43_uc001xou.2_Silent_p.S407S|C14orf43_uc010tud.1_Silent_p.S407S|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	407					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)														---	---	---	---
TMED8	283578	broad.mit.edu	37	14	77808279	77808279	+	Silent	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77808279A>T	uc001xto.1	-	6	813	c.813T>A	c.(811-813)GGT>GGA	p.G271G	TMED8_uc010ast.1_RNA|TMED8_uc001xtn.1_Silent_p.G115G	NM_213601	NP_998766	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain	271	GOLD.				transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)														---	---	---	---
FAM181A	90050	broad.mit.edu	37	14	94395003	94395003	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94395003G>A	uc001ybz.1	+	3	865	c.558G>A	c.(556-558)CAG>CAA	p.Q186Q	C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.Q124Q|FAM181A_uc001yca.1_Silent_p.Q124Q	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	186											0																		---	---	---	---
KIAA0284	283638	broad.mit.edu	37	14	105349144	105349144	+	Silent	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105349144C>A	uc010axb.2	+	7	776	c.552C>A	c.(550-552)GCC>GCA	p.A184A	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Silent_p.A114A|KIAA0284_uc001yps.2_Silent_p.A90A	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	184						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)														---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105411774	105411774	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105411774C>T	uc010axc.1	-	7	10134	c.10014G>A	c.(10012-10014)GCG>GCA	p.A3338A	AHNAK2_uc001ypx.2_Silent_p.A3238A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3338						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106471382	106471382	+	RNA	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106471382G>T	uc010tyt.1	-	1891		c.36727C>A								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33873841	33873841	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33873841C>T	uc001zhi.2	+	14	1640	c.1570C>T	c.(1570-1572)CTG>TTG	p.L524L	RYR3_uc010bar.2_Silent_p.L524L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	524	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
TP53BP1	7158	broad.mit.edu	37	15	43714236	43714236	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43714236T>G	uc001zrs.2	-	19	4050	c.3902A>C	c.(3901-3903)GAT>GCT	p.D1301A	TP53BP1_uc010udp.1_Missense_Mutation_p.D1301A|TP53BP1_uc001zrq.3_Missense_Mutation_p.D1306A|TP53BP1_uc001zrr.3_Missense_Mutation_p.D1306A|TP53BP1_uc010udq.1_Missense_Mutation_p.D1306A	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	1301					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)									Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
FGF7	2252	broad.mit.edu	37	15	49776672	49776672	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49776672G>A	uc001zxn.2	+	4	1085	c.556G>A	c.(556-558)GCC>ACC	p.A186T	C15orf33_uc001zxl.2_Intron|C15orf33_uc001zxm.2_Intron	NM_002009	NP_002000	P21781	FGF7_HUMAN	fibroblast growth factor 7 precursor	186					actin cytoskeleton reorganization|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization at cell surface|secretion by lung epithelial cell involved in lung growth		chemoattractant activity|growth factor activity				0		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)	Palifermin(DB00039)													---	---	---	---
CYP19A1	1588	broad.mit.edu	37	15	51514616	51514616	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51514616G>A	uc001zyz.3	-	6	809	c.558C>T	c.(556-558)GAC>GAT	p.D186D	CYP19A1_uc001zza.3_Silent_p.D186D|CYP19A1_uc001zzb.2_Silent_p.D186D|CYP19A1_uc001zzd.2_Silent_p.D186D|CYP19A1_uc010bey.1_Silent_p.D186D	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	186					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)													---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51783923	51783923	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51783923G>T	uc002abf.2	-	20	5030	c.4805C>A	c.(4804-4806)GCC>GAC	p.A1602D	DMXL2_uc010ufy.1_Missense_Mutation_p.A1602D|DMXL2_uc010bfa.2_Missense_Mutation_p.A966D	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1602						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
TLN2	83660	broad.mit.edu	37	15	63040619	63040619	+	Silent	SNP	C	T	T	rs151024322	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63040619C>T	uc002alb.3	+	30	4095	c.4095C>T	c.(4093-4095)TGC>TGT	p.C1365C	TLN2_uc002alc.3_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1365					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton	p.C1365C(1)		ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11																		---	---	---	---
TLN2	83660	broad.mit.edu	37	15	63069014	63069014	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63069014G>A	uc002alb.3	+	40	5419	c.5419G>A	c.(5419-5421)GCC>ACC	p.A1807T	TLN2_uc002alc.3_Missense_Mutation_p.A200T|TLN2_uc002ald.2_Missense_Mutation_p.A200T	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1807					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11																		---	---	---	---
CILP	8483	broad.mit.edu	37	15	65489719	65489719	+	Nonsense_Mutation	SNP	G	A	A	rs150946463		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65489719G>A	uc002aon.2	-	9	3086	c.2905C>T	c.(2905-2907)CGA>TGA	p.R969*		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	969					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7																		---	---	---	---
C15orf44	81556	broad.mit.edu	37	15	65871779	65871779	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65871779C>T	uc002apd.2	-	12	1860	c.1524G>A	c.(1522-1524)ACG>ACA	p.T508T	C15orf44_uc010uix.1_Silent_p.T544T|C15orf44_uc010uiz.1_Silent_p.T472T|C15orf44_uc010uja.1_Silent_p.T458T|C15orf44_uc010ujb.1_Silent_p.T429T|C15orf44_uc002ape.3_Silent_p.T508T|C15orf44_uc010uiy.1_Silent_p.T429T	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	508										ovary(1)	1																		---	---	---	---
C15orf44	81556	broad.mit.edu	37	15	65891302	65891302	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65891302G>A	uc002apd.2	-	5	849	c.513C>T	c.(511-513)TGC>TGT	p.C171C	C15orf44_uc010uix.1_Silent_p.C207C|C15orf44_uc010uiz.1_Silent_p.C135C|C15orf44_uc010uja.1_Silent_p.C122C|C15orf44_uc010ujb.1_Silent_p.C92C|C15orf44_uc002ape.3_Silent_p.C171C|C15orf44_uc010uiy.1_Silent_p.C92C	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	171	VWFA.									ovary(1)	1																		---	---	---	---
FEM1B	10116	broad.mit.edu	37	15	68582994	68582994	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68582994T>C	uc002arg.2	+	2	1913	c.1298T>C	c.(1297-1299)GTC>GCC	p.V433A	FEM1B_uc002arh.2_Missense_Mutation_p.V353A	NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	433					apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	72020961	72020961	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72020961C>T	uc002atb.1	+	8	1510	c.1431C>T	c.(1429-1431)GGC>GGT	p.G477G	THSD4_uc002atd.1_Silent_p.G151G|THSD4_uc010ukg.1_Silent_p.G117G|THSD4_uc002ate.2_Silent_p.G117G	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	477						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
GOLGA6B	55889	broad.mit.edu	37	15	72956779	72956779	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72956779G>A	uc010uks.1	+	13	1469	c.1428G>A	c.(1426-1428)GAG>GAA	p.E476E	uc002aux.1_5'Flank	NM_018652	NP_061122	A6NDN3	GOG6B_HUMAN	golgi autoantigen, golgin subfamily a, 6B	476	Potential.										0																		---	---	---	---
PML	5371	broad.mit.edu	37	15	74315644	74315644	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74315644C>T	uc002awv.2	+	3	1218	c.1078C>T	c.(1078-1080)CGC>TGC	p.R360C	PML_uc002awm.2_Missense_Mutation_p.R360C|PML_uc002awl.2_Missense_Mutation_p.R360C|PML_uc002awj.1_Missense_Mutation_p.R360C|PML_uc002awk.2_Missense_Mutation_p.R360C|PML_uc002awn.2_Missense_Mutation_p.R360C|PML_uc002awo.2_Missense_Mutation_p.R360C|PML_uc002awp.2_Missense_Mutation_p.R360C|PML_uc002awq.2_Missense_Mutation_p.R360C|PML_uc002awr.2_Missense_Mutation_p.R360C|PML_uc002aws.2_Missense_Mutation_p.R360C|PML_uc002awt.2_Missense_Mutation_p.R360C|PML_uc002awu.2_Missense_Mutation_p.R360C|PML_uc010ule.1_Intron|PML_uc002aww.1_Missense_Mutation_p.R275C|PML_uc002awx.2_Missense_Mutation_p.R118C|PML_uc002awy.2_5'Flank	NM_033238	NP_150241	P29590	PML_HUMAN	promyelocytic leukemia protein isoform 1	360					cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction resulting in induction of apoptosis|endoplasmic reticulum calcium ion homeostasis|induction of apoptosis|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|maintenance of protein location in nucleus|negative regulation of angiogenesis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of mitotic cell cycle|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|negative regulation of telomerase activity|negative regulation of telomere maintenance via telomerase|negative regulation of transcription, DNA-dependent|negative regulation of translation in response to oxidative stress|PML body organization|PML body organization|positive regulation of defense response to virus by host|positive regulation of histone deacetylation|protein complex assembly|protein stabilization|protein targeting|regulation of calcium ion transport into cytosol|regulation of protein phosphorylation|response to hypoxia|response to virus|transcription, DNA-dependent	cytoplasm|cytosol|early endosome membrane|extrinsic to endoplasmic reticulum membrane|insoluble fraction|nuclear matrix|nuclear membrane|nucleolus|nucleus|PML body	cobalt ion binding|DNA binding|protein binding|protein binding|protein heterodimerization activity|protein homodimerization activity|SUMO binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding|zinc ion binding			central_nervous_system(2)|kidney(2)|breast(1)	5								T	RARA|PAX5	APL|ALL								---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86261259	86261259	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86261259A>G	uc002blv.1	+	22	6040	c.5870A>G	c.(5869-5871)GAA>GGA	p.E1957G	AKAP13_uc002blu.1_Missense_Mutation_p.E1961G|AKAP13_uc010bnf.1_Missense_Mutation_p.E578G|AKAP13_uc002blw.1_Missense_Mutation_p.E422G|AKAP13_uc002blx.1_Missense_Mutation_p.E202G	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1957	Interaction with ESR1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
HAPLN3	145864	broad.mit.edu	37	15	89424594	89424594	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89424594G>T	uc002bnc.2	-	3	615	c.487C>A	c.(487-489)CTG>ATG	p.L163M	HAPLN3_uc002bne.2_RNA|HAPLN3_uc002bnd.2_Missense_Mutation_p.L225M	NM_178232	NP_839946	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	163	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	Lung NSC(78;0.0392)|all_lung(78;0.077)																	---	---	---	---
C15orf42	90381	broad.mit.edu	37	15	90125982	90125982	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90125982C>T	uc002boe.2	+	2	720	c.720C>T	c.(718-720)GGC>GGT	p.G240G		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	240					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
ANPEP	290	broad.mit.edu	37	15	90335567	90335567	+	Intron	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90335567G>T	uc002bop.3	-							NM_001150	NP_001141			membrane alanine aminopeptidase precursor						angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)													---	---	---	---
MAN2A2	4122	broad.mit.edu	37	15	91454123	91454123	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91454123G>T	uc010bnz.2	+	12	1922	c.1807G>T	c.(1807-1809)GCC>TCC	p.A603S	MAN2A2_uc010boa.2_Missense_Mutation_p.A645S|MAN2A2_uc002bqc.2_Missense_Mutation_p.A603S|MAN2A2_uc010uql.1_Missense_Mutation_p.A265S|MAN2A2_uc010uqm.1_Missense_Mutation_p.A182S|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	603	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)															---	---	---	---
MPG	4350	broad.mit.edu	37	16	133266	133266	+	Intron	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:133266C>A	uc002cfn.2	+						MPG_uc002cfm.2_Intron|MPG_uc010bqp.2_Nonsense_Mutation_p.C160*|MPG_uc002cfo.2_Intron	NM_002434	NP_002425			N-methylpurine-DNA glycosylase isoform a						depurination|DNA dealkylation involved in DNA repair	nucleoplasm	alkylbase DNA N-glycosylase activity|damaged DNA binding|identical protein binding			ovary(1)|skin(1)	2		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)											BER_DNA_glycosylases					---	---	---	---
RPUSD1	113000	broad.mit.edu	37	16	836929	836929	+	Splice_Site	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:836929C>A	uc002cka.2	-	4	644	c.410_splice	c.e4-1	p.G137_splice	RPUSD1_uc002ckb.2_Splice_Site_p.G137_splice|RPUSD1_uc002ckc.2_Splice_Site_p.G8_splice|RPUSD1_uc002ckd.2_Splice_Site_p.V103_splice|CHTF18_uc010uus.1_5'Flank|CHTF18_uc010bre.1_5'Flank|CHTF18_uc002cke.3_5'Flank|CHTF18_uc002ckf.3_5'Flank|CHTF18_uc010brf.2_5'Flank|CHTF18_uc002ckg.3_5'Flank	NM_058192	NP_478072			RNA pseudouridylate synthase domain containing						pseudouridine synthesis		pseudouridine synthase activity|RNA binding				0		Hepatocellular(780;0.00335)																---	---	---	---
CCNF	899	broad.mit.edu	37	16	2499405	2499405	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2499405C>T	uc002cqd.1	+	12	1429	c.1341C>T	c.(1339-1341)TAC>TAT	p.Y447Y	CCNF_uc002cqe.1_Silent_p.Y139Y	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	447					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)																---	---	---	---
CPPED1	55313	broad.mit.edu	37	16	12875064	12875064	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12875064G>A	uc002dca.3	-	2	378	c.267C>T	c.(265-267)GGC>GGT	p.G89G	CPPED1_uc002dcb.3_Silent_p.G89G	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain	89							hydrolase activity|metal ion binding				0																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16218650	16218650	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16218650C>T	uc010bvi.2	+	25	3770	c.3595C>T	c.(3595-3597)CTG>TTG	p.L1199L	ABCC1_uc010bvj.2_Silent_p.L1140L|ABCC1_uc010bvk.2_Silent_p.L1143L|ABCC1_uc010bvl.2_Silent_p.L1199L|ABCC1_uc010bvm.2_Silent_p.L1084L|ABCC1_uc002del.3_Silent_p.L1093L	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1199	Cytoplasmic.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22144335	22144335	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22144335G>A	uc010vbq.1	+	20	2083	c.1987G>A	c.(1987-1989)GCC>ACC	p.A663T	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.A671T	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	663	VWFA 1.					extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
TNRC6A	27327	broad.mit.edu	37	16	24802619	24802619	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24802619G>A	uc002dmm.2	+	6	2770	c.2656G>A	c.(2656-2658)GGT>AGT	p.G886S	TNRC6A_uc010bxs.2_Missense_Mutation_p.G633S|TNRC6A_uc010vcc.1_Missense_Mutation_p.G633S|TNRC6A_uc002dmn.2_Missense_Mutation_p.G633S|TNRC6A_uc002dmo.2_Missense_Mutation_p.G633S	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	886	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)														---	---	---	---
ZNF629	23361	broad.mit.edu	37	16	30794465	30794465	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30794465G>A	uc002dzs.1	-	3	1392	c.1184C>T	c.(1183-1185)ACG>ATG	p.T395M		NM_001080417	NP_001073886	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	395	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)															---	---	---	---
N4BP1	9683	broad.mit.edu	37	16	48594880	48594880	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48594880G>A	uc002efp.2	-	2	1911	c.1674C>T	c.(1672-1674)TGC>TGT	p.C558C		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	558					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)																---	---	---	---
CBLN1	869	broad.mit.edu	37	16	49315161	49315161	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49315161G>A	uc002efq.2	-	1	555	c.216C>T	c.(214-216)CAC>CAT	p.H72H		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	72	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)																---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53191220	53191220	+	Missense_Mutation	SNP	G	A	A	rs147266259	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53191220G>A	uc002ehb.2	+	1	1383	c.1219G>A	c.(1219-1221)GAG>AAG	p.E407K	CHD9_uc002egy.2_Missense_Mutation_p.E407K|CHD9_uc002egz.1_Missense_Mutation_p.E407K|CHD9_uc002eha.1_Missense_Mutation_p.E407K|CHD9_uc002ehc.2_Missense_Mutation_p.E407K	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	407					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)																---	---	---	---
C16orf80	29105	broad.mit.edu	37	16	58149340	58149340	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58149340G>A	uc002enb.1	-	4	575	c.298C>T	c.(298-300)CGT>TGT	p.R100C		NM_013242	NP_037374	Q9Y6A4	CP080_HUMAN	transcription factor IIB	100					multicellular organismal development						0																		---	---	---	---
DPEP3	64180	broad.mit.edu	37	16	68013621	68013621	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68013621A>G	uc002evc.3	-	2	504	c.410T>C	c.(409-411)CTT>CCT	p.L137P	DPEP3_uc010cex.2_Missense_Mutation_p.L137P	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN	dipeptidase 3 isoform a	112					meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)														---	---	---	---
DUS2L	54920	broad.mit.edu	37	16	68110548	68110548	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68110548G>A	uc002evi.2	+	15	1245	c.1096G>A	c.(1096-1098)GCC>ACC	p.A366T	DUS2L_uc002evj.2_Missense_Mutation_p.A366T|DUS2L_uc010vkk.1_Missense_Mutation_p.A331T|DUS2L_uc010cez.2_Missense_Mutation_p.A279T	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog	366					tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)														---	---	---	---
PLA2G15	23659	broad.mit.edu	37	16	68283238	68283238	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68283238C>A	uc002evr.2	+	2	256	c.173C>A	c.(172-174)CCG>CAG	p.P58Q	PLA2G15_uc010vld.1_Missense_Mutation_p.P58Q|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)	58					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1																		---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69964094	69964094	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69964094C>T	uc002exu.1	+	14	1467	c.1378C>T	c.(1378-1380)CGA>TGA	p.R460*	WWP2_uc002exv.1_Nonsense_Mutation_p.R460*|WWP2_uc010vlm.1_Nonsense_Mutation_p.R344*|WWP2_uc010vln.1_Nonsense_Mutation_p.R78*|WWP2_uc002exw.1_Nonsense_Mutation_p.R21*|uc002exx.1_5'Flank|MIR140_hsa-mir-140|MI0000456_5'Flank	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	460	WW 4.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																OREG0023910	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MTSS1L	92154	broad.mit.edu	37	16	70708342	70708342	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70708342T>C	uc002ezj.2	-	11	1180	c.920A>G	c.(919-921)TAC>TGC	p.Y307C		NM_138383	NP_612392	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	307	Ser-rich.				filopodium assembly|signal transduction		actin binding|cytoskeletal adaptor activity|SH3 domain binding			central_nervous_system(1)	1																		---	---	---	---
PMFBP1	83449	broad.mit.edu	37	16	72158677	72158677	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72158677C>T	uc002fcc.3	-	17	2765	c.2593G>A	c.(2593-2595)GAC>AAC	p.D865N	PMFBP1_uc002fcd.2_Missense_Mutation_p.D860N|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.D715N|PMFBP1_uc010cgo.1_Missense_Mutation_p.D156N	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	865	Potential.									ovary(2)	2		Ovarian(137;0.179)														OREG0023927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MLYCD	23417	broad.mit.edu	37	16	83933108	83933108	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83933108C>T	uc002fgz.2	+	1	379	c.359C>T	c.(358-360)GCG>GTG	p.A120V		NM_012213	NP_036345	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase precursor	120					acyl-CoA metabolic process|fatty acid biosynthetic process	mitochondrion|peroxisome	malonyl-CoA decarboxylase activity|methylmalonyl-CoA decarboxylase activity				0																		---	---	---	---
SLC38A8	146167	broad.mit.edu	37	16	84050219	84050219	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84050219G>A	uc002fhg.1	-	8	1067	c.1067C>T	c.(1066-1068)ACC>ATC	p.T356I		NM_001080442	NP_001073911	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	356	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane					0																		---	---	---	---
ATP2C2	9914	broad.mit.edu	37	16	84485577	84485577	+	Missense_Mutation	SNP	C	A	A	rs146513346	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84485577C>A	uc002fhx.2	+	18	1800	c.1711C>A	c.(1711-1713)CTT>ATT	p.L571I	ATP2C2_uc010chj.2_Missense_Mutation_p.L571I|ATP2C2_uc002fhy.2_Missense_Mutation_p.L588I|ATP2C2_uc002fhz.2_Missense_Mutation_p.L420I	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	571	Extracellular (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
KLHL36	79786	broad.mit.edu	37	16	84691319	84691319	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84691319C>T	uc002fig.2	+	3	1047	c.906C>T	c.(904-906)GGC>GGT	p.G302G	KLHL36_uc010chl.2_Silent_p.G301G	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	302	Kelch 1.									skin(2)	2																		---	---	---	---
COX4I1	1327	broad.mit.edu	37	16	85839401	85839401	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85839401A>G	uc002fje.2	+	4	468	c.304A>G	c.(304-306)ACG>GCG	p.T102A	COX4I1_uc002fjf.2_3'UTR|COX4I1_uc002fjg.1_Missense_Mutation_p.T102A|COX4I1_uc010vom.1_Missense_Mutation_p.T69A	NM_001861	NP_001852	P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	102					respiratory electron transport chain	mitochondrial inner membrane|nucleus	cytochrome-c oxidase activity|protein binding			lung(1)	1		Renal(780;0.228)																---	---	---	---
RPA1	6117	broad.mit.edu	37	17	1783866	1783866	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1783866C>T	uc002fto.2	+	12	1237	c.1122C>T	c.(1120-1122)CCC>CCT	p.P374P		NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1	374					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0													NER					---	---	---	---
PITPNM3	83394	broad.mit.edu	37	17	6376029	6376029	+	Silent	SNP	G	A	A	rs143785279		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6376029G>A	uc002gdd.3	-	11	1528	c.1377C>T	c.(1375-1377)AGC>AGT	p.S459S	PITPNM3_uc010cln.2_Silent_p.S423S|PITPNM3_uc010clm.2_5'UTR|PITPNM3_uc002gdc.3_Silent_p.S50S	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	459	DDHD.				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)														---	---	---	---
DNAH2	146754	broad.mit.edu	37	17	7707688	7707688	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7707688G>T	uc002giu.1	+	58	9101	c.9087G>T	c.(9085-9087)GAG>GAT	p.E3029D	DNAH2_uc010cnm.1_Missense_Mutation_p.E6D	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3029	Potential.|Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---
KDM6B	23135	broad.mit.edu	37	17	7753402	7753402	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7753402C>T	uc002giw.1	+	13	3956	c.3580C>T	c.(3580-3582)CGG>TGG	p.R1194W	KDM6B_uc002gix.2_Missense_Mutation_p.R496W	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1194					inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8216372	8216372	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8216372G>A	uc002glc.2	+	3	855	c.734G>A	c.(733-735)CGG>CAG	p.R245Q	ARHGEF15_uc002glb.1_3'UTR|ARHGEF15_uc002gld.2_Missense_Mutation_p.R245Q|ARHGEF15_uc010vuw.1_Intron	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	245					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
ARHGEF15	22899	broad.mit.edu	37	17	8218457	8218457	+	Silent	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8218457T>G	uc002glc.2	+	6	1243	c.1122T>G	c.(1120-1122)CCT>CCG	p.P374P	ARHGEF15_uc002gld.2_Silent_p.P374P|ARHGEF15_uc010vuw.1_Silent_p.P263P	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	374					negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3																		---	---	---	---
MFSD6L	162387	broad.mit.edu	37	17	8701217	8701217	+	Missense_Mutation	SNP	C	T	T	rs143056359	byFrequency	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8701217C>T	uc002glp.1	-	1	1370	c.1222G>A	c.(1222-1224)GCC>ACC	p.A408T		NM_152599	NP_689812	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing	408	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1																		---	---	---	---
ELAC2	60528	broad.mit.edu	37	17	12919158	12919158	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12919158G>A	uc002gnz.3	-						ELAC2_uc010vvo.1_5'Flank|ELAC2_uc010vvp.1_Intron|ELAC2_uc010vvq.1_Intron|ELAC2_uc010vvr.1_Intron	NM_018127	NP_060597			elaC homolog 2 isoform 1						tRNA processing	nucleus	endonuclease activity|metal ion binding|protein binding				0														Hereditary_Prostate_Cancer				---	---	---	---
CDRT15	146822	broad.mit.edu	37	17	14139301	14139301	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14139301G>A	uc010vvu.1	-	3	439	c.439C>T	c.(439-441)CTG>TTG	p.L147L	CDRT15_uc010coq.2_RNA	NM_001007530	NP_001007531	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	147											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)														---	---	---	---
SSH2	85464	broad.mit.edu	37	17	27958581	27958581	+	Missense_Mutation	SNP	C	T	T	rs144293105	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958581C>T	uc002heo.1	-	15	3550	c.3550G>A	c.(3550-3552)GCA>ACA	p.A1184T	SSH2_uc010wbh.1_Missense_Mutation_p.A1211T	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1184					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31618768	31618768	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31618768G>A	uc002hhu.2	-						ACCN1_uc002hht.2_Silent_p.R122R	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
MMP28	79148	broad.mit.edu	37	17	34094866	34094866	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34094866T>A	uc002hjy.1	-	9	1332	c.1073A>T	c.(1072-1074)GAG>GTG	p.E358V	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	358	Hemopexin-like 1.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
CCL23	6368	broad.mit.edu	37	17	34340329	34340329	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34340329G>A	uc002hkt.1	-	4	342	c.271C>T	c.(271-273)CGA>TGA	p.R91*	CCL23_uc002hks.1_Nonsense_Mutation_p.R108*	NM_145898	NP_665905	P55773	CCL23_HUMAN	small inducible cytokine A23 isoform CKbeta8	91					cell-cell signaling|cellular calcium ion homeostasis|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|negative regulation of cell proliferation	extracellular space	chemokine activity|heparin binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)	Treprostinil(DB00374)													---	---	---	---
ERBB2	2064	broad.mit.edu	37	17	37879658	37879658	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37879658G>A	uc002hso.2	+	17	2271	c.2033G>A	c.(2032-2034)CGG>CAG	p.R678Q	ERBB2_uc002hsm.2_Missense_Mutation_p.R648Q|ERBB2_uc010cwa.2_Missense_Mutation_p.R663Q|ERBB2_uc002hsp.2_Missense_Mutation_p.R481Q|ERBB2_uc010cwb.2_Missense_Mutation_p.R678Q|ERBB2_uc010wek.1_Missense_Mutation_p.R402Q	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	678	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			---	---	---	---
KRT32	3882	broad.mit.edu	37	17	39623484	39623484	+	Missense_Mutation	SNP	G	A	A	rs149170177	by1000genomes	TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39623484G>A	uc002hwr.2	-	1	155	c.94C>T	c.(94-96)CGG>TGG	p.R32W		NM_002278	NP_002269	Q14532	K1H2_HUMAN	keratin 32	32	Head.				epidermis development	intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000812)																---	---	---	---
SOST	50964	broad.mit.edu	37	17	41832889	41832889	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41832889G>A	uc002iec.1	-	2	510	c.463C>T	c.(463-465)CGC>TGC	p.R155C		NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor	155	CTCK.				negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)														---	---	---	---
HOXB9	3219	broad.mit.edu	37	17	46703515	46703515	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46703515C>T	uc002inx.2	-	1	321	c.117G>A	c.(115-117)CCG>CCA	p.P39P		NM_024017	NP_076922	P17482	HXB9_HUMAN	homeobox B9	39					canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48603504	48603504	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48603504G>A	uc010wmr.1	+	14	2336	c.2174G>A	c.(2173-2175)CGG>CAG	p.R725Q	MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	688					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13069103	13069103	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13069103G>A	uc010xac.1	+	26	5058	c.4978G>A	c.(4978-4980)GCC>ACC	p.A1660T	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.A1185T|CEP192_uc002kru.2_RNA|CEP192_uc002krv.2_Missense_Mutation_p.A82T|CEP192_uc002krw.2_5'Flank	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	1660										ovary(4)|pancreas(1)	5																		---	---	---	---
C18orf19	125228	broad.mit.edu	37	18	13671878	13671878	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13671878C>T	uc010dlh.2	-	4	1000	c.568G>A	c.(568-570)GCA>ACA	p.A190T	C18orf19_uc010dlg.2_Intron|C18orf19_uc010dli.2_Missense_Mutation_p.A190T|C18orf19_uc002ksj.3_Missense_Mutation_p.A190T|C18orf19_uc010dlj.2_Intron	NM_001098801	NP_001092271	Q96ND0	CR019_HUMAN	hypothetical protein LOC125228	190	DUF1279.					integral to membrane				breast(2)	2																		---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24035755	24035755	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24035755C>T	uc002kvw.2	-	5	1286	c.726G>A	c.(724-726)ACG>ACA	p.T242T	KCTD1_uc010xbj.1_Silent_p.T850T|KCTD1_uc010xbk.1_Silent_p.T242T|KCTD1_uc002kvy.2_3'UTR	NM_001136205	NP_001129677	Q719H9	KCTD1_HUMAN	potassium channel tetramerisation domain	242					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25572682	25572682	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25572682A>G	uc002kwg.2	-	9	1740	c.1281T>C	c.(1279-1281)CCT>CCC	p.P427P	CDH2_uc010xbn.1_Silent_p.P396P	NM_001792	NP_001783	P19022	CADH2_HUMAN	cadherin 2, type 1 preproprotein	427	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
C18orf34	374864	broad.mit.edu	37	18	30554568	30554568	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30554568C>T	uc002kxn.2	-	21	2608	c.2466G>A	c.(2464-2466)AGG>AGA	p.R822R	C18orf34_uc010xbq.1_RNA|C18orf34_uc010dme.1_Silent_p.R286R|C18orf34_uc010xbr.1_Silent_p.R846R|C18orf34_uc010dmf.1_Silent_p.R142R|C18orf34_uc002kxo.2_Silent_p.R784R|C18orf34_uc002kxp.2_Silent_p.R822R	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1	822										ovary(1)	1																		---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43262295	43262295	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43262295G>A	uc010dnj.2	+	21	2895	c.2574G>A	c.(2572-2574)CCG>CCA	p.P858P	SLC14A2_uc002lbe.2_Silent_p.P858P	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	858	Helical; (Potential).					apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67425047	67425047	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67425047G>A	uc002lkl.2	+	7	984	c.794G>A	c.(793-795)CGC>CAC	p.R265H		NM_152721	NP_689934	Q6PKX4	DOK6_HUMAN	docking protein 6	265	DKFBH motif.						insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
GALR1	2587	broad.mit.edu	37	18	74963015	74963015	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74963015G>A	uc002lms.3	+	1	1008	c.511G>A	c.(511-513)GCC>ACC	p.A171T		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	171	Helical; Name=4; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)														---	---	---	---
SALL3	27164	broad.mit.edu	37	18	76757125	76757125	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76757125G>A	uc002lmt.2	+	3	3706	c.3706G>A	c.(3706-3708)GGC>AGC	p.G1236S	SALL3_uc010dra.2_Missense_Mutation_p.G771S	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)														---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	76870408	76870408	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76870408G>A	uc002lmx.2	+	3	361	c.347G>A	c.(346-348)CGC>CAC	p.R116H	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Missense_Mutation_p.R116H|ATP9B_uc002lmy.1_RNA|ATP9B_uc002lmz.1_5'Flank|ATP9B_uc002lmu.2_Missense_Mutation_p.R116H	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	116	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)														---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2415849	2415849	+	Intron	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2415849G>A	uc010xgx.1	+							NM_182973	NP_892018			transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
C19orf28	126321	broad.mit.edu	37	19	3546376	3546376	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3546376C>A	uc002lxz.2	-	7	1241	c.1071G>T	c.(1069-1071)TGG>TGT	p.W357C	C19orf28_uc002lxw.2_Missense_Mutation_p.W357C|C19orf28_uc002lxx.2_Missense_Mutation_p.W357C|C19orf28_uc002lxy.2_Missense_Mutation_p.W348C	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	357	Helical; (Potential).				transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
PLIN4	729359	broad.mit.edu	37	19	4504766	4504766	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4504766C>T	uc002mar.1	-	6	3779	c.3779G>A	c.(3778-3780)TGC>TAC	p.C1260Y	PLIN4_uc010dub.1_Missense_Mutation_p.C284Y	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	1260						lipid particle|plasma membrane					0																		---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5240270	5240270	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5240270C>T	uc002mbv.2	-	12	1878	c.1644G>A	c.(1642-1644)CCG>CCA	p.P548P	PTPRS_uc002mbu.1_Silent_p.P535P|PTPRS_uc010xin.1_Silent_p.P535P|PTPRS_uc002mbw.2_Silent_p.P535P|PTPRS_uc002mbx.2_Silent_p.P539P|PTPRS_uc002mby.2_Silent_p.P535P	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	548	Extracellular (Potential).|Fibronectin type-III 3.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
SLC25A23	79085	broad.mit.edu	37	19	6441978	6441978	+	3'UTR	SNP	C	T	T	rs111515970		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6441978C>T	uc002mex.1	-	10					SLC25A23_uc010duu.1_Intron|SLC25A23_uc002meu.2_Intron|SLC25A23_uc002mev.2_Intron|SLC25A23_uc002mew.1_Intron|SLC25A23_uc010xjd.1_3'UTR	NM_024103	NP_077008			solute carrier family 25, member 23						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
EMR1	2015	broad.mit.edu	37	19	6924840	6924840	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6924840C>T	uc002mfw.2	+	15	1981	c.1943C>T	c.(1942-1944)GCG>GTG	p.A648V	EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Missense_Mutation_p.A596V|EMR1_uc010xji.1_Missense_Mutation_p.A507V|EMR1_uc010xjj.1_Missense_Mutation_p.A471V	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	648	Helical; Name=2; (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)																	---	---	---	---
PNPLA6	10908	broad.mit.edu	37	19	7607530	7607530	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7607530G>A	uc010xjq.1	+	13	1558	c.1363G>A	c.(1363-1365)GGG>AGG	p.G455R	PNPLA6_uc002mgq.1_Missense_Mutation_p.G407R|PNPLA6_uc010xjp.1_Missense_Mutation_p.G407R|PNPLA6_uc002mgr.1_Missense_Mutation_p.G407R|PNPLA6_uc002mgs.2_Missense_Mutation_p.G446R	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	446	Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9085173	9085173	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9085173A>G	uc002mkp.2	-	1	6846	c.6642T>C	c.(6640-6642)AAT>AAC	p.N2214N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2214	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9090794	9090794	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090794C>T	uc002mkp.2	-	1	1225	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	341	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
LPPR2	64748	broad.mit.edu	37	19	11468409	11468409	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11468409C>T	uc002mre.1	+	3	397	c.60C>T	c.(58-60)TTC>TTT	p.F20F	LPPR2_uc002mrf.1_Silent_p.F20F|LPPR2_uc010dxy.1_5'Flank	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type	20	Helical; (Potential).					integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1																		---	---	---	---
CIB3	117286	broad.mit.edu	37	19	16284237	16284237	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16284237T>C	uc002nds.2	-	1	50	c.50A>G	c.(49-51)CAG>CGG	p.Q17R	CIB3_uc010eae.2_5'UTR|CIB3_uc010eaf.2_RNA|CIB3_uc010eag.2_Missense_Mutation_p.Q17R	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic	17							calcium ion binding			ovary(1)	1																		---	---	---	---
PIK3R2	5296	broad.mit.edu	37	19	18273240	18273240	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18273240C>T	uc002nia.1	+	9	1545	c.1033C>T	c.(1033-1035)CGG>TGG	p.R345W	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	345	SH2 1.				fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
NCAN	1463	broad.mit.edu	37	19	19337381	19337381	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19337381G>A	uc002nlz.2	+	7	1258	c.1159G>A	c.(1159-1161)GTT>ATT	p.V387I	NCAN_uc010ecc.1_5'UTR	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	387					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)															---	---	---	---
CILP2	148113	broad.mit.edu	37	19	19656302	19656302	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19656302G>A	uc002nmv.3	+	8	3033	c.2948G>A	c.(2947-2949)CGT>CAT	p.R983H	CILP2_uc002nmw.3_Missense_Mutation_p.R989H	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	983						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1																		---	---	---	---
ZNF85	7639	broad.mit.edu	37	19	21117776	21117776	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21117776A>C	uc002npg.3	+	3	279	c.152A>C	c.(151-153)GAC>GCC	p.D51A	ZNF85_uc002npf.2_RNA|ZNF85_uc002nph.1_RNA|ZNF85_uc010ecn.2_Intron|ZNF85_uc010eco.2_5'Flank|ZNF85_uc002npi.2_5'Flank	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	51	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
GAPDHS	26330	broad.mit.edu	37	19	36033284	36033284	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36033284C>T	uc002oaf.1	+	5	629	c.513C>T	c.(511-513)GGC>GGT	p.G171G	uc010eec.1_Intron|uc002oag.2_Intron	NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,	171					gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)													---	---	---	---
ZNF567	163081	broad.mit.edu	37	19	37211245	37211245	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37211245A>G	uc010xtl.1	+	6	1841	c.1619A>G	c.(1618-1620)AAG>AGG	p.K540R	ZNF567_uc002oeo.1_Missense_Mutation_p.K540R|ZNF567_uc010xtk.1_Missense_Mutation_p.K540R|ZNF567_uc002oep.3_Missense_Mutation_p.K509R|ZNF567_uc002oeq.1_Missense_Mutation_p.K509R	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	540	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)															---	---	---	---
LGALS14	56891	broad.mit.edu	37	19	40197860	40197860	+	Silent	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40197860T>C	uc002omg.2	+	3	358	c.135T>C	c.(133-135)GAT>GAC	p.D45D	LGALS14_uc002omf.2_Silent_p.D74D	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform	45	Galectin.					nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)															---	---	---	---
FCGBP	8857	broad.mit.edu	37	19	40434210	40434210	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40434210A>G	uc002omp.3	-	2	67	c.59T>C	c.(58-60)TTG>TCG	p.L20S		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	20						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)															---	---	---	---
CIC	23152	broad.mit.edu	37	19	42791717	42791717	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42791717G>A	uc002otf.1	+	5	643	c.603G>A	c.(601-603)CGG>CGA	p.R201R		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	201	HMG box.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)						T	DUX4	soft tissue sarcoma								---	---	---	---
BCAM	4059	broad.mit.edu	37	19	45317997	45317997	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45317997C>T	uc002ozu.2	+	8	1102	c.1058C>T	c.(1057-1059)ACG>ATG	p.T353M	BCAM_uc002ozt.1_Missense_Mutation_p.T353M	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1	353	Extracellular (Potential).|Ig-like C2-type 1.				cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)																---	---	---	---
GEMIN7	79760	broad.mit.edu	37	19	45593386	45593386	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45593386T>C	uc002pap.1	+	3	165	c.14T>C	c.(13-15)GTG>GCG	p.V5A	uc002pas.2_5'Flank|GEMIN7_uc002paq.1_Missense_Mutation_p.V5A|GEMIN7_uc002par.1_Missense_Mutation_p.V5A	NM_001007270	NP_001007271	Q9H840	GEMI7_HUMAN	gemin 7	5					ncRNA metabolic process|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)														---	---	---	---
CGB7	94027	broad.mit.edu	37	19	49558135	49558135	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49558135A>G	uc002pmd.2	-	2	511	c.146T>C	c.(145-147)GTC>GCC	p.V49A	CGB_uc010yad.1_Intron|CGB8_uc002pmc.2_Intron|CGB7_uc002pme.2_Missense_Mutation_p.V49A	NM_033142	NP_149133	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 7	49					apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)													---	---	---	---
TRPM4	54795	broad.mit.edu	37	19	49713591	49713591	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49713591G>A	uc002pmw.2	+	21	3329	c.3257G>A	c.(3256-3258)CGC>CAC	p.R1086H	TRPM4_uc010emu.2_Missense_Mutation_p.R941H|TRPM4_uc010yak.1_Missense_Mutation_p.R550H|TRPM4_uc002pmx.2_Missense_Mutation_p.R912H|TRPM4_uc010emv.2_Missense_Mutation_p.R971H|TRPM4_uc010yal.1_Missense_Mutation_p.R732H|TRPM4_uc002pmy.2_Missense_Mutation_p.R428H	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,	1086	Cytoplasmic (Potential).|Calmodulin-binding.				dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)														---	---	---	---
PRMT1	3276	broad.mit.edu	37	19	50185189	50185189	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50185189G>A	uc010enf.1	+	4	257	c.215G>A	c.(214-216)CGC>CAC	p.R72H	PRMT1_uc002ppc.1_RNA|PRMT1_uc002ppd.2_Missense_Mutation_p.R48H|PRMT1_uc002ppe.2_Missense_Mutation_p.R54H|PRMT1_uc002ppf.2_RNA|PRMT1_uc002ppg.2_Missense_Mutation_p.R19H|PRMT1_uc010yba.1_RNA	NM_001536	NP_001527	Q8WUW5	Q8WUW5_HUMAN	HMT1 hnRNP methyltransferase-like 2 isoform 1	53						cytoplasm	protein methyltransferase activity			ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)														---	---	---	---
TSKS	60385	broad.mit.edu	37	19	50266392	50266392	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50266392C>A	uc002ppm.2	-	1	124	c.113G>T	c.(112-114)AGG>ATG	p.R38M		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	38							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)														---	---	---	---
PTOV1	53635	broad.mit.edu	37	19	50360277	50360277	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50360277G>A	uc002pqf.1	+	6	774	c.604G>A	c.(604-606)GTG>ATG	p.V202M	PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_Missense_Mutation_p.V170M|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	202	Interaction with FLOT1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)														---	---	---	---
NR1H2	7376	broad.mit.edu	37	19	50882274	50882274	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50882274G>A	uc010enw.2	+	8	1042	c.766G>A	c.(766-768)GCA>ACA	p.A256T	NR1H2_uc002prv.3_Intron|NR1H2_uc002prz.3_Intron|NR1H2_uc002psa.3_Missense_Mutation_p.A158T	NM_007121	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	255	Ligand-binding (Potential).				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)														---	---	---	---
POLD1	5424	broad.mit.edu	37	19	50905604	50905604	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50905604C>T	uc002psb.3	+	6	788	c.732C>T	c.(730-732)TAC>TAT	p.Y244Y	POLD1_uc002psc.3_Silent_p.Y244Y|POLD1_uc010enx.2_RNA|POLD1_uc010eny.2_Silent_p.Y244Y	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1	244					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
IGLON5	402665	broad.mit.edu	37	19	51826934	51826934	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51826934C>T	uc002pwc.2	+	3	177	c.177C>T	c.(175-177)CAC>CAT	p.H59H		NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor	59	Ig-like C2-type 1.					extracellular region					0																		---	---	---	---
ZNF480	147657	broad.mit.edu	37	19	52825647	52825647	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52825647C>T	uc010ydl.1	+	5	1214	c.1144C>T	c.(1144-1146)CAA>TAA	p.Q382*	ZNF480_uc002pyv.2_Nonsense_Mutation_p.Q305*|ZNF480_uc010ydm.1_Nonsense_Mutation_p.Q339*|ZNF480_uc010epn.2_Nonsense_Mutation_p.Q213*|uc002pyw.1_Intron	NM_144684	NP_653285	Q8WV37	ZN480_HUMAN	zinc finger protein 480	382	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)														---	---	---	---
MIR518A2	574491	broad.mit.edu	37	19	54242600	54242600	+	RNA	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54242600G>A	hsa-mir-518a-2|MI0003173	+			c.14G>A			MIR517C_hsa-mir-517c|MI0003174_5'Flank																	0																		---	---	---	---
EPN1	29924	broad.mit.edu	37	19	56203248	56203248	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56203248C>T	uc002qlw.2	+	7	1233	c.891C>T	c.(889-891)GGC>GGT	p.G297G	EPN1_uc002qlv.2_Silent_p.G272G|EPN1_uc010etd.2_Silent_p.G297G|EPN1_uc002qlx.2_Silent_p.G383G	NM_001130072	NP_001123544	Q9Y6I3	EPN1_HUMAN	epsin 1 isoform b	297	Ala/Gly/Pro-rich.|8 X 3 AA repeats of [ED]-P-W.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding				0		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)														---	---	---	---
NLRP5	126206	broad.mit.edu	37	19	56539649	56539649	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56539649A>C	uc002qmj.2	+	7	2050	c.2050A>C	c.(2050-2052)ACC>CCC	p.T684P	NLRP5_uc002qmi.2_Missense_Mutation_p.T665P	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	684						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)														---	---	---	---
ZNF583	147949	broad.mit.edu	37	19	56935314	56935314	+	Silent	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56935314T>G	uc010ygl.1	+	5	1452	c.1287T>G	c.(1285-1287)GTT>GTG	p.V429V	ZNF583_uc002qnc.2_Silent_p.V429V|ZNF583_uc010ygm.1_Silent_p.V429V	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	429	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)														---	---	---	---
ZNF8	7554	broad.mit.edu	37	19	58806559	58806559	+	Missense_Mutation	SNP	G	A	A	rs145443903		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58806559G>A	uc002qry.1	+	4	1515	c.1385G>A	c.(1384-1386)CGA>CAA	p.R462Q	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	462					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)														---	---	---	---
GPCPD1	56261	broad.mit.edu	37	20	5574004	5574004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5574004C>T	uc002wme.3	-	4	413	c.200G>A	c.(199-201)CGC>CAC	p.R67H		NM_019593	NP_062539	Q9NPB8	GPCP1_HUMAN	hypothetical protein LOC56261	67	CBM20.				glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0																		---	---	---	---
KIF16B	55614	broad.mit.edu	37	20	16488691	16488691	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16488691G>A	uc002wpg.1	-	7	769	c.611C>T	c.(610-612)GCG>GTG	p.A204V	KIF16B_uc010gch.1_Missense_Mutation_p.A204V|KIF16B_uc010gci.1_Missense_Mutation_p.A204V|KIF16B_uc010gcj.1_Missense_Mutation_p.A204V	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	204	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8																		---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35060650	35060650	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35060650G>A	uc002xff.2	+	3	965	c.530G>A	c.(529-531)GGC>GAC	p.G177D	DLGAP4_uc010zvp.1_Missense_Mutation_p.G177D	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	177					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
TTPAL	79183	broad.mit.edu	37	20	43108886	43108886	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43108886C>T	uc002xmc.1	+	3	371	c.247C>T	c.(247-249)CGC>TGC	p.R83C	TTPAL_uc002xmd.1_Missense_Mutation_p.R83C|TTPAL_uc010ggr.1_5'UTR	NM_024331	NP_077307	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	83						intracellular	transporter activity			breast(1)	1																		---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	45004410	45004410	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45004410C>T	uc002xrt.1	-	12	1037	c.827G>A	c.(826-828)CGC>CAC	p.R276H	ELMO2_uc010zxq.1_Missense_Mutation_p.R8H|ELMO2_uc002xrs.1_Missense_Mutation_p.R23H|ELMO2_uc002xru.1_Missense_Mutation_p.R276H|ELMO2_uc010zxr.1_Missense_Mutation_p.R288H|ELMO2_uc010zxs.1_Missense_Mutation_p.R93H|ELMO2_uc002xrv.1_5'UTR|ELMO2_uc002xrw.2_Missense_Mutation_p.R93H|ELMO2_uc002xrx.1_Missense_Mutation_p.R276H	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	276					apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC9A8	23315	broad.mit.edu	37	20	48503379	48503379	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48503379G>A	uc002xuv.1	+	15	1792	c.1582G>A	c.(1582-1584)GTG>ATG	p.V528M	SLC9A8_uc010zym.1_Missense_Mutation_p.V228M|SLC9A8_uc010gid.2_Missense_Mutation_p.V152M	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	528						Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)															---	---	---	---
SLC17A9	63910	broad.mit.edu	37	20	61598711	61598711	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61598711C>T	uc002yea.3	+	13	1354	c.1170C>T	c.(1168-1170)GGC>GGT	p.G390G	SLC17A9_uc002ydz.3_Silent_p.G384G|SLC17A9_uc011aap.1_3'UTR	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	390					exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
KRTAP21-1	337977	broad.mit.edu	37	21	32127620	32127620	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127620C>G	uc011adi.1	-	1	77	c.77G>C	c.(76-78)TGT>TCT	p.C26S		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	26						intermediate filament				breast(1)	1																		---	---	---	---
C21orf45	54069	broad.mit.edu	37	21	33651281	33651281	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33651281G>A	uc002ypi.2	-	1	96	c.45C>T	c.(43-45)GGC>GGT	p.G15G	C21orf45_uc011adn.1_Silent_p.G15G	NM_018944	NP_061817	Q9NYP9	MS18A_HUMAN	chromosome 21 open reading frame 45	15					cell division|CenH3-containing nucleosome assembly at centromere|mitosis	chromosome, centromeric region|nucleoplasm					0																		---	---	---	---
MRAP	56246	broad.mit.edu	37	21	33679016	33679016	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33679016C>T	uc002ypj.2	+	4	359	c.172C>T	c.(172-174)CTC>TTC	p.L58F	MRAP_uc002ypk.2_Missense_Mutation_p.L58F|MRAP_uc011ado.1_5'UTR|MRAP_uc002ypl.2_Missense_Mutation_p.L58F|uc002ypm.2_RNA	NM_178817	NP_848932	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	58	Helical; (Potential).				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding				0																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37572809	37572809	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37572809C>T	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37665815	37665815	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37665815A>T	uc002yvg.2	+	37	6922	c.6843A>T	c.(6841-6843)TTA>TTT	p.L2281F	DOPEY2_uc011aeb.1_Missense_Mutation_p.L2230F	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	2281					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DYRK1A	1859	broad.mit.edu	37	21	38862544	38862544	+	Missense_Mutation	SNP	C	G	G	rs1049784		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38862544C>G	uc002ywk.2	+	6	807	c.732C>G	c.(730-732)AAC>AAG	p.N244K	DYRK1A_uc002ywi.2_Missense_Mutation_p.N244K|DYRK1A_uc002ywj.2_Missense_Mutation_p.N235K|DYRK1A_uc002ywl.2_Missense_Mutation_p.N244K|DYRK1A_uc002ywm.2_Missense_Mutation_p.N244K|DYRK1A_uc011aei.1_Missense_Mutation_p.N5K	NM_001396	NP_001387	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	244	Protein kinase.				nervous system development|peptidyl-tyrosine phosphorylation|protein autophosphorylation	nuclear speck	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein self-association|protein serine/threonine kinase activity			ovary(2)|lung(1)|breast(1)	4																		---	---	---	---
UBASH3A	53347	broad.mit.edu	37	21	43833294	43833294	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43833294C>T	uc002zbe.2	+	4	552	c.516C>T	c.(514-516)TTC>TTT	p.F172F	UBASH3A_uc002zbf.2_Silent_p.F172F|UBASH3A_uc010gpc.2_RNA|UBASH3A_uc010gpd.2_RNA|UBASH3A_uc010gpe.2_Silent_p.F172F	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	172						cytosol|nucleus				ovary(3)	3																		---	---	---	---
RSPH1	89765	broad.mit.edu	37	21	43906511	43906511	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43906511G>A	uc002zbg.2	-	4	440	c.335C>T	c.(334-336)ACC>ATC	p.T112I		NM_080860	NP_543136	Q8WYR4	RSPH1_HUMAN	testis-specific gene A2	112	MORN 4.				meiosis	cytosol|nucleus				ovary(1)	1																		---	---	---	---
ITGB2	3689	broad.mit.edu	37	21	46308725	46308725	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46308725T>G	uc002zgd.2	-	13	2007	c.1963A>C	c.(1963-1965)AAC>CAC	p.N655H	ITGB2_uc002zge.2_Missense_Mutation_p.N655H|ITGB2_uc002zgf.3_Missense_Mutation_p.N655H|ITGB2_uc011afl.1_Missense_Mutation_p.N577H|ITGB2_uc010gpw.2_Missense_Mutation_p.N598H|ITGB2_uc002zgg.2_Missense_Mutation_p.N655H	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	655	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)													---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47423388	47423388	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47423388C>T	uc002zhu.1	+	35	2650	c.2548C>T	c.(2548-2550)CGC>TGC	p.R850C	COL6A1_uc010gqd.1_Missense_Mutation_p.R181C|COL6A1_uc002zhv.1_Missense_Mutation_p.R181C|COL6A1_uc002zhw.1_5'UTR	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	850	C-terminal globular domain.|VWFA 3.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
COL6A2	1292	broad.mit.edu	37	21	47549166	47549166	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47549166C>T	uc002zia.1	+						COL6A2_uc002zhy.1_3'UTR|COL6A2_uc002zhz.1_Missense_Mutation_p.P840S|COL6A2_uc002zib.1_Intron|COL6A2_uc002zic.1_Intron|COL6A2_uc010gqe.1_5'Flank	NM_001849	NP_001840			alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
ADRBK2	157	broad.mit.edu	37	22	26118420	26118420	+	3'UTR	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26118420C>A	uc003abx.3	+	21					ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151			beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)													---	---	---	---
CHEK2	11200	broad.mit.edu	37	22	29121017	29121017	+	Silent	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29121017G>T	uc003adu.1	-	4	612	c.540C>A	c.(538-540)CGC>CGA	p.R180R	CHEK2_uc003ads.1_Intron|CHEK2_uc010gvh.1_Intron|CHEK2_uc010gvi.1_Silent_p.R180R|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.R223R|CHEK2_uc003adv.1_Silent_p.R180R|CHEK2_uc003adw.1_Silent_p.R180R|CHEK2_uc003adx.1_5'UTR|CHEK2_uc003ady.1_Silent_p.R180R|CHEK2_uc003adz.1_Intron	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	180			R -> C (in prostate cancer; somatic mutation).|R -> H (in prostate cancer; somatic mutation).		cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20								F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				---	---	---	---
ZNRF3	84133	broad.mit.edu	37	22	29444405	29444405	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29444405G>A	uc003aeg.2	+	7	806	c.641G>A	c.(640-642)CGG>CAG	p.R214Q	ZNRF3_uc003aeh.1_Missense_Mutation_p.R214Q	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	314	RING-type; atypical.|Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1																		---	---	---	---
ASCC2	84164	broad.mit.edu	37	22	30218382	30218382	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30218382G>A	uc003agr.2	-	5	588	c.483C>T	c.(481-483)ATC>ATT	p.I161I	ASCC2_uc003ags.2_RNA|ASCC2_uc003agt.2_Silent_p.I161I|ASCC2_uc011akr.1_Silent_p.I85I	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	161					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)															---	---	---	---
MPST	4357	broad.mit.edu	37	22	37420785	37420785	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37420785C>T	uc003aqj.2	+	3	941	c.529C>T	c.(529-531)CGC>TGC	p.R177C	MPST_uc003aqi.1_Missense_Mutation_p.R177C|MPST_uc003aqm.2_Missense_Mutation_p.R177C|MPST_uc011amu.1_Missense_Mutation_p.R197C|MPST_uc003aql.2_Missense_Mutation_p.R177C|MPST_uc003aqn.2_Missense_Mutation_p.R177C|MPST_uc003aqo.2_Missense_Mutation_p.R177C	NM_001130517	NP_001123989	P25325	THTM_HUMAN	mercaptopyruvate sulfurtransferase isoform 2	177	Rhodanese 2.				cyanate catabolic process|response to toxin		3-mercaptopyruvate sulfurtransferase activity|thiosulfate sulfurtransferase activity				0																		---	---	---	---
SH3BP1	23616	broad.mit.edu	37	22	38046564	38046564	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38046564T>C	uc003ati.2	+	16	1541	c.1430T>C	c.(1429-1431)GTG>GCG	p.V477A	SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_3'UTR|SH3BP1_uc003ath.1_Missense_Mutation_p.V477A|SH3BP1_uc003atj.1_Missense_Mutation_p.V413A|SH3BP1_uc003atk.1_Missense_Mutation_p.V391A|uc003atl.1_RNA	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	477					signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
GCAT	23464	broad.mit.edu	37	22	38209628	38209628	+	Intron	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38209628C>T	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106			glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	38421886	38421886	+	IGR	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38421886G>A								POLR2F (37545 upstream) : PICK1 (31376 downstream)																																			---	---	---	---
RANGAP1	5905	broad.mit.edu	37	22	41676938	41676938	+	Silent	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41676938A>G	uc003azs.2	-	1	1581	c.111T>C	c.(109-111)GAT>GAC	p.D37D	RANGAP1_uc003azt.2_Silent_p.D37D|RANGAP1_uc003azu.2_Silent_p.D37D|RANGAP1_uc011aoz.1_5'Flank	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	37					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0																		---	---	---	---
PARVB	29780	broad.mit.edu	37	22	44514998	44514998	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44514998C>T	uc003ben.2	+	4	406	c.354C>T	c.(352-354)GGC>GGT	p.G118G	PARVB_uc003bem.2_Silent_p.G151G|PARVB_uc010gzn.2_Silent_p.G66G|PARVB_uc003beo.2_Silent_p.G81G	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b	118	CH 1.				cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---
PLXNB2	23654	broad.mit.edu	37	22	50726198	50726198	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50726198C>T	uc003bkv.3	-	7	1612	c.1506G>A	c.(1504-1506)CCG>CCA	p.P502P		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	502	Extracellular (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
LMF2	91289	broad.mit.edu	37	22	50944598	50944598	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50944598C>T	uc003blp.2	-	5	671	c.640G>A	c.(640-642)GCC>ACC	p.A214T	LMF2_uc010hba.2_Missense_Mutation_p.A36T|LMF2_uc003blo.2_Missense_Mutation_p.A189T|NCAPH2_uc003blq.3_5'Flank|NCAPH2_uc003blv.2_5'Flank|NCAPH2_uc003blr.3_5'Flank|NCAPH2_uc010hbb.2_5'Flank|NCAPH2_uc003blu.3_5'Flank|NCAPH2_uc003bls.3_5'Flank|NCAPH2_uc003blt.3_5'Flank|NCAPH2_uc003blw.3_5'Flank|NCAPH2_uc003blx.3_5'Flank|NCAPH2_uc003bly.3_5'Flank	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	214						endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
PPP2R3B	28227	broad.mit.edu	37	X	295141	295141	+	Silent	SNP	G	A	A	rs144810281		TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:295141G>A	uc004cpg.2	-	13	1890	c.1689C>T	c.(1687-1689)TAC>TAT	p.Y563Y	PPP2R3B_uc004cpf.2_Silent_p.Y164Y	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',	563					cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
PIGA	5277	broad.mit.edu	37	X	15349629	15349629	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15349629C>T	uc004cwr.2	-	2	524	c.424G>A	c.(424-426)GCC>ACC	p.A142T	PIGA_uc004cwq.2_Intron|PIGA_uc010nev.2_Intron|PIGA_uc004cws.2_Intron|PIGA_uc011miq.1_Intron|PIGA_uc010new.1_Intron	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol	142	Cytoplasmic (Potential).				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)																	---	---	---	---
MAGEB16	139604	broad.mit.edu	37	X	35821242	35821242	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35821242C>T	uc010ngt.1	+	2	1208	c.929C>T	c.(928-930)GCG>GTG	p.A310V		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	310	MAGE.									lung(3)|ovary(2)|breast(1)|skin(1)	7																		---	---	---	---
CASK	8573	broad.mit.edu	37	X	41379720	41379720	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41379720G>A	uc004dfl.3	-	27	2765	c.2719C>T	c.(2719-2721)CTC>TTC	p.L907F	CASK_uc004dfj.3_Missense_Mutation_p.L452F|CASK_uc004dfk.3_Missense_Mutation_p.L727F|CASK_uc004dfm.3_Missense_Mutation_p.L884F|CASK_uc004dfn.3_Missense_Mutation_p.L883F	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein	912					cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6																		---	---	---	---
SUV39H1	6839	broad.mit.edu	37	X	48564698	48564698	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48564698G>T	uc004dkn.2	+	4	916	c.871G>T	c.(871-873)GAC>TAC	p.D291Y	SUV39H1_uc011mmf.1_Missense_Mutation_p.D302Y|SUV39H1_uc011mmg.1_RNA	NM_003173	NP_003164	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1	291	Mediates interaction with MECOM (By similarity).|SET.				cell cycle|cell differentiation|chromatin silencing at rDNA|interspecies interaction between organisms|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|chromosome, centromeric region|condensed nuclear chromosome|rDNA heterochromatin	chromatin binding|histone methyltransferase activity (H3-K9 specific)|protein N-terminus binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	51150887	51150887	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51150887C>T	uc004dpj.2	+	1	1121	c.1019C>T	c.(1018-1020)ACG>ATG	p.T340M		NM_203407	NP_981952			hypothetical protein LOC340602																														---	---	---	---
WNK3	65267	broad.mit.edu	37	X	54276024	54276024	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54276024C>A	uc004dtd.1	-	17	3196	c.2757G>T	c.(2755-2757)TTG>TTT	p.L919F	WNK3_uc004dtc.1_Missense_Mutation_p.L919F	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	919					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11																		---	---	---	---
UBQLN2	29978	broad.mit.edu	37	X	56591820	56591820	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56591820T>C	uc004dus.2	+	1	1749	c.1514T>C	c.(1513-1515)GTC>GCC	p.V505A	UBQLN2_uc011moq.1_Intron	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	505	5.|12 X 3 AA tandem repeats of P-X-X.					cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2																		---	---	---	---
LAS1L	81887	broad.mit.edu	37	X	64753482	64753482	+	Intron	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64753482G>T	uc004dwa.1	-						LAS1L_uc004dwc.1_Intron|LAS1L_uc004dwd.1_Intron	NM_031206	NP_112483			LAS1-like							MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
RGAG4	340526	broad.mit.edu	37	X	71351350	71351350	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71351350G>A	uc010nlh.1	-	1	402	c.41C>T	c.(40-42)GCG>GTG	p.A14V	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank|NHSL2_uc010nli.2_5'Flank	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	14										ovary(2)|skin(1)	3	Renal(35;0.156)																	---	---	---	---
ERCC6L	54821	broad.mit.edu	37	X	71427426	71427426	+	Silent	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427426C>T	uc004eaq.1	-	2	1288	c.1191G>A	c.(1189-1191)ACG>ACA	p.T397T	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Silent_p.T274T	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	397					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)																	---	---	---	---
CDX4	1046	broad.mit.edu	37	X	72674374	72674374	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72674374C>T	uc011mqk.1	+	3	808	c.808C>T	c.(808-810)CGT>TGT	p.R270C		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	270						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)																	---	---	---	---
SATL1	340562	broad.mit.edu	37	X	84363384	84363384	+	Silent	SNP	G	A	A			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84363384G>A	uc011mqx.1	-	1	591	c.591C>T	c.(589-591)GGC>GGT	p.G197G	SATL1_uc004een.2_Silent_p.G197G	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	10	Gln-rich.						N-acetyltransferase activity			breast(2)	2																		---	---	---	---
TRMT2B	79979	broad.mit.edu	37	X	100274338	100274338	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100274338A>G	uc004egq.2	-	11	1522	c.1223T>C	c.(1222-1224)CTG>CCG	p.L408P	TRMT2B_uc004egp.2_RNA|TRMT2B_uc004egr.2_Missense_Mutation_p.L408P|TRMT2B_uc004egs.2_Missense_Mutation_p.L408P|TRMT2B_uc004egt.2_Missense_Mutation_p.L408P|TRMT2B_uc004egu.2_Missense_Mutation_p.L289P|TRMT2B_uc004egv.2_Missense_Mutation_p.L363P	NM_024917	NP_079193	Q96GJ1	TRM2_HUMAN	TRM2 tRNA methyltransferase 2 homolog B	408							tRNA (uracil-5-)-methyltransferase activity			ovary(1)	1																		---	---	---	---
TCEAL6	158931	broad.mit.edu	37	X	101396155	101396155	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6802-01	TCGA-BR-6802-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101396155G>T	uc004eiq.2	-	3	310	c.149C>A	c.(148-150)GCT>GAT	p.A50D		NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	50	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1																		---	---	---	---
