Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA0319L	79932	broad.mit.edu	37	1	35919962	35919962	+	Splice_Site	SNP	C	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35919962C>G	uc001byx.2	-	11	2038	c.1780_splice	c.e11+1	p.E594_splice	KIAA0319L_uc001byw.2_Splice_Site_p.E31_splice|KIAA0319L_uc010ohv.1_Splice_Site_p.E236_splice	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGGAGCTTACCAGGTTGCAC	0.498													16	96	---	---	---	---	PASS
MYSM1	114803	broad.mit.edu	37	1	59134248	59134248	+	Intron	SNP	A	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59134248A>C	uc009wab.1	-						MYSM1_uc009waa.1_5'UTR|MYSM1_uc001czc.2_Intron	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					CCTGCAATAAAAATACACAAG	0.323													2	3	---	---	---	---	PASS
GBP7	388646	broad.mit.edu	37	1	89637586	89637586	+	Silent	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89637586C>A	uc001dna.2	-	2	172	c.33G>T	c.(31-33)GTG>GTT	p.V11V		NM_207398	NP_997281	Q8N8V2	GBP7_HUMAN	guanylate binding protein 4-like	11						integral to membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		CAGTGAGGCACACTGGGCCTG	0.483													8	191	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104117881	104117881	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104117881C>A	uc001duq.2	+	8	1531	c.915C>A	c.(913-915)GAC>GAA	p.D305E	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.D305E|AMY2B_uc001dus.1_5'Flank	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	305					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TGCCTTCTGACAGAGCACTTG	0.413													116	233	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111495013	111495013	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111495013C>T	uc001eaa.2	-	2	749	c.493G>A	c.(493-495)GTT>ATT	p.V165I	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	165					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		TGGGTATTAACTACAATAAAA	0.418													10	66	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114308928	114308928	+	Silent	SNP	A	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114308928A>G	uc001edq.2	-	7	2119	c.2083T>C	c.(2083-2085)TTA>CTA	p.L695L	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	695						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCCAGGCTAAGCTGCACACC	0.428													15	131	---	---	---	---	PASS
ATP1A1	476	broad.mit.edu	37	1	116946551	116946551	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116946551C>A	uc001ege.2	+	22	3336	c.2997C>A	c.(2995-2997)TTC>TTA	p.F999L	ATP1A1_uc010owv.1_Missense_Mutation_p.F968L|ATP1A1_uc010oww.1_Missense_Mutation_p.F999L|ATP1A1_uc010owx.1_Missense_Mutation_p.F968L|C1orf203_uc009whb.2_Intron|C1orf203_uc001egg.3_Intron|ATP1A1_uc001egh.2_Missense_Mutation_p.F141L	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	999	Helical; (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	TTCTCATCTTCGTATATGACG	0.463													4	238	---	---	---	---	PASS
C1orf61	10485	broad.mit.edu	37	1	156376645	156376645	+	Intron	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156376645C>T	uc001fou.1	-						C1orf61_uc001fot.1_3'UTR|C1orf61_uc001fov.1_Intron|C1orf61_uc001fow.1_Intron|C1orf61_uc001fox.1_Intron	NM_006365	NP_006356	Q13536	CROC4_HUMAN	transcriptional activator of the c-fos promoter							nucleus				skin(1)	1	Hepatocellular(266;0.158)					CCATGGTCTCCGGCTCCTCTT	0.557													13	22	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186143685	186143685	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186143685A>G	uc001grq.1	+	103	16083	c.15854A>G	c.(15853-15855)TAT>TGT	p.Y5285C	HMCN1_uc001grs.1_Missense_Mutation_p.Y854C	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5285	EGF-like 5; calcium-binding (Potential).				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAGTGCAGATATAACCAGATA	0.408													11	66	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214782168	214782168	+	Intron	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214782168G>A	uc001hkm.2	+						uc001hkn.1_Silent_p.L6L	NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGCTCACTCAGCGACAGCCCG	0.572													3	20	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228444535	228444535	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228444535G>A	uc009xez.1	+	15	4537	c.4493G>A	c.(4492-4494)AGG>AAG	p.R1498K	OBSCN_uc001hsn.2_Missense_Mutation_p.R1498K	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	1498	Ig-like 15.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TGCACACGGAGGCTGGTGGTG	0.672													4	45	---	---	---	---	PASS
AKT3	10000	broad.mit.edu	37	1	243668581	243668581	+	Silent	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243668581T>C	uc001iab.1	-	13	1491	c.1410A>G	c.(1408-1410)CAA>CAG	p.Q470Q	AKT3_uc001hzz.1_Intron|AKT3_uc001iaa.2_5'Flank	NM_005465	NP_005456	Q9Y243	AKT3_HUMAN	AKT3 kinase isoform 1	470	AGC-kinase C-terminal.				signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AGTAGGAAAATTGAGGGAAAT	0.398													23	21	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50850546	50850546	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50850546C>T	uc010fbq.2	-	6	2616	c.1139G>A	c.(1138-1140)GGA>GAA	p.G380E	NRXN1_uc002rxb.3_Missense_Mutation_p.G27E|NRXN1_uc002rxe.3_Missense_Mutation_p.G347E|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	159	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGCCCCTGATCCCAAATTAAT	0.458													43	94	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74432845	74432845	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74432845G>T	uc002skk.2	+	2	194	c.115G>T	c.(115-117)GTC>TTC	p.V39F	MTHFD2_uc002skj.2_5'UTR|MTHFD2_uc010yro.1_Intron|MTHFD2_uc010ffb.2_Missense_Mutation_p.V39F|MTHFD2_uc010yrp.1_Intron	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2	39					folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	TGAAGCTGTTGTCATTTCTGG	0.398													8	51	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166245543	166245543	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166245543A>G	uc002udc.2	+	27	5517	c.5227A>G	c.(5227-5229)AAA>GAA	p.K1743E	SCN2A_uc002udd.2_Missense_Mutation_p.K1743E|SCN2A_uc002ude.2_Missense_Mutation_p.K1743E	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1743	IV.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	AAGCTCAGTTAAAGGAGACTG	0.458													70	231	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179475790	179475790	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179475790G>A	uc010zfg.1	-	219	43586	c.43362C>T	c.(43360-43362)GCC>GCT	p.A14454A	uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A8149A|TTN_uc010zfi.1_Silent_p.A8082A|TTN_uc010zfj.1_Silent_p.A7957A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15381							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATAAATTCCGGCATCTGCAC	0.393													6	185	---	---	---	---	PASS
C3orf45	132228	broad.mit.edu	37	3	50324241	50324241	+	Silent	SNP	G	A	A	rs148270141		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50324241G>A	uc003cyz.2	+	3	336	c.309G>A	c.(307-309)GCG>GCA	p.A103A		NM_153215	NP_694947	Q8N112	CC045_HUMAN	hypothetical protein LOC132228	103	Helical; (Potential).					integral to membrane				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TGCTGCTCGCGCTGCTGGTGC	0.622													11	75	---	---	---	---	PASS
FAM86D	692099	broad.mit.edu	37	3	75476630	75476630	+	Silent	SNP	T	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75476630T>G	uc003dpp.3	-	6	794	c.435A>C	c.(433-435)GTA>GTC	p.V145V	FAM86D_uc003dpo.3_Intron|FAM86D_uc003dps.3_Intron|FAM86D_uc003dpq.3_Silent_p.V53V|FAM86D_uc003dpr.3_Intron	NR_024241				RecName: Full=Protein FAM86B1;												0						GGACCGTCGCTACGTCCCAGT	0.582													6	52	---	---	---	---	PASS
NEK11	79858	broad.mit.edu	37	3	130881325	130881325	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130881325C>T	uc003eny.2	+	11	1362	c.1036C>T	c.(1036-1038)CGG>TGG	p.R346W	NEK11_uc003enx.2_Missense_Mutation_p.R346W|NEK11_uc003eoa.2_Missense_Mutation_p.R346W|NEK11_uc003enz.2_Missense_Mutation_p.R164W|NEK11_uc010htn.2_RNA|NEK11_uc011blk.1_Missense_Mutation_p.R198W|NEK11_uc011bll.1_Missense_Mutation_p.R241W|NEK11_uc011blm.1_Missense_Mutation_p.R346W	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	346	Potential.				cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						AGAAAGGATGCGGCTGAGGAA	0.493													5	208	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													4	5	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1803564	1803564	+	Missense_Mutation	SNP	C	T	T	rs121913482		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1803564C>T	uc003gdr.3	+	7	998	c.742C>T	c.(742-744)CGC>TGC	p.R248C	FGFR3_uc003gdu.2_Missense_Mutation_p.R248C|FGFR3_uc003gds.3_Missense_Mutation_p.R248C|FGFR3_uc003gdq.3_Missense_Mutation_p.R248C|FGFR3_uc010icb.1_Missense_Mutation_p.R90C|FGFR3_uc003gdt.1_Missense_Mutation_p.R90C	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	248	Extracellular (Potential).		R -> C (in KERSEB, bladder cancer, keratinocytic non-epidermolytic nevus and TD1; severe and lethal; also found as somatic mutation in one patient with multiple myeloma).		bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.R248C(291)|p.R248_S249insC(2)|p.R248_S249del(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CCCCACAGAGCGCTCCCCGCA	0.567		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				7	14	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49040081	49040081	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49040081A>T	uc003gyv.2	+	13	1869	c.1687A>T	c.(1687-1689)ATT>TTT	p.I563F	CWH43_uc011bzl.1_Missense_Mutation_p.I536F	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	563					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						ACTGCAGGCTATTGCTGTTTC	0.358													58	226	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90857417	90857417	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90857417G>A	uc003hst.2	+	6	2657	c.2586G>A	c.(2584-2586)TTG>TTA	p.L862L	MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Silent_p.L604L	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	862	Potential.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		AGACTCGGTTGCAAGACATTG	0.358													6	26	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143159109	143159109	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143159109C>T	uc003iix.3	-	13	1339	c.744G>A	c.(742-744)TGG>TGA	p.W248*	INPP4B_uc003iiw.3_Nonsense_Mutation_p.W248*|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Nonsense_Mutation_p.W63*|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Nonsense_Mutation_p.W119*	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,	248					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					GAATTCGCATCCACTTATTGT	0.328													18	32	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143159110	143159110	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143159110C>G	uc003iix.3	-	13	1338	c.743G>C	c.(742-744)TGG>TCG	p.W248S	INPP4B_uc003iiw.3_Missense_Mutation_p.W248S|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Missense_Mutation_p.W63S|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Missense_Mutation_p.W119S	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,	248					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					AATTCGCATCCACTTATTGTC	0.328													19	32	---	---	---	---	PASS
FGG	2266	broad.mit.edu	37	4	155530879	155530879	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155530879C>T	uc003ioj.2	-	6	710	c.569G>A	c.(568-570)AGC>AAC	p.S190N	FGG_uc003iog.2_Missense_Mutation_p.S190N|FGG_uc003ioh.2_Missense_Mutation_p.S198N|FGG_uc010ipx.2_Missense_Mutation_p.S18N|FGG_uc010ipy.2_5'UTR|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.S198N	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	190	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GTAAAGCCCGCTCTGTTTAGC	0.418													26	98	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175899049	175899049	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175899049G>A	uc003iuc.2	+	5	3043	c.2373G>A	c.(2371-2373)ACG>ACA	p.T791T	ADAM29_uc003iud.2_Silent_p.T791T|ADAM29_uc010irr.2_Silent_p.T791T|ADAM29_uc011cki.1_Silent_p.T791T	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	791	Cytoplasmic (Potential).|6.|9 X 9 AA approximate repeats.				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTCAGTTGACGCCTTCCCAGA	0.572													6	186	---	---	---	---	PASS
TPPP	11076	broad.mit.edu	37	5	665124	665124	+	3'UTR	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:665124C>T	uc003jbg.3	-	3					TPPP_uc003jbh.3_3'UTR	NM_007030	NP_008961	O94811	TPPP_HUMAN	tubulin polymerization promoting protein						microtubule bundle formation|microtubule polymerization|positive regulation of protein polymerization	nucleus|perinuclear region of cytoplasm|soluble fraction	calcium ion binding|microtubule binding				0		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		CGTCTGAGTTCTGCCCCAGTT	0.667													26	20	---	---	---	---	PASS
PARP8	79668	broad.mit.edu	37	5	50137809	50137809	+	Silent	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50137809C>T	uc003jon.3	+	27	2654	c.2472C>T	c.(2470-2472)GAC>GAT	p.D824D	PARP8_uc011cpz.1_Silent_p.D716D|PARP8_uc003joo.2_Silent_p.D824D|PARP8_uc003jop.2_Silent_p.D782D	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	824	PARP catalytic.					intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				GCTATGAAGACGGCCAAGTGG	0.333													4	28	---	---	---	---	PASS
MRPS36	92259	broad.mit.edu	37	5	68524147	68524147	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68524147T>C	uc003jvq.2	+	3	311	c.227T>C	c.(226-228)ATA>ACA	p.I76T	MRPS36_uc003jvr.2_RNA	NM_033281	NP_150597	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	76					translation	mitochondrial small ribosomal subunit	structural constituent of ribosome				0		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		ACTGCAGAAATAATAAAAACA	0.388													78	81	---	---	---	---	PASS
PCDHAC2	56134	broad.mit.edu	37	5	140346900	140346900	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140346900G>T	uc003lii.2	+	1	789	c.549G>T	c.(547-549)CAG>CAT	p.Q183H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_Intron|PCDHAC2_uc011dag.1_Missense_Mutation_p.Q183H	NM_018899	NP_061722	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2 isoform 1	183	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCAGTACAGACCTACGAGC	0.607													15	14	---	---	---	---	PASS
GABRB2	2561	broad.mit.edu	37	5	160721255	160721255	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160721255G>A	uc003lys.1	-	11	1590	c.1372C>T	c.(1372-1374)CGA>TGA	p.R458*	GABRB2_uc011deh.1_Nonsense_Mutation_p.R259*|GABRB2_uc003lyr.1_Nonsense_Mutation_p.R420*|GABRB2_uc003lyt.1_Nonsense_Mutation_p.R420*|GABRB2_uc010jiu.1_Nonsense_Mutation_p.R357*	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	458	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	GCCACATGTCGTTCCAGAGCA	0.527													41	61	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7579653	7579653	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7579653C>T	uc003mxp.1	+	23	3509	c.3230C>T	c.(3229-3231)GCG>GTG	p.A1077V	DSP_uc003mxq.1_Missense_Mutation_p.A1077V	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1077	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCGAAGCTTGCGAGCCTGGAG	0.483													4	134	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	28060389	28060389	+	Intron	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28060389C>T	uc010jqw.1	-						ZSCAN12P1_uc003nkj.3_RNA					SubName: Full=cDNA FLJ45995 fis, clone SKNMC2003639;																		CCAGGAGACACCTGGACCCTG	0.517													3	2	---	---	---	---	PASS
C6orf27	80737	broad.mit.edu	37	6	31734406	31734406	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31734406T>C	uc011dog.1	-	14	2256	c.2018A>G	c.(2017-2019)GAG>GGG	p.E673G	C6orf27_uc003nxd.2_Missense_Mutation_p.E348G	NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor	673						extracellular region				ovary(3)	3						TCCCACGGGCTCCAAGGGCAC	0.652													29	56	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31901504	31901504	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31901504C>T	uc011dor.1	+	3	638	c.374C>T	c.(373-375)TCG>TTG	p.S125L	C2_uc003nyc.2_Missense_Mutation_p.R19W|C2_uc011doo.1_Missense_Mutation_p.R19W|C2_uc011dop.1_Missense_Mutation_p.S64L|C2_uc003nye.3_Missense_Mutation_p.S187L|C2_uc003nyf.2_Missense_Mutation_p.S187L|C2_uc010jtk.2_Missense_Mutation_p.S55L|C2_uc011doq.1_Missense_Mutation_p.S158L|C2_uc003nyg.2_Missense_Mutation_p.S55L	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						ACGGGGTCTTCGGAGCGGGAG	0.647													63	74	---	---	---	---	PASS
SUPT3H	8464	broad.mit.edu	37	6	45332969	45332969	+	5'UTR	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45332969T>C	uc003oxo.2	-	2					SUPT3H_uc003oxn.1_Missense_Mutation_p.I24V|SUPT3H_uc011dvv.1_5'UTR|SUPT3H_uc003oxp.2_Missense_Mutation_p.I24V|RUNX2_uc011dvx.1_Intron|RUNX2_uc011dvy.1_Intron	NM_181356	NP_852001	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog isoform 2						histone deubiquitination|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	STAGA complex|transcription factor TFTC complex	DNA binding|transcription coactivator activity			ovary(2)|breast(1)	3						GCAAAGCTTATAGACTTCCCT	0.333													43	84	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567271	5567271	+	3'UTR	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567271C>A	uc003sos.3	-	5					ACTB_uc003sor.3_3'UTR|ACTB_uc003sot.3_3'UTR|ACTB_uc003soq.3_3'UTR|ACTB_uc010ksy.2_3'UTR	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin						'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		aaaaaaaaaaccaaaacaaaa	0.368													5	65	---	---	---	---	PASS
DLX6	1750	broad.mit.edu	37	7	96636997	96636997	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96636997G>A	uc003uom.2	+	3	400	c.400G>A	c.(400-402)GGA>AGA	p.G134R	DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron	NM_005222	NP_005213	P56179	DLX6_HUMAN	distal-less homeobox 6	44					nervous system development|skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CAGGTTCAATGGAAAAGGGAA	0.478													6	21	---	---	---	---	PASS
PILRB	29990	broad.mit.edu	37	7	99950746	99950746	+	5'UTR	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99950746G>T	uc003uuk.2	+	10					PILRB_uc003uul.2_5'UTR|PILRB_uc003uum.1_RNA	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN	paired immunoglobulin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGAAGCACCGGTGAGACCTG	0.637													3	74	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148496370	148496370	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148496370G>A	uc010lpg.2	+	21	2666	c.2140G>A	c.(2140-2142)GCC>ACC	p.A714T	CUL1_uc003wey.2_Missense_Mutation_p.A714T|CUL1_uc003wez.2_Missense_Mutation_p.A604T|CUL1_uc003wfa.2_Missense_Mutation_p.A375T	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	714					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TGCATAGGCGGCCATCGTGAG	0.483													4	115	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3076926	3076926	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3076926T>C	uc011kwk.1	-	29	4916	c.4526A>G	c.(4525-4527)TAT>TGT	p.Y1509C	CSMD1_uc011kwj.1_Missense_Mutation_p.Y901C|CSMD1_uc003wqe.2_Missense_Mutation_p.Y665C	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1509	Extracellular (Potential).|CUB 9.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTCCCCTTCATAGATGTGTAG	0.443													4	8	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113668395	113668395	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113668395T>A	uc003ynu.2	-	18	3151	c.2992A>T	c.(2992-2994)ATT>TTT	p.I998F	CSMD3_uc003yns.2_Missense_Mutation_p.I270F|CSMD3_uc003ynt.2_Missense_Mutation_p.I958F|CSMD3_uc011lhx.1_Missense_Mutation_p.I894F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	998	Extracellular (Potential).|CUB 5.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCATAATGAATCTTGAAACCA	0.308										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			14	68	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113678640	113678640	+	Silent	SNP	T	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113678640T>A	uc003ynu.2	-	17	2841	c.2682A>T	c.(2680-2682)CCA>CCT	p.P894P	CSMD3_uc003yns.2_Silent_p.P166P|CSMD3_uc003ynt.2_Silent_p.P854P|CSMD3_uc011lhx.1_Silent_p.P790P	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	894	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGCCACCACATGGGGCTGAAA	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			10	20	---	---	---	---	PASS
HSF1	3297	broad.mit.edu	37	8	145533230	145533230	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145533230C>T	uc003zbt.3	+	3	486	c.316C>T	c.(316-318)CGT>TGT	p.R106C	HSF1_uc003zbu.3_RNA	NM_005526	NP_005517	Q00613	HSF1_HUMAN	heat shock transcription factor 1	106	By similarity.					cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			ATGCTTCCTGCGTGGCCAGGA	0.612													62	109	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	90744896	90744896	+	Missense_Mutation	SNP	G	A	A	rs140683876	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90744896G>A	uc011lti.1	-	4	3085	c.3056C>T	c.(3055-3057)ACG>ATG	p.T1019M	uc004apx.1_5'Flank					SubName: Full=cDNA FLJ59639;																		TGAAAAAATCGTCTGAAAAAA	0.443													51	149	---	---	---	---	PASS
KIAA0913	23053	broad.mit.edu	37	10	75548921	75548921	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75548921C>T	uc009xrl.2	+	3	462	c.430C>T	c.(430-432)CGG>TGG	p.R144W	KIAA0913_uc001jve.2_Missense_Mutation_p.R144W|KIAA0913_uc001jvf.2_Missense_Mutation_p.R144W|KIAA0913_uc001jvh.2_5'Flank|KIAA0913_uc001jvi.2_5'Flank|KIAA0913_uc010qkr.1_5'Flank|KIAA0913_uc001jvj.2_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	144							zinc ion binding			breast(1)	1	Prostate(51;0.0112)					CTTCCGCATGCGGGCTGTGAA	0.572													4	117	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129900995	129900995	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129900995C>T	uc001lke.2	-	13	9304	c.9109G>A	c.(9109-9111)GCA>ACA	p.A3037T	MKI67_uc001lkf.2_Missense_Mutation_p.A2677T|MKI67_uc009yav.1_Missense_Mutation_p.A2612T|MKI67_uc009yaw.1_Missense_Mutation_p.A2187T	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	3037	ATP (Potential).				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGCCTCTTGCCCTGGGAGCA	0.537													5	219	---	---	---	---	PASS
LOC650368	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3427845C>T	uc010qxs.1	+	9		c.838C>T			LOC650368_uc001lxx.2_RNA|LOC650368_uc001lxy.2_RNA	NR_024248				Homo sapiens cDNA FLJ41654 fis, clone FEBRA2025463, weakly  similar to Homo sapiens HMT-1 mRNA for beta-1,4 mannosyltransferase.												0						CTTCAAGTGGCAGGAGCAGAA	0.587													6	73	---	---	---	---	PASS
OR5M3	219482	broad.mit.edu	37	11	56237250	56237250	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56237250G>T	uc010rjk.1	-	1	724	c.724C>A	c.(724-726)CAT>AAT	p.H242N		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GCTGTCAGATGGGACCCACAT	0.473													3	52	---	---	---	---	PASS
USP35	57558	broad.mit.edu	37	11	77924751	77924751	+	Silent	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77924751G>T	uc009yva.1	+	11	3195	c.2949G>T	c.(2947-2949)CCG>CCT	p.P983P	USP35_uc001ozc.2_Silent_p.P551P|USP35_uc010rsp.1_Silent_p.P415P|USP35_uc001ozd.2_Silent_p.P594P|USP35_uc001ozf.2_Silent_p.P714P	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	983					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCACATCTCCGCACTGGGGGA	0.577													25	126	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26217667	26217667	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217667C>A	uc001rgx.2	+	3	561	c.340C>A	c.(340-342)CCT>ACT	p.P114T	RASSF8_uc001rgy.2_Missense_Mutation_p.P114T|RASSF8_uc001rgz.2_Missense_Mutation_p.P114T|RASSF8_uc009zjd.1_Missense_Mutation_p.P114T|RASSF8_uc009zje.1_Missense_Mutation_p.P114T	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	114					signal transduction						0	Colorectal(261;0.0847)					TAAACTGAGGCCTCAGATTGA	0.458													39	109	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49398453	49398453	+	Intron	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49398453T>C	uc001rsy.2	-						uc001rsw.2_Intron|PRKAG1_uc010smd.1_Intron|PRKAG1_uc001rsx.2_Intron|PRKAG1_uc001rsz.2_Intron|PRKAG1_uc009zlb.2_Intron|PRKAG1_uc010sme.1_3'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						TCCACAGTGCTGGGGCTGGGG	0.473													29	125	---	---	---	---	PASS
KRT73	319101	broad.mit.edu	37	12	53012081	53012081	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53012081G>A	uc001sas.2	-	1	263	c.228C>T	c.(226-228)GGC>GGT	p.G76G		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	76	Head.|Gly-rich.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		CACTGGCCCGGCCCCGGCCAA	0.637													73	140	---	---	---	---	PASS
FRS2	10818	broad.mit.edu	37	12	69968295	69968295	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69968295A>C	uc001suy.2	+	10	1597	c.1087A>C	c.(1087-1089)AAG>CAG	p.K363Q	FRS2_uc001suz.2_Missense_Mutation_p.K363Q|FRS2_uc009zrj.2_Missense_Mutation_p.K363Q|FRS2_uc009zrk.2_Missense_Mutation_p.K363Q	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	363					activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GGAAGCCCGCAAGCTAAGTAG	0.388													22	901	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123041992	123041992	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123041992C>T	uc001ucv.2	+	17	1497	c.1334C>T	c.(1333-1335)GCC>GTC	p.A445V	KNTC1_uc010taf.1_Missense_Mutation_p.A408V	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	445					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TCTGTGGATGCCAGTGAACAG	0.378													3	56	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	32902841	32902841	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32902841T>A	uc001wrq.2	+	2	312	c.142T>A	c.(142-144)TCT>ACT	p.S48T	AKAP6_uc010aml.2_Missense_Mutation_p.S45T	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	48					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GGACATGGACTCTGACCAGCA	0.547													32	77	---	---	---	---	PASS
CCDC88C	440193	broad.mit.edu	37	14	91738888	91738888	+	3'UTR	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91738888G>A	uc010aty.2	-	30					CCDC88C_uc001xzj.2_3'UTR|CCDC88C_uc001xzi.2_3'UTR	NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				TCCTGGCACCGCAGGCAAGCA	0.532													20	48	---	---	---	---	PASS
BRF1	2972	broad.mit.edu	37	14	105685542	105685542	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105685542C>T	uc001yqp.2	-	13	1768	c.1405G>A	c.(1405-1407)GTG>ATG	p.V469M	BRF1_uc010tyo.1_Missense_Mutation_p.V354M|BRF1_uc010typ.1_Missense_Mutation_p.V376M|BRF1_uc001yqk.2_Translation_Start_Site|BRF1_uc001yql.2_Missense_Mutation_p.V265M|BRF1_uc001yqo.2_Missense_Mutation_p.V231M|BRF1_uc010axg.1_Missense_Mutation_p.V442M|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_Translation_Start_Site	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1	469					positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TCGGCCTTCACGCGGGCTTCC	0.642													52	128	---	---	---	---	PASS
TRIM69	140691	broad.mit.edu	37	15	45028800	45028800	+	5'UTR	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45028800C>A	uc001zuf.2	+	2					TRIM69_uc001zui.1_5'UTR|TRIM69_uc010bdy.1_5'UTR|TRIM69_uc001zug.1_5'UTR|TRIM69_uc001zuh.1_5'UTR	NM_182985	NP_892030	Q86WT6	TRI69_HUMAN	tripartite motif-containing 69 isoform a						apoptosis	nuclear speck	zinc ion binding				0		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		TGAGCCCATTCCTTGAAAACT	0.537													7	10	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50782647	50782647	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50782647C>A	uc001zym.3	+	15	2659	c.2159C>A	c.(2158-2160)CCA>CAA	p.P720Q	USP8_uc001zyl.3_Missense_Mutation_p.P720Q|USP8_uc001zyn.3_Missense_Mutation_p.P720Q|USP8_uc010ufh.1_Missense_Mutation_p.P614Q|USP8_uc001zyp.3_5'Flank	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	720					cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		TACTCCTCCCCAGATATAACC	0.478													8	170	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72030241	72030241	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72030241C>T	uc002atb.1	+	10	1880	c.1801C>T	c.(1801-1803)CGA>TGA	p.R601*	THSD4_uc010ukg.1_Nonsense_Mutation_p.R241*|THSD4_uc002ate.2_Nonsense_Mutation_p.R241*	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	601						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TTCTCCCCATCGACCGGACAA	0.597													50	52	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	703599	703599	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:703599G>A	uc002cii.1	+	12	1362	c.1308G>A	c.(1306-1308)CGG>CGA	p.R436R	WDR90_uc002cig.1_Silent_p.R436R|WDR90_uc002cih.1_Silent_p.R437R|WDR90_uc002cij.1_RNA|WDR90_uc002cik.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	436	WD 1.									ovary(1)	1		Hepatocellular(780;0.0218)				GTGTGATGCGGCTCTGGGACT	0.657													50	59	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9858022	9858022	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9858022C>A	uc002czo.3	-	13	3927	c.3379G>T	c.(3379-3381)GGT>TGT	p.G1127C	GRIN2A_uc010uym.1_Missense_Mutation_p.G1127C|GRIN2A_uc010uyn.1_Missense_Mutation_p.G970C|GRIN2A_uc002czr.3_Missense_Mutation_p.G1127C	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1127	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AAGTGGAAACCAGGCTCCTTC	0.512													10	260	---	---	---	---	PASS
ABCC6	368	broad.mit.edu	37	16	16297362	16297362	+	Silent	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16297362C>T	uc002den.3	-	8	940	c.903G>A	c.(901-903)AAG>AAA	p.K301K	ABCC6_uc010bvo.2_RNA|ABCC6_uc010uzz.1_Silent_p.K313K	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	301	Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		GCCAGATGGCCTTCAGCAGTG	0.567													23	53	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3214416	3214416	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3214416C>A	uc002fvi.2	+	1	878	c.812C>A	c.(811-813)TCG>TAG	p.S271*		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						GTGGAGTCTTCGGACAAGGAC	0.547													4	187	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11592918	11592918	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11592918C>T	uc002gne.2	+	20	3847	c.3779C>T	c.(3778-3780)GCC>GTC	p.A1260V	DNAH9_uc010coo.2_Missense_Mutation_p.A554V	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1260	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ATGCTGGATGCCAGGCACATC	0.483													4	138	---	---	---	---	PASS
CCDC144A	9720	broad.mit.edu	37	17	16593762	16593762	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16593762G>A	uc002gqk.1	+	1	124	c.48G>A	c.(46-48)CCG>CCA	p.P16P		NM_014695	NP_055510	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	16											0						AGGGGTCTCCGAAGCCGGCAG	0.672													7	42	---	---	---	---	PASS
SLFN13	146857	broad.mit.edu	37	17	33767432	33767432	+	3'UTR	SNP	A	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33767432A>G	uc002hjk.1	-	4					SLFN13_uc010wch.1_3'UTR|SLFN13_uc002hjl.2_3'UTR|SLFN13_uc010ctt.2_3'UTR|SLFN13_uc002hjm.2_3'UTR	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13							intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		tgctgaaaagagttgggggag	0.000													2	6	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71433929	71433929	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71433929G>A	uc010dfm.2	-	8	949	c.949C>T	c.(949-951)CAC>TAC	p.H317Y	SDK2_uc010dfn.2_5'UTR	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	317	Extracellular (Potential).|Ig-like C2-type 4.				cell adhesion	integral to membrane				ovary(2)	2						GCAGTGATGTGTCTTTCTGGC	0.587													53	92	---	---	---	---	PASS
TXNDC2	84203	broad.mit.edu	37	18	9886894	9886894	+	Missense_Mutation	SNP	A	G	G	rs146821851		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9886894A>G	uc002koi.3	+	2	867	c.418A>G	c.(418-420)AAA>GAA	p.K140E	TXNDC2_uc010wzq.1_RNA|TXNDC2_uc002koh.3_Missense_Mutation_p.K73E	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	140	2.|22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						GTCCTCAGAAAAAGCCATCCA	0.547													3	190	---	---	---	---	PASS
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284													3	95	---	---	---	---	PASS
C19orf36	113177	broad.mit.edu	37	19	2098100	2098100	+	Silent	SNP	C	T	T	rs146461646	byFrequency	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2098100C>T	uc002luw.1	+	5	524	c.447C>T	c.(445-447)CAC>CAT	p.H149H	C19orf36_uc002lux.1_Silent_p.H149H|C19orf36_uc010xgw.1_Silent_p.H149H	NM_001039846	NP_001034935	Q1ZYL8	IZUM4_HUMAN	hypothetical protein LOC113177 isoform 3	149						extracellular region					0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGACTCGCACGTCGCCTGCT	0.632													7	349	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9045585	9045585	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9045585C>T	uc002mkp.2	-	5	36250	c.36046G>A	c.(36046-36048)GAG>AAG	p.E12016K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12018	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTCACACTCTCAGAGGCCAAG	0.333													18	15	---	---	---	---	PASS
GCDH	2639	broad.mit.edu	37	19	13008279	13008279	+	Intron	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13008279G>A	uc002mvq.2	+						GCDH_uc010xms.1_3'UTR|GCDH_uc002mvp.2_Intron|GCDH_uc010xmt.1_Intron|GCDH_uc010xmu.1_Intron	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a						lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						GGATGGCAGCGGTGGCTGGAG	0.632													5	61	---	---	---	---	PASS
C19orf44	84167	broad.mit.edu	37	19	16612266	16612266	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16612266G>T	uc002neh.1	+	2	736	c.663G>T	c.(661-663)TTG>TTT	p.L221F	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.L221F|C19orf44_uc002neg.2_Missense_Mutation_p.L221F|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	221											0						TGAAAGTATTGCTAGGAAGCT	0.433													21	83	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54327327	54327327	+	Silent	SNP	G	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54327327G>A	uc002qch.3	-	1	322	c.102C>T	c.(100-102)ACC>ACT	p.T34T	NLRP12_uc002qci.3_Silent_p.T34T|NLRP12_uc002qcj.3_Silent_p.T34T|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.T34T	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	34	DAPIN.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCTCTGTCGCGGTCCCCAGGT	0.602													51	98	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	40735463	40735463	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40735463T>G	uc002xkg.2	-	24	3537	c.3353A>C	c.(3352-3354)GAG>GCG	p.E1118A	PTPRT_uc010ggj.2_Missense_Mutation_p.E1137A|PTPRT_uc010ggi.2_Missense_Mutation_p.E321A	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1118	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGCCCGGAGCTCACGCACGCA	0.577													76	191	---	---	---	---	PASS
psiTPTE22	387590	broad.mit.edu	37	22	17119559	17119559	+	RNA	SNP	G	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17119559G>C	uc002zls.1	+	2		c.396G>C			psiTPTE22_uc002zlr.2_RNA|psiTPTE22_uc002zlt.2_RNA					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						TTCCTTCGGAGTATCGTTCTA	0.343													19	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	20952662	20952665	+	IGR	DEL	AAGA	-	-	rs72050492	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20952662_20952665delAAGA								CDA (7264 upstream) : PINK1 (7283 downstream)																							ggaaggaaggaagaaaggaaggga	0.010													4	3	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175456	24175456	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175456delT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GCTGTTTTAAttttttttttt	0.184													4	2	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	154100027	154100029	+	Intron	DEL	TTC	-	-	rs10531787		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154100027_154100029delTTC	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCAAAGTAGGttctttttttttt	0.153													4	2	---	---	---	---	
TRIM11	81559	broad.mit.edu	37	1	228582354	228582355	+	3'UTR	DEL	AG	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228582354_228582355delAG	uc001hss.2	-	6					TRIM11_uc010pvx.1_3'UTR	NM_145214	NP_660215	Q96F44	TRI11_HUMAN	tripartite motif-containing 11						response to virus	cytoplasm|nucleus	protein binding|zinc ion binding			lung(3)|ovary(1)	4		Prostate(94;0.0724)				CAAAACACTCAGTGGCCTGGAG	0.639													15	12	---	---	---	---	
OR2T35	403244	broad.mit.edu	37	1	248801602	248801603	+	Frame_Shift_Ins	INS	-	CA	CA			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248801602_248801603insCA	uc001ies.1	-	1	957_958	c.957_958insTG	c.(955-960)GTGATCfs	p.V319fs		NM_001001827	NP_001001827	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T,	319_320	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTCCTGATCACAGTCGCCA	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	97691619	97691620	+	IGR	INS	-	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97691619_97691620insA								FAM178B (39318 upstream) : FAHD2B (57704 downstream)																							CACTAAAGTACAAAAAAGCCTG	0.312													4	2	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97864187	97864187	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97864187delT	uc010yva.1	+						ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						TATGAATCCCTTTTACTTTTC	0.358													4	2	---	---	---	---	
SCN2A	6326	broad.mit.edu	37	2	166237618	166237619	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166237618_166237619insT	uc002udc.2	+	25	4752_4753	c.4462_4463insT	c.(4462-4464)ATTfs	p.I1488fs	SCN2A_uc002udd.2_Frame_Shift_Ins_p.I1488fs|SCN2A_uc002ude.2_Frame_Shift_Ins_p.I1488fs	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1488	III.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	AGGTCAAGACATTTTTATGACA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221290621	221290622	+	IGR	INS	-	CCTTCCTT	CCTTCCTT	rs148674567	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221290621_221290622insCCTTCCTT								SLC4A3 (783920 upstream) : EPHA4 (992127 downstream)																							ctttctttctcccttccttcct	0.124													4	3	---	---	---	---	
CP	1356	broad.mit.edu	37	3	148901396	148901396	+	Intron	DEL	A	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148901396delA	uc003ewy.3	-						CP_uc011bnr.1_Intron|CP_uc003ewx.3_Intron|CP_uc003ewz.2_Intron	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor						cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TGAAACACTTAAAAAAAAAAA	0.259													27	7	---	---	---	---	
CPLX1	10815	broad.mit.edu	37	4	780647	780648	+	Intron	INS	-	G	G	rs145744400	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:780647_780648insG	uc003gbi.2	-						CPLX1_uc003gbj.2_Intron	NM_006651	NP_006642	O14810	CPLX1_HUMAN	complexin 1						glutamate secretion	cytosol					0				Colorectal(103;0.187)		GACCCCACCCCGGGGGGTCCCT	0.698													3	3	---	---	---	---	
GUSBP1	728411	broad.mit.edu	37	5	21344713	21344713	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21344713delT	uc011cnn.1	+											Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0						ccttccttcctttccttcctt	0.000													3	3	---	---	---	---	
TTC23L	153657	broad.mit.edu	37	5	34861450	34861450	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34861450delT	uc003jiu.2	+							NM_144725	NP_653326	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like								binding			central_nervous_system(1)	1						CAATCTGAACTTCATCATCCT	0.363													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137346646	137346647	+	Intron	INS	-	A	A	rs35839686		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137346646_137346647insA	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						ATATTATTCTTaaaaaaaaaaa	0.282													9	8	---	---	---	---	
TFAP2A	7020	broad.mit.edu	37	6	10415409	10415411	+	5'UTR	DEL	GAG	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10415409_10415411delGAG	uc003myr.2	-	1					TFAP2A_uc003myq.2_5'Flank|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_5'UTR|TFAP2A_uc003myt.2_Intron|TFAP2A_uc003myu.1_5'UTR|TFAP2A_uc003myv.1_5'Flank|TFAP2A_uc011dii.1_Intron|uc003myw.2_Intron|uc003myx.2_Intron|uc003myy.1_Intron	NM_003220	NP_003211	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform a						ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				agaggagggcgaggaggaggagg	0.202											OREG0017182	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
DTNBP1	84062	broad.mit.edu	37	6	15627420	15627422	+	Intron	DEL	TCC	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15627420_15627422delTCC	uc003nbm.2	-						DTNBP1_uc003nbl.2_Intron|DTNBP1_uc003nbn.2_Intron|DTNBP1_uc003nbo.2_Intron|DTNBP1_uc003nbp.2_Intron|DTNBP1_uc010jph.2_Intron	NM_032122	NP_115498	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1 isoform a						actin cytoskeleton reorganization|cellular membrane organization|neuron projection morphogenesis|post-Golgi vesicle-mediated transport|regulation of dopamine receptor signaling pathway	axon part|BLOC-1 complex|cell junction|dendritic spine|endoplasmic reticulum membrane|endosome membrane|growth cone|melanosome membrane|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|synaptic vesicle membrane|synaptosome	identical protein binding				0	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			TTCTGTGGAATCCTCAACTAATC	0.350									Hermansky-Pudlak_syndrome				13	9	---	---	---	---	
DOPEY1	23033	broad.mit.edu	37	6	83818634	83818650	+	Frame_Shift_Del	DEL	GATTATTTCCTCTTCTT	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83818634_83818650delGATTATTTCCTCTTCTT	uc003pjs.1	+	5	586_602	c.326_342delGATTATTTCCTCTTCTT	c.(325-342)GGATTATTTCCTCTTCTTfs	p.G109fs	DOPEY1_uc011dyy.1_Frame_Shift_Del_p.G109fs|DOPEY1_uc010kbl.1_Frame_Shift_Del_p.G109fs	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	109_114					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AATAGTTCTGGATTATTTCCTCTTCTTGCAAATGCTG	0.318													110	14	---	---	---	---	
ROS1	6098	broad.mit.edu	37	6	117631544	117631544	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117631544delT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGAGAAACTAttttttttttt	0.139			T	GOPC|ROS1	glioblastoma|NSCLC								4	2	---	---	---	---	
RNF217	154214	broad.mit.edu	37	6	125346722	125346723	+	Intron	INS	-	AGGG	AGGG	rs140086309	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125346722_125346723insAGGG	uc003pzs.2	+						RNF217_uc003pzr.2_Intron|RNF217_uc003pzt.2_Intron	NM_152553	NP_689766	Q8TC41	RN217_HUMAN	ring finger protein 217						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		gaaaagaaggaagggagggagg	0.257													6	3	---	---	---	---	
TCP10L2	401285	broad.mit.edu	37	6	167590551	167590552	+	Frame_Shift_Ins	INS	-	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167590551_167590552insC	uc010kkp.2	+	4	558_559	c.427_428insC	c.(427-429)GCTfs	p.A143fs		NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN	t-complex 10-like 2	143											0						GCCCAAATACGCTGGCCGCAAG	0.465													197	21	---	---	---	---	
TCP10	6953	broad.mit.edu	37	6	167791512	167791513	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167791512_167791513insG	uc003qvv.1	-	4	559_560	c.347_348insC	c.(346-348)GCTfs	p.A116fs	TCP10_uc003qvu.2_Frame_Shift_Ins_p.A116fs|TCP10_uc003qvw.2_Frame_Shift_Ins_p.A92fs	NM_004610	NP_004601	Q12799	TCP10_HUMAN	t-complex 10	143						cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TCTTGCGGCCAGCGTATTTGGG	0.460													122	7	---	---	---	---	
ZNF12	7559	broad.mit.edu	37	7	6732517	6732518	+	Intron	INS	-	AC	AC	rs146513565	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6732517_6732518insAC	uc003sqt.1	-						ZNF12_uc011jxa.1_Intron|ZNF12_uc003sqs.1_Intron	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		cacacacacaaacacacacaca	0.302													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	27270281	27270281	+	IGR	DEL	C	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27270281delC								HOXA13 (30556 upstream) : EVX1 (11883 downstream)																							ttccttccttccttccttcct	0.080													4	2	---	---	---	---	
CCDC136	64753	broad.mit.edu	37	7	128434455	128434457	+	In_Frame_Del	DEL	GAA	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128434455_128434457delGAA	uc003vnv.1	+	2	437_439	c.70_72delGAA	c.(70-72)GAAdel	p.E26del	CCDC136_uc003vnu.1_In_Frame_Del_p.E76del|CCDC136_uc003vnw.1_In_Frame_Del_p.E26del	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	26	Glu-rich.					integral to membrane	protein binding			ovary(2)	2						ggaagaggaggaagaagaggtgg	0.394													4	2	---	---	---	---	
FGFR1	2260	broad.mit.edu	37	8	38291839	38291841	+	Intron	DEL	TGC	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38291839_38291841delTGC	uc003xlp.2	-						FGFR1_uc011lbo.1_Intron|FGFR1_uc011lbp.1_Intron|FGFR1_uc011lbq.1_Intron|FGFR1_uc010lwk.2_Intron|FGFR1_uc011lbs.1_Intron|FGFR1_uc011lbt.1_Intron|FGFR1_uc011lbu.1_Intron|FGFR1_uc011lbv.1_Intron|FGFR1_uc011lbw.1_Intron|FGFR1_uc011lbx.1_Intron|FGFR1_uc003xlv.2_Intron|FGFR1_uc003xlu.2_Intron|FGFR1_uc003xlw.1_Intron	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1						axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	caaccCATATTGCTGCTGCtttt	0.182		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56442703	56442710	+	IGR	DEL	GAAGGAAG	-	-	rs10545270		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56442703_56442710delGAAGGAAG								XKR4 (3995 upstream) : TMEM68 (208610 downstream)																							agggaaggaagaaggaaggaaggaagga	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143948810	143948811	+	IGR	INS	-	TG	TG	rs139484767	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143948810_143948811insTG								GML (20549 upstream) : CYP11B1 (4963 downstream)																							aatatatactctgtgtgtgtgt	0.010													4	2	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18198213	18198214	+	Intron	INS	-	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18198213_18198214insT	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						Gtttttataaattttttttttt	0.297													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42398703	42398704	+	IGR	INS	-	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42398703_42398704insA								None (None upstream) : LOC441666 (428611 downstream)																							accaatggtagaaaggaaatat	0.000													4	6	---	---	---	---	
FAM178A	55719	broad.mit.edu	37	10	102697375	102697376	+	Intron	INS	-	T	T	rs73336293	byFrequency	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102697375_102697376insT	uc001krt.3	+						FAM178A_uc001krs.2_Intron	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1												0						Gttttttttggttttttttttg	0.114													4	2	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108850678	108850679	+	Intron	DEL	AC	-	-	rs10569833		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108850678_108850679delAC	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ATTCTAAAGTacacacacacac	0.317													4	2	---	---	---	---	
PPFIBP2	8495	broad.mit.edu	37	11	7570841	7570841	+	Intron	DEL	T	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7570841delT	uc001mfj.3	+							NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CTCCTTTTACTTTTTTTTTTT	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	58060361	58060362	+	IGR	INS	-	T	T	rs34408829		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58060361_58060362insT								OR10W1 (24629 upstream) : OR5B17 (65238 downstream)																							ATTGAGATTCCttttttttttt	0.223													4	2	---	---	---	---	
ZNF259	8882	broad.mit.edu	37	11	116652743	116652743	+	Intron	DEL	G	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116652743delG	uc001ppp.2	-						ZNF259_uc009yzd.2_Intron|ZNF259_uc001ppq.2_Intron	NM_003904	NP_003895	O75312	ZPR1_HUMAN	zinc finger protein 259						cell proliferation|signal transduction	cytoplasm|nucleolus					0	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		aaaaaaaaaagaaaagaaaac	0.154													4	3	---	---	---	---	
PRPF40B	25766	broad.mit.edu	37	12	50026780	50026780	+	Intron	DEL	C	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50026780delC	uc001rur.1	+						PRPF40B_uc001rup.1_Intron|PRPF40B_uc001ruq.1_Intron|PRPF40B_uc001rus.1_Intron	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1						mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						CCATTCTGTGCCCCCCCCCCC	0.577													32	7	---	---	---	---	
MBD6	114785	broad.mit.edu	37	12	57918608	57918609	+	Intron	INS	-	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57918608_57918609insA	uc001soj.1	+						MBD6_uc001sok.1_5'Flank|MBD6_uc001sol.1_5'Flank	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6							chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4						TCCCCAAGGTCAGAGTGGTGAG	0.550													188	16	---	---	---	---	
CPSF6	11052	broad.mit.edu	37	12	69646939	69646940	+	Intron	INS	-	T	T			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69646939_69646940insT	uc001sut.3	+						CPSF6_uc001suu.3_Intron	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,						mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			AAAGGGGTAAGTTTTTTTTTTC	0.292													412	10	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31175237	31175238	+	Intron	INS	-	TT	TT	rs150091343	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31175237_31175238insTT	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		AGTTCTCCTGGTTTTTTTTTTC	0.208													6	4	---	---	---	---	
DLST	1743	broad.mit.edu	37	14	75367595	75367597	+	Intron	DEL	TTC	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75367595_75367597delTTC	uc001xqv.2	+						DLST_uc001xqu.2_Intron|DLST_uc001xqt.2_Intron|DLST_uc010tuw.1_Intron	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2						lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		gcctggctaattcttaagttttt	0.000													5	3	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11064866	11064866	+	Intron	DEL	T	-	-	rs71404430		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11064866delT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						ATTGGCAACATTTTTTTTTTT	0.428													5	3	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2921210	2921211	+	Intron	INS	-	GT	GT	rs142119866	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2921210_2921211insGT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						CCTCTGTGACCgtgtgtgtgtg	0.475													5	3	---	---	---	---	
DHRS7C	201140	broad.mit.edu	37	17	9683469	9683469	+	Intron	DEL	A	-	-	rs111824797		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9683469delA	uc010vvb.1	-						DHRS7C_uc010cof.2_Intron	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C							extracellular region	binding|oxidoreductase activity				0						GAAATGACTGAAAAAAAAAAA	0.413													4	4	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15496417	15496417	+	Intron	DEL	A	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15496417delA	uc002gor.1	-						CDRT1_uc010vvy.1_Intron|CDRT1_uc010vvz.1_Intron|CDRT1_uc002gov.3_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		actatgtctcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
MPRIP	23164	broad.mit.edu	37	17	16981086	16981086	+	Intron	DEL	G	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16981086delG	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0						aaaaaaaaaaGACTTCTTATT	0.428													4	2	---	---	---	---	
MRM1	79922	broad.mit.edu	37	17	34958251	34958281	+	Frame_Shift_Del	DEL	CTCGACCGTCCGGGGCGCGACCTGGGGTCGC	-	-	rs141604685		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34958251_34958281delCTCGACCGTCCGGGGCGCGACCTGGGGTCGC	uc002hne.2	+	1	227_257	c.12_42delCTCGACCGTCCGGGGCGCGACCTGGGGTCGC	c.(10-42)CTCTCGACCGTCCGGGGCGCGACCTGGGGTCGCfs	p.L4fs	MRM1_uc002hnf.2_5'Flank	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog	4_14					RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TGGCATTGCTCTCGACCGTCCGGGGCGCGACCTGGGGTCGCCTCGTCACCC	0.697													97	14	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655757	47655757	+	Intron	DEL	G	-	-	rs36092852		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655757delG	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					AAAGGACAATGGGGGGGGGGG	0.532													6	3	---	---	---	---	
SPATA20	64847	broad.mit.edu	37	17	48625308	48625319	+	Intron	DEL	GGGGAGGGGCCT	-	-	rs3833151	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48625308_48625319delGGGGAGGGGCCT	uc002irf.2	+						SPATA20_uc002irc.2_Intron|SPATA20_uc002ire.2_Intron|SPATA20_uc002ird.2_Intron|SPATA20_uc010wmv.1_5'Flank|SPATA20_uc002irg.2_5'Flank	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20						cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GGAAGGGCCGGGGGAGGGGCCTGGGGAGGGGT	0.656													6	4	---	---	---	---	
NOL11	25926	broad.mit.edu	37	17	65720449	65720449	+	Intron	DEL	T	-	-	rs34287872		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65720449delT	uc002jgd.1	+						NOL11_uc010wql.1_Intron|NOL11_uc010deu.1_Intron	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11							nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATGCCTTCACttttttttttt	0.194													3	3	---	---	---	---	
SLC38A10	124565	broad.mit.edu	37	17	79257418	79257418	+	Intron	DEL	T	-	-	rs111438281		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79257418delT	uc002jzz.1	-						SLC38A10_uc002jzy.1_Intron|SLC38A10_uc002kab.2_Intron	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a						amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			ttcttttttcttttttttttt	0.274													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3581662	3581663	+	Intron	INS	-	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3581662_3581663insA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TTCTCACCATGaaaaaaaaaaa	0.381													5	4	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1048807	1048808	+	Intron	INS	-	A	A	rs77486898		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1048807_1048808insA	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gactccgtctcaaaaaaaaaaa	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	11384264	11384265	+	IGR	INS	-	TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	TTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC	rs151202085	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11384264_11384265insTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC								DOCK6 (11107 upstream) : TSPAN16 (22559 downstream)																							TGGACCACATTttccttccttc	0.158													4	2	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11495381	11495382	+	Intron	INS	-	TTCC	TTCC	rs112493159		TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11495381_11495382insTTCC	uc002mrn.2	-						EPOR_uc002mri.2_5'Flank|EPOR_uc002mrk.1_5'Flank|EPOR_uc002mrl.1_5'Flank|EPOR_uc002mrj.1_5'Flank|EPOR_uc010xlx.1_5'Flank|EPOR_uc010xly.1_5'Flank|RGL3_uc002mrm.2_Intron			Q3MIN7	RGL3_HUMAN	SubName: Full=FLJ00153 protein; Flags: Fragment;						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						ctctctctcctttccttccttc	0.104													5	3	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21321692	21321693	+	Intron	INS	-	GTA	GTA	rs141054974	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21321692_21321693insGTA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						AAGAAGAGCACGTAGGATTGTT	0.262													2	5	---	---	---	---	
ATP9A	10079	broad.mit.edu	37	20	50252339	50252340	+	Intron	INS	-	GGAGGGAGGAAG	GGAGGGAGGAAG	rs141656779	by1000genomes	TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50252339_50252340insGGAGGGAGGAAG	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						agaggaggggaggaggaaggaa	0.020													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085863	11085864	+	Intron	INS	-	C	C			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085863_11085864insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catcaccaccaccaccatcacc	0.000													5	4	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38164813	38164814	+	Intron	INS	-	A	A			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38164813_38164814insA	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					agactccatctaaaaaaaaaaa	0.000													5	3	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44896934	44896934	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A0S7-01	TCGA-BT-A0S7-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44896934delG	uc004dge.3	+	8	1029	c.654delG	c.(652-654)CAGfs	p.Q218fs	KDM6A_uc010nhk.2_Frame_Shift_Del_p.Q218fs|KDM6A_uc011mkz.1_Frame_Shift_Del_p.Q218fs|KDM6A_uc011mla.1_Frame_Shift_Del_p.Q218fs|KDM6A_uc011mlb.1_Frame_Shift_Del_p.Q218fs|KDM6A_uc011mlc.1_5'UTR	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	218	TPR 4.				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.0(2)|p.?(1)		kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						ATGAAACCCAGGTAAGTATTT	0.303			D|N|F|S		renal|oesophageal SCC|MM								24	23	---	---	---	---	
