Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PLEKHN1	84069	broad.mit.edu	37	1	909923	909923	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:909923G>C	uc001ace.2	+	15	1995	c.1960G>C	c.(1960-1962)GAG>CAG	p.E654Q	PLEKHN1_uc001acd.2_Missense_Mutation_p.E602Q|PLEKHN1_uc001acf.2_Missense_Mutation_p.E567Q	NM_032129	NP_115505	Q494U1	PKHN1_HUMAN	pleckstrin homology domain containing, family N	654											0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.93e-23)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.00095)|Kidney(185;0.0023)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.199)		TGGAGGGCCTGAGGCCAGTGG	0.662													9	20	---	---	---	---	PASS
NOL9	79707	broad.mit.edu	37	1	6592664	6592664	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6592664C>T	uc001ans.2	-	8	1413	c.1394G>A	c.(1393-1395)AGA>AAA	p.R465K	NOL9_uc010nzs.1_RNA	NM_024654	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	465					maturation of 5.8S rRNA	nucleolus	ATP binding|polynucleotide 5'-hydroxyl-kinase activity|RNA binding			skin(1)	1	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		ACGTCGATTTCTCATCTTGGT	0.433													46	147	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8418325	8418325	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8418325G>C	uc001ape.2	-	21	5080	c.4270C>G	c.(4270-4272)CCG>GCG	p.P1424A	RERE_uc001apf.2_Missense_Mutation_p.P1424A|RERE_uc001apd.2_Missense_Mutation_p.P870A	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	1424					multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		tgatggtgCGGAGTCACGTTG	0.438													10	34	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9801223	9801223	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9801223G>A	uc001aqh.2	-	10	2207	c.1448C>T	c.(1447-1449)TCT>TTT	p.S483F	CLSTN1_uc001aqi.2_Missense_Mutation_p.S473F|CLSTN1_uc010oag.1_Missense_Mutation_p.S483F	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	483	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CTCAGTCACAGAGAAGGGCTC	0.552													19	79	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10725233	10725233	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10725233C>G	uc001aro.2	-	5	732	c.412G>C	c.(412-414)GAG>CAG	p.E138Q	CASZ1_uc001arp.1_Missense_Mutation_p.E138Q|CASZ1_uc009vmx.2_Missense_Mutation_p.E162Q	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	138					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TTGGAGGGCTCCTCCGCGTGG	0.692													11	57	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11184592	11184592	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11184592G>C	uc001asd.2	-	47	6746	c.6625C>G	c.(6625-6627)CTG>GTG	p.L2209V	MTOR_uc001asc.2_Missense_Mutation_p.L414V	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	2209	PI3K/PI4K.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TCATTGGCCAGAAGGGTGTTA	0.463													15	72	---	---	---	---	PASS
UBIAD1	29914	broad.mit.edu	37	1	11333510	11333510	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11333510C>T	uc001asg.2	+	1						NM_013319	NP_037451	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1						menaquinone biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrion|nucleus	prenyltransferase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		CCTGCTGCCCCGCCCCGTCCT	0.652													9	28	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12333105	12333105	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12333105C>T	uc001atv.2	+	18	2290	c.2149C>T	c.(2149-2151)CAG>TAG	p.Q717*	VPS13D_uc001atw.2_Nonsense_Mutation_p.Q717*|VPS13D_uc001atx.2_5'Flank	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	717					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTCTGCCCCTCAGGTGATATT	0.428													27	101	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12333134	12333134	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12333134C>G	uc001atv.2	+	18	2319	c.2178C>G	c.(2176-2178)TTC>TTG	p.F726L	VPS13D_uc001atw.2_Missense_Mutation_p.F726L|VPS13D_uc001atx.2_5'Flank	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	726					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATTTCAAATTCAAGAATCCTG	0.423													19	88	---	---	---	---	PASS
MST1P9	11223	broad.mit.edu	37	1	17085908	17085908	+	Intron	SNP	C	G	G	rs1805293	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17085908C>G	uc010ock.1	-						CROCC_uc009voy.1_Intron|MST1P9_uc001azp.3_5'UTR	NR_002729				SubName: Full=Hepatocyte growth factor-like protein homolog;												0						AGCAGGCGCTCCACTCAGCCC	0.701													3	28	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17395563	17395563	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17395563G>A	uc001baf.2	-	16	2056	c.1974C>T	c.(1972-1974)TTC>TTT	p.F658F	PADI2_uc010ocm.1_Silent_p.F542F	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	658					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GCCACCACTTGAAGGTGAAGG	0.592													33	117	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17395644	17395644	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17395644G>A	uc001baf.2	-	16	1975	c.1893C>T	c.(1891-1893)TTC>TTT	p.F631F	PADI2_uc010ocm.1_Silent_p.F515F	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	631					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TGTCGTCGATGAAGGTGCATT	0.597													38	142	---	---	---	---	PASS
PADI3	51702	broad.mit.edu	37	1	17575710	17575710	+	Silent	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17575710C>A	uc001bai.2	+	1	118	c.78C>A	c.(76-78)CTC>CTA	p.L26L		NM_016233	NP_057317	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	26					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(1)|breast(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGGAGACCCTCGTGGACATTT	0.602													17	105	---	---	---	---	PASS
ALPL	249	broad.mit.edu	37	1	21889741	21889741	+	Missense_Mutation	SNP	G	A	A	rs138587317		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21889741G>A	uc001bet.2	+	5	693	c.436G>A	c.(436-438)GAG>AAG	p.E146K	ALPL_uc010odn.1_Missense_Mutation_p.E94K|ALPL_uc010odo.1_Missense_Mutation_p.E91K|ALPL_uc010odp.1_Missense_Mutation_p.E69K|ALPL_uc001beu.3_Missense_Mutation_p.E146K	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	146					response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	CCAGGGGAACGAGGTCACCTC	0.547													17	61	---	---	---	---	PASS
PAFAH2	5051	broad.mit.edu	37	1	26288494	26288494	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26288494G>C	uc001bld.3	-	11	1345	c.1165C>G	c.(1165-1167)CTG>GTG	p.L389V	PAFAH2_uc001ble.3_Missense_Mutation_p.L389V	NM_000437	NP_000428	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2	389					lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCTGGACAGATGGTGGGGG	0.488													83	252	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27106166	27106166	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27106166G>C	uc001bmv.1	+	20	6150	c.5777G>C	c.(5776-5778)GGA>GCA	p.G1926A	ARID1A_uc001bmu.1_Missense_Mutation_p.G1709A|ARID1A_uc001bmx.1_Missense_Mutation_p.G772A|ARID1A_uc009vsm.1_Missense_Mutation_p.G254A|ARID1A_uc009vsn.1_Missense_Mutation_p.G168A	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1926					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCGAGGATGGAGCTAAGAGT	0.542			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								47	143	---	---	---	---	PASS
PPP1R8	5511	broad.mit.edu	37	1	28178068	28178068	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28178068C>G	uc001bov.1	+	7					PPP1R8_uc001bow.1_3'UTR|PPP1R8_uc001box.1_3'UTR|PPP1R8_uc009vtc.1_RNA|PPP1R8_uc009vtd.1_RNA	NM_014110	NP_054829	Q12972	PP1R8_HUMAN	protein phosphatase 1 regulatory inhibitor						mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|RNA splicing|transcription, DNA-dependent	cytoplasm|nuclear speck|spliceosomal complex	DNA binding|endonuclease activity|protein binding|protein serine/threonine phosphatase inhibitor activity|ribonuclease E activity|RNA binding				0		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		ATTTGTCTCTCAGTCACTGAT	0.393													4	6	---	---	---	---	PASS
PPP1R8	5511	broad.mit.edu	37	1	28178076	28178076	+	3'UTR	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28178076G>T	uc001bov.1	+	7					PPP1R8_uc001bow.1_3'UTR|PPP1R8_uc001box.1_3'UTR|PPP1R8_uc009vtc.1_RNA|PPP1R8_uc009vtd.1_RNA	NM_014110	NP_054829	Q12972	PP1R8_HUMAN	protein phosphatase 1 regulatory inhibitor						mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|RNA splicing|transcription, DNA-dependent	cytoplasm|nuclear speck|spliceosomal complex	DNA binding|endonuclease activity|protein binding|protein serine/threonine phosphatase inhibitor activity|ribonuclease E activity|RNA binding				0		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		CTCAGTCACTGATTGCCACTG	0.398													5	7	---	---	---	---	PASS
YTHDF2	51441	broad.mit.edu	37	1	29070328	29070328	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29070328G>C	uc001brc.2	+	4	2043	c.1546G>C	c.(1546-1548)GAG>CAG	p.E516Q	YTHDF2_uc001brd.2_Missense_Mutation_p.E513Q|YTHDF2_uc010ofx.1_Missense_Mutation_p.E466Q|YTHDF2_uc001bre.2_Missense_Mutation_p.E466Q	NM_016258	NP_057342	Q9Y5A9	YTHD2_HUMAN	high glucose-regulated protein 8	516	YTH.				humoral immune response					ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CATTCGCCTAGAGAACAACGA	0.478													30	58	---	---	---	---	PASS
PTPRU	10076	broad.mit.edu	37	1	29609213	29609213	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29609213G>A	uc001bru.2	+	12	2004	c.1894G>A	c.(1894-1896)GAG>AAG	p.E632K	PTPRU_uc001brv.2_Missense_Mutation_p.E632K|PTPRU_uc001brw.2_Missense_Mutation_p.E632K|PTPRU_uc009vtq.2_Missense_Mutation_p.E632K|PTPRU_uc009vtr.2_Missense_Mutation_p.E632K	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	632	Extracellular (Potential).|Fibronectin type-III 4.				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TGTGGAGGAGGAGCGGGCGCG	0.582													16	47	---	---	---	---	PASS
YARS	8565	broad.mit.edu	37	1	33245110	33245110	+	Missense_Mutation	SNP	C	T	T	rs147005844	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33245110C>T	uc001bvy.1	-	12	2137	c.1349G>A	c.(1348-1350)CGC>CAC	p.R450H	YARS_uc001bvw.1_Missense_Mutation_p.R110H|YARS_uc001bvx.1_Missense_Mutation_p.R101H	NM_003680	NP_003671	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	450	tRNA-binding.				apoptosis|tyrosyl-tRNA aminoacylation	cytosol|extracellular space|nucleus|soluble fraction	ATP binding|interleukin-8 receptor binding|signal transducer activity|tRNA binding|tyrosine-tRNA ligase activity			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	TTCAACCTGGCGGTTTATCCC	0.557													34	83	---	---	---	---	PASS
SFPQ	6421	broad.mit.edu	37	1	35654606	35654606	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35654606C>G	uc001bys.2	-	6	1788	c.1695G>C	c.(1693-1695)TTG>TTC	p.L565F	SFPQ_uc001byr.2_RNA	NM_005066	NP_005057	P23246	SFPQ_HUMAN	splicing factor proline/glutamine rich	565					alternative nuclear mRNA splicing, via spliceosome|DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|nucleotide binding|protein binding|protein binding|RNA binding		SFPQ/TFE3(6)	kidney(4)|soft_tissue(2)|ovary(1)|skin(1)	8		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.196)				AATTTTACCTCAATTGCATTT	0.229			T	TFE3	papillary renal cell								3	46	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39797236	39797236	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797236G>C	uc010oiu.1	+	1	427	c.296G>C	c.(295-297)GGA>GCA	p.G99A	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1664	Plectin 2.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTGGCAACTGGAGGTTTCAGT	0.433													29	114	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43893963	43893963	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43893963G>A	uc001cjk.1	+	13	1737	c.1275G>A	c.(1273-1275)CTG>CTA	p.L425L		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	1324						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGGATTTGCTGACAGCGGTAG	0.547													23	74	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43905293	43905293	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43905293C>G	uc001cjk.1	+	35	4660	c.4198C>G	c.(4198-4200)CTA>GTA	p.L1400V		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2299						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGCATCACTCTAGCCTTTGT	0.622													40	170	---	---	---	---	PASS
CYP4A22	284541	broad.mit.edu	37	1	47614449	47614449	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47614449G>A	uc001cqv.1	+	12	1591	c.1540G>A	c.(1540-1542)GAA>AAA	p.E514K		NM_001010969	NP_001010969	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A,	514						endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding			skin(2)|ovary(1)|breast(1)	4						TAACCCTTGTGAAGACAAGGA	0.463													5	87	---	---	---	---	PASS
CYB5RL	606495	broad.mit.edu	37	1	54644891	54644891	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54644891G>C	uc009vzo.2	-	7	995	c.675C>G	c.(673-675)ATC>ATG	p.I225M	CYB5RL_uc001cww.2_Missense_Mutation_p.I115M|CYB5RL_uc001cwx.3_RNA|CYB5RL_uc001cwy.3_Missense_Mutation_p.I77M	NM_001031672	NP_001026842	Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	225							cytochrome-b5 reductase activity				0						TTTTCAGGTAGATGCTCTCAA	0.512													7	12	---	---	---	---	PASS
C1orf175	374977	broad.mit.edu	37	1	55136238	55136238	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55136238G>C	uc010ooe.1	+	6	1782	c.1458G>C	c.(1456-1458)CTG>CTC	p.L486L	C1orf175_uc001cxq.2_RNA|C1orf175_uc010ooc.1_Silent_p.L54L|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Silent_p.L4L|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc010oog.1_Silent_p.L486L|C1orf175_uc010ooh.1_RNA|C1orf175_uc009vzq.1_Intron|C1orf175_uc001cxt.1_RNA	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	486						integral to membrane	binding				0						TGGAGATCCTGACCCAGCTGA	0.378													9	30	---	---	---	---	PASS
HOOK1	51361	broad.mit.edu	37	1	60336747	60336747	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60336747G>T	uc009wad.2	+	22	2083	c.1981G>T	c.(1981-1983)GAA>TAA	p.E661*	HOOK1_uc001czo.2_Nonsense_Mutation_p.E661*|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Nonsense_Mutation_p.E619*	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	661	Sufficient for interaction with AKTIP and VPS18.			EE->AA: Abrogates interaction with AKTIP, VPS16, VPS18, VPS39 and VPS41, but does not affect interaction with HOOK2 or HOOK3; when associated with 669-A-A-670.	early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					CCGTGATTATGAAGAAAAACT	0.328													19	45	---	---	---	---	PASS
CYP2J2	1573	broad.mit.edu	37	1	60359206	60359206	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60359206C>G	uc001czq.2	-	9						NM_000775	NP_000766	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J,						epoxygenase P450 pathway|linoleic acid metabolic process|regulation of heart contraction|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	arachidonic acid 11,12-epoxygenase activity|arachidonic acid 14,15-epoxygenase activity|aromatase activity|electron carrier activity|heme binding|linoleic acid epoxygenase activity			ovary(1)	1	all_cancers(7;0.000396)					tcaaattcctctgatctttct	0.184													39	119	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65304176	65304176	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65304176T>A	uc001dbu.1	-	21	3188	c.2939A>T	c.(2938-2940)CAG>CTG	p.Q980L	JAK1_uc009wam.1_Missense_Mutation_p.Q968L|JAK1_uc009wal.1_Missense_Mutation_p.Q157L	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	980	Protein kinase 2.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	p.E966_K989del(1)		haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		ATATTTTAGCTGCTGTTTGAG	0.358			Mis		ALL								23	92	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75699699	75699699	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75699699C>T	uc001dgu.2	-	12	969	c.825G>A	c.(823-825)ATG>ATA	p.M275I	SLC44A5_uc001dgt.2_Missense_Mutation_p.M275I|SLC44A5_uc001dgs.2_Missense_Mutation_p.M233I|SLC44A5_uc001dgr.2_Missense_Mutation_p.M233I|SLC44A5_uc010oqz.1_Missense_Mutation_p.M314I|SLC44A5_uc010ora.1_Missense_Mutation_p.M269I|SLC44A5_uc010orb.1_Missense_Mutation_p.M145I	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	275	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						TCACACCAATCATGAAGACCC	0.373													38	134	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78163603	78163603	+	Silent	SNP	A	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78163603A>G	uc001dht.2	-	24	2963	c.2616T>C	c.(2614-2616)CCT>CCC	p.P872P	USP33_uc009wca.1_RNA|USP33_uc001dhs.2_Missense_Mutation_p.L559P|USP33_uc001dhu.2_Silent_p.P841P	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	872	DUSP 2.				axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TATTGTCAATAGGACCTGGAG	0.313													51	142	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82456494	82456494	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82456494G>C	uc001dit.3	+	21	4058	c.3877G>C	c.(3877-3879)GAC>CAC	p.D1293H	LPHN2_uc001dis.2_Missense_Mutation_p.D273H|LPHN2_uc001diu.2_Missense_Mutation_p.D1293H|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.D920H	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1349	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CGAGGGAACTGACAGCTATGT	0.512													28	100	---	---	---	---	PASS
COL24A1	255631	broad.mit.edu	37	1	86554904	86554904	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86554904G>C	uc001dlj.2	-	7	1702	c.1660C>G	c.(1660-1662)CAA>GAA	p.Q554E	COL24A1_uc010osd.1_Translation_Start_Site|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.Q554E	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	554	Collagen-like 2.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		GAAAGGCCTTGATCACCCTAT	0.294													24	72	---	---	---	---	PASS
CCBL2	56267	broad.mit.edu	37	1	89426873	89426873	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89426873G>C	uc001dmp.2	-	8	1141	c.764C>G	c.(763-765)TCT>TGT	p.S255C	CCBL2_uc001dmq.2_Missense_Mutation_p.S221C|CCBL2_uc001dmr.2_Missense_Mutation_p.S91C	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1	255					biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CTTATTTCCAGAATATACAAG	0.383													28	110	---	---	---	---	PASS
LRRC8B	23507	broad.mit.edu	37	1	90049431	90049431	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90049431G>C	uc001dni.2	+	7	1729	c.1222G>C	c.(1222-1224)GAG>CAG	p.E408Q	LRRC8B_uc001dnh.2_Missense_Mutation_p.E408Q|LRRC8B_uc001dnj.2_Missense_Mutation_p.E408Q	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	408						integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		ATGGACAGTTGAGAAACTGAA	0.383													22	89	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92193314	92193314	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92193314G>C	uc001doh.2	-	7	1253	c.787C>G	c.(787-789)CTT>GTT	p.L263V	TGFBR3_uc009wde.2_Missense_Mutation_p.L41V|TGFBR3_uc010osy.1_Missense_Mutation_p.L221V|TGFBR3_uc001doi.2_Missense_Mutation_p.L263V|TGFBR3_uc001doj.2_Missense_Mutation_p.L263V	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	263	Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		ACCACTTCAAGATCCTCTTGA	0.383													18	74	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93649605	93649605	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93649605C>T	uc001dpq.2	+	3	727	c.559C>T	c.(559-561)CAG>TAG	p.Q187*		NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	69										ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TTTGGATGTTCAGCCTAGCCA	0.353													43	134	---	---	---	---	PASS
FAM102B	284611	broad.mit.edu	37	1	109103109	109103109	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109103109C>T	uc010ouy.1	+	1	139	c.59C>T	c.(58-60)TCA>TTA	p.S20L		NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611	20										large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		GAGCTCTCCTCAGTGCCCTTC	0.627													18	62	---	---	---	---	PASS
RBM15	64783	broad.mit.edu	37	1	110882500	110882500	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110882500C>T	uc001dzl.1	+	1	556	c.473C>T	c.(472-474)TCC>TTC	p.S158F	RBM15_uc001dzm.1_Missense_Mutation_p.S158F|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	158	Gly/Ser-rich.				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGGGCCGCCTCCTCAGCTCCC	0.642			T	MKL1	acute megakaryocytic leukemia						OREG0013656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	53	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111854982	111854982	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111854982C>G	uc001eas.2	+	4	329	c.226C>G	c.(226-228)CTC>GTC	p.L76V	CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	76					apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TGATGTGACTCTCTACCAAGC	0.443													42	116	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112318805	112318805	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112318805G>T	uc001ebu.1	-	8	2342	c.1862C>A	c.(1861-1863)CCA>CAA	p.P621Q	KCND3_uc001ebv.1_Missense_Mutation_p.P602Q	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	621	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		GGTTAGCGCTGGGGGAGTGGG	0.582													4	115	---	---	---	---	PASS
SLC16A1	6566	broad.mit.edu	37	1	113460506	113460506	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113460506C>T	uc001ecx.2	-	4	1354	c.522G>A	c.(520-522)TGG>TGA	p.W174*	SLC16A1_uc001ecy.2_Nonsense_Mutation_p.W174*|SLC16A1_uc001ecz.2_Nonsense_Mutation_p.W174*	NM_003051	NP_003042	P53985	MOT1_HUMAN	solute carrier family 16, member 1	174	Helical; (Potential).				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Pyruvic acid(DB00119)	AGCTTCCTCTCCATCCAAAGA	0.557													21	73	---	---	---	---	PASS
DENND2C	163259	broad.mit.edu	37	1	115079344	115079344	+	RNA	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115079344C>T	uc001eez.2	-	29		c.4299G>A				NM_198459		Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C											skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTGCGTCGTTCATCCGCAAGG	0.522													12	120	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120529700	120529700	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120529700C>G	uc001eik.2	-	5	1013	c.757G>C	c.(757-759)GAA>CAA	p.E253Q	NOTCH2_uc001eil.2_Missense_Mutation_p.E253Q|NOTCH2_uc001eim.3_Missense_Mutation_p.E170Q	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	253	EGF-like 6.|Extracellular (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGCTCCCTTCAAAACCTGGT	0.453			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				17	63	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144619367	144619367	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144619367G>A	uc009wig.1	+	7	590	c.514G>A	c.(514-516)GAA>AAA	p.E172K	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.E172K|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.E103K|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.E103K|NBPF9_uc010oyg.1_Missense_Mutation_p.E137K|NBPF9_uc009wii.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	172	NBPF 1.					cytoplasm					0						AGATGAGGATGAAGATGTTCA	0.418													34	396	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	144619391	144619391	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144619391G>A	uc009wig.1	+	7	614	c.538G>A	c.(538-540)GAG>AAG	p.E180K	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Missense_Mutation_p.E180K|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Missense_Mutation_p.E111K|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Missense_Mutation_p.E111K|NBPF9_uc010oyg.1_Missense_Mutation_p.E145K|NBPF9_uc009wii.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	180	NBPF 1.					cytoplasm					0						TGAGGAGGATGAGAAAGTGCA	0.418													44	431	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	146399560	146399560	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146399560G>C	uc001emp.3	+	14	2510	c.1312G>C	c.(1312-1314)GAT>CAT	p.D438H	uc010ozk.1_5'UTR	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672	167											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATAGAAAATGATGAAGATGA	0.413													25	153	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151498241	151498241	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151498241G>T	uc009wmw.2	+	9	1882	c.1738G>T	c.(1738-1740)GAG>TAG	p.E580*		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	574	Glu-rich.|Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GAAGAACAAGGAGGATCTTAG	0.468													10	45	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152083887	152083887	+	Silent	SNP	C	T	T	rs115769840	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152083887C>T	uc001ezp.2	-	2	1806	c.1806G>A	c.(1804-1806)CTG>CTA	p.L602L	TCHH_uc009wne.1_Silent_p.L602L	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	602	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCGCGCTTCAGTCGCTGCT	0.677													11	66	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152328793	152328793	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152328793G>A	uc001ezw.3	-	3	1542	c.1469C>T	c.(1468-1470)TCT>TTT	p.S490F	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	490	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCAAAGCCAGAGGACTGACC	0.527													100	290	---	---	---	---	PASS
LCE1B	353132	broad.mit.edu	37	1	152785377	152785377	+	3'UTR	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152785377G>T	uc001faq.2	+	1						NM_178349	NP_848126	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B						keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGTCTTGGTGAGGGCTCAAC	0.478													3	15	---	---	---	---	PASS
SPRR4	163778	broad.mit.edu	37	1	152944714	152944714	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152944714C>T	uc001fav.1	+	2						NM_173080	NP_775103	Q96PI1	SPRR4_HUMAN	small proline-rich protein 4						keratinization|peptide cross-linking	cell cortex					0	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCTCTCACATCTCCTCCTGCC	0.507													4	6	---	---	---	---	PASS
SPRR2F	6705	broad.mit.edu	37	1	153085095	153085095	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153085095A>G	uc001fbi.2	-	2	174	c.115T>C	c.(115-117)TCA>CCA	p.S39P	SPRR2D_uc009wnz.2_Intron|SPRR2A_uc001fbf.2_Intron|SPRR2A_uc009woa.2_Intron	NM_001014450	NP_001014450	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	39	3 X 9 AA tandem repeats of [PS]-K-C-P- [EQ]-[PS]-C-P-P.|3.				keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGACACTTTGATGGTGGGCAG	0.632													70	282	---	---	---	---	PASS
UBAP2L	9898	broad.mit.edu	37	1	154233401	154233401	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154233401C>A	uc001fep.3	+	23	2779	c.2612C>A	c.(2611-2613)TCC>TAC	p.S871Y	UBAP2L_uc009wot.2_Missense_Mutation_p.S871Y|UBAP2L_uc010pek.1_Missense_Mutation_p.S863Y|UBAP2L_uc010pel.1_Missense_Mutation_p.S881Y|UBAP2L_uc010pen.1_Missense_Mutation_p.S785Y|UBAP2L_uc001feq.2_Missense_Mutation_p.S67Y|UBAP2L_uc001fer.2_Missense_Mutation_p.S67Y	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	871					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGGGATGCCTCCTCCCCAGCC	0.567													16	80	---	---	---	---	PASS
PMVK	10654	broad.mit.edu	37	1	154897577	154897577	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154897577G>A	uc001ffq.2	-	5						NM_006556	NP_006547	Q15126	PMVK_HUMAN	phosphomevalonate kinase						cholesterol biosynthetic process|protein phosphorylation	cytosol|peroxisome	ATP binding|phosphomevalonate kinase activity|protein binding				0	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACCTCAGCAGGCCCCAGCTCA	0.577													44	154	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155172609	155172609	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155172609G>A	uc001fix.2	-	8	974	c.951C>T	c.(949-951)ATC>ATT	p.I317I	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Silent_p.I308I|THBS3_uc001fiz.2_Silent_p.I317I|THBS3_uc001fiy.2_5'UTR|THBS3_uc010pfu.1_Silent_p.I197I|THBS3_uc010pfv.1_RNA|THBS3_uc001fja.2_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	317	EGF-like 2; calcium-binding (Potential).				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TCACCTCATTGATGTCACTGC	0.612													34	96	---	---	---	---	PASS
PKLR	5313	broad.mit.edu	37	1	155264172	155264172	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155264172C>T	uc001fkb.3	-	7	1009	c.970G>A	c.(970-972)GAT>AAT	p.D324N	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Missense_Mutation_p.D293N	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	324					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	AGGATTTCATCAAACCTGAGA	0.562													15	51	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155450350	155450350	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155450350C>G	uc009wqq.2	-	3	2791	c.2311G>C	c.(2311-2313)GAT>CAT	p.D771H	ASH1L_uc001fkt.2_Missense_Mutation_p.D771H|ASH1L_uc009wqr.1_Missense_Mutation_p.D771H	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	771					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AAGTCATGATCTACAAATGAA	0.383													53	179	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157485321	157485321	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157485321C>T	uc001fqu.2	-	17					FCRL5_uc009wsm.2_3'UTR	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5							integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				GCATTCTGGTCAGACTGAGAA	0.527													14	20	---	---	---	---	PASS
FCRL5	83416	broad.mit.edu	37	1	157504671	157504671	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157504671G>A	uc001fqu.2	-	8	1572	c.1414C>T	c.(1414-1416)CAT>TAT	p.H472Y	FCRL5_uc009wsm.2_Missense_Mutation_p.H472Y|FCRL5_uc010phv.1_Missense_Mutation_p.H472Y|FCRL5_uc010phw.1_Missense_Mutation_p.H387Y|FCRL5_uc001fqv.1_Missense_Mutation_p.H472Y|FCRL5_uc010phx.1_Missense_Mutation_p.H223Y	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	472	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AGGACAGGATGAGACACAGGG	0.493													22	59	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158323802	158323802	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158323802C>G	uc001fse.2	+	1	263	c.24C>G	c.(22-24)TTC>TTG	p.F8L	CD1E_uc010pid.1_Intron|CD1E_uc010pie.1_Missense_Mutation_p.F8L|CD1E_uc010pif.1_Missense_Mutation_p.F8L|CD1E_uc001fsd.2_Missense_Mutation_p.F8L|CD1E_uc001fsk.2_Missense_Mutation_p.F8L|CD1E_uc001fsj.2_Missense_Mutation_p.F8L|CD1E_uc001fsc.2_Missense_Mutation_p.F8L|CD1E_uc010pig.1_RNA|CD1E_uc001fsa.2_Missense_Mutation_p.F8L|CD1E_uc001fsf.2_Missense_Mutation_p.F8L|CD1E_uc001fry.2_Missense_Mutation_p.F8L|CD1E_uc001fsg.2_Missense_Mutation_p.F8L|CD1E_uc001fsh.2_Missense_Mutation_p.F8L|CD1E_uc001fsi.2_Missense_Mutation_p.F8L|CD1E_uc009wsv.2_Missense_Mutation_p.F8L|CD1E_uc001frz.2_Missense_Mutation_p.F8L|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	8					antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					TCCTCCTCTTCGAGGGTCTCT	0.522													17	72	---	---	---	---	PASS
OR10K2	391107	broad.mit.edu	37	1	158390393	158390393	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158390393C>G	uc010pii.1	-	1	264	c.264G>C	c.(262-264)CAG>CAC	p.Q88H		NM_001004476	NP_001004476	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TGGTCTTCTTCTGGGACAGCA	0.478													60	172	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908911	158908911	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908911G>C	uc001ftb.2	+	4	698	c.453G>C	c.(451-453)AGG>AGC	p.R151S	PYHIN1_uc001fta.3_Missense_Mutation_p.R151S|PYHIN1_uc001ftc.2_Missense_Mutation_p.R142S|PYHIN1_uc001ftd.2_Missense_Mutation_p.R151S|PYHIN1_uc001fte.2_Missense_Mutation_p.R142S	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	151					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GAACCAAAAGGAGTAAGATGT	0.463													16	49	---	---	---	---	PASS
SLAMF8	56833	broad.mit.edu	37	1	159805105	159805105	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159805105G>C	uc001fue.3	+	5					C1orf204_uc001fuf.1_RNA|C1orf204_uc001fug.1_3'UTR	NM_020125	NP_064510	Q9P0V8	SLAF8_HUMAN	SLAM family member 8 precursor							integral to membrane					0	all_hematologic(112;0.0597)					ACAGGCACACGATGCTCTGGG	0.542													10	20	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160156493	160156493	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160156493C>T	uc001fve.3	+	22					ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_3'UTR|ATP1A4_uc001fvh.2_3'UTR	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTACTAAACTCAGCAGATGAA	0.502													3	19	---	---	---	---	PASS
ITLN2	142683	broad.mit.edu	37	1	160914989	160914989	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160914989C>T	uc001fxd.2	-	8	977	c.919G>A	c.(919-921)GTT>ATT	p.V307I	ITLN2_uc009wts.2_Missense_Mutation_p.V306I|ITLN2_uc010pju.1_Missense_Mutation_p.V224I	NM_080878	NP_543154	Q8WWU7	ITLN2_HUMAN	intelectin 2 precursor	307					signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTGCTCTTAACGTGAGTTCCA	0.557													18	65	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161166037	161166037	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161166037G>A	uc001fyt.3	-	3	1442	c.1014C>T	c.(1012-1014)GTC>GTT	p.V338V	ADAMTS4_uc001fyu.2_3'UTR	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	338	Peptidase M12B.				proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CCGGGTCACAGACGGTGCCCA	0.567													12	53	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171509701	171509701	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171509701G>C	uc010pmg.1	+	16	3356	c.3090G>C	c.(3088-3090)CAG>CAC	p.Q1030H	BAT2L2_uc010pmh.1_Missense_Mutation_p.Q7H	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1030	Potential.						protein C-terminus binding				0						AACGGGAACAGAGGAAGGAGA	0.433													11	43	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171621260	171621260	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171621260C>T	uc001ghu.2	-	1	514	c.492G>A	c.(490-492)GAG>GAA	p.E164E	MYOC_uc010pmk.1_Silent_p.E106E	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	164	Potential.				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TGGCCAGATTCTCATTTTCTT	0.562													106	414	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173839997	173839997	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173839997C>G	uc009wwp.1	+	3	910	c.634C>G	c.(634-636)CTT>GTT	p.L212V	GAS5_uc001gjj.2_5'Flank|GAS5_uc001gjk.2_5'Flank|ZBTB37_uc001gjp.1_Missense_Mutation_p.L212V|ZBTB37_uc001gjq.3_Missense_Mutation_p.L212V|ZBTB37_uc001gjr.2_Missense_Mutation_p.L212V	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	212					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGAGCCCATTCTTCGGATCAA	0.532													13	67	---	---	---	---	PASS
TOR1AIP1	26092	broad.mit.edu	37	1	179851926	179851926	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179851926G>A	uc001gnq.2	+	1	507	c.289G>A	c.(289-291)GAG>AAG	p.E97K	TOR1AIP1_uc001gnp.1_Missense_Mutation_p.E97K	NM_015602	NP_056417	Q5JTV8	TOIP1_HUMAN	lamina-associated polypeptide 1B	97	Nuclear (Potential).					integral to membrane|nuclear inner membrane				breast(1)|central_nervous_system(1)	2						TTCTGCGAAAGAGGAAGTGAG	0.597													32	77	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180775197	180775197	+	Splice_Site	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180775197G>C	uc001goi.2	+	5	640	c.448_splice	c.e5-1	p.N150_splice	XPR1_uc009wxm.2_Splice_Site_p.N150_splice|XPR1_uc009wxn.2_Splice_Site_p.N150_splice	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						TCTTTCTGTAGAATCTGAATT	0.398													11	32	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180775240	180775240	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180775240G>C	uc001goi.2	+	5	682	c.490G>C	c.(490-492)GAC>CAC	p.D164H	XPR1_uc009wxm.2_Missense_Mutation_p.D164H|XPR1_uc009wxn.2_Missense_Mutation_p.D164H	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor	164	SPX.|Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0						GAAAAAGCATGACAAGATCCT	0.383													20	65	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183194782	183194782	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183194782G>A	uc001gqa.2	+	8	1307	c.993G>A	c.(991-993)CTG>CTA	p.L331L	LAMC2_uc001gpz.3_Silent_p.L331L|LAMC2_uc010poa.1_Silent_p.L31L	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	331	Laminin IV type A.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						GCCCCCAGCTGAGTTACTTTG	0.398													47	153	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183212553	183212553	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183212553C>G	uc001gqa.2	+	23						NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						ATAAATATTTCTCAACTGAGG	0.493													19	55	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183387492	183387492	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183387492C>T	uc001gqc.1	-	1						NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						AGGCGAGGCTCCGGCGGTGGA	0.612													8	18	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185902803	185902803	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185902803G>C	uc001grq.1	+	11	1904	c.1675G>C	c.(1675-1677)GAT>CAT	p.D559H		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	559	Ig-like C2-type 2.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GAATGACAGAGATGTCAGACT	0.448													24	54	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186324879	186324879	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186324879G>A	uc001grv.2	-	16	2207	c.1910C>T	c.(1909-1911)TCT>TTT	p.S637F		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	637					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGATGCAAGAGAAACATCATC	0.383			T	NTRK1	papillary thyroid								29	102	---	---	---	---	PASS
RGS2	5997	broad.mit.edu	37	1	192780193	192780193	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192780193C>G	uc001gsl.2	+	4	390	c.357C>G	c.(355-357)TTC>TTG	p.F119L		NM_002923	NP_002914	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	119	RGS.				cell cycle|negative regulation of cardiac muscle hypertrophy|negative regulation of G-protein coupled receptor protein signaling pathway|negative regulation of MAP kinase activity|negative regulation of phospholipase activity|positive regulation of cardiac muscle contraction|regulation of adrenergic receptor signaling pathway|regulation of translation|relaxation of cardiac muscle	cytosol|internal side of plasma membrane|mitochondrion|nucleolus	calmodulin binding|GTPase activator activity|signal transducer activity				0						GTGAAGACTTCAAAAAAACCA	0.398													49	117	---	---	---	---	PASS
PPP1R12B	4660	broad.mit.edu	37	1	202411574	202411574	+	Splice_Site	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202411574G>A	uc001gya.1	+	12	1686	c.1542_splice	c.e12-1	p.R514_splice	PPP1R12B_uc001gxz.1_Splice_Site_p.R514_splice	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			TGCTTCTACAGAGAATCAGCT	0.443													13	43	---	---	---	---	PASS
MYOG	4656	broad.mit.edu	37	1	203054957	203054957	+	Missense_Mutation	SNP	C	T	T	rs150337281		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203054957C>T	uc001gzd.2	-	1	421	c.133G>A	c.(133-135)GAG>AAG	p.E45K		NM_002479	NP_002470	P15173	MYOG_HUMAN	myogenin	45					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			skin(2)	2						CCTGGGGCCTCGGGGCTCAGG	0.652													27	86	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203453266	203453266	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203453266C>G	uc001gzs.2	+	2	1154	c.954C>G	c.(952-954)CTC>CTG	p.L318L	PRELP_uc001gzt.2_Silent_p.L318L	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	318	LRR 10.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			ACCTGTACCTCAACAACAATA	0.562													13	55	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203667370	203667370	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203667370C>G	uc001gzw.2	+	3	1163	c.279C>G	c.(277-279)TTC>TTG	p.F93L	ATP2B4_uc001gzv.2_Missense_Mutation_p.F93L|ATP2B4_uc009xaq.2_Missense_Mutation_p.F93L	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	93	Helical; (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAAGACTTTCTTAGAATTAG	0.502													26	83	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203693027	203693027	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203693027G>C	uc001gzw.2	+	19	3927	c.3043G>C	c.(3043-3045)GGG>CGG	p.G1015R	ATP2B4_uc001gzv.2_Missense_Mutation_p.G1015R|ATP2B4_uc009xaq.2_Missense_Mutation_p.G1015R|ATP2B4_uc001gzx.2_Missense_Mutation_p.G46R|ATP2B4_uc009xar.2_Intron	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b	1015	Helical; (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CGTGGAATTTGGGGGTAAACC	0.542													24	65	---	---	---	---	PASS
LAX1	54900	broad.mit.edu	37	1	203743841	203743841	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203743841G>A	uc001haa.2	+	5					LAX1_uc010pql.1_3'UTR|LAX1_uc001hab.2_3'UTR	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a						B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AAGCCACATTGAGTAGTCTAT	0.502													6	7	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204379015	204379015	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204379015C>G	uc001hav.3	-	1	1930	c.1525G>C	c.(1525-1527)GAT>CAT	p.D509H		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	509					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TTCTCTGAATCAGAAGGCTCT	0.463													25	77	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204379192	204379192	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204379192C>T	uc001hav.3	-	1	1753	c.1348G>A	c.(1348-1350)GAG>AAG	p.E450K		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	450					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TCAGCTTCCTCATCCCAATCC	0.458													48	218	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204379760	204379760	+	Silent	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204379760C>A	uc001hav.3	-	1	1185	c.780G>T	c.(778-780)CTG>CTT	p.L260L		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	260					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GGTCCTCTCTCAGGCAGCTGC	0.542													35	138	---	---	---	---	PASS
LOC642587	642587	broad.mit.edu	37	1	209605571	209605571	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209605571G>C	uc009xcn.2	+	4	569	c.186G>C	c.(184-186)AGG>AGC	p.R62S	LOC642587_uc010psk.1_RNA|MIR205_hsa-mir-205|MI0000285_RNA	NM_001104548	NP_001098018			hypothetical protein LOC642587												0				OV - Ovarian serous cystadenocarcinoma(81;0.0422)		TGAAGTTCAGGAGGCATGGAG	0.299													6	32	---	---	---	---	PASS
SERTAD4	56256	broad.mit.edu	37	1	210411352	210411352	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210411352C>T	uc001hhy.2	+	2	226	c.47C>T	c.(46-48)TCG>TTG	p.S16L	SERTAD4_uc009xcw.2_Missense_Mutation_p.S16L	NM_019605	NP_062551	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	16							protein binding			ovary(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		CCCATTGTCTCGGAAGGAGCT	0.488													33	124	---	---	---	---	PASS
FLVCR1	28982	broad.mit.edu	37	1	213032118	213032118	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213032118C>A	uc001hjt.2	+	1	522	c.324C>A	c.(322-324)TTC>TTA	p.F108L	LQK1_uc001hjr.3_5'Flank|LQK1_uc001hjs.3_5'Flank	NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular	108	Helical; (Potential).				cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		CGCGGCGCTTCGTGGTGCTCC	0.657													14	27	---	---	---	---	PASS
KCNK2	3776	broad.mit.edu	37	1	215256745	215256745	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215256745C>G	uc001hkq.2	+	1	186	c.17C>G	c.(16-18)TCG>TGG	p.S6W	KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Intron	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform	6	Cytoplasmic (Potential).						outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	CCCAGCGCCTCGCGGGAGAGA	0.547													25	90	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220213549	220213549	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220213549C>G	uc001hly.1	-	2	379	c.109G>C	c.(109-111)GAG>CAG	p.E37Q	EPRS_uc010puf.1_5'UTR|EPRS_uc001hlz.1_Missense_Mutation_p.E37Q|EPRS_uc009xdt.1_5'UTR	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	37					glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	AGAATATTCTCTTTCCCTTCT	0.269													20	130	---	---	---	---	PASS
HLX	3142	broad.mit.edu	37	1	221053221	221053221	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221053221C>T	uc001hmv.3	+	1	479	c.22C>T	c.(22-24)CCC>TCC	p.P8S		NM_021958	NP_068777	Q14774	HLX_HUMAN	H2.0-like homeobox	8					cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				GBM - Glioblastoma multiforme(131;0.00914)		CGGGCTGGCTCCCTTCTACGC	0.731													5	9	---	---	---	---	PASS
C1orf55	163859	broad.mit.edu	37	1	226180638	226180638	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180638G>A	uc001hpu.3	-	3	357	c.304C>T	c.(304-306)CGG>TGG	p.R102W	C1orf55_uc001hpv.2_Missense_Mutation_p.R102W	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859	102										lung(1)	1	Breast(184;0.197)					CTGAGATCCCGACAAGCTTCT	0.423													31	68	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227261667	227261667	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227261667G>C	uc001hqr.2	-	19	3576	c.2633C>G	c.(2632-2634)GCT>GGT	p.A878G	CDC42BPA_uc001hqq.2_Missense_Mutation_p.A142G|CDC42BPA_uc001hqs.2_Missense_Mutation_p.A797G|CDC42BPA_uc009xes.2_Missense_Mutation_p.A878G|CDC42BPA_uc010pvs.1_Missense_Mutation_p.A878G|CDC42BPA_uc001hqp.2_Missense_Mutation_p.A34G|CDC42BPA_uc001hqu.1_Missense_Mutation_p.A34G	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	878					actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				CTCCAGTCTAGCTGACATATC	0.368													52	154	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235357527	235357527	+	Splice_Site	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235357527C>G	uc001hwq.2	-	19	2425	c.1927_splice	c.e19-1	p.N643_splice	ARID4B_uc001hwr.2_Splice_Site_p.N557_splice|ARID4B_uc001hws.3_Splice_Site_p.N557_splice|ARID4B_uc001hwp.2_Splice_Site|ARID4B_uc001hwt.3_Splice_Site_p.N324_splice	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CTAATTTATTCTAGGTTAAGA	0.303													10	42	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237774219	237774219	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237774219G>A	uc001hyl.1	+	36	4961	c.4841G>A	c.(4840-4842)CGC>CAC	p.R1614H		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1614	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATAAGTGAACGCCAAGGCTGG	0.527													8	25	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241964444	241964444	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241964444G>C	uc001hzf.1	+	17	1985	c.1832G>C	c.(1831-1833)AGA>ACA	p.R611T	WDR64_uc001hzg.1_Missense_Mutation_p.R524T	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	1058										skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GCACCACGAAGAAGAAGTTTG	0.378													22	70	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243328908	243328908	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243328908G>C	uc001hzs.2	-	13	2762	c.2354C>G	c.(2353-2355)TCA>TGA	p.S785*	CEP170_uc001hzt.2_Nonsense_Mutation_p.S687*|CEP170_uc001hzu.2_Nonsense_Mutation_p.S687*|CEP170_uc001hzv.1_Nonsense_Mutation_p.S163*	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	785						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			TGGAGGTTGTGATTCTTGTTT	0.398													17	133	---	---	---	---	PASS
ZNF124	7678	broad.mit.edu	37	1	247319833	247319833	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247319833C>G	uc001ick.2	-	4					ZNF124_uc001ici.2_Intron|ZNF124_uc001icj.1_3'UTR	NM_003431	NP_003422	Q15973	ZN124_HUMAN	zinc finger protein 124						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1	all_cancers(71;5.07e-05)|all_epithelial(71;8.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00739)			TGTGACTGTTCATGTTTTTGA	0.328													10	25	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1914091	1914091	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1914091C>G	uc002qxe.2	-	13	2565	c.1738G>C	c.(1738-1740)GAG>CAG	p.E580Q	MYT1L_uc002qxd.2_Missense_Mutation_p.E578Q|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	580					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCCAGTTTCTCTGCTGCAGCG	0.592													5	65	---	---	---	---	PASS
TP53I3	9540	broad.mit.edu	37	2	24300523	24300523	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24300523C>T	uc002rey.1	-	6	985	c.925G>A	c.(925-927)GAA>AAA	p.E309K	LOC375190_uc002rew.2_Intron|SF3B14_uc002rev.2_5'Flank|SF3B14_uc010eyb.2_5'Flank|TP53I3_uc002rex.1_Missense_Mutation_p.R243Q|TP53I3_uc002rez.1_Missense_Mutation_p.E309K|TP53I3_uc010ykk.1_Missense_Mutation_p.E220K	NM_147184	NP_671713	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	309					induction of apoptosis by oxidative stress|NADP metabolic process		NADPH binding|NADPH:quinone reductase activity|protein homodimerization activity|quinone binding|zinc ion binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTGGATTTCGGTCACTGGG	0.562													61	90	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25042689	25042689	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25042689C>G	uc002rfs.3	-	21					CENPO_uc002rfo.1_3'UTR|CENPO_uc002rfp.1_3'UTR|CENPO_uc002rfq.1_3'UTR|ADCY3_uc002rfr.3_3'UTR|ADCY3_uc010ykm.1_3'UTR	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GAGGAGGTTTCTAAACCTAAA	0.493													3	7	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25457063	25457063	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25457063C>T	uc002rgc.2	-	23					DNMT3A_uc002rgd.2_3'UTR|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_3'UTR	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCCATCCTCATGTTCTTGG	0.413			Mis|F|N|S		AML								16	39	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25976464	25976464	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25976464C>G	uc002rgs.2	-	10	1302	c.1081G>C	c.(1081-1083)GAG>CAG	p.E361Q	ASXL2_uc002rgt.1_Missense_Mutation_p.E101Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	361					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCCTTCTCAATCTCTTGT	0.363													54	240	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27801442	27801442	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27801442C>T	uc002rkz.3	+	1	2054	c.2003C>T	c.(2002-2004)TCT>TTT	p.S668F		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	668										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CCGCAAACATCTCCATTTGAG	0.408													72	103	---	---	---	---	PASS
FOSL2	2355	broad.mit.edu	37	2	28616622	28616622	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28616622C>G	uc002rma.2	+	1	844	c.35C>G	c.(34-36)TCG>TGG	p.S12W	uc002rlz.1_Intron|FOSL2_uc010ymi.1_5'Flank	NM_005253	NP_005244	P15408	FOSL2_HUMAN	FOS-like antigen 2	12					cell death|regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(172;0.155)					TTTGACACCTCGTCCCGGGGC	0.716													7	9	---	---	---	---	PASS
SRD5A2	6716	broad.mit.edu	37	2	31805994	31805994	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31805994C>T	uc002rnw.1	-	1						NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2						androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)	CGCCGGTGGCCGCTGCCCTCC	0.706													4	20	---	---	---	---	PASS
FAM98A	25940	broad.mit.edu	37	2	33813645	33813645	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33813645C>T	uc002rpa.1	-						FAM98A_uc010yne.1_Intron|FAM98A_uc010ynd.1_5'Flank|FAM98A_uc002roz.1_5'UTR	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940											ovary(1)	1	all_hematologic(175;0.115)					AGTCATAAGTCTGGAGTCACA	0.328													6	29	---	---	---	---	PASS
FAM98A	25940	broad.mit.edu	37	2	33813652	33813652	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33813652C>T	uc002rpa.1	-						FAM98A_uc010yne.1_Intron|FAM98A_uc010ynd.1_5'Flank|FAM98A_uc002roz.1_5'UTR	NM_015475	NP_056290	Q8NCA5	FA98A_HUMAN	hypothetical protein LOC25940											ovary(1)	1	all_hematologic(175;0.115)					AGTCTGGAGTCACAACTATAT	0.313													5	25	---	---	---	---	PASS
CCDC75	253635	broad.mit.edu	37	2	37319356	37319356	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37319356C>G	uc010ezz.2	+	6	631	c.486C>G	c.(484-486)CTC>CTG	p.L162L	CCDC75_uc002rpr.3_Silent_p.L59L	NM_174931	NP_777591	Q8N954	CCD75_HUMAN	coiled-coil domain containing 75	162						intracellular	nucleic acid binding				0		all_hematologic(82;0.21)				AAGGAGATCTCAGAAGAAGCC	0.378													3	11	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39213087	39213087	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39213087G>C	uc002rrk.3	-	23	3921	c.3880C>G	c.(3880-3882)CCA>GCA	p.P1294A	SOS1_uc002rrj.3_Missense_Mutation_p.P893A	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	1294					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				CTTTGTCGTGGAGGAACAGGC	0.502									Noonan_syndrome				94	204	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48573348	48573348	+	5'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48573348G>C	uc002rwh.1	+	3						NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			AGAACTGTAAGAGTAAATGGG	0.358													24	177	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73677000	73677000	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73677000C>G	uc002sje.1	+	10	3460	c.3349C>G	c.(3349-3351)CTG>GTG	p.L1117V	ALMS1_uc002sjf.1_Missense_Mutation_p.L1073V|ALMS1_uc002sjg.2_Missense_Mutation_p.L503V|ALMS1_uc002sjh.1_Missense_Mutation_p.L503V	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1115	34 X 47 AA approximate tandem repeat.|13.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGAGAGTCATCTGCCTAAAGA	0.468													81	231	---	---	---	---	PASS
MOGS	7841	broad.mit.edu	37	2	74689052	74689052	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74689052C>T	uc010ffj.2	-	4	2027	c.1864G>A	c.(1864-1866)GAG>AAG	p.E622K	MOGS_uc010ffh.2_Missense_Mutation_p.E347K|MOGS_uc010yrt.1_Missense_Mutation_p.E503K|MOGS_uc010ffi.2_Missense_Mutation_p.E516K	NM_006302	NP_006293	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase isoform 1	622	Lumenal (Potential).				oligosaccharide metabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|membrane fraction	mannosyl-oligosaccharide glucosidase activity				0						GCAGCTACCTCAGCCTCACCC	0.632													13	53	---	---	---	---	PASS
MRPL53	116540	broad.mit.edu	37	2	74699205	74699205	+	3'UTR	SNP	T	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74699205T>G	uc002sln.2	-	3					CCDC142_uc002slo.2_RNA	NM_053050	NP_444278	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53 precursor							mitochondrion|ribosome					0						TTAAGTGTCCTAGTCCACGCT	0.502													21	76	---	---	---	---	PASS
MRPL53	116540	broad.mit.edu	37	2	74699247	74699247	+	Nonstop_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74699247C>A	uc002sln.2	-	3	478	c.338G>T	c.(337-339)TGA>TTA	p.*113L	CCDC142_uc002slo.2_RNA	NM_053050	NP_444278	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53 precursor	113						mitochondrion|ribosome					0						TTGGCGCTGTCAGCGACCAGT	0.547													26	84	---	---	---	---	PASS
HK2	3099	broad.mit.edu	37	2	75061718	75061718	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75061718C>G	uc002snd.2	+	1	1937	c.11C>G	c.(10-12)TCG>TGG	p.S4W		NM_000189	NP_000180	P52789	HXK2_HUMAN	hexokinase 2	4	Hydrophobic.				apoptotic mitochondrial changes|glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane	ATP binding|glucokinase activity			ovary(1)|lung(1)	2						ATGATTGCCTCGCATCTGCTT	0.662													16	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90044319	90044319	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90044319C>G	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CTAACCGGTTCTCTGGGGTCC	0.507													55	198	---	---	---	---	PASS
PROM2	150696	broad.mit.edu	37	2	95941808	95941808	+	Missense_Mutation	SNP	C	A	A	rs147971761		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95941808C>A	uc002suh.1	+	3	558	c.425C>A	c.(424-426)ACA>AAA	p.T142K	PROM2_uc002sui.2_Missense_Mutation_p.T142K|PROM2_uc002suj.2_5'UTR|PROM2_uc002suk.2_Missense_Mutation_p.T142K|PROM2_uc002sul.2_5'UTR	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	142	Cytoplasmic (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						CGAGTGAAGACAGAGCACAAG	0.687													9	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96587533	96587533	+	RNA	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96587533C>T	uc002sva.1	-	14		c.673G>A			uc002svc.1_RNA					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		TAATTACCTTCAAGGCTGGTT	0.284													5	19	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96952861	96952861	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96952861G>A	uc002svu.2	-	27	3608	c.3522C>T	c.(3520-3522)ATC>ATT	p.I1174I	SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_5'Flank|SNRNP200_uc002svv.1_5'Flank|SNRNP200_uc002svw.1_Silent_p.I246I	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1174	SEC63 1.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						CATATTTGTGGATGGTCTTCC	0.537													58	149	---	---	---	---	PASS
CNNM3	26505	broad.mit.edu	37	2	97494773	97494773	+	Missense_Mutation	SNP	G	A	A	rs149301704		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97494773G>A	uc002swy.2	+	7	1985	c.1961G>A	c.(1960-1962)CGA>CAA	p.R654Q	CNNM3_uc002swz.2_Missense_Mutation_p.R606Q	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	654					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1						CTGGCTACCCGAGCCCAGAAC	0.587													25	38	---	---	---	---	PASS
EIF5B	9669	broad.mit.edu	37	2	100011209	100011209	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100011209G>C	uc002tab.2	+	21	3301	c.3117G>C	c.(3115-3117)GTG>GTC	p.V1039V	EIF5B_uc010yvq.1_Silent_p.V21V	NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	1039					regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3						CCTTCGATGTGAGAATTGAAC	0.318													26	121	---	---	---	---	PASS
IL1RL1	9173	broad.mit.edu	37	2	102956721	102956721	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102956721G>C	uc002tbu.1	+	4	707	c.436G>C	c.(436-438)GAG>CAG	p.E146Q	IL1RL1_uc010ywa.1_Missense_Mutation_p.E29Q|IL18R1_uc002tbw.3_Intron|IL1RL1_uc002tbv.2_Missense_Mutation_p.E146Q	NM_016232	NP_057316	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1 isoform 1	146	Ig-like C2-type 2.|Extracellular (Potential).				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4						AGCACCTCTTGAGTGGTTTAA	0.274													12	62	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103119999	103119999	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103119999C>T	uc002tbz.3	+	3	1270	c.813C>T	c.(811-813)ATC>ATT	p.I271I		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	271	Helical; Name=H/M6; (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CCCGATTCATCGTTGTGGGGC	0.393													24	69	---	---	---	---	PASS
IL1F8	27177	broad.mit.edu	37	2	113785616	113785616	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113785616G>C	uc002tiq.1	-						IL1F8_uc002tir.1_Missense_Mutation_p.S113C	NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN	interleukin 1 family, member 8 isoform 1						immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1						GACAGAAGTGGAGCCTTCTTT	0.468													10	119	---	---	---	---	PASS
GYPC	2995	broad.mit.edu	37	2	127453717	127453717	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127453717G>A	uc002tnq.2	+	4	542	c.386G>A	c.(385-387)TGA>TAA	p.*129*	GYPC_uc002tnr.2_Silent_p.*110*|GYPC_uc010flv.2_RNA	NM_002101	NP_002092	P04921	GLPC_HUMAN	glycophorin C isoform 1	129						cortical cytoskeleton|integral to plasma membrane	protein binding			central_nervous_system(1)	1	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TACTTTATTTGAGGGACAACA	0.552													10	34	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128408370	128408370	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128408370G>C	uc010yzn.1	+	4	756	c.145G>C	c.(145-147)GAG>CAG	p.E49Q	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.E49Q|GPR17_uc010yzo.1_Missense_Mutation_p.E21Q|GPR17_uc002tpd.2_Missense_Mutation_p.E21Q	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	49	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		ggccacggcagagcaatgtgg	0.080											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	127	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136467039	136467039	+	Silent	SNP	A	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136467039A>G	uc002tuo.2	+	21	2761	c.2391A>G	c.(2389-2391)GAA>GAG	p.E797E	R3HDM1_uc010fni.2_Silent_p.E796E|R3HDM1_uc002tup.2_Silent_p.E742E|R3HDM1_uc010zbh.1_Silent_p.E545E	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	797							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		CAGGATCAGAACAAGTACAAT	0.388													3	111	---	---	---	---	PASS
NR4A2	4929	broad.mit.edu	37	2	157186256	157186256	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157186256G>C	uc002tyz.3	-	3	865	c.443C>G	c.(442-444)TCT>TGT	p.S148C	NR4A2_uc002tyx.3_Missense_Mutation_p.S85C|NR4A2_uc010zcf.1_Missense_Mutation_p.S148C|NR4A2_uc010zcg.1_5'Flank	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	148	Pro-rich.				cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						GTTGTGGAGAGATCCCGGGTC	0.622													51	157	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158115547	158115547	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158115547C>T	uc002tzg.2	+	1	1208	c.953C>T	c.(952-954)TCT>TTT	p.S318F	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	318	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CTCAATTTCTCTGAAAGCCAT	0.388													31	93	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162833271	162833271	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162833271G>C	uc002ubx.3	+	25	3413	c.3229G>C	c.(3229-3231)GAT>CAT	p.D1077H	SLC4A10_uc002uby.3_Missense_Mutation_p.D1047H|SLC4A10_uc010zcs.1_Missense_Mutation_p.D1058H	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	1077	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						CCTGTCTAGAGATGATCCATC	0.348													2	8	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165956815	165956815	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165956815C>T	uc002ucx.2	-	22	4455	c.3963G>A	c.(3961-3963)ATG>ATA	p.M1321I	SCN3A_uc002ucy.2_Missense_Mutation_p.M1272I|SCN3A_uc002ucz.2_Missense_Mutation_p.M1272I|SCN3A_uc002uda.1_Missense_Mutation_p.M1141I|SCN3A_uc002udb.1_Missense_Mutation_p.M1141I	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1321						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	TTCTTACCCTCATGCCTTCAA	0.373													35	117	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167160597	167160597	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167160597G>A	uc010fpl.2	-						SCN9A_uc002udr.1_Intron|SCN9A_uc002uds.1_Missense_Mutation_p.S82L|SCN9A_uc002udt.1_Missense_Mutation_p.S82L	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	TCTCAATGCTGAGACATTGCC	0.433													16	45	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	167992460	167992460	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167992460G>C	uc002udx.2	+	2	468	c.450G>C	c.(448-450)AAG>AAC	p.K150N	XIRP2_uc010fpn.2_Missense_Mutation_p.K150N|XIRP2_uc010fpo.2_Missense_Mutation_p.K150N|XIRP2_uc010fpp.2_Missense_Mutation_p.K150N|XIRP2_uc002udy.2_5'UTR	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CAGCTTTTAAGAGTCACCCTG	0.433													21	67	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170083085	170083085	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170083085G>A	uc002ues.2	-	32	5454	c.5241C>T	c.(5239-5241)TTC>TTT	p.F1747F		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1747	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CAGTTATTAAGAAAGGTTGAT	0.378													17	64	---	---	---	---	PASS
KBTBD10	10324	broad.mit.edu	37	2	170367164	170367164	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170367164G>A	uc002ueu.1	+	1	953	c.876G>A	c.(874-876)CTG>CTA	p.L292L	KBTBD10_uc010zdh.1_Intron	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10	292					striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						CTGGTTACCTGAATGACATTC	0.478													22	63	---	---	---	---	PASS
MAP1D	254042	broad.mit.edu	37	2	172928614	172928614	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172928614G>A	uc002uhk.2	+						MAP1D_uc010zdw.1_5'UTR	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GCCTCAGAACGACTTACATAA	0.418													12	52	---	---	---	---	PASS
DLX2	1746	broad.mit.edu	37	2	172965328	172965328	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172965328G>C	uc002uhn.2	-	3	1142	c.930C>G	c.(928-930)CAC>CAG	p.H310Q		NM_004405	NP_004396	Q07687	DLX2_HUMAN	distal-less homeobox 2	310	Poly-His.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GGTGGTGGTGGTGATGCGGCT	0.672													6	38	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098975	178098975	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098975A>G	uc002ulh.3	-	2	625	c.70T>C	c.(70-72)TGG>CGG	p.W24R	NFE2L2_uc002ulg.3_Missense_Mutation_p.W8R|NFE2L2_uc010zfa.1_Missense_Mutation_p.W8R|NFE2L2_uc002uli.3_Missense_Mutation_p.W8R|NFE2L2_uc010fra.2_Missense_Mutation_p.W8R|NFE2L2_uc010frb.2_Missense_Mutation_p.W8R	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	24					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCTTGCCTCCAAAGTATGTCA	0.348			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			8	64	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179472934	179472934	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179472934G>A	uc010zfg.1	-	224	45196	c.44972C>T	c.(44971-44973)TCA>TTA	p.S14991L	uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.S8686L|TTN_uc010zfi.1_Missense_Mutation_p.S8619L|TTN_uc010zfj.1_Missense_Mutation_p.S8494L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15918							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGGGATCTGAAGGTGGACT	0.418													9	21	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179583286	179583286	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179583286C>G	uc010zfg.1	-	82	21039	c.20815G>C	c.(20815-20817)GAG>CAG	p.E6939Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E3600Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7866							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCCTGTCTCAACACTGAAA	0.423													9	49	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179598113	179598113	+	Missense_Mutation	SNP	C	T	T	rs72648934		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179598113C>T	uc010zfg.1	-	51	12399	c.12175G>A	c.(12175-12177)GCC>ACC	p.A4059T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A720T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4986							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTTACTGGCGACCAAGGGT	0.473													41	127	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182543515	182543515	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182543515C>G	uc002uof.2	-	2	309	c.73G>C	c.(73-75)GAG>CAG	p.E25Q	CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1	25					amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CTGAGACACTCGTCTGTCCAG	0.552													20	57	---	---	---	---	PASS
PDE1A	5136	broad.mit.edu	37	2	183095762	183095762	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183095762C>T	uc002uos.2	-	6	646	c.562G>A	c.(562-564)GAT>AAT	p.D188N	PDE1A_uc010zfp.1_Missense_Mutation_p.D84N|PDE1A_uc002uoq.1_Missense_Mutation_p.D188N|PDE1A_uc010zfq.1_Missense_Mutation_p.D188N|PDE1A_uc002uor.2_Missense_Mutation_p.D172N|PDE1A_uc002uou.2_Missense_Mutation_p.D154N	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	188					activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			TTGATAAGATCATATCTGGTA	0.338													41	131	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187626715	187626715	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187626715C>T	uc002ups.2	+	8	1758	c.1646C>T	c.(1645-1647)TCC>TTC	p.S549F	FAM171B_uc002upr.1_Missense_Mutation_p.S516F|FAM171B_uc002upt.2_Missense_Mutation_p.S18F	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	549	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						GACCTTTTCTCCACACCGGAA	0.438													14	55	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187626819	187626819	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187626819C>G	uc002ups.2	+	8	1862	c.1750C>G	c.(1750-1752)CAG>GAG	p.Q584E	FAM171B_uc002upr.1_Missense_Mutation_p.Q551E|FAM171B_uc002upt.2_Missense_Mutation_p.Q53E	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	584	Cytoplasmic (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						GAACTTTACGCAGACCTTGCC	0.473													17	69	---	---	---	---	PASS
ORC2L	4999	broad.mit.edu	37	2	201778523	201778523	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201778523G>C	uc002uwr.2	-						ORC2L_uc010zhj.1_3'UTR	NM_006190	NP_006181	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0						CTATGTGGCAGACATACCCAT	0.393													2	5	---	---	---	---	PASS
ABI2	10152	broad.mit.edu	37	2	204291976	204291976	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204291976C>G	uc002vaa.2	+	11	1678	c.1443C>G	c.(1441-1443)ATC>ATG	p.I481M	ABI2_uc002uzz.2_Missense_Mutation_p.I443M|ABI2_uc010zih.1_Missense_Mutation_p.I129M|ABI2_uc010zii.1_Missense_Mutation_p.I475M|ABI2_uc010zij.1_Missense_Mutation_p.I358M|ABI2_uc002vab.2_Missense_Mutation_p.I369M|ABI2_uc010zik.1_Missense_Mutation_p.I206M|ABI2_uc010zil.1_Missense_Mutation_p.I345M|ABI2_uc010zim.1_Missense_Mutation_p.I294M|ABI2_uc002vac.2_Missense_Mutation_p.I267M|ABI2_uc010zin.1_Missense_Mutation_p.I158M	NM_005759	NP_005750	Q9NYB9	ABI2_HUMAN	abl interactor 2	481	SH3.				actin polymerization or depolymerization|cell migration|peptidyl-tyrosine phosphorylation	cytoskeleton|cytosol|filopodium|lamellipodium	cytoskeletal adaptor activity|DNA binding|kinase binding|proline-rich region binding|SH3 domain binding|ubiquitin protein ligase binding				0						TTTATGTCATCAAGAAGAATG	0.393													18	65	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393			Mis		gliobastoma 								34	71	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210557605	210557605	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210557605G>A	uc002vde.1	+	7	959	c.711G>A	c.(709-711)ATG>ATA	p.M237I	MAP2_uc002vdc.1_Missense_Mutation_p.M237I|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.M233I	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	237					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	TGGAAGACATGAAACAGAAGA	0.458													23	105	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216279496	216279496	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216279496G>C	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vfl.2_3'UTR	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGAAAAAAAGAAACCATCAG	0.358													8	26	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218712319	218712319	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218712319G>A	uc002vgt.2	-	17	2944	c.2546C>T	c.(2545-2547)TCA>TTA	p.S849L	TNS1_uc002vgr.2_Missense_Mutation_p.S849L|TNS1_uc002vgs.2_Missense_Mutation_p.S849L|TNS1_uc010zjv.1_Missense_Mutation_p.S849L|TNS1_uc010fvj.1_Missense_Mutation_p.S917L|TNS1_uc010fvk.1_Missense_Mutation_p.S974L|TNS1_uc010fvi.1_Missense_Mutation_p.S536L	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	849						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TTCCTTTGGTGAGAGCAGAGG	0.602													39	97	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220357396	220357396	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220357396T>C	uc010fwg.2	+	41	9692	c.9692T>C	c.(9691-9693)CTC>CCC	p.L3231P		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	3231					muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCCAGACGCTCACCTTCACC	0.697													3	99	---	---	---	---	PASS
SGPP2	130367	broad.mit.edu	37	2	223389719	223389719	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223389719C>T	uc010zlo.1	+	4	615	c.615C>T	c.(613-615)CTC>CTT	p.L205L	SGPP2_uc010zlp.1_Silent_p.L77L	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	205	Helical; (Potential).				sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		TGGTGTGTCTCAGCAGGCTCT	0.473													15	64	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227662879	227662879	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227662879G>A	uc002voh.3	-	1	628	c.576C>T	c.(574-576)ATC>ATT	p.I192I		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	192	IRS-type PTB.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TCACGAAGCTGATGGTCTTGC	0.552											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	72	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227663125	227663125	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227663125G>C	uc002voh.3	-	1	382	c.330C>G	c.(328-330)CTC>CTG	p.L110L		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	110	PH.|Mediates interaction with PHIP (By similarity).				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCAGCTGTAGGAGAGCCTGGT	0.672											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	131	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227886844	227886844	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227886844G>T	uc010zlt.1	-	43	4790	c.4136C>A	c.(4135-4137)CCA>CAA	p.P1379Q		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1379	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGGAAGGCCTGGGATTCGGGG	0.582													76	297	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228163449	228163449	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228163449G>C	uc002vom.1	+	43	3965	c.3803G>C	c.(3802-3804)GGA>GCA	p.G1268A	COL4A3_uc002von.1_Missense_Mutation_p.G1268A|COL4A3_uc002voo.1_Missense_Mutation_p.G1268A|COL4A3_uc002vop.1_Missense_Mutation_p.G1268A|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	1268	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GGCATAAAAGGAGACAAAGGG	0.522													21	73	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230656622	230656622	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230656622G>A	uc002vpw.1	-	28	4259	c.4150C>T	c.(4150-4152)CTA>TTA	p.L1384L	TRIP12_uc002vpx.1_Silent_p.L1432L|TRIP12_uc002vpy.1_Silent_p.L1114L	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1384					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCTCTGCCTAGAGGATTGCTC	0.378													58	199	---	---	---	---	PASS
ARMC9	80210	broad.mit.edu	37	2	232141419	232141419	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232141419G>A	uc002vrq.3	+	15	1517	c.1405G>A	c.(1405-1407)GAC>AAC	p.D469N	ARMC9_uc002vrp.3_Missense_Mutation_p.D469N|ARMC9_uc002vrr.1_RNA	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	469							binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GAAGGACCCTGACTGCCTGTC	0.557													47	159	---	---	---	---	PASS
ARMC9	80210	broad.mit.edu	37	2	232141443	232141443	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232141443G>A	uc002vrq.3	+	15	1541	c.1429G>A	c.(1429-1431)GAG>AAG	p.E477K	ARMC9_uc002vrp.3_Missense_Mutation_p.E477K|ARMC9_uc002vrr.1_RNA	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	477							binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CTACACGCTGGAGTACTCGGT	0.567													37	139	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	240061422	240061422	+	Silent	SNP	C	T	T	rs138989369	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240061422C>T	uc002vyk.3	-	9	1728	c.936G>A	c.(934-936)GCG>GCA	p.A312A	HDAC4_uc010fyz.1_Silent_p.A307A|HDAC4_uc010zoa.1_Silent_p.A307A|HDAC4_uc010fza.2_Silent_p.A312A|HDAC4_uc010fyy.2_Silent_p.A264A|HDAC4_uc010znz.1_Silent_p.A195A|HDAC4_uc010fzb.1_RNA	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	312	Interaction with MEF2A.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TACCGTTCTCCGCGCTGACGC	0.662													40	121	---	---	---	---	PASS
MTERFD2	130916	broad.mit.edu	37	2	242039257	242039257	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242039257T>C	uc002wan.1	-	1	654	c.161A>G	c.(160-162)CAG>CGG	p.Q54R	MTERFD2_uc010zoj.1_Intron|MTERFD2_uc010zok.1_Missense_Mutation_p.Q25R	NM_182501	NP_872307	Q7Z6M4	MTER2_HUMAN	MTERF domain containing 2	25										ovary(1)	1		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		ATGAGGAGTCTGCCTAGCCAT	0.498													12	26	---	---	---	---	PASS
D2HGDH	728294	broad.mit.edu	37	2	242707248	242707248	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242707248G>C	uc002wce.1	+	10	1603	c.1430G>C	c.(1429-1431)GGA>GCA	p.G477A	D2HGDH_uc010fzq.1_Missense_Mutation_p.G343A|D2HGDH_uc002wcg.1_RNA|D2HGDH_uc002wch.2_RNA|D2HGDH_uc002wci.2_Missense_Mutation_p.G176A	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	477					2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GCGGAGCACGGAGTGGGCTTC	0.701													5	16	---	---	---	---	PASS
RAD18	56852	broad.mit.edu	37	3	8922890	8922890	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8922890C>G	uc003brd.2	-	13					RAD18_uc003bre.2_RNA	NM_020165	NP_064550	Q9NS91	RAD18_HUMAN	postreplication repair protein hRAD18p						DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding			skin(3)|ovary(2)	5				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TTTTTCCCCTCTGGAAAAGCA	0.358								Rad6_pathway					3	8	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9487330	9487330	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9487330C>G	uc003brt.2	+						SETD5_uc003brs.1_Intron|SETD5_uc003bru.2_Intron|SETD5_uc003brv.2_Intron|SETD5_uc010hck.2_5'UTR|SETD5_uc003brw.1_3'UTR|SETD5_uc003brx.2_Intron	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5											ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AATATTGCCTCTATCTTAAAG	0.373													11	44	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10089620	10089620	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10089620C>T	uc003buw.2	+	16	1376	c.1298C>T	c.(1297-1299)TCA>TTA	p.S433L	FANCD2_uc003bux.1_Missense_Mutation_p.S433L|FANCD2_uc003buy.1_Missense_Mutation_p.S433L|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	433					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GATATGTGTTCATCCATTCTG	0.393			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				51	283	---	---	---	---	PASS
FANCD2	2177	broad.mit.edu	37	3	10091133	10091133	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10091133C>G	uc003buw.2	+	17	1567	c.1489C>G	c.(1489-1491)CTA>GTA	p.L497V	FANCD2_uc003bux.1_Missense_Mutation_p.L497V|FANCD2_uc003buy.1_Missense_Mutation_p.L497V|FANCD2_uc010hcw.1_RNA	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform	497					DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		AGATGTCCTTCTAGAGTTGGT	0.398			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				70	254	---	---	---	---	PASS
C3orf10	55845	broad.mit.edu	37	3	10157368	10157368	+	5'UTR	SNP	C	G	G	rs7645759	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10157368C>G	uc003bvb.2	+	1						NM_018462	NP_060932	Q8WUW1	BRK1_HUMAN	chromosome 3 open reading frame 10							cytoplasm|cytoskeleton					0						CGCAGTCGCTCTTCCTCAGGC	0.637													3	13	---	---	---	---	PASS
TIMP4	7079	broad.mit.edu	37	3	12194810	12194810	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12194810G>C	uc003bwo.2	-	5					SYN2_uc003bwl.1_Intron|SYN2_uc003bwm.2_Intron|SYN2_uc003bwn.2_Intron	NM_003256	NP_003247	Q99727	TIMP4_HUMAN	tissue inhibitor of metalloproteinase 4								metal ion binding|metalloendopeptidase inhibitor activity				0						GACTAATGGGGTTTGGGAGGC	0.512													2	1	---	---	---	---	PASS
NUP210	23225	broad.mit.edu	37	3	13393439	13393439	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13393439G>C	uc003bxv.1	-	20	2858	c.2775C>G	c.(2773-2775)CTC>CTG	p.L925L	NUP210_uc003bxw.2_Silent_p.L101L|NUP210_uc003bxx.2_Silent_p.L597L	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	925	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					TGCTGGTGTTGAGGAAGAAGT	0.617													20	72	---	---	---	---	PASS
TBC1D5	9779	broad.mit.edu	37	3	17300041	17300041	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17300041C>G	uc003cbf.2	-	16	2953	c.1288G>C	c.(1288-1290)GAT>CAT	p.D430H	TBC1D5_uc010heu.2_Missense_Mutation_p.D17H|TBC1D5_uc010hev.2_Missense_Mutation_p.D430H|TBC1D5_uc003cbe.2_Missense_Mutation_p.D430H|TBC1D5_uc010hew.1_Missense_Mutation_p.D382H	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b	430						intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						TTGTAATAATCTAAATTTGGA	0.308													62	208	---	---	---	---	PASS
KAT2B	8850	broad.mit.edu	37	3	20082225	20082225	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20082225C>G	uc003cbq.2	+	1	702	c.256C>G	c.(256-258)CCG>GCG	p.P86A		NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	86					cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ACGCTCCGCTCCGCGGGCCAA	0.706													4	27	---	---	---	---	PASS
AZI2	64343	broad.mit.edu	37	3	28381983	28381983	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28381983G>A	uc003ceb.2	-	2	658	c.126C>T	c.(124-126)GTC>GTT	p.V42V	AZI2_uc003cec.2_5'UTR|AZI2_uc003ced.2_Silent_p.V42V|AZI2_uc003cee.3_Silent_p.V42V|AZI2_uc003ceg.2_Silent_p.V42V|AZI2_uc011axd.1_Silent_p.V42V|AZI2_uc003cef.2_Silent_p.V42V	NM_022461	NP_071906	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2 isoform a	42	Potential.					mitochondrion|plasma membrane				ovary(2)	2						CATATGCAGTGACAAGAGCAA	0.333													29	95	---	---	---	---	PASS
UBP1	7342	broad.mit.edu	37	3	33450953	33450953	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33450953G>C	uc003cfq.3	-	6	1226	c.696C>G	c.(694-696)ATC>ATG	p.I232M	UBP1_uc003cfr.3_Missense_Mutation_p.I232M|UBP1_uc010hga.2_Missense_Mutation_p.I232M	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a	232					negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						TAAAAACTTTGATTTGGCAGC	0.418													45	142	---	---	---	---	PASS
UBP1	7342	broad.mit.edu	37	3	33458292	33458292	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33458292C>G	uc003cfq.3	-	3	830	c.300G>C	c.(298-300)CGG>CGC	p.R100R	UBP1_uc003cfr.3_Silent_p.R100R|UBP1_uc010hga.2_Silent_p.R100R	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a	100					negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						CACCCATTTTCCGATTATCCA	0.318													27	79	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38921615	38921615	+	Splice_Site	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38921615C>G	uc011ays.1	-	19	3419	c.3220_splice	c.e19-1	p.I1074_splice	SCN11A_uc010hhn.1_Intron	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	CTTCAAATATCTGAAATGAAA	0.318													8	31	---	---	---	---	PASS
CX3CR1	1524	broad.mit.edu	37	3	39307706	39307706	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39307706T>A	uc003cjl.2	-	2	387	c.295A>T	c.(295-297)AAT>TAT	p.N99Y		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	99	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		CACATGGCATTGTGGAGGCCC	0.463													39	112	---	---	---	---	PASS
ZNF620	253639	broad.mit.edu	37	3	40557421	40557421	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40557421C>G	uc003ckk.2	+	5	485	c.336C>G	c.(334-336)TTC>TTG	p.F112L	ZNF620_uc003ckl.2_5'UTR	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	112					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CAGAGTCCTTCAGACTGATGG	0.463													16	52	---	---	---	---	PASS
NKTR	4820	broad.mit.edu	37	3	42672757	42672757	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42672757G>C	uc003clo.2	+	8	646	c.499G>C	c.(499-501)GAT>CAT	p.D167H	NKTR_uc003clm.1_5'UTR|NKTR_uc003clp.2_5'UTR|NKTR_uc011azp.1_Missense_Mutation_p.D57H|NKTR_uc003clq.1_Missense_Mutation_p.D57H|NKTR_uc003clr.1_5'UTR|NKTR_uc003cls.2_5'UTR	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	167	PPIase cyclophilin-type.				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		ACCATATGCAGATGTGCGAGT	0.388													17	50	---	---	---	---	PASS
KBTBD5	131377	broad.mit.edu	37	3	42730464	42730464	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42730464G>A	uc003clv.1	+	4	1625	c.1525G>A	c.(1525-1527)GAT>AAT	p.D509N		NM_152393	NP_689606	Q2TBA0	KBTB5_HUMAN	kelch repeat and BTB (POZ) domain containing 5	509	Kelch 3.									ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CACTGTCCATGATGGCCGCAT	0.557													19	55	---	---	---	---	PASS
KIF15	56992	broad.mit.edu	37	3	44893313	44893313	+	Missense_Mutation	SNP	G	C	C	rs77808243		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44893313G>C	uc003cnx.3	+	33	3990	c.3841G>C	c.(3841-3843)GAG>CAG	p.E1281Q	KIF15_uc010hiq.2_Missense_Mutation_p.E1184Q|KIF15_uc010hir.2_Missense_Mutation_p.E329Q	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15	1281	Potential.				blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TTACAACAAAGAGATGGAATG	0.373													43	158	---	---	---	---	PASS
FBXW12	285231	broad.mit.edu	37	3	48423544	48423544	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48423544G>T	uc003csr.2	+	10	1450	c.1264G>T	c.(1264-1266)GAA>TAA	p.E422*	FBXW12_uc010hjv.2_Nonsense_Mutation_p.E403*|FBXW12_uc003css.2_Nonsense_Mutation_p.E352*|FBXW12_uc010hjw.2_Nonsense_Mutation_p.E321*	NM_207102	NP_996985	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12 isoform	422											0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGTCACCTGGAAAACACGTG	0.428													9	39	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48621376	48621376	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48621376C>T	uc003ctz.2	-	38	4236	c.4235G>A	c.(4234-4236)GGA>GAA	p.G1412E		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1412	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTCACCTGGTCCAGGGGGACC	0.652													9	56	---	---	---	---	PASS
UQCRC1	7384	broad.mit.edu	37	3	48641043	48641043	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48641043G>A	uc003cub.1	-	6	705	c.660C>T	c.(658-660)CTC>CTT	p.L220L	UQCRC1_uc003cua.1_Silent_p.L105L|UQCRC1_uc003cuc.1_Silent_p.L220L|UQCRC1_uc003cud.1_Silent_p.L220L	NM_003365	NP_003356	P31930	QCR1_HUMAN	ubiquinol-cytochrome c reductase core protein I	220					aerobic respiration|proteolysis		metalloendopeptidase activity|ubiquinol-cytochrome-c reductase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)	Atovaquone(DB01117)	AATGTGTGCTGAGGTACTCGG	0.532													8	45	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48684260	48684260	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48684260G>A	uc003cul.2	-	21	7512	c.7231C>T	c.(7231-7233)CTC>TTC	p.L2411F	CELSR3_uc003cuf.1_Missense_Mutation_p.L2481F|CELSR3_uc010hkf.2_5'Flank|CELSR3_uc010hkg.2_Missense_Mutation_p.L394F	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2411	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGGTAAACGAGGAGAATGATA	0.607													15	42	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49690134	49690134	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49690134G>C	uc003cxe.3	+	5	3259	c.3145G>C	c.(3145-3147)GAA>CAA	p.E1049Q		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1049	Potential.				synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCTGCGGGAGGAAGAGGAGCT	0.652													8	29	---	---	---	---	PASS
CAMKV	79012	broad.mit.edu	37	3	49899235	49899235	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49899235G>C	uc003cxt.1	-	4	484	c.291C>G	c.(289-291)ATC>ATG	p.I97M	CAMKV_uc011bcy.1_Missense_Mutation_p.I22M|CAMKV_uc003cxv.1_Missense_Mutation_p.I97M|CAMKV_uc003cxw.1_Translation_Start_Site|CAMKV_uc003cxx.1_Translation_Start_Site|CAMKV_uc003cxu.2_Missense_Mutation_p.I97M|CAMKV_uc011bcz.1_Missense_Mutation_p.I60M|CAMKV_uc011bda.1_Missense_Mutation_p.I97M|CAMKV_uc011bdb.1_RNA	NM_024046	NP_076951	Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	97	Protein kinase.					cytoplasmic vesicle membrane|plasma membrane	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|large_intestine(2)|central_nervous_system(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GCTCCAGGAAGATAAAGTACT	0.582													14	65	---	---	---	---	PASS
NPRL2	10641	broad.mit.edu	37	3	50387459	50387459	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50387459G>A	uc003daj.1	-						NPRL2_uc003dai.1_5'UTR|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN	tumor suppressor candidate 4						negative regulation of kinase activity		protein binding|protein kinase activity			lung(1)	1						GGGACCTGGGGAGGGGAGTGG	0.413													32	118	---	---	---	---	PASS
CYB561D2	11068	broad.mit.edu	37	3	50391174	50391174	+	Nonstop_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50391174G>C	uc003dak.2	+	3	1244	c.668G>C	c.(667-669)TGA>TCA	p.*223S	NPRL2_uc003dai.1_5'Flank|NPRL2_uc003daj.1_5'Flank|CYB561D2_uc003dal.2_Nonstop_Mutation_p.*223S|CYB561D2_uc003dam.2_Nonstop_Mutation_p.*223S	NM_007022	NP_008953	O14569	C56D2_HUMAN	cytochrome b-561 domain containing 2	223					electron transport chain|transport	integral to membrane	metal ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		ATCCAACCATGAGCTCTTCCC	0.557													21	96	---	---	---	---	PASS
CYB561D2	11068	broad.mit.edu	37	3	50391323	50391323	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50391323C>G	uc003dak.2	+	3					NPRL2_uc003daj.1_5'Flank|CYB561D2_uc003dal.2_3'UTR|CYB561D2_uc003dam.2_3'UTR	NM_007022	NP_008953	O14569	C56D2_HUMAN	cytochrome b-561 domain containing 2						electron transport chain|transport	integral to membrane	metal ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AATTCCTGCTCCTCATGCTGG	0.567													3	10	---	---	---	---	PASS
RFT1	91869	broad.mit.edu	37	3	53157763	53157763	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53157763C>T	uc003dgj.2	-	3	297	c.243G>A	c.(241-243)CAG>CAA	p.Q81Q	RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog	81					carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		GGTTGAGGGTCTGGCTCCAGT	0.542													13	49	---	---	---	---	PASS
DCP1A	55802	broad.mit.edu	37	3	53326414	53326414	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53326414C>T	uc003dgs.3	-	7	1161	c.1068G>A	c.(1066-1068)CTG>CTA	p.L356L	DCP1A_uc003dgt.3_RNA	NM_018403	NP_060873	Q9NPI6	DCP1A_HUMAN	DCP1 decapping enzyme homolog A	356					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasmic mRNA processing body|cytosol|nucleus	hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		CTGGCTGGTTCAGGAGTGGAG	0.582													25	66	---	---	---	---	PASS
CCDC66	285331	broad.mit.edu	37	3	56647736	56647736	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56647736G>A	uc003dhz.2	+	11	1611	c.1524G>A	c.(1522-1524)CAG>CAA	p.Q508Q	CCDC66_uc003dhy.2_Silent_p.Q144Q|CCDC66_uc003dhu.2_Silent_p.Q474Q|CCDC66_uc003dhx.2_RNA|CCDC66_uc003dia.2_5'Flank	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1	508	Potential.									breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AAGAGATGCAGAAACAGTATG	0.343													27	84	---	---	---	---	PASS
PDHB	5162	broad.mit.edu	37	3	58414123	58414123	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58414123C>G	uc003dkf.3	-						PDHB_uc003dke.3_Intron|PDHB_uc003dkg.3_Intron|PDHB_uc010hnl.2_Missense_Mutation_p.K319N|PDHB_uc011bff.1_Intron	NM_000925	NP_000916	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	NADH(DB00157)|Pyruvic acid(DB00119)	CTTTCAATCTCTTTATCCTGT	0.373													5	42	---	---	---	---	PASS
GBE1	2632	broad.mit.edu	37	3	81586104	81586104	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81586104C>T	uc003dqg.2	-	14	2044	c.1761G>A	c.(1759-1761)ATG>ATA	p.M587I	GBE1_uc011bgm.1_Missense_Mutation_p.M546I	NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	587					glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		CCAATCTATTCATATCCCTGT	0.413									Glycogen_Storage_Disease_type_IV				19	75	---	---	---	---	PASS
CLDND1	56650	broad.mit.edu	37	3	98241652	98241652	+	5'Flank	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98241652G>A	uc003dsp.2	-						CLDND1_uc003dso.2_5'Flank|CLDND1_uc003dsq.2_Intron|CLDND1_uc003dss.2_Intron|CLDND1_uc003dsr.2_Intron|CLDND1_uc003dst.2_Intron|CLDND1_uc003dsu.2_Intron|CLDND1_uc003dsv.2_5'UTR	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a							integral to membrane				ovary(1)	1						ATGGAACCGCGACGCGACCCC	0.701													12	69	---	---	---	---	PASS
C3orf26	84319	broad.mit.edu	37	3	99865849	99865849	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99865849G>A	uc003dtl.2	+	2	240	c.97G>A	c.(97-99)GAA>AAA	p.E33K		NM_032359	NP_115735	Q9BQ75	CC026_HUMAN	hypothetical protein LOC84319	33							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(1)	1						AGGAGACACAGAAGTGATGCA	0.433													9	49	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101390113	101390113	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101390113G>A	uc003dve.3	-	3	869	c.639C>T	c.(637-639)TTC>TTT	p.F213F	ZBTB11_uc003dvf.2_3'UTR	NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TAACATCACAGAACTGGTTGG	0.373													34	211	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105438984	105438984	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105438984G>A	uc003dwc.2	-	10	1636	c.1314C>T	c.(1312-1314)ATC>ATT	p.I438I	CBLB_uc011bhi.1_Silent_p.I460I|CBLB_uc003dwd.1_Silent_p.I438I|CBLB_uc003dwe.1_Silent_p.I438I|CBLB_uc011bhj.1_RNA	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	438					cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						AGGGGTCAATGATGCTGCAAC	0.498			Mis S		AML								16	87	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107524362	107524362	+	3'UTR	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107524362C>A	uc010hpr.2	+	18					BBX_uc003dwk.3_3'UTR|BBX_uc003dwl.3_Silent_p.T625T|BBX_uc003dwm.3_3'UTR|BBX_uc003dwo.3_Silent_p.T278T	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TTGTCTTTACCGAGGGATGCT	0.483													3	79	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112534713	112534713	+	3'UTR	SNP	T	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112534713T>G	uc003dzi.1	-	6					CD200R1L_uc011bhw.1_3'UTR|CD200R1L_uc010hqf.1_3'UTR	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2							integral to membrane	receptor activity			ovary(1)	1						cttaacatcatccatggccca	0.000													4	35	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119101938	119101938	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119101938G>C	uc003ecj.3	+	6	1079	c.547G>C	c.(547-549)GAA>CAA	p.E183Q		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	183	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TAGGTCTAAAGAAATTGAAGC	0.463													22	145	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121400701	121400701	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121400701C>G	uc003eei.3	-	15	8817	c.8691G>C	c.(8689-8691)TTG>TTC	p.L2897F	GOLGB1_uc010hrc.2_Missense_Mutation_p.L2902F|GOLGB1_uc003eej.3_Missense_Mutation_p.L2863F	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2897	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		GCAGATTCTTCAATTCCTTCA	0.368													19	148	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121417101	121417101	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121417101G>T	uc003eei.3	-	13	2380	c.2254C>A	c.(2254-2256)CAG>AAG	p.Q752K	GOLGB1_uc010hrc.2_Missense_Mutation_p.Q757K|GOLGB1_uc003eej.3_Missense_Mutation_p.Q718K|GOLGB1_uc011bjm.1_Missense_Mutation_p.Q638K|GOLGB1_uc010hrd.1_Missense_Mutation_p.Q716K	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	752	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TCCTTCACCTGAGAGAGAAGC	0.418													41	217	---	---	---	---	PASS
KPNA1	3836	broad.mit.edu	37	3	122215299	122215299	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122215299C>G	uc003efd.1	-	2	150	c.114G>C	c.(112-114)CAG>CAC	p.Q38H	KPNA1_uc011bjr.1_5'UTR|KPNA1_uc010hrh.2_5'UTR|KPNA1_uc003efe.2_Missense_Mutation_p.Q38H	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1	38	IBB.				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		CTTCTCTTTTCTGCTTTCGTA	0.373													26	183	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122255822	122255822	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122255822G>C	uc010hri.2	-	9	2114	c.1969C>G	c.(1969-1971)CAA>GAA	p.Q657E	PARP9_uc003eff.3_Missense_Mutation_p.Q622E|PARP9_uc011bjs.1_Missense_Mutation_p.Q622E|PARP9_uc003efg.2_Missense_Mutation_p.Q202E|PARP9_uc003efi.2_Missense_Mutation_p.Q622E|PARP9_uc003efh.2_Missense_Mutation_p.Q657E|PARP9_uc003efj.2_Missense_Mutation_p.Q622E	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	657	PARP catalytic.				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		TGTTTCTTTTGATCTAGAAGC	0.353													50	290	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122447406	122447406	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122447406C>G	uc003efq.3	+	17	5427	c.5368C>G	c.(5368-5370)CAA>GAA	p.Q1790E	PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.Q1507E	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1790	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		TTATGACTACCAAGCATACCC	0.368													43	256	---	---	---	---	PASS
PDIA5	10954	broad.mit.edu	37	3	122865043	122865043	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122865043A>T	uc003egc.1	+	13	1135	c.1079A>T	c.(1078-1080)AAT>ATT	p.N360I	PDIA5_uc003egd.1_RNA	NM_006810	NP_006801	Q14554	PDIA5_HUMAN	protein disulfide isomerase A5 precursor	360	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)		TATTTTAAGAATGGAGAGAAA	0.468													41	303	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123051504	123051504	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123051504G>C	uc003egh.1	-	4	1425	c.1425C>G	c.(1423-1425)ATC>ATG	p.I475M	ADCY5_uc003egg.1_Missense_Mutation_p.I108M|ADCY5_uc003egi.1_Missense_Mutation_p.I34M	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	475	Guanylate cyclase 1.|Cytoplasmic (Potential).	Magnesium 2; via carbonyl oxygen (By similarity).			activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		TGAAGCCCTCGATGTCAGCAA	0.448													5	60	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	123987680	123987680	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123987680G>C	uc003ehg.2	+	5	668	c.541G>C	c.(541-543)GAG>CAG	p.E181Q	KALRN_uc010hrv.1_Missense_Mutation_p.E181Q|KALRN_uc003ehf.1_Missense_Mutation_p.E181Q|KALRN_uc011bjy.1_Missense_Mutation_p.E181Q	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	181					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						CTACAACCATGAGGAGTGGAT	0.612													63	88	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	123987800	123987800	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123987800G>A	uc003ehg.2	+	5	788	c.661G>A	c.(661-663)GAG>AAG	p.E221K	KALRN_uc010hrv.1_Missense_Mutation_p.E221K|KALRN_uc003ehf.1_Missense_Mutation_p.E221K|KALRN_uc011bjy.1_Missense_Mutation_p.E221K	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	221	Spectrin 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TGTGGATGTGGAGGGCTCTCG	0.627													30	26	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129020945	129020945	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129020945C>G	uc003elt.2	+	6	876	c.788C>G	c.(787-789)ACT>AGT	p.T263S	C3orf37_uc003elu.2_Missense_Mutation_p.T221S|C3orf37_uc003elv.2_Missense_Mutation_p.T263S|C3orf37_uc003elw.2_Missense_Mutation_p.T263S	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	263										ovary(1)	1						CGAAACAACACTCCTGAGTGT	0.483													33	189	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129023525	129023525	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129023525G>C	uc003elt.2	+	7	1010	c.922G>C	c.(922-924)GAG>CAG	p.E308Q	C3orf37_uc003elu.2_Missense_Mutation_p.E266Q|C3orf37_uc003elv.2_Missense_Mutation_p.E308Q|C3orf37_uc003elw.2_Missense_Mutation_p.E308Q	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	308										ovary(1)	1						TCAAAAGGAAGAGTCAGATGT	0.532													32	135	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129282030	129282030	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129282030G>A	uc003emx.2	-	26	4675	c.4575C>T	c.(4573-4575)ATC>ATT	p.I1525I	PLXND1_uc011blb.1_Silent_p.I193I	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1525	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGCCCTTGTTGATTTGCTGCT	0.617													12	44	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290018	130290018	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290018G>A	uc010htl.2	+	6	2789	c.2758G>A	c.(2758-2760)GAT>AAT	p.D920N		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	920	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TGTGATCACCGATGGGGAATC	0.557													15	68	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130464024	130464024	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130464024G>C	uc003enj.2	-	2	620	c.39C>G	c.(37-39)ATC>ATG	p.I13M		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	13					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						CTACAGAAAGGATCTGGGAGG	0.398													16	99	---	---	---	---	PASS
BFSP2	8419	broad.mit.edu	37	3	133185754	133185754	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133185754C>T	uc003epn.1	+	5	1112	c.974C>T	c.(973-975)TCG>TTG	p.S325L		NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin	325	Rod.|Potential.				response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0						CACAACACTTCGTGCCAAGTC	0.562													23	143	---	---	---	---	PASS
TXNDC6	347736	broad.mit.edu	37	3	138033219	138033219	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138033219C>T	uc003esg.2	-	6	443	c.415G>A	c.(415-417)GAA>AAA	p.E139K	TXNDC6_uc003esd.1_RNA|TXNDC6_uc010huf.1_Missense_Mutation_p.E54K|TXNDC6_uc003ese.1_Missense_Mutation_p.E78K	NM_178130	NP_835231	Q86XW9	TXND6_HUMAN	thioredoxin domain containing 6	139					cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	cytoplasm|cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			breast(3)|ovary(1)|pancreas(1)	5						GAAACACATTCATCTTCATCA	0.358													43	295	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138374293	138374293	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138374293C>T	uc011bmq.1	-	22	3151	c.3151G>A	c.(3151-3153)GAA>AAA	p.E1051K	PIK3CB_uc011bmn.1_Missense_Mutation_p.E563K|PIK3CB_uc011bmo.1_Missense_Mutation_p.E502K|PIK3CB_uc011bmp.1_Missense_Mutation_p.E638K|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1051	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						GTCCAGCTTTCCCTGAGCGCC	0.423													56	116	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138374305	138374305	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138374305C>T	uc011bmq.1	-	22	3139	c.3139G>A	c.(3139-3141)GAG>AAG	p.E1047K	PIK3CB_uc011bmn.1_Missense_Mutation_p.E559K|PIK3CB_uc011bmo.1_Missense_Mutation_p.E498K|PIK3CB_uc011bmp.1_Missense_Mutation_p.E634K|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1047	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						CTGAGCGCCTCATCAAATTTT	0.408													56	117	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138374308	138374308	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138374308C>T	uc011bmq.1	-	22	3136	c.3136G>A	c.(3136-3138)GAT>AAT	p.D1046N	PIK3CB_uc011bmn.1_Missense_Mutation_p.D558N|PIK3CB_uc011bmo.1_Missense_Mutation_p.D497N|PIK3CB_uc011bmp.1_Missense_Mutation_p.D633N|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1046	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AGCGCCTCATCAAATTTTTGC	0.408													56	118	---	---	---	---	PASS
PIK3CB	5291	broad.mit.edu	37	3	138433362	138433362	+	Missense_Mutation	SNP	G	A	A	rs143122477	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138433362G>A	uc011bmq.1	-	7	1250	c.1250C>T	c.(1249-1251)ACG>ATG	p.T417M	PIK3CB_uc011bmo.1_Translation_Start_Site|PIK3CB_uc011bmp.1_Missense_Mutation_p.T21M	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	417	Nuclear localization signal.|C2 PI3K-type.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AATAGTTTTCGTTGATTTCTT	0.318													54	56	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140185546	140185546	+	Silent	SNP	C	T	T	rs139804872	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140185546C>T	uc003etn.2	+	8	1507	c.1317C>T	c.(1315-1317)CCC>CCT	p.P439P	CLSTN2_uc003etm.2_Silent_p.P439P	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	439	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						CCTTTCGCCCCGCGGAGTTCC	0.567										HNSCC(16;0.037)			15	105	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401335	140401335	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401335G>C	uc003eto.1	+	2	564	c.373G>C	c.(373-375)GAT>CAT	p.D125H		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	125						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TGGGAGCAGCGATACCCAGGT	0.557													15	154	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142170203	142170203	+	Intron	SNP	T	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142170203T>G	uc003eux.3	-						ATR_uc003euy.1_3'UTR	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein						cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TAGTGGAAGGTGTGTTTTACA	0.398								Other_conserved_DNA_damage_response_genes					8	16	---	---	---	---	PASS
COMMD2	51122	broad.mit.edu	37	3	149459490	149459490	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149459490G>A	uc003exk.2	-	5	465	c.418C>T	c.(418-420)CTC>TTC	p.L140F	COMMD2_uc003exj.1_5'Flank	NM_016094	NP_057178	Q86X83	COMD2_HUMAN	COMM domain containing 2	140	COMM.						protein binding				0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TGTTGCCTGAGACTTCTACTT	0.333													23	214	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155199659	155199659	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199659G>C	uc011bok.1	-	23	4457	c.4180C>G	c.(4180-4182)CAG>GAG	p.Q1394E	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.Q1356E	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1394					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ACCACACCCTGATTGTACTTG	0.403													32	183	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160156857	160156857	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160156857G>A	uc003fdm.2	-	3	310	c.115C>T	c.(115-117)CAG>TAG	p.Q39*	IFT80_uc003fda.2_RNA	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	39	RING-type.					integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CCAGATGCCTGAAGAATGTTT	0.368													18	131	---	---	---	---	PASS
PDCD10	11235	broad.mit.edu	37	3	167414911	167414911	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167414911C>G	uc003fex.2	-	5	552	c.154G>C	c.(154-156)GAA>CAA	p.E52Q	PDCD10_uc003fez.2_Missense_Mutation_p.E52Q|PDCD10_uc003fey.2_Missense_Mutation_p.E52Q	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	52					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						TTTTCTTTTTCAGCCTATAAT	0.343									Familial_Cerebral_Cavernous_Angioma				18	89	---	---	---	---	PASS
GOLIM4	27333	broad.mit.edu	37	3	167759263	167759263	+	Splice_Site	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167759263C>G	uc003ffe.2	-	6	862	c.518_splice	c.e6-1	p.E173_splice	GOLIM4_uc011bpe.1_Splice_Site_p.E173_splice|GOLIM4_uc011bpf.1_Splice_Site_p.E173_splice|GOLIM4_uc011bpg.1_Splice_Site_p.E173_splice	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TATACAGTCTCTATTTTAGAA	0.318													12	81	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168807914	168807914	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168807914T>A	uc003ffi.3	-	14	2980	c.2711A>T	c.(2710-2712)GAA>GTA	p.E904V	MECOM_uc010hwk.1_Missense_Mutation_p.E918V|MECOM_uc003ffj.3_Missense_Mutation_p.E969V|MECOM_uc011bpi.1_Missense_Mutation_p.E896V|MECOM_uc003ffn.3_Missense_Mutation_p.E904V|MECOM_uc003ffk.2_Missense_Mutation_p.E895V|MECOM_uc003ffl.2_Missense_Mutation_p.E1055V|MECOM_uc011bpj.1_Missense_Mutation_p.E1092V|MECOM_uc011bpk.1_Missense_Mutation_p.E894V	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	904	Asp/Glu-rich (acidic).				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						ATCATTGTCTTCATCCTCCTC	0.398													160	226	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168807915	168807915	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168807915C>T	uc003ffi.3	-	14	2979	c.2710G>A	c.(2710-2712)GAA>AAA	p.E904K	MECOM_uc010hwk.1_Missense_Mutation_p.E918K|MECOM_uc003ffj.3_Missense_Mutation_p.E969K|MECOM_uc011bpi.1_Missense_Mutation_p.E896K|MECOM_uc003ffn.3_Missense_Mutation_p.E904K|MECOM_uc003ffk.2_Missense_Mutation_p.E895K|MECOM_uc003ffl.2_Missense_Mutation_p.E1055K|MECOM_uc011bpj.1_Missense_Mutation_p.E1092K|MECOM_uc011bpk.1_Missense_Mutation_p.E894K	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	904	Asp/Glu-rich (acidic).				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						TCATTGTCTTCATCCTCCTCA	0.398													162	227	---	---	---	---	PASS
ALG3	10195	broad.mit.edu	37	3	183967044	183967044	+	5'Flank	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183967044C>G	uc003fne.2	-						ALG3_uc011brc.1_5'Flank|ALG3_uc011brd.1_5'Flank|ALG3_uc011bre.1_Missense_Mutation_p.E8Q|ALG3_uc003fnf.1_5'UTR|ALG3_uc011brf.1_5'Flank|ECE2_uc003fnh.3_5'Flank|ECE2_uc003fni.3_5'Flank	NM_005787	NP_005778	Q92685	ALG3_HUMAN	alpha-1,3-mannosyltransferase ALG3 isoform a						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity				0	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCAGCATTCTCCTTCGCCTGC	0.458											OREG0015944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	22	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	184009972	184009972	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184009972C>T	uc003fni.3	+	19	2636	c.2598C>T	c.(2596-2598)TTC>TTT	p.F866F	ECE2_uc003fnl.3_Silent_p.F794F|ECE2_uc003fnm.3_Silent_p.F748F|ECE2_uc003fnk.3_Silent_p.F719F	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	866	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCGGCACTTCGGCTGCCCTG	0.657													29	154	---	---	---	---	PASS
C3orf70	285382	broad.mit.edu	37	3	184870595	184870595	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184870595G>A	uc003fpd.2	-	1	208	c.17C>T	c.(16-18)TCG>TTG	p.S6L		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	6											0						CGACGCCGGCGAGGCCGCCGC	0.716													23	27	---	---	---	---	PASS
LIPH	200879	broad.mit.edu	37	3	185270277	185270277	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185270277C>T	uc003fpm.2	-	1					LIPH_uc010hyh.2_5'UTR	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTGGAGAGATCGTGTGTCACA	0.413													13	68	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186299204	186299204	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299204G>A	uc003fqi.2	+	5	721	c.501G>A	c.(499-501)CGG>CGA	p.R167R		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	167					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		CTGGCAAACGGAAGTGCAATT	0.517													24	158	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186510677	186510677	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186510677G>A	uc003fqz.2	-	6	693	c.470C>T	c.(469-471)TCA>TTA	p.S157L	RFC4_uc011bsc.1_Missense_Mutation_p.S157L|RFC4_uc011bsd.1_Missense_Mutation_p.S157L	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	157					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CTGAGCAGCTGAGGTCATAGA	0.428													13	87	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186512523	186512523	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186512523C>T	uc003fqz.2	-	5	557	c.334G>A	c.(334-336)GAT>AAT	p.D112N	RFC4_uc011bsc.1_Missense_Mutation_p.D112N|RFC4_uc011bsd.1_Missense_Mutation_p.D112N	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	112					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		CCACGTTCATCAGATGCATTT	0.368													16	101	---	---	---	---	PASS
TPRG1	285386	broad.mit.edu	37	3	188925327	188925327	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188925327C>G	uc003frv.1	+	7	1381	c.154C>G	c.(154-156)CTT>GTT	p.L52V	TPRG1_uc003frw.1_Missense_Mutation_p.L52V	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	52											0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CGAATCAACTCTTTACCCCAA	0.438													48	185	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193353228	193353228	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193353228G>A	uc003ftm.2	+	7	934	c.700G>A	c.(700-702)GAA>AAA	p.E234K	OPA1_uc003ftg.2_Missense_Mutation_p.E289K|OPA1_uc003fth.2_Missense_Mutation_p.E253K|OPA1_uc003fti.2_Missense_Mutation_p.E271K|OPA1_uc003ftj.2_Missense_Mutation_p.E252K|OPA1_uc003ftk.2_Missense_Mutation_p.E235K|OPA1_uc003ftl.2_Missense_Mutation_p.E216K|OPA1_uc003ftn.2_Missense_Mutation_p.E198K	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	234	Mitochondrial intermembrane (By similarity).|Potential.				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GAGAATCTTGGAACGATTAGA	0.289													18	120	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193364936	193364936	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193364936G>C	uc003ftm.2	+	17	1906	c.1672G>C	c.(1672-1674)GAG>CAG	p.E558Q	OPA1_uc003ftg.2_Missense_Mutation_p.E613Q|OPA1_uc003fth.2_Missense_Mutation_p.E577Q|OPA1_uc003fti.2_Missense_Mutation_p.E595Q|OPA1_uc003ftj.2_Missense_Mutation_p.E576Q|OPA1_uc003ftk.2_Missense_Mutation_p.E559Q|OPA1_uc003ftl.2_Missense_Mutation_p.E540Q|OPA1_uc003ftn.2_Missense_Mutation_p.E522Q	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	558	Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AATGGTACGAGAGTCTGTTGA	0.358													4	63	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195692349	195692349	+	Missense_Mutation	SNP	T	A	A	rs139762755	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195692349T>A	uc003fvy.2	-	3	308	c.194A>T	c.(193-195)GAG>GTG	p.E65V	SDHAP1_uc003fvx.3_RNA					Homo sapiens full length insert cDNA clone ZC24D06.												0						CCTCCAGTGCTCCTCAAAGGG	0.572													4	21	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196778504	196778504	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196778504C>T	uc003fxo.3	-	25	2742	c.2552G>A	c.(2551-2553)AGA>AAA	p.R851K	DLG1_uc011bub.1_Missense_Mutation_p.R747K|DLG1_uc011buc.1_Missense_Mutation_p.R735K|DLG1_uc011bud.1_Missense_Mutation_p.R534K|DLG1_uc003fxn.3_Missense_Mutation_p.R873K|DLG1_uc011bue.1_Missense_Mutation_p.R839K|DLG1_uc010ial.2_Missense_Mutation_p.R851K	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	851	Guanylate kinase-like.				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AAATGTTTTTCTGGCTTGTTC	0.328													13	137	---	---	---	---	PASS
HAUS3	79441	broad.mit.edu	37	4	2233842	2233842	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2233842G>C	uc003ges.1	-	5	1854	c.1624C>G	c.(1624-1626)CTA>GTA	p.L542V	POLN_uc003ger.2_5'Flank|POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Intron|HAUS3_uc003get.1_Missense_Mutation_p.L542V	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	542					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				large_intestine(2)|breast(2)	4						AGATGATTTAGCTTATTCAGT	0.264													10	60	---	---	---	---	PASS
SH3BP2	6452	broad.mit.edu	37	4	2828854	2828854	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2828854C>T	uc003gfi.3	+						SH3BP2_uc011bvp.1_Intron|SH3BP2_uc003gfj.3_Intron|SH3BP2_uc003gfk.3_Intron|SH3BP2_uc003gfl.3_Intron|SH3BP2_uc003gfm.3_Missense_Mutation_p.S84F	NM_001122681	NP_001116153	P78314	3BP2_HUMAN	SH3-domain binding protein 2 isoform a						signal transduction		SH3 domain binding|SH3/SH2 adaptor activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		atctgtgtatctgtccatgta	0.224									Cherubism				6	15	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3208288	3208288	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3208288C>T	uc011bvq.1	+	44	5935	c.5790C>T	c.(5788-5790)ATC>ATT	p.I1930I		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1928					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AAGATCTGATCAGCCTTTCCC	0.473													25	112	---	---	---	---	PASS
MAN2B2	23324	broad.mit.edu	37	4	6606942	6606942	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6606942G>A	uc003gjf.1	+	11	1736	c.1700G>A	c.(1699-1701)CGC>CAC	p.R567H	MAN2B2_uc003gje.1_Missense_Mutation_p.R567H|MAN2B2_uc011bwf.1_Missense_Mutation_p.R516H	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	567					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						CAATTTGGCCGCAGGCTGAGG	0.617													14	35	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15529226	15529226	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15529226G>A	uc010idv.2	+	13	1551	c.1306G>A	c.(1306-1308)GAC>AAC	p.D436N	CC2D2A_uc003gnx.2_Missense_Mutation_p.D387N|CC2D2A_uc003gnv.2_Missense_Mutation_p.D436N	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	436					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						CCAGTTATATGACCAGTACCT	0.408													6	31	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	30723906	30723906	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30723906C>T	uc003gsk.1	+	1	1870	c.862C>T	c.(862-864)CGC>TGC	p.R288C	PCDH7_uc011bxw.1_Intron|PCDH7_uc011bxx.1_Missense_Mutation_p.R288C	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	288	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						CGACCCGCCTCGCTCCTCGCA	0.672													3	5	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060556	46060556	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060556G>C	uc003gxb.2	-	6	861	c.709C>G	c.(709-711)CAG>GAG	p.Q237E		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	237	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		AATGCAAACTGATATAATCTC	0.353													16	74	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46967025	46967025	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46967025G>C	uc003gxg.2	-	8	1235	c.1096C>G	c.(1096-1098)CCA>GCA	p.P366A		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	366	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTCTGCACTGGAGCAGCGGGA	0.433													20	83	---	---	---	---	PASS
OCIAD2	132299	broad.mit.edu	37	4	48901920	48901920	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48901920G>C	uc003gyt.2	-	3	292	c.89C>G	c.(88-90)TCA>TGA	p.S30*	OCIAD2_uc003gyu.2_Nonsense_Mutation_p.S30*	NM_001014446	NP_001014446	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2 isoform 1	30	OCIA.					endosome					0						GTGCAGTTTTGATTTTGGACA	0.393													10	112	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68935699	68935699	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68935699G>C	uc003hdt.1	-	6	590	c.541C>G	c.(541-543)CTT>GTT	p.L181V	LOC550112_uc003hdl.3_Intron|uc011cak.1_Intron	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	181	Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						CTGTTGAGAAGATTCCTCATC	0.333													38	205	---	---	---	---	PASS
CSN2	1447	broad.mit.edu	37	4	70822044	70822044	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70822044G>A	uc003hes.3	-	6					CSN2_uc003het.3_3'UTR	NM_001891	NP_001882	P05814	CASB_HUMAN	casein beta precursor						calcium ion transport	extracellular region	calcium ion binding|enzyme inhibitor activity|transporter activity				0						AAAATAAGGAGGGAAAATTAA	0.274													6	22	---	---	---	---	PASS
IL8	3576	broad.mit.edu	37	4	74607297	74607297	+	Missense_Mutation	SNP	C	G	G	rs149273289		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74607297C>G	uc003hhe.2	+	2	204	c.103C>G	c.(103-105)CAG>GAG	p.Q35E	IL8_uc011cbh.1_Missense_Mutation_p.Q35E	NM_000584	NP_000575	P10145	IL8_HUMAN	interleukin 8 precursor	35					angiogenesis|calcium-mediated signaling|cell cycle arrest|cellular response to lipopolysaccharide|embryonic digestive tract development|G-protein coupled receptor protein signaling pathway|immune response|induction of positive chemotaxis|inflammatory response|negative regulation of cell proliferation|neutrophil activation|neutrophil chemotaxis|positive regulation of neutrophil chemotaxis|regulation of cell adhesion|regulation of retroviral genome replication	extracellular space|intracellular	chemokine activity|interleukin-8 receptor binding			ovary(2)	2	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)	Ketoprofen(DB01009)|Salbutamol(DB01001)|Simvastatin(DB00641)|Zileuton(DB00744)	ACTTAGATGTCAGTGCATAAA	0.423													16	58	---	---	---	---	PASS
CXCL5	6374	broad.mit.edu	37	4	74863775	74863775	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74863775G>C	uc003hhk.2	-	3	398	c.280C>G	c.(280-282)CCA>GCA	p.P94A		NM_002994	NP_002985	P42830	CXCL5_HUMAN	chemokine (C-X-C motif) ligand 5 precursor	94					cell-cell signaling|chemotaxis|immune response|positive regulation of cell proliferation|signal transduction	extracellular space	chemokine activity				0	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			GGGGCTTCTGGATCAAGACAA	0.433													32	137	---	---	---	---	PASS
HPSE	10855	broad.mit.edu	37	4	84230599	84230599	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84230599C>T	uc003hoj.3	-	7	1039	c.940G>A	c.(940-942)GAT>AAT	p.D314N	HPSE_uc010ika.2_Missense_Mutation_p.D256N|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.D57N|HPSE_uc011cct.1_Missense_Mutation_p.D314N|HPSE_uc003hok.3_Missense_Mutation_p.D314N	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	314					carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	TCCAATACATCAGGGTTTAGA	0.279													15	74	---	---	---	---	PASS
HPSE	10855	broad.mit.edu	37	4	84231203	84231203	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84231203C>G	uc003hoj.3	-	6	970	c.871G>C	c.(871-873)GAT>CAT	p.D291H	HPSE_uc010ika.2_Missense_Mutation_p.D233H|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.D34H|HPSE_uc011cct.1_Missense_Mutation_p.D291H|HPSE_uc003hok.3_Missense_Mutation_p.D291H	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	291				D -> G (in Ref. 9; BAD96706).	carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	GTAACTGAATCAATCACTTCT	0.308													34	185	---	---	---	---	PASS
HPGDS	27306	broad.mit.edu	37	4	95223298	95223298	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95223298G>A	uc003hte.1	-	5	525	c.434C>T	c.(433-435)TCT>TTT	p.S145F		NM_014485	NP_055300	O60760	HPGDS_HUMAN	prostaglandin D2 synthase, hematopoietic	145	GST C-terminal.				locomotory behavior|prostaglandin biosynthetic process|signal transduction	cytoplasm|nucleus	calcium ion binding|glutathione transferase activity|magnesium ion binding|prostaglandin-D synthase activity|protein homodimerization activity			ovary(1)	1					Glutathione(DB00143)	CATACTCACAGAGTTACCAAT	0.363													76	195	---	---	---	---	PASS
SEC24B	10427	broad.mit.edu	37	4	110442741	110442741	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110442741C>T	uc003hzk.2	+	14	2522	c.2467C>T	c.(2467-2469)CTG>TTG	p.L823L	SEC24B_uc003hzl.2_Silent_p.L788L|SEC24B_uc011cfp.1_Silent_p.L853L|SEC24B_uc011cfq.1_Silent_p.L822L|SEC24B_uc011cfr.1_Silent_p.L787L	NM_006323	NP_006314	O95487	SC24B_HUMAN	SEC24 (S. cerevisiae) homolog B isoform a	823					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|transporter activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		TGCAGGACTTCTGCAATCCAG	0.383													11	31	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	119163257	119163257	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119163257G>C	uc003ibx.2	+	12	2755	c.2352G>C	c.(2350-2352)CAG>CAC	p.Q784H		NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	784	Lumenal (Potential).|Heparan sulfate N-sulfotransferase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						ATGAAGTACAGAAGTTTCTAG	0.303													46	146	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126241888	126241888	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126241888C>T	uc003ifj.3	+	1	4322	c.4322C>T	c.(4321-4323)TCA>TTA	p.S1441L		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1441	Cadherin 14.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TCTGTCATTTCAGTGACTGCA	0.418													38	149	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126371358	126371358	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126371358G>C	uc003ifj.3	+	9	9187	c.9187G>C	c.(9187-9189)GAT>CAT	p.D3063H	FAT4_uc011cgp.1_Missense_Mutation_p.D1361H|FAT4_uc003ifi.1_Missense_Mutation_p.D541H	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3063	Extracellular (Potential).|Cadherin 29.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CACTGCAAAGGATAAGGGAAA	0.418													25	65	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126371891	126371891	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126371891C>G	uc003ifj.3	+	9	9720	c.9720C>G	c.(9718-9720)CTC>CTG	p.L3240L	FAT4_uc011cgp.1_Silent_p.L1538L|FAT4_uc003ifi.1_Silent_p.L718L	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3240	Cadherin 31.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						ACAGTGACCTCTTTGTCATTG	0.443													23	117	---	---	---	---	PASS
C4orf29	80167	broad.mit.edu	37	4	128938605	128938605	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128938605G>A	uc003ifr.2	+	9	876	c.558G>A	c.(556-558)GAG>GAA	p.E186E	C4orf29_uc003ifs.2_Silent_p.E80E|C4orf29_uc003ift.2_Silent_p.E17E|C4orf29_uc003ifu.2_Silent_p.E17E|C4orf29_uc010inz.2_Intron|C4orf29_uc003ifv.2_Silent_p.E17E	NM_001039717	NP_001034806	Q0P651	CD029_HUMAN	hypothetical protein LOC80167 precursor	186						extracellular region				ovary(1)	1						ACTGGCTAGAGAGGGAAGGTT	0.418													8	16	---	---	---	---	PASS
ZNF330	27309	broad.mit.edu	37	4	142152618	142152618	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142152618G>C	uc003iiq.3	+	8	769	c.549G>C	c.(547-549)CAG>CAC	p.Q183H	ZNF330_uc011chl.1_Missense_Mutation_p.Q123H	NM_014487	NP_055302	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	183	C4-type 4 (Potential).					chromosome, centromeric region|midbody|nucleolus	protein binding|zinc ion binding				0	all_hematologic(180;0.162)					GGCTTGGTCAGCACTCATGTC	0.353													43	119	---	---	---	---	PASS
USP38	84640	broad.mit.edu	37	4	144107121	144107121	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144107121G>A	uc003ijb.2	+	1	1052	c.518G>A	c.(517-519)CGA>CAA	p.R173Q	USP38_uc003ija.3_Missense_Mutation_p.R173Q|USP38_uc003ijc.2_RNA	NM_032557	NP_115946	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	173					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_hematologic(180;0.158)					CAGCTGGTTCGAACGATAGGC	0.537													37	135	---	---	---	---	PASS
PRSS48	345062	broad.mit.edu	37	4	152204409	152204409	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152204409G>T	uc011cif.1	+	4	622	c.622G>T	c.(622-624)GAT>TAT	p.D208Y	PRSS48_uc011cig.1_Missense_Mutation_p.D65Y	NM_183375	NP_899231	Q7RTY5	PRS48_HUMAN	epidermis-specific serine protease-like protein	208	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			large_intestine(1)	1						TTGTGCTGGTGATACTCAAAA	0.413													22	81	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153249501	153249501	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153249501G>A	uc003ims.2	-	9	1426	c.1277C>T	c.(1276-1278)TCA>TTA	p.S426L	FBXW7_uc011cii.1_Missense_Mutation_p.S426L|FBXW7_uc003imt.2_Missense_Mutation_p.S426L|FBXW7_uc011cih.1_Missense_Mutation_p.S250L|FBXW7_uc003imq.2_Missense_Mutation_p.S346L|FBXW7_uc003imr.2_Missense_Mutation_p.S308L	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	426	WD 2.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CATTTGTGATGACCATACTCC	0.378			Mis|N|D|F		colorectal|endometrial|T-ALL								67	229	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160260433	160260433	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160260433G>T	uc003iqg.3	+	13	2288	c.1978G>T	c.(1978-1980)GAG>TAG	p.E660*		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	660	Ras-associating.				cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TGTCACACCTGAGGGAGTAAT	0.433													50	202	---	---	---	---	PASS
KLHL2	11275	broad.mit.edu	37	4	166220763	166220763	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166220763G>T	uc003irb.2	+	8	1135	c.876G>T	c.(874-876)ATG>ATT	p.M292I	KLHL2_uc011cjm.1_Missense_Mutation_p.M296I|KLHL2_uc003irc.2_Missense_Mutation_p.M204I|KLHL2_uc010ira.2_5'UTR	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1	292					intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GTATATTAATGAAGAGTGTCC	0.433													27	69	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169215078	169215078	+	Missense_Mutation	SNP	G	C	C	rs138195535		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169215078G>C	uc003irp.2	-	7	1034	c.742C>G	c.(742-744)CTG>GTG	p.L248V		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	248							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TGTGTAAGCAGAGATACAGTC	0.323													23	92	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177052884	177052884	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177052884G>C	uc003iuj.2	+	8	1321	c.1165G>C	c.(1165-1167)GAC>CAC	p.D389H	WDR17_uc003iuk.2_Missense_Mutation_p.D365H|WDR17_uc003ium.3_Missense_Mutation_p.D365H|WDR17_uc003iul.1_Intron	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	389										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TTTTCTTAGAGACTTGGTATG	0.338													16	252	---	---	---	---	PASS
DCTD	1635	broad.mit.edu	37	4	183836719	183836719	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183836719C>G	uc003ivf.2	-	2	177	c.3G>C	c.(1-3)ATG>ATC	p.M1I	DCTD_uc003ivg.2_Missense_Mutation_p.M12I|DCTD_uc010irw.2_5'UTR|DCTD_uc003ivh.2_5'UTR	NM_001921	NP_001912	P32321	DCTD_HUMAN	dCMP deaminase isoform b	1					nucleotide biosynthetic process|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide metabolic process	cytosol	dCMP deaminase activity|zinc ion binding				0		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00666)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.202)		all cancers(43;1.65e-24)|Epithelial(43;3.44e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.39e-10)|Colorectal(24;4.69e-07)|COAD - Colon adenocarcinoma(29;7.07e-05)|STAD - Stomach adenocarcinoma(60;0.000118)|GBM - Glioblastoma multiforme(59;0.000472)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.0419)		AAACTTCACTCATGTTGGGTC	0.398													29	111	---	---	---	---	PASS
WWC2	80014	broad.mit.edu	37	4	184233512	184233512	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184233512G>C	uc010irx.2	+	22	3585	c.3403G>C	c.(3403-3405)GAG>CAG	p.E1135Q	WWC2_uc003ivk.3_Missense_Mutation_p.E930Q|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_Missense_Mutation_p.E817Q|WWC2_uc003ivn.3_Missense_Mutation_p.E650Q|WWC2_uc010irz.2_Missense_Mutation_p.E476Q|WWC2_uc003ivo.3_Missense_Mutation_p.E263Q	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	1135	Potential.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GTCCAAAGAAGAGCAGAAGCA	0.478													33	132	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186188198	186188198	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186188198G>A	uc003ixh.2	+	5	677	c.488G>A	c.(487-489)AGA>AAA	p.R163K		NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	163	PXA.				cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		CTGGCGTACAGAGAGCAAATG	0.458													53	146	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	637659	637659	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:637659C>G	uc003jbf.2	+	7	1004	c.932C>G	c.(931-933)TCT>TGT	p.S311C	CEP72_uc011clz.1_RNA	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	311					G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GACTCGGCCTCTTCTCAGAAG	0.532													16	66	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	637664	637664	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:637664C>A	uc003jbf.2	+	7	1009	c.937C>A	c.(937-939)CAG>AAG	p.Q313K	CEP72_uc011clz.1_RNA	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa	313					G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GGCCTCTTCTCAGAAGTTGGA	0.537													4	81	---	---	---	---	PASS
SLC12A7	10723	broad.mit.edu	37	5	1064231	1064231	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1064231G>C	uc003jbu.2	-	19	2640	c.2574C>G	c.(2572-2574)CTC>CTG	p.L858L		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	858	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GCAGCAGCATGAGCATGCCGC	0.697													5	20	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1221314	1221314	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1221314C>T	uc003jbw.3	+	11	1643	c.1587C>T	c.(1585-1587)TTC>TTT	p.F529F		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	529	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCAACATCTTCTGGCAAGTCA	0.547													10	32	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7816985	7816985	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7816985G>A	uc003jdz.1	+	23	2957	c.2890G>A	c.(2890-2892)GAG>AAG	p.E964K	ADCY2_uc011cmo.1_Missense_Mutation_p.E784K|ADCY2_uc010itm.1_Missense_Mutation_p.E160K	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	964	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TCAGGAGCCCGAGCGGCAGTA	0.502											OREG0016499	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	89	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10403539	10403539	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10403539G>C	uc003jet.1	+	15	1401	c.1218G>C	c.(1216-1218)CTG>CTC	p.L406L	MARCH6_uc011cmu.1_Silent_p.L358L|MARCH6_uc003jeu.1_Silent_p.L104L|MARCH6_uc011cmv.1_Silent_p.L301L	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	406	Extracellular (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ATGCTACTCTGAAAGATCGAG	0.418													28	79	---	---	---	---	PASS
MARCH11	441061	broad.mit.edu	37	5	16177875	16177875	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16177875C>T	uc003jfo.2	-	2	866	c.653G>A	c.(652-654)AGA>AAA	p.R218K	uc003jfp.2_5'Flank	NM_001102562	NP_001096032	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	218	RING-CH-type.					cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0						AACATGGTATCTATAACAGCA	0.398													13	51	---	---	---	---	PASS
PTGER4	5734	broad.mit.edu	37	5	40692015	40692015	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40692015G>C	uc003jlz.2	+	3	1594	c.1002G>C	c.(1000-1002)AAG>AAC	p.K334N		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	334	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						TCCTGAGAAAGACAGTGCTCA	0.507													54	145	---	---	---	---	PASS
GPBP1	65056	broad.mit.edu	37	5	56545357	56545357	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56545357G>C	uc003jrh.3	+	9	2200	c.926G>C	c.(925-927)AGA>ACA	p.R309T	GPBP1_uc010iwg.2_Missense_Mutation_p.R329T|GPBP1_uc003jri.3_Missense_Mutation_p.R138T|GPBP1_uc003jrj.3_Missense_Mutation_p.R301T|GPBP1_uc003jrk.3_Missense_Mutation_p.R316T|GPBP1_uc003jrl.3_RNA	NM_022913	NP_075064	Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1 isoform 1	309					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		AAAAGAGACAGAGTAGAAGAG	0.373													17	48	---	---	---	---	PASS
NDUFAF2	91942	broad.mit.edu	37	5	60448785	60448785	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60448785G>A	uc003jsp.3	+	4					NDUFAF2_uc003jso.3_RNA	NM_174889	NP_777549	Q8N183	MIMIT_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha							membrane|mitochondrion	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0		Lung NSC(810;3.36e-05)|Prostate(74;0.0225)|Ovarian(174;0.17)|Breast(144;0.237)				ATCAATGAATGCATTATGGTC	0.383													3	30	---	---	---	---	PASS
SLC30A5	64924	broad.mit.edu	37	5	68412387	68412387	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68412387G>A	uc003jvh.2	+	10	1440	c.1239G>A	c.(1237-1239)GAG>GAA	p.E413E	SLC30A5_uc003jvj.2_RNA|SLC30A5_uc003jvk.2_Silent_p.E142E|SLC30A5_uc003jvi.2_Silent_p.E242E	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),	413	Cytoplasmic (Potential).				cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTCTTGAGGAGAGTGACTCTA	0.328													10	68	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68616292	68616292	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68616292C>A	uc003jvv.1	-	1	119	c.76G>T	c.(76-78)GGT>TGT	p.G26C	CCDC125_uc003jvx.1_Missense_Mutation_p.G26C|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_Translation_Start_Site|CCDC125_uc003jvz.1_Missense_Mutation_p.G26C	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	26						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		CCTAAATCACCTTCTGTCATG	0.433													21	137	---	---	---	---	PASS
MAP1B	4131	broad.mit.edu	37	5	71491837	71491837	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71491837C>T	uc003kbw.3	+	5	2896	c.2655C>T	c.(2653-2655)ACC>ACT	p.T885T	MAP1B_uc010iyw.1_Silent_p.T902T|MAP1B_uc010iyx.1_Silent_p.T759T|MAP1B_uc010iyy.1_Silent_p.T759T	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	885						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAGAAGTCACCAAAGGTCCTG	0.547													50	181	---	---	---	---	PASS
BHMT2	23743	broad.mit.edu	37	5	78373343	78373343	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78373343G>C	uc003kft.2	+	2	97	c.74G>C	c.(73-75)GGA>GCA	p.G25A	BHMT2_uc011cth.1_Missense_Mutation_p.G25A	NM_017614	NP_060084	Q9H2M3	BHMT2_HUMAN	betaine-homocysteine methyltransferase 2	25	Hcy-binding.				methionine biosynthetic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	GTTGTGATTGGAGATGGCAGC	0.488													38	159	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79027767	79027767	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79027767C>T	uc003kgc.2	+	2	3251	c.3179C>T	c.(3178-3180)TCA>TTA	p.S1060L		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	1060						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CAGTTCAGTTCATCACAGAAG	0.428													9	36	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90449160	90449160	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90449160G>A	uc003kju.2	+	89	18843	c.18747G>A	c.(18745-18747)CTG>CTA	p.L6249L	GPR98_uc003kjt.2_Silent_p.L3955L|GPR98_uc003kjw.2_Silent_p.L1910L|GPR98_uc003kjx.2_Silent_p.L277L	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	6249	Cytoplasmic (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGGGGTCACTGATAGCCGATG	0.478													5	27	---	---	---	---	PASS
CHD1	1105	broad.mit.edu	37	5	98207807	98207807	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98207807T>C	uc003knf.2	-	27	3957	c.3809A>G	c.(3808-3810)TAT>TGT	p.Y1270C	CHD1_uc010jbn.2_Translation_Start_Site	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1270					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CCAGCTTCCATATCCATATTC	0.353													34	144	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101593786	101593786	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101593786C>G	uc003knm.2	-	7	1421	c.1134G>C	c.(1132-1134)TTG>TTC	p.L378F		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	378	Helical; Name=7; (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		CATTCTTCATCAAATTCTAAA	0.274													23	55	---	---	---	---	PASS
NUDT12	83594	broad.mit.edu	37	5	102891757	102891757	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102891757C>T	uc003koi.2	-	4	932	c.839G>A	c.(838-840)CGA>CAA	p.R280Q	NUDT12_uc011cvb.1_Missense_Mutation_p.R262Q	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12	280						nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		AAACTTGTATCGACTGTGCCA	0.353													19	92	---	---	---	---	PASS
FER	2241	broad.mit.edu	37	5	108281850	108281850	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108281850C>G	uc003kop.1	+	11	1640	c.1256C>G	c.(1255-1257)TCC>TGC	p.S419C	FER_uc011cvf.1_RNA|FER_uc011cvg.1_Missense_Mutation_p.S244C	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	419					intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		GAGAGGCTATCCAAATTTGAA	0.378													32	112	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109026131	109026131	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109026131C>A	uc003kou.1	+	1	976	c.13C>A	c.(13-15)CGC>AGC	p.R5S	MAN2A1_uc003kot.1_RNA	NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	5	Cytoplasmic (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GAAGTTAAGCCGCCAGTTCAC	0.582													3	78	---	---	---	---	PASS
CAMK4	814	broad.mit.edu	37	5	110818485	110818485	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110818485C>T	uc011cvj.1	+	11	930	c.831C>T	c.(829-831)GTC>GTT	p.V277V	CAMK4_uc003kpf.2_Silent_p.V277V|CAMK4_uc010jbv.2_Silent_p.V80V|CAMK4_uc003kpg.2_5'UTR	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	277	Protein kinase.				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TATTTCAGGTCAGAAAATTAA	0.418													15	95	---	---	---	---	PASS
TSSK1B	83942	broad.mit.edu	37	5	112769841	112769841	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112769841G>A	uc003kqm.2	-	1	888	c.696C>T	c.(694-696)CGC>CGT	p.R232R	MCC_uc003kql.3_Intron	NM_032028	NP_114417	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1	232	Protein kinase.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.R232H(1)		ovary(2)|skin(2)|stomach(1)	5		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GGAAGTTGACGCGGTGCTCCT	0.587													16	65	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113831654	113831654	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113831654G>C	uc003kqo.2	+	8	1972	c.1515G>C	c.(1513-1515)AAG>AAC	p.K505N	KCNN2_uc003kqp.2_Missense_Mutation_p.K157N|KCNN2_uc010jcg.2_RNA|uc003kqr.1_Intron	NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	505						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		ACTTCGAGAAGAGGATTGTTA	0.428													38	160	---	---	---	---	PASS
CSNK1G3	1456	broad.mit.edu	37	5	122881333	122881333	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122881333C>G	uc003ktm.2	+	2					CSNK1G3_uc003ktl.2_5'UTR|CSNK1G3_uc003ktn.2_5'UTR|CSNK1G3_uc003kto.2_5'UTR|CSNK1G3_uc011cwr.1_Intron|CSNK1G3_uc011cws.1_Intron|CSNK1G3_uc010jda.2_5'UTR	NM_004384	NP_004375	Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3 isoform 1						Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		TTAAAGAATTCAAAGTGGAGT	0.383													11	17	---	---	---	---	PASS
CSF2	1437	broad.mit.edu	37	5	131411636	131411636	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131411636G>A	uc003kwf.2	+	4						NM_000758	NP_000749	P04141	CSF2_HUMAN	colony stimulating factor 2 precursor						immune response|negative regulation of cytolysis|positive regulation of DNA replication|positive regulation of interleukin-23 production|positive regulation of macrophage derived foam cell differentiation|positive regulation of podosome assembly|positive regulation of tyrosine phosphorylation of Stat5 protein	extracellular space	cytokine activity|granulocyte macrophage colony-stimulating factor receptor binding|growth factor activity				0		all_cancers(142;4.28e-07)|all_lung(232;2.81e-05)|Lung NSC(810;0.000693)|Lung SC(612;0.122)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Sargramostim(DB00020)	GAGGGACCAAGGGGTGGGCCA	0.572													8	20	---	---	---	---	PASS
SEPT8	23176	broad.mit.edu	37	5	132086692	132086692	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132086692G>C	uc003kxr.2	-	10					CCNI2_uc003kxq.1_Intron|CCNI2_uc011cxg.1_Intron|CCNI2_uc011cxh.1_Intron	NM_001098811	NP_001092281	Q92599	SEPT8_HUMAN	septin 8 isoform a						cell cycle	septin complex	GTP binding|protein binding			ovary(2)	2		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGACTATAGTGAGTAAGGAGG	0.507													14	105	---	---	---	---	PASS
SHROOM1	134549	broad.mit.edu	37	5	132160910	132160910	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132160910G>A	uc003kxx.2	-	4	1728	c.923C>T	c.(922-924)TCA>TTA	p.S308L	SHROOM1_uc003kxy.1_Missense_Mutation_p.S308L	NM_133456	NP_597713	Q2M3G4	SHRM1_HUMAN	shroom family member 1	308					actin filament bundle assembly|cell morphogenesis	cytoplasm|microtubule	actin filament binding			pancreas(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GACTTCGCCTGAAGCGCTCCG	0.617													11	34	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905956	139905956	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905956C>G	uc003lfs.1	+	26	4992	c.4868C>G	c.(4867-4869)TCT>TGT	p.S1623C	ANKHD1_uc003lfr.2_Missense_Mutation_p.S1623C|ANKHD1_uc003lfu.1_Missense_Mutation_p.S1103C|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.S362C|ANKHD1_uc003lfw.2_Missense_Mutation_p.S261C|ANKHD1_uc010jfl.2_Missense_Mutation_p.S58C|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1623						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAATTCCTCTAAATACCCC	0.393													33	104	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905979	139905979	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905979C>G	uc003lfs.1	+	26	5015	c.4891C>G	c.(4891-4893)CAT>GAT	p.H1631D	ANKHD1_uc003lfr.2_Missense_Mutation_p.H1631D|ANKHD1_uc003lfu.1_Missense_Mutation_p.H1111D|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.H370D|ANKHD1_uc003lfw.2_Missense_Mutation_p.H269D|ANKHD1_uc010jfl.2_Missense_Mutation_p.H66D|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1631						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGCTCCTTCATTCCCAAGA	0.418													35	96	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140214299	140214299	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140214299G>A	uc003lhq.2	+	1	331	c.331G>A	c.(331-333)GAA>AAA	p.E111K	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.E111K	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	111	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGATCGTGGAAAGGCCGCT	0.557													37	351	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140228411	140228411	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140228411G>A	uc003lhu.2	+	1	1055	c.331G>A	c.(331-333)GAC>AAC	p.D111N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.D111N	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	111	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGATCGTAGACAGGCCGCT	0.547													12	205	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553716	140553716	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553716G>A	uc003lit.2	+	1	1474	c.1300G>A	c.(1300-1302)GAG>AAG	p.E434K		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	434	Extracellular (Potential).|Cadherin 4.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGAAAACCGAGCACAACAT	0.537													40	105	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140605331	140605331	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140605331G>A	uc003ljb.2	+	1	2254	c.2254G>A	c.(2254-2256)GAG>AAG	p.E752K	PCDHB14_uc011dal.1_Missense_Mutation_p.E599K	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	752	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTACCAATACGAGGTGTGTCT	0.572													42	154	---	---	---	---	PASS
PCDHGA7	56108	broad.mit.edu	37	5	140763130	140763130	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140763130C>T	uc003lka.1	+	1	664	c.664C>T	c.(664-666)CGA>TGA	p.R222*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003ljz.1_Nonsense_Mutation_p.R222*	NM_018920	NP_061743	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7 isoform 1	222	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACCCGCCCCGATCCAGCAC	0.607													7	15	---	---	---	---	PASS
PCDHGA9	56107	broad.mit.edu	37	5	140783493	140783493	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140783493G>A	uc003lkh.1	+	1	974	c.974G>A	c.(973-975)GGG>GAG	p.G325E	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.G325E	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	325	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGATGGTGGGGGATTGAAA	0.378													41	131	---	---	---	---	PASS
PCDHGC5	56097	broad.mit.edu	37	5	140870089	140870089	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140870089G>A	uc003lla.1	+	1	1282	c.1282G>A	c.(1282-1284)GAT>AAT	p.D428N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc003lky.1_Intron|PCDHGC5_uc011dbc.1_Missense_Mutation_p.D428N	NM_018929	NP_061752	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5 isoform 1	428	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGCCAGCGATGCTGGTTC	0.512													76	244	---	---	---	---	PASS
FGF1	2246	broad.mit.edu	37	5	141974804	141974804	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141974804G>A	uc003lmm.2	-	4					FGF1_uc011dbi.1_3'UTR|FGF1_uc003lmn.3_3'UTR|FGF1_uc003lmp.3_3'UTR|FGF1_uc003lmq.2_3'UTR|FGF1_uc010jgj.2_3'UTR|FGF1_uc003lmr.2_3'UTR|FGF1_uc003lms.3_3'UTR	NM_001144892	NP_001138364	P05230	FGF1_HUMAN	fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)	TCAACCAGGTGAGGACCCCTC	0.498													9	29	---	---	---	---	PASS
GLRA1	2741	broad.mit.edu	37	5	151231107	151231107	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151231107C>G	uc003lut.2	-	7	1043	c.756G>C	c.(754-756)CTG>CTC	p.L252L	GLRA1_uc003lur.2_Silent_p.L252L|GLRA1_uc003lus.2_Silent_p.L169L	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor	252	Helical; (Probable).				muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ACATCTGAATCAGGTAGTAAC	0.468													20	88	---	---	---	---	PASS
MRPL22	29093	broad.mit.edu	37	5	154330479	154330479	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154330479G>C	uc003lvy.3	+	3	214	c.176G>C	c.(175-177)GGA>GCA	p.G59A	MRPL22_uc003lvz.3_Intron	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22 isoform a	59					translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAACTGCCTGGAGAACCTCGG	0.373													26	73	---	---	---	---	PASS
C5orf40	408263	broad.mit.edu	37	5	156770349	156770349	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156770349G>C	uc003lwu.2	-	2	384	c.196C>G	c.(196-198)CTT>GTT	p.L66V	CYFIP2_uc003lwq.2_Intron|CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001001343	NP_001001343	Q8TBE3	FNDC9_HUMAN	hypothetical protein LOC408263	66	Fibronectin type-III.					integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAAGGGGCAAGATGTTCCAGC	0.547													24	92	---	---	---	---	PASS
C5orf54	63920	broad.mit.edu	37	5	159822236	159822236	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159822236C>T	uc003lye.1	-	2	726	c.262G>A	c.(262-264)GAG>AAG	p.E88K	C5orf54_uc003lyf.1_Missense_Mutation_p.E88K	NM_022090	NP_071373	Q8IZ13	CE054_HUMAN	transposon-derived Buster3 transposase-like	88										pancreas(1)	1						aaagtatcctcatgagatgca	0.000													47	133	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167553912	167553912	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167553912G>A	uc010jjd.2	+	12	2363	c.2363G>A	c.(2362-2364)CGA>CAA	p.R788Q	ODZ2_uc003lzr.3_Missense_Mutation_p.R556Q|ODZ2_uc003lzt.3_Missense_Mutation_p.R152Q|ODZ2_uc010jje.2_Missense_Mutation_p.R59Q|uc003lzs.1_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TGTGAATGCCGAGAGGGCTGG	0.532													4	11	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168199850	168199850	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168199850G>T	uc003mab.2	-	14	1815	c.1395C>A	c.(1393-1395)AGC>AGA	p.S465R	SLIT3_uc010jjg.2_Missense_Mutation_p.S465R|SLIT3_uc010jji.2_Missense_Mutation_p.S465R|SLIT3_uc003mac.1_Missense_Mutation_p.S262R	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	465	LRRCT 2.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCGCGGGCTGCTGCAGCGGG	0.612													3	32	---	---	---	---	PASS
RPL26L1	51121	broad.mit.edu	37	5	172386933	172386933	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172386933C>T	uc003mcc.2	+	2	99	c.57C>T	c.(55-57)TTC>TTT	p.F19F	LOC100268168_uc011dfb.1_5'Flank|LOC100268168_uc011dfc.1_5'Flank	NM_016093	NP_057177	Q9UNX3	RL26L_HUMAN	ribosomal protein L26-like 1	19					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	structural constituent of ribosome				0	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AACGTCACTTCAATGCCCCCT	0.567													52	216	---	---	---	---	PASS
ZNF354C	30832	broad.mit.edu	37	5	178506267	178506267	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178506267G>T	uc003mju.2	+	5	949	c.834G>T	c.(832-834)GAG>GAT	p.E278D		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	278	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		ATGAATGTGAGAAGGCATTTA	0.403													38	96	---	---	---	---	PASS
CDYL	9425	broad.mit.edu	37	6	4943860	4943860	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4943860C>G	uc003mwi.2	+	7	1495	c.1364C>G	c.(1363-1365)TCT>TGT	p.S455C	CDYL_uc003mwj.2_Missense_Mutation_p.S401C|CDYL_uc003mwk.2_Missense_Mutation_p.S166C|CDYL_uc011dhx.1_Missense_Mutation_p.S269C|CDYL_uc011dhy.1_Missense_Mutation_p.S269C	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform	455					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CTAGGAGCATCTATATTGCCT	0.413													35	136	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7231404	7231404	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7231404C>T	uc003mxc.2	+	10	3462	c.3072C>T	c.(3070-3072)GTC>GTT	p.V1024V	RREB1_uc003mxb.2_Silent_p.V1024V|RREB1_uc010jnx.2_Silent_p.V1024V	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	1024	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CAGCCCTGGTCAGCAGCCCTC	0.706													24	64	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29641179	29641179	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29641179C>T	uc011dlw.1	-	4	860	c.709G>A	c.(709-711)GAC>AAC	p.D237N	ZFP57_uc003nnl.3_Missense_Mutation_p.D217N	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	153	C2H2-type 3.				DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						TAGGTCTTGTCACAGAGCGTG	0.572													28	95	---	---	---	---	PASS
RNF39	80352	broad.mit.edu	37	6	30043478	30043478	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30043478G>A	uc003npe.2	-	1	151	c.89C>T	c.(88-90)GCG>GTG	p.A30V	RNF39_uc003npd.2_Missense_Mutation_p.A30V	NM_025236	NP_079512	Q9H2S5	RNF39_HUMAN	ring finger protein 39 isoform 1	30						cytoplasm	zinc ion binding				0						TCCGACTCCCGCATTAACTTT	0.607													28	79	---	---	---	---	PASS
TRIM15	89870	broad.mit.edu	37	6	30139765	30139765	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30139765C>G	uc010jrx.2	+	7	1516	c.1037C>G	c.(1036-1038)TCC>TGC	p.S346C		NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15	346	B30.2/SPRY.				mesodermal cell fate determination	intracellular	zinc ion binding				0						GGCTTCTCCTCCGGGCGCCAC	0.706													2	5	---	---	---	---	PASS
IER3	8870	broad.mit.edu	37	6	30711642	30711642	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30711642C>G	uc003nrn.2	-	2					FLOT1_uc003nrm.2_5'Flank|FLOT1_uc011dmr.1_5'Flank	NM_003897	NP_003888	P46695	IEX1_HUMAN	immediate early response 3						anatomical structure morphogenesis|anti-apoptosis|apoptosis	integral to membrane	protein binding				0						GATACGCTCTCGCGCACCAGG	0.587													10	28	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30954371	30954371	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30954371C>G	uc003nsh.2	+	2	670	c.419C>G	c.(418-420)TCC>TGC	p.S140C	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	140	28 X 15 AA approximate tandem repeats.|Ser-rich.|8.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						AACTCTGACTCCAGCACAACC	0.607													52	222	---	---	---	---	PASS
BAT3	7917	broad.mit.edu	37	6	31609349	31609349	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31609349G>A	uc003nvg.3	-	17	2750	c.2436C>T	c.(2434-2436)ATC>ATT	p.I812I	BAT3_uc003nvf.3_Silent_p.I806I|BAT3_uc003nvh.3_Silent_p.I806I|BAT3_uc003nvi.3_Silent_p.I806I|BAT3_uc011dnw.1_Silent_p.I806I|BAT3_uc011dnx.1_Silent_p.I680I	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a	812					apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0						CTAGCCCCGTGATCAATGTGT	0.537													62	112	---	---	---	---	PASS
MSH5	4439	broad.mit.edu	37	6	31710892	31710892	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31710892G>A	uc003nwv.1	+	5	439	c.360G>A	c.(358-360)CAG>CAA	p.Q120Q	MSH5_uc003nwt.1_Silent_p.Q120Q|MSH5_uc003nwu.1_Silent_p.Q120Q|MSH5_uc003nww.1_Silent_p.Q120Q|MSH5_uc003nwx.1_Silent_p.Q120Q|MSH5_uc011dof.1_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	120					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3						CAGCCTCCCAGGAGCACAGAG	0.488								Direct_reversal_of_damage|MMR					82	103	---	---	---	---	PASS
C2	717	broad.mit.edu	37	6	31913003	31913003	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31913003G>A	uc003nyf.2	+	18	2392	c.2128G>A	c.(2128-2130)GAC>AAC	p.D710N	C2_uc011doo.1_Missense_Mutation_p.D464N|C2_uc011dop.1_Missense_Mutation_p.D496N|C2_uc010jtk.2_Missense_Mutation_p.D578N|C2_uc011doq.1_Missense_Mutation_p.D681N|C2_uc003nyg.2_Missense_Mutation_p.D487N|CFB_uc011dor.1_Intron|C2_uc003nyh.1_Silent_p.*344*|CFB_uc011dos.1_5'Flank|CFB_uc003nyi.2_5'Flank|CFB_uc003nyj.3_5'Flank	NM_000063	NP_000054	P06681	CO2_HUMAN	complement component 2 isoform 1 preproprotein	710	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular space	serine-type endopeptidase activity			ovary(1)|skin(1)	2		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		TGGCTCTGCTGACAAAAACTC	0.592													32	103	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33660624	33660624	+	Silent	SNP	G	A	A	rs149058562		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33660624G>A	uc011drk.1	+	55	7797	c.7578G>A	c.(7576-7578)GAG>GAA	p.E2526E	ITPR3_uc003oey.2_Silent_p.E613E	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	2526	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						TGCGTAGTGAGAAGCAGAAGA	0.522													41	64	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33661456	33661456	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33661456G>C	uc011drk.1	+	56	7978	c.7759G>C	c.(7759-7761)GAG>CAG	p.E2587Q	ITPR3_uc003oey.2_Missense_Mutation_p.E674Q	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3	2587	Cytoplasmic (Potential).				activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						CACGGGCCCTGAGAGCTACGT	0.552													18	25	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33662904	33662904	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33662904C>T	uc011drk.1	+						C6orf125_uc003oez.1_RNA	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3						activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						TGGGTTCTATCCCTGGGCAGT	0.637													16	12	---	---	---	---	PASS
ITPR3	3710	broad.mit.edu	37	6	33663418	33663418	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33663418C>G	uc011drk.1	+						C6orf125_uc003oez.1_RNA	NM_002224	NP_002215	Q14573	ITPR3_HUMAN	inositol 1,4,5-triphosphate receptor, type 3						activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19						GTGCCAAGCTCTTCCACAGCA	0.642													68	46	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36298201	36298201	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36298201C>G	uc003oly.2	-	2	445	c.267G>C	c.(265-267)CAG>CAC	p.Q89H		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	89										skin(2)|ovary(1)|breast(1)	4						GCGAAGGCCTCTGCTCGCTGG	0.617													34	121	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36930731	36930731	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36930731G>A	uc003ona.2	+	5	941	c.613G>A	c.(613-615)GAT>AAT	p.D205N	PI16_uc003omz.1_Missense_Mutation_p.D205N|PI16_uc003onb.2_Missense_Mutation_p.D205N|PI16_uc011dts.1_5'UTR	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	205	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						AAGCCCGGAAGATGCTCAGGA	0.542													25	55	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37620068	37620068	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37620068C>T	uc003onu.1	-	7	2210	c.1031G>A	c.(1030-1032)AGT>AAT	p.S344N	MDGA1_uc003onw.3_RNA	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	344	Ig-like 4.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						GATGTTCTCACTCTCTTTGAT	0.567													15	37	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38834581	38834581	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38834581C>G	uc003ooe.1	+	45	6571	c.5971C>G	c.(5971-5973)CTT>GTT	p.L1991V		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CTGTGGTTTTCTTGAAAATGT	0.308													7	62	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38881670	38881670	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38881670C>T	uc003ooe.1	+	65	9854	c.9254C>T	c.(9253-9255)TCT>TTT	p.S3085F	uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GCTAAACTCTCTCAGGATCTT	0.368													20	53	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38957823	38957823	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38957823C>T	uc003ooe.1	+	86	13038	c.12438C>T	c.(12436-12438)TTC>TTT	p.F4146F		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AACCGTCATTCTGCTTTTATA	0.363													37	149	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43114421	43114421	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43114421C>T	uc003oub.1	+	17	2904	c.2706C>T	c.(2704-2706)CTC>CTT	p.L902L	PTK7_uc003ouc.1_Silent_p.L846L|PTK7_uc003oud.1_Silent_p.L862L|PTK7_uc003oue.1_Silent_p.L772L|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.L910L|PTK7_uc010jyj.1_Silent_p.L228L	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	902	Cytoplasmic (Potential).|Protein kinase; inactive.|Interaction with CTNNB1.				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			CACAGCCCCTCAGCACCAAGC	0.488													14	71	---	---	---	---	PASS
SPATS1	221409	broad.mit.edu	37	6	44310891	44310891	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44310891C>G	uc003oxk.2	+	1	406	c.59C>G	c.(58-60)TCA>TGA	p.S20*	SPATS1_uc003oxg.2_Intron|SPATS1_uc010jzb.2_5'UTR	NM_145026	NP_659463	Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	20										skin(1)	1	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCCTCCATCTCAAGCACGACC	0.512													16	72	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51929769	51929769	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51929769G>A	uc003pah.1	-	13	1236	c.960C>T	c.(958-960)CTC>CTT	p.L320L	PKHD1_uc003pai.2_Silent_p.L320L	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	320	IPT/TIG 3.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GAGGGGTGGTGAGCCTCACAT	0.448													27	112	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72957721	72957721	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72957721C>T	uc003pga.2	+	12	2209	c.2132C>T	c.(2131-2133)TCA>TTA	p.S711L	RIMS1_uc011dyb.1_Missense_Mutation_p.S337L|RIMS1_uc003pgc.2_Missense_Mutation_p.S337L|RIMS1_uc010kaq.2_Missense_Mutation_p.S185L|RIMS1_uc011dyc.1_Missense_Mutation_p.S185L|RIMS1_uc010kar.2_Missense_Mutation_p.S104L|RIMS1_uc011dyd.1_Missense_Mutation_p.S170L|RIMS1_uc003pgf.2_5'Flank|RIMS1_uc003pgg.2_5'Flank|RIMS1_uc003pgi.2_5'Flank|RIMS1_uc003pgh.2_5'Flank|RIMS1_uc003pgd.2_5'Flank|RIMS1_uc003pge.2_5'Flank|RIMS1_uc003pgb.3_Missense_Mutation_p.S337L|RIMS1_uc010kas.1_Missense_Mutation_p.S170L	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	711					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ATTTTAGGTTCAAGTTCCTTT	0.318													23	93	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73900420	73900420	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73900420C>G	uc003pgk.2	+	12	2049	c.1702C>G	c.(1702-1704)CAA>GAA	p.Q568E	KCNQ5_uc011dyh.1_Missense_Mutation_p.Q587E|KCNQ5_uc011dyi.1_Missense_Mutation_p.Q578E|KCNQ5_uc010kat.2_Missense_Mutation_p.Q559E|KCNQ5_uc011dyj.1_Missense_Mutation_p.Q458E|KCNQ5_uc011dyk.1_Missense_Mutation_p.Q318E	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	568					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		TAAAAGCCTTCAAACACGGTA	0.373													23	82	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74533302	74533302	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74533302C>T	uc003php.2	+	33	4708	c.4283C>T	c.(4282-4284)TCA>TTA	p.S1428L	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.S1411L|CD109_uc010kba.2_Missense_Mutation_p.S1351L	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	1428						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						CATCACTCTTCAGTCATTTTT	0.428													31	123	---	---	---	---	PASS
UBE2CBP	90025	broad.mit.edu	37	6	83728625	83728625	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83728625C>T	uc003pjp.2	-						UBE2CBP_uc011dyx.1_Intron|UBE2CBP_uc003pjq.2_3'UTR	NM_198920	NP_944602	Q7Z6J8	UB2CB_HUMAN	ubiquitin-conjugating enzyme E2C binding							cytoplasm	ligase activity			ovary(1)	1		all_cancers(76;0.000374)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0548)		BRCA - Breast invasive adenocarcinoma(397;0.0944)		TCATTAATTTCTTAACACCAA	0.318													15	35	---	---	---	---	PASS
CNR1	1268	broad.mit.edu	37	6	88854856	88854856	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854856C>G	uc011dzq.1	-	2	3701	c.138G>C	c.(136-138)CAG>CAC	p.Q46H	CNR1_uc010kbz.2_Missense_Mutation_p.Q46H|CNR1_uc011dzr.1_Missense_Mutation_p.Q46H|CNR1_uc011dzs.1_Missense_Mutation_p.Q46H|CNR1_uc003pmq.3_Missense_Mutation_p.Q46H|CNR1_uc011dzt.1_Missense_Mutation_p.Q46H|CNR1_uc010kca.2_Intron	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	46	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	AAGGGAATTTCTGTGGGAAGT	0.498													37	94	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90576217	90576217	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90576217G>C	uc003pnr.2	+	8	3404	c.3208G>C	c.(3208-3210)GAG>CAG	p.E1070Q	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.E1070Q|CASP8AP2_uc011dzz.1_Missense_Mutation_p.E1070Q	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1070					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CAGAATTATTGAGTCAGCAAT	0.274													2	5	---	---	---	---	PASS
FRK	2444	broad.mit.edu	37	6	116264315	116264315	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116264315C>T	uc003pwi.1	-	7	1621	c.1174G>A	c.(1174-1176)GAA>AAA	p.E392K		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	392	Protein kinase.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		AGCTTTATTTCGTGTCTAGAT	0.378													18	52	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117718277	117718277	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117718277G>A	uc003pxp.1	-	7	779	c.580C>T	c.(580-582)CCT>TCT	p.P194S	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	194	Fibronectin type-III 2.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GCAGTTTCAGGAACTGGAAGA	0.388			T	GOPC|ROS1	glioblastoma|NSCLC								22	86	---	---	---	---	PASS
SMPDL3A	10924	broad.mit.edu	37	6	123127407	123127407	+	Missense_Mutation	SNP	C	G	G	rs143627205		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123127407C>G	uc003pzg.2	+	7	1470	c.949C>G	c.(949-951)CCT>GCT	p.P317A	SMPDL3A_uc003pzh.2_Missense_Mutation_p.P186A	NM_006714	NP_006705	Q92484	ASM3A_HUMAN	acid sphingomyelinase-like phosphodiesterase 3A	317					sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity				0				GBM - Glioblastoma multiforme(226;0.236)		GTTTGTGGCTCCTGCTGTTAC	0.313													12	42	---	---	---	---	PASS
TRMT11	60487	broad.mit.edu	37	6	126320719	126320719	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126320719G>A	uc003qam.2	+	7	760	c.639G>A	c.(637-639)GTG>GTA	p.V213V	TRMT11_uc003qan.2_RNA|TRMT11_uc010kev.2_Silent_p.V213V	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11	213					tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		ATGGAAAAGTGAAAGAAAATG	0.313													26	81	---	---	---	---	PASS
RPS12	6206	broad.mit.edu	37	6	133138091	133138091	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133138091C>G	uc003qdx.2	+						RPS12_uc003qdy.1_3'UTR	NM_001016	NP_001007	P25398	RS12_HUMAN	ribosomal protein S12						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	structural constituent of ribosome				0	Breast(56;0.214)			OV - Ovarian serous cystadenocarcinoma(155;0.00284)|GBM - Glioblastoma multiforme(226;0.0256)		TAACCTTTCTCCCAATAGGTT	0.378													27	104	---	---	---	---	PASS
TCF21	6943	broad.mit.edu	37	6	134210742	134210742	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134210742G>A	uc003qei.3	+	1	483	c.207G>A	c.(205-207)CTG>CTA	p.L69L	uc003qeg.1_5'Flank|TCF21_uc003qej.2_Silent_p.L69L	NM_003206	NP_003197	O43680	TCF21_HUMAN	transcription factor 21	69					branching involved in ureteric bud morphogenesis|mesoderm development|negative regulation of androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus	androgen receptor binding|E-box binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity				0	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		AGAGCCCCCTGAGCGGGGTCA	0.682													5	63	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152461256	152461256	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152461256C>G	uc010kiw.2	-	140	25889	c.25287G>C	c.(25285-25287)TTG>TTC	p.L8429F	SYNE1_uc010kiv.2_Missense_Mutation_p.L2953F|SYNE1_uc003qos.3_Missense_Mutation_p.L2953F|SYNE1_uc003qot.3_Missense_Mutation_p.L8381F|SYNE1_uc003qou.3_Missense_Mutation_p.L8429F|SYNE1_uc003qop.3_Missense_Mutation_p.L614F|SYNE1_uc011eez.1_Missense_Mutation_p.L631F|SYNE1_uc003qoq.3_Missense_Mutation_p.L631F|SYNE1_uc003qor.3_Missense_Mutation_p.L1352F	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8429	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTCCTTGCTCAATGCCTGGG	0.502										HNSCC(10;0.0054)			33	125	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158834155	158834155	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158834155G>A	uc003qrf.2	+	2	1668	c.311G>A	c.(310-312)GGA>GAA	p.G104E	TULP4_uc011efo.1_Missense_Mutation_p.G104E|TULP4_uc003qrg.2_Missense_Mutation_p.G104E	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	104	WD 1.				intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GATGCGGACGGAGGCATATTC	0.562													14	33	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166571975	166571975	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166571975G>C	uc003quu.1	-	9	1629	c.1136C>G	c.(1135-1137)TCC>TGC	p.S379C	T_uc003qut.1_Missense_Mutation_p.S380C|T_uc003quv.1_Missense_Mutation_p.S321C	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	379					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GTGCGCGGGGGAGCCCCGGAA	0.706									Chordoma_Familial_Clustering_of				13	55	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168344641	168344641	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168344641G>C	uc003qwd.2	+	25	3378	c.3236G>C	c.(3235-3237)AGA>ACA	p.R1079T	MLLT4_uc003qwb.1_Missense_Mutation_p.R1064T|MLLT4_uc003qwc.1_Missense_Mutation_p.R1080T|MLLT4_uc003qwg.1_Missense_Mutation_p.R389T	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1080	PDZ.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTCATGACAAGAACAAGCTCT	0.488			T	MLL	AL								27	66	---	---	---	---	PASS
TCTE3	6991	broad.mit.edu	37	6	170151276	170151276	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170151276C>T	uc003qxe.1	-						TCTE3_uc003qxf.2_RNA|C6orf70_uc003qxg.1_5'Flank|C6orf70_uc011ehb.1_5'Flank|C6orf70_uc003qxh.1_5'Flank|C6orf70_uc010kky.1_5'Flank	NM_174910	NP_777570	Q8IZS6	TC1D3_HUMAN	t-complex-associated-testis-expressed 3						transport	cytoplasm|dynein complex|membrane|microtubule	motor activity				0		Breast(66;0.000338)		OV - Ovarian serous cystadenocarcinoma(33;1.08e-21)|BRCA - Breast invasive adenocarcinoma(81;1.32e-07)|GBM - Glioblastoma multiforme(31;0.00157)		AACTCAGTCTCAGGCTTCAAT	0.512													14	48	---	---	---	---	PASS
FAM20C	56975	broad.mit.edu	37	7	195701	195701	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:195701C>A	uc003sip.2	+	2	984	c.753C>A	c.(751-753)CAC>CAA	p.H251Q		NM_020223	NP_064608	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	251						extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CCCTGCTGCACGACCTCAGCT	0.627													4	120	---	---	---	---	PASS
LFNG	3955	broad.mit.edu	37	7	2565989	2565989	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2565989C>G	uc003smf.2	+	6	950	c.933C>G	c.(931-933)TTC>TTG	p.F311L	LFNG_uc003smg.2_Missense_Mutation_p.F311L	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a	311	Lumenal (Potential).				organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		GCGGCCTCTTCCACTCCCACC	0.657													34	96	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2583099	2583099	+	Intron	SNP	C	T	T	rs77555101	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2583099C>T	uc003smi.2	-						C7orf27_uc003smh.3_5'Flank|C7orf27_uc003smj.1_3'UTR	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor						response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		AGGGTCACCCCGGTGCCGCTT	0.647													9	28	---	---	---	---	PASS
KIAA0415	9907	broad.mit.edu	37	7	4830468	4830468	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4830468G>C	uc003sne.2	+	16	2186	c.2103G>C	c.(2101-2103)CTG>CTC	p.L701L	KIAA0415_uc010ksp.2_RNA|KIAA0415_uc003snf.2_Silent_p.L178L	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	701					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)		TCACCGTGCTGATGACCACGC	0.647													2	12	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6180583	6180583	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6180583G>C	uc011jwo.1	+	7	886	c.763G>C	c.(763-765)GAT>CAT	p.D255H	USP42_uc011jwn.1_Missense_Mutation_p.D100H|USP42_uc010kth.1_Missense_Mutation_p.D188H|USP42_uc011jwp.1_Missense_Mutation_p.D255H|USP42_uc011jwq.1_Missense_Mutation_p.D62H|USP42_uc011jwr.1_Missense_Mutation_p.D100H	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	255					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AGATACTTTTGATCCATATCT	0.264													9	48	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7413118	7413118	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7413118C>G	uc003src.1	-	32	2536	c.2419G>C	c.(2419-2421)GAA>CAA	p.E807Q	COL28A1_uc011jxe.1_Missense_Mutation_p.E490Q	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	807	VWFA 2.				cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		CCCACGCTTTCTGAGCTGTCG	0.463													41	134	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30876370	30876370	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30876370C>T	uc003tbt.2	+	7	1306	c.1229C>T	c.(1228-1230)TCA>TTA	p.S410L	FAM188B_uc010kwe.2_Missense_Mutation_p.S381L	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	410											0						ATTGACCTCTCAGTAGCAAAG	0.463													29	128	---	---	---	---	PASS
POLD2	5425	broad.mit.edu	37	7	44157622	44157622	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44157622C>T	uc010kxz.2	-	4	912	c.262G>A	c.(262-264)GAG>AAG	p.E88K	POLD2_uc003tke.3_Missense_Mutation_p.E88K|POLD2_uc010kya.2_Missense_Mutation_p.E88K|POLD2_uc003tkf.3_Missense_Mutation_p.E88K	NM_006230	NP_006221	P49005	DPOD2_HUMAN	DNA-directed DNA polymerase delta 2	88					base-excision repair|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	DNA binding|DNA-directed DNA polymerase activity|protein binding			ovary(2)	2						CACTTCTCCTCAGGCTGCAGT	0.622													25	93	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44747299	44747299	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44747299G>C	uc003tln.2	+	22	3024	c.2915G>C	c.(2914-2916)AGA>ACA	p.R972T	OGDH_uc011kbx.1_Missense_Mutation_p.R968T|OGDH_uc011kby.1_Missense_Mutation_p.R822T|OGDH_uc003tlp.2_Missense_Mutation_p.R983T|OGDH_uc011kbz.1_Missense_Mutation_p.R767T	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	972					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	GTGAAGCCAAGACTTCGGACC	0.602													23	90	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55220190	55220190	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55220190G>A	uc003tqk.2	+						EGFR_uc003tqh.2_Intron|EGFR_uc003tqi.2_Intron|EGFR_uc003tqj.2_Intron|EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Intron|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CCTGGGAAATGATCCTACCCT	0.483		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			89	327	---	---	---	---	PASS
ZNF727	442319	broad.mit.edu	37	7	63538522	63538522	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63538522G>C	uc011kdm.1	+	4	1274	c.1095G>C	c.(1093-1095)TTG>TTC	p.L365F		NM_001159522	NP_001152994	A8MUV8	ZN727_HUMAN	zinc finger protein 727	365					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATATGGAATTGAGACCTTACA	0.393													7	18	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73795236	73795236	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73795236G>A	uc003uam.2	+						CLIP2_uc003uan.2_Intron|CLIP2_uc003uao.2_Missense_Mutation_p.R235K	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2							microtubule associated complex				skin(3)	3						GCTCTGGGAAGAGGCTGGCTG	0.547													42	114	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77885556	77885556	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77885556G>A	uc003ugx.2	-	10	2005	c.1751C>T	c.(1750-1752)CCG>CTG	p.P584L	MAGI2_uc003ugy.2_Missense_Mutation_p.P584L|MAGI2_uc010ldx.1_Missense_Mutation_p.P193L|MAGI2_uc010ldy.1_Missense_Mutation_p.P193L|MAGI2_uc011kgr.1_Missense_Mutation_p.P416L|MAGI2_uc011kgs.1_Missense_Mutation_p.P421L	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	584						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATGGACGGGCGGTGGATACGT	0.527													7	53	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82585375	82585375	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82585375C>T	uc003uhx.2	-	5	5183	c.4894G>A	c.(4894-4896)GAA>AAA	p.E1632K	PCLO_uc003uhv.2_Missense_Mutation_p.E1632K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1563					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCATCGTCTTCATCATGCCAT	0.428													25	396	---	---	---	---	PASS
PEX1	5189	broad.mit.edu	37	7	92116642	92116642	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92116642C>T	uc003uly.2	-	24					PEX1_uc011khr.1_3'UTR|PEX1_uc010ley.2_3'UTR|PEX1_uc011khs.1_3'UTR	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			ATTTACCAATCTGTGATTTTA	0.249													7	9	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94919406	94919406	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94919406C>G	uc003unp.2	+	16	3370	c.3088C>G	c.(3088-3090)CTT>GTT	p.L1030V	PPP1R9A_uc010lfj.2_Missense_Mutation_p.L1306V|PPP1R9A_uc011kif.1_Missense_Mutation_p.L1228V|PPP1R9A_uc003unq.2_Missense_Mutation_p.L1185V|PPP1R9A_uc011kig.1_Missense_Mutation_p.L1022V|PPP1R9A_uc003unr.2_Missense_Mutation_p.L319V	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	1030	Interacts with TGN38 (By similarity).|SAM.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TTCTTAGGCTCTTGGAATGAC	0.413										HNSCC(28;0.073)			10	41	---	---	---	---	PASS
TAC1	6863	broad.mit.edu	37	7	97362036	97362036	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97362036G>T	uc003uop.3	+	2	358	c.112G>T	c.(112-114)GAC>TAC	p.D38Y	TAC1_uc003uoq.3_Missense_Mutation_p.D38Y|TAC1_uc003uor.3_Missense_Mutation_p.D38Y|TAC1_uc003uos.3_Missense_Mutation_p.D38Y	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	38					detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)	GTACGACAGCGACCAGATCAA	0.557													24	69	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170257	99170257	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170257G>A	uc003urh.2	+	3	919	c.526G>A	c.(526-528)GAA>AAA	p.E176K	ZNF655_uc010lga.2_Missense_Mutation_p.E211K|ZNF655_uc010lgc.2_Missense_Mutation_p.E211K|ZNF655_uc003urj.2_Missense_Mutation_p.E176K|ZNF655_uc003urk.2_Missense_Mutation_p.E13K|ZNF655_uc010lgd.2_Missense_Mutation_p.E13K	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	176					G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					TGGTAAACATGAACACTTAAA	0.378													9	57	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170385	99170385	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170385G>A	uc003urh.2	+	3	1047	c.654G>A	c.(652-654)GGG>GGA	p.G218G	ZNF655_uc010lga.2_Silent_p.G253G|ZNF655_uc010lgc.2_Silent_p.G253G|ZNF655_uc003urj.2_Silent_p.G218G|ZNF655_uc003urk.2_Silent_p.G55G|ZNF655_uc010lgd.2_Silent_p.G55G	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	218	C2H2-type 1.				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATGTATGTGGGAAAATTTTCC	0.388													16	46	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170442	99170442	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170442G>A	uc003urh.2	+	3	1104	c.711G>A	c.(709-711)GAG>GAA	p.E237E	ZNF655_uc010lga.2_Silent_p.E272E|ZNF655_uc010lgc.2_Silent_p.E272E|ZNF655_uc003urj.2_Silent_p.E237E|ZNF655_uc003urk.2_Silent_p.E74E|ZNF655_uc010lgd.2_Silent_p.E74E	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	237					G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					ATACTAGAGAGAAGCCCTACA	0.378													9	52	---	---	---	---	PASS
ZNF655	79027	broad.mit.edu	37	7	99170930	99170930	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99170930G>C	uc003urh.2	+	3	1592	c.1199G>C	c.(1198-1200)AGA>ACA	p.R400T	ZNF655_uc010lga.2_Missense_Mutation_p.R435T|ZNF655_uc010lgc.2_Missense_Mutation_p.R435T|ZNF655_uc003urj.2_Missense_Mutation_p.R400T|ZNF655_uc003urk.2_Missense_Mutation_p.R237T|ZNF655_uc010lgd.2_Missense_Mutation_p.R237T	NM_138494	NP_612503	Q8N720	ZN655_HUMAN	zinc finger protein 655 isoform a	400	C2H2-type 5.				G1 phase|regulation of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CAGCATCAAAGAATTCACACA	0.353													23	72	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100695124	100695124	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100695124C>T	uc003uxp.1	+	9	13037	c.12984C>T	c.(12982-12984)TTC>TTT	p.F4328F	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4328	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAGACTACTTCGTAGTGGAGT	0.587													41	116	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101845024	101845024	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101845024G>A	uc003uyx.3	+	18	2485	c.2447G>A	c.(2446-2448)CGC>CAC	p.R816H	CUX1_uc003uys.3_Missense_Mutation_p.R827H|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	816					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						GAGGTGGGCCGCAGCGGTGCC	0.672													11	18	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102940661	102940661	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102940661G>C	uc003vbl.2	+	4	398	c.364G>C	c.(364-366)GAG>CAG	p.E122Q	PMPCB_uc010liu.1_Missense_Mutation_p.E122Q|PMPCB_uc003vbk.1_Missense_Mutation_p.E122Q|PMPCB_uc003vbm.2_Missense_Mutation_p.E31Q|PMPCB_uc010liv.2_Missense_Mutation_p.E28Q|PMPCB_uc010liw.2_Missense_Mutation_p.E31Q|PMPCB_uc011kll.1_Missense_Mutation_p.E17Q|PMPCB_uc011klm.1_5'UTR	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit	122					proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						TCTGGAACTTGAGATTGAAAA	0.388													31	157	---	---	---	---	PASS
BCAP29	55973	broad.mit.edu	37	7	107253828	107253828	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107253828G>C	uc003vej.2	+	7	980	c.641G>C	c.(640-642)AGA>ACA	p.R214T	BCAP29_uc011kly.1_Missense_Mutation_p.R120T|BCAP29_uc011klz.1_Missense_Mutation_p.R214T|BCAP29_uc011kma.1_Missense_Mutation_p.R214T	NM_018844	NP_061332	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein BAP29 isoform	214	Cytoplasmic (Potential).				apoptosis|intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane				large_intestine(1)|ovary(1)	2						CAGTCAGAGAGACTTTCGAAA	0.313													11	41	---	---	---	---	PASS
IFRD1	3475	broad.mit.edu	37	7	112096062	112096062	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112096062G>A	uc003vgh.2	+	4	648	c.205G>A	c.(205-207)GAA>AAA	p.E69K	IFRD1_uc011kmn.1_Missense_Mutation_p.E19K|IFRD1_uc003vgi.2_Missense_Mutation_p.E69K|IFRD1_uc003vgj.2_Missense_Mutation_p.E69K|IFRD1_uc011kmo.1_RNA|IFRD1_uc011kmp.1_Missense_Mutation_p.E19K	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	69					multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						CTTAGGACCAGAAGTCCTTGA	0.368													9	53	---	---	---	---	PASS
WASL	8976	broad.mit.edu	37	7	123332847	123332847	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123332847G>C	uc003vkz.2	-	9	1229	c.901C>G	c.(901-903)CCT>GCT	p.P301A		NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein	301	Pro-rich.				actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						gcaggaggaggaggaggacct	0.428													32	89	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127714730	127714730	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127714730G>A	uc003vmi.2	+	17	2182	c.1956G>A	c.(1954-1956)CAG>CAA	p.Q652Q	SND1_uc010lle.2_Silent_p.Q305Q	NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	652	TNase-like 4.				gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						CCGCAAAGCAGAAGAAAGAGA	0.602													4	23	---	---	---	---	PASS
CHCHD3	54927	broad.mit.edu	37	7	132754904	132754904	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132754904G>C	uc003vre.2	-	2	303	c.167C>G	c.(166-168)TCA>TGA	p.S56*	CHCHD3_uc010lmi.2_RNA|CHCHD3_uc003vrf.2_Nonsense_Mutation_p.S56*|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Nonsense_Mutation_p.S56*	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain	56					inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						AGCAATACCTGAGGCACCATA	0.378													11	49	---	---	---	---	PASS
PTN	5764	broad.mit.edu	37	7	136936106	136936106	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136936106C>T	uc003vtq.2	-	4	685	c.322G>A	c.(322-324)GAA>AAA	p.E108K	PTN_uc010lmx.2_Missense_Mutation_p.E108K|PTN_uc003vtr.1_Missense_Mutation_p.E108K	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin	108					nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2						AGGTCACATTCTCCCCAGGCC	0.507													57	211	---	---	---	---	PASS
ARHGEF35	445328	broad.mit.edu	37	7	143883993	143883993	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143883993G>C	uc003wdz.1	-	2						NM_001003702	NP_001003702	A5YM69	ARG35_HUMAN	Rho guanine nucleotide exchange factor (GEF)												0						aaaatacattgaactggataa	0.149													3	20	---	---	---	---	PASS
ZNF467	168544	broad.mit.edu	37	7	149463159	149463159	+	Silent	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149463159C>A	uc003wgd.2	-	5	573	c.432G>T	c.(430-432)CTG>CTT	p.L144L	ZNF467_uc003wgc.2_Intron	NM_207336	NP_997219	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	144					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGAGCCCACTCAGTGCCCCCG	0.692													8	9	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149505350	149505350	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149505350T>C	uc010lpk.2	+	62	8908	c.8908T>C	c.(8908-8910)TGT>CGT	p.C2970R		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2970					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGCAGCACCTGTGTCTCTGG	0.607													4	242	---	---	---	---	PASS
ABCB8	11194	broad.mit.edu	37	7	150732853	150732853	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150732853C>G	uc003wil.3	+						ABCB8_uc003wii.2_Intron|ABCB8_uc003wij.3_Intron|ABCB8_uc010lpw.1_Silent_p.L136L|ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Intron	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8							ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGCCATCCTCTTCACCCTCC	0.592													17	85	---	---	---	---	PASS
PAXIP1	22976	broad.mit.edu	37	7	154738261	154738261	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154738261C>T	uc003wlp.2	-	19	3137	c.3094G>A	c.(3094-3096)GAC>AAC	p.D1032N	LOC100132707_uc011kvr.1_Intron|LOC100132707_uc003wlo.2_Intron|PAXIP1_uc003wlq.1_Missense_Mutation_p.D998N|PAXIP1_uc011kvs.1_Missense_Mutation_p.D996N	NM_007349	NP_031375	Q6ZW49	PAXI1_HUMAN	PAX interacting protein 1	1032	Interaction with TP53BP1.|BRCT 6.				DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix				lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		AAATGAAGGTCATTTTCACAG	0.423													6	40	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10466192	10466192	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10466192G>C	uc003wtc.2	-	4	5645	c.5416C>G	c.(5416-5418)CAA>GAA	p.Q1806E		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1806					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCAGAGCCTTGACCCCCAGTT	0.587													80	308	---	---	---	---	PASS
BIN3	55909	broad.mit.edu	37	8	22487503	22487503	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22487503C>T	uc003xcl.2	-	6	409	c.312G>A	c.(310-312)CAG>CAA	p.Q104Q	BIN3_uc003xck.2_Silent_p.Q56Q|BIN3_uc010ltw.2_Silent_p.Q50Q	NM_018688	NP_061158	Q9NQY0	BIN3_HUMAN	bridging integrator 3	104	BAR.				actin filament organization|barrier septum formation|cell cycle|protein localization|unidimensional cell growth	cytoplasm|cytoskeleton	cytoskeletal adaptor activity				0		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		TCACAGTCTTCTGGATCTGGT	0.537													4	19	---	---	---	---	PASS
ZNF395	55893	broad.mit.edu	37	8	28206244	28206244	+	Missense_Mutation	SNP	G	C	C	rs12545851		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28206244G>C	uc003xgq.2	-	10	1622	c.1534C>G	c.(1534-1536)CTG>GTG	p.L512V	ZNF395_uc003xgt.2_Missense_Mutation_p.L512V|ZNF395_uc003xgr.2_Missense_Mutation_p.L512V|ZNF395_uc003xgs.2_Missense_Mutation_p.L512V	NM_018660	NP_061130	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	512					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding				0		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GCTCAGTCCAGAAAGCGCTGG	0.622													14	60	---	---	---	---	PASS
EXTL3	2137	broad.mit.edu	37	8	28574875	28574875	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28574875C>G	uc003xgz.1	+	3	1892	c.1299C>G	c.(1297-1299)ATC>ATG	p.I433M		NM_001440	NP_001431	O43909	EXTL3_HUMAN	exostoses-like 3	433	Lumenal (Potential).					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding			skin(2)	2		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TCGCCCTCATCATTACCCCCG	0.622													32	84	---	---	---	---	PASS
IDO2	169355	broad.mit.edu	37	8	39806667	39806667	+	Splice_Site	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39806667G>C	uc010lwy.1	+	2	265	c.23_splice	c.e2-1	p.D8_splice	IDO2_uc003xno.1_Splice_Site	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1						tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2						TTTCCATGCAGATACTTCAAA	0.428													4	16	---	---	---	---	PASS
CHRNB3	1142	broad.mit.edu	37	8	42585842	42585842	+	Missense_Mutation	SNP	G	A	A	rs75170626		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42585842G>A	uc003xpi.1	+	4	483	c.355G>A	c.(355-357)GAA>AAA	p.E119K		NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta	119	Extracellular (Potential).				synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			AGTTCTCTTTGAAAAGTAAGT	0.284													14	58	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43211963	43211963	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43211963C>G	uc003xpz.1	+	12	1465	c.1422C>G	c.(1420-1422)CTC>CTG	p.L474L	POTEA_uc003xqa.1_Silent_p.L428L	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	474	Potential.									ovary(1)	1						TACTAGAACTCAAAAATAGCC	0.353													13	63	---	---	---	---	PASS
KIAA0146	23514	broad.mit.edu	37	8	48641538	48641538	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48641538C>T	uc003xqd.2	+	18	2488	c.2479C>T	c.(2479-2481)CCT>TCT	p.P827S	KIAA0146_uc011ldc.1_Missense_Mutation_p.P757S|KIAA0146_uc011ldd.1_Missense_Mutation_p.P767S|KIAA0146_uc003xqe.2_Missense_Mutation_p.P302S|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Missense_Mutation_p.P332S|KIAA0146_uc011ldg.1_Missense_Mutation_p.P317S|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	827											0		Lung NSC(58;0.175)				GGTCACATCTCCTGTTCTCAA	0.592													24	91	---	---	---	---	PASS
KIAA0146	23514	broad.mit.edu	37	8	48641544	48641544	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48641544C>T	uc003xqd.2	+	18	2494	c.2485C>T	c.(2485-2487)CTC>TTC	p.L829F	KIAA0146_uc011ldc.1_Missense_Mutation_p.L759F|KIAA0146_uc011ldd.1_Missense_Mutation_p.L769F|KIAA0146_uc003xqe.2_Missense_Mutation_p.L304F|KIAA0146_uc003xqf.2_RNA|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Missense_Mutation_p.L334F|KIAA0146_uc011ldg.1_Missense_Mutation_p.L319F|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514	829											0		Lung NSC(58;0.175)				ATCTCCTGTTCTCAAGAGGCA	0.592													24	90	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68163633	68163633	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68163633C>G	uc003xxo.1	-	19	3141	c.2751G>C	c.(2749-2751)CAG>CAC	p.Q917H	ARFGEF1_uc003xxl.1_Missense_Mutation_p.Q371H	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	917					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCTTGGCCATCTGCTCCATTT	0.398													7	50	---	---	---	---	PASS
SLCO5A1	81796	broad.mit.edu	37	8	70650368	70650368	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70650368C>G	uc003xyl.2	-	5	2037	c.1330G>C	c.(1330-1332)GAG>CAG	p.E444Q	SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Missense_Mutation_p.E444Q|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	444	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			ATGGCACTCTCAGCTGTGTAT	0.423													11	82	---	---	---	---	PASS
GDAP1	54332	broad.mit.edu	37	8	75262801	75262801	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75262801C>T	uc003yah.2	+	1	184	c.105C>T	c.(103-105)TTC>TTT	p.F35F	GDAP1_uc011lfj.1_5'UTR|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated	35	GST N-terminal.					cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CGCATTCGTTCAGCTCTCAAA	0.627													14	58	---	---	---	---	PASS
LRRCC1	85444	broad.mit.edu	37	8	86057846	86057846	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86057846C>G	uc003ycw.2	+	19					LRRCC1_uc003ycx.2_3'UTR|LRRCC1_uc003ycy.2_3'UTR	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a						cell division|mitosis	centriole|nucleus					0						TGAAATGTCTCTTTCTATACA	0.229													8	25	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95541352	95541352	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95541352C>T	uc003ygo.1	-	7	839	c.826G>A	c.(826-828)GAG>AAG	p.E276K	KIAA1429_uc003ygp.2_Missense_Mutation_p.E276K|KIAA1429_uc010maz.1_5'Flank	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	276	Glu-rich.				mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			tcttcctcctcAGGAATACTG	0.194													11	21	---	---	---	---	PASS
KCNS2	3788	broad.mit.edu	37	8	99440459	99440459	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440459C>T	uc003yin.2	+	2	602	c.252C>T	c.(250-252)TTC>TTT	p.F84F		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	84	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TGCTGCATTTCTATCACACCG	0.557													34	138	---	---	---	---	PASS
KCNS2	3788	broad.mit.edu	37	8	99440510	99440510	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440510C>A	uc003yin.2	+	2	653	c.303C>A	c.(301-303)TTC>TTA	p.F101L		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	101	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			TCTTCTCCTTCAGCCAGGAGA	0.537													38	122	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	104987673	104987673	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104987673C>G	uc003yls.2	+	14	2441	c.2200C>G	c.(2200-2202)CAT>GAT	p.H734D	RIMS2_uc003ylp.2_Missense_Mutation_p.H956D|RIMS2_uc003ylw.2_Missense_Mutation_p.H748D|RIMS2_uc003ylq.2_Missense_Mutation_p.H748D|RIMS2_uc003ylr.2_Missense_Mutation_p.H795D|RIMS2_uc003ylt.2_Missense_Mutation_p.H341D	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1018					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGGGTCTCCTCATCGAGTAGA	0.413										HNSCC(12;0.0054)			14	64	---	---	---	---	PASS
UTP23	84294	broad.mit.edu	37	8	117782565	117782565	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117782565T>C	uc003yoc.2	+	2	424	c.323T>C	c.(322-324)GTT>GCT	p.V108A		NM_032334	NP_115710	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component,	108					rRNA processing	nucleolus					0						CTTTCCATGGTTGAAGAGGGA	0.373													26	154	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125052230	125052230	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125052230C>T	uc003yqw.2	+	20	2778	c.2572C>T	c.(2572-2574)CAC>TAC	p.H858Y	uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	858	Cytoplasmic (Potential).|C2 3.					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GTTCCTTTCTCACTGCCAGAC	0.522													24	127	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144732816	144732816	+	Silent	SNP	G	T	T	rs147942891		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144732816G>T	uc003yzd.2	+	1	863	c.774G>T	c.(772-774)ACG>ACT	p.T258T	ZNF623_uc011lkp.1_Silent_p.T218T|ZNF623_uc003yzc.2_Silent_p.T218T	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	258					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGATTCACACGGGAGAAAGGC	0.468													4	106	---	---	---	---	PASS
FAM83H	286077	broad.mit.edu	37	8	144808291	144808291	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144808291C>T	uc003yzk.2	-	5	3409	c.3340G>A	c.(3340-3342)GAG>AAG	p.E1114K	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	1114					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCGCGCTCCTCCGCGCTGGCT	0.652													3	14	---	---	---	---	PASS
MIR937	100126338	broad.mit.edu	37	8	144895147	144895147	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144895147G>C	hsa-mir-937|MI0005759	-			c.66G>C			SCRIB_uc003yzo.1_Intron|SCRIB_uc003yzp.1_Intron																	0						GGTGGGCAGAGAGTCAGAGCG	0.692													6	15	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16435866	16435866	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16435866C>A	uc003zml.2	-	6	2466	c.2326G>T	c.(2326-2328)GAA>TAA	p.E776*	BNC2_uc011lmw.1_Nonsense_Mutation_p.E681*|BNC2_uc003zmm.2_Nonsense_Mutation_p.E734*|BNC2_uc003zmq.1_Nonsense_Mutation_p.E790*|BNC2_uc003zmr.1_Nonsense_Mutation_p.E813*|BNC2_uc003zmp.1_Nonsense_Mutation_p.E804*|BNC2_uc010mij.1_Nonsense_Mutation_p.E698*|BNC2_uc011lmv.1_Nonsense_Mutation_p.E602*|BNC2_uc003zmo.1_Nonsense_Mutation_p.E698*|BNC2_uc003zmj.2_Nonsense_Mutation_p.E541*|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Nonsense_Mutation_p.E541*|BNC2_uc003zmn.1_Nonsense_Mutation_p.E541*	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	776					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		GTAAATTCTTCCTTCACCTTG	0.498													22	57	---	---	---	---	PASS
IFT74	80173	broad.mit.edu	37	9	27036447	27036447	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27036447G>C	uc010mja.2	+						IFT74_uc010mjb.2_Intron|IFT74_uc003zqf.3_Splice_Site_p.D352_splice|IFT74_uc003zqg.3_Intron	NM_001099223	NP_001092693	Q96LB3	IFT74_HUMAN	coiled-coil domain containing 2 isoform a							cytoplasmic membrane-bounded vesicle|intraflagellar transport particle B|microtubule-based flagellum				skin(1)	1		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		ttcatctgcagatcctaccaa	0.085													11	38	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35404054	35404054	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35404054C>T	uc003zwq.2	+	39					UNC13B_uc003zwr.2_3'UTR|ATP8B5P_uc010mkn.1_5'Flank|ATP8B5P_uc010mko.2_5'Flank|ATP8B5P_uc010mkp.2_5'Flank|ATP8B5P_uc003zwu.2_5'Flank	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CTGTGCCAATCAGGCAGCAGC	0.512													13	37	---	---	---	---	PASS
TPM2	7169	broad.mit.edu	37	9	35689748	35689748	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35689748C>T	uc003zxq.2	-	1	306	c.67G>A	c.(67-69)GAG>AAG	p.E23K	TPM2_uc003zxr.2_Missense_Mutation_p.E23K|TPM2_uc003zxs.2_Missense_Mutation_p.E23K|TPM2_uc010mkz.2_Missense_Mutation_p.E23K|TPM2_uc011lpa.1_Missense_Mutation_p.E23K	NM_213674	NP_998839	P07951	TPM2_HUMAN	tropomyosin 2 (beta) isoform 2	23	By similarity.				muscle filament sliding|regulation of ATPase activity	cytosol|muscle thin filament tropomyosin	actin binding|structural constituent of muscle			ovary(1)	1	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCGGCCTGCTCGGCGCGGTCG	0.677													55	193	---	---	---	---	PASS
CREB3	10488	broad.mit.edu	37	9	35736618	35736618	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35736618C>G	uc003zxv.2	+	9	1464	c.1011C>G	c.(1009-1011)CTC>CTG	p.L337L	CREB3_uc010mla.2_Silent_p.L256L	NM_006368	NP_006359	O43889	CREB3_HUMAN	cAMP responsive element binding protein 3	361	Lumenal (Potential).|Pro-rich.				chemotaxis|induction of positive chemotaxis|interspecies interaction between organisms|negative regulation of cell cycle|positive regulation of calcium ion transport|positive regulation of cell migration|positive regulation of transcription, DNA-dependent|reactivation of latent virus|regulation of cell proliferation	cytosol|endoplasmic reticulum|endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|integral to membrane|nucleus|nucleus	cAMP response element binding protein binding|CCR1 chemokine receptor binding|DNA binding|protein dimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity				0	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)	GBM - Glioblastoma multiforme(74;0.0285)		CAGAGCCTCTCTGCCGAGGTC	0.587											OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	54	267	---	---	---	---	PASS
DCAF10	79269	broad.mit.edu	37	9	37861519	37861519	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37861519C>G	uc004aao.2	+	7					DCAF10_uc010mlz.2_3'UTR|DCAF10_uc004aap.2_3'UTR	NM_024345	NP_077321	Q5QP82	DCA10_HUMAN	WD repeat domain 32							CUL4 RING ubiquitin ligase complex				central_nervous_system(1)	1						CAACTTACATCAAATAAGGAA	0.383													29	96	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88190360	88190360	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88190360C>T	uc011ltd.1	-	24	3406	c.3373G>A	c.(3373-3375)GAG>AAG	p.E1125K	AGTPBP1_uc004aod.3_Missense_Mutation_p.E751K|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Missense_Mutation_p.E1085K|AGTPBP1_uc011lte.1_Missense_Mutation_p.E1137K	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	1125					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						GCTCCCATCTCTTCCAGTTCT	0.363													30	84	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96847533	96847533	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96847533G>C	uc004auf.1	+	3	423	c.83G>C	c.(82-84)GGA>GCA	p.G28A	PTPDC1_uc004aug.1_Missense_Mutation_p.G28A|PTPDC1_uc004auh.1_Missense_Mutation_p.R80T|PTPDC1_uc010mrj.1_Missense_Mutation_p.G82A|PTPDC1_uc010mri.1_Missense_Mutation_p.R80T	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	28							protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						TATGTTCTAGGAAATTTAGAA	0.408													16	64	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98232132	98232132	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98232132C>G	uc004avk.3	-	13	1998	c.1810G>C	c.(1810-1812)GAG>CAG	p.E604Q	PTCH1_uc010mro.2_Missense_Mutation_p.E453Q|PTCH1_uc010mrp.2_Missense_Mutation_p.E453Q|PTCH1_uc010mrq.2_Missense_Mutation_p.E453Q|PTCH1_uc004avl.3_Missense_Mutation_p.E453Q|PTCH1_uc010mrr.2_Missense_Mutation_p.E538Q|PTCH1_uc004avm.3_Missense_Mutation_p.E603Q|PTCH1_uc010mrs.1_Missense_Mutation_p.E272Q	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	604	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CTCCTGTCCTCGCGTCGATAT	0.438									Basal_Cell_Nevus_syndrome				46	158	---	---	---	---	PASS
C9orf102	375748	broad.mit.edu	37	9	98691087	98691087	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98691087C>G	uc004avt.3	+	11	2113	c.1725C>G	c.(1723-1725)CTC>CTG	p.L575L	C9orf102_uc010mrx.1_RNA|C9orf102_uc011lum.1_Silent_p.L277L|C9orf102_uc010mry.1_Silent_p.L277L|C9orf102_uc010mrz.2_Silent_p.L386L|C9orf102_uc004avu.2_5'UTR	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	575	Helicase C-terminal.				DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGGAAAGACTCAAGATTGTAA	0.368													22	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	99884147	99884147	+	RNA	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99884147C>T	uc004aww.1	-	2		c.1647G>A								Homo sapiens cDNA FLJ34611 fis, clone KIDNE2014112.																		AGAAAGGATCCGAGCAGGGCT	0.547													6	14	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101825366	101825366	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101825366C>G	uc004azb.1	+	39	3832	c.3626C>G	c.(3625-3627)TCA>TGA	p.S1209*		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1209	Nonhelical region 10 (NC10).				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				AACCCTATTTCAAGTGCCAAT	0.269													15	53	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109687655	109687655	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109687655C>T	uc004bcz.2	+	3	1751	c.1462C>T	c.(1462-1464)CAC>TAC	p.H488Y	ZNF462_uc010mto.2_Missense_Mutation_p.H336Y|ZNF462_uc004bda.2_Missense_Mutation_p.H336Y	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	488	C2H2-type 5.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						ACTTGGGGCTCACAAACAGTG	0.448													19	76	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111741738	111741738	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111741738C>T	uc004bdo.1	-	7	966	c.924G>A	c.(922-924)GAG>GAA	p.E308E	CTNNAL1_uc010mts.1_Silent_p.E44E|CTNNAL1_uc010mtt.1_Silent_p.E308E|CTNNAL1_uc004bdp.1_Silent_p.E308E	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	308					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		AATAAAGATTCTCCCGAAGAG	0.418													9	30	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113231341	113231341	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113231341G>C	uc010mtz.2	-	17	3376	c.3039C>G	c.(3037-3039)TTC>TTG	p.F1013L	SVEP1_uc010mua.1_Missense_Mutation_p.F1013L	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1013					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						TTTCACAGGTGAAATGTTCCA	0.438													17	79	---	---	---	---	PASS
SVEP1	79987	broad.mit.edu	37	9	113312147	113312147	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113312147G>A	uc010mtz.2	-	2	1106	c.769C>T	c.(769-771)CGC>TGC	p.R257C	SVEP1_uc010mua.1_Missense_Mutation_p.R257C|SVEP1_uc004beu.2_Missense_Mutation_p.R257C|SVEP1_uc004bev.2_5'UTR	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	257	VWFA.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						AATGCCCGGCGAGCTAAAGCC	0.478													6	21	---	---	---	---	PASS
BSPRY	54836	broad.mit.edu	37	9	116131969	116131969	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116131969G>A	uc004bhg.3	+	6	804	c.756G>A	c.(754-756)CTG>CTA	p.L252L	BSPRY_uc010muw.2_3'UTR	NM_017688	NP_060158	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	252	B30.2/SPRY.				calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1						GAAAGACCCTGACCTTCAGCA	0.567													30	93	---	---	---	---	PASS
C5	727	broad.mit.edu	37	9	123714866	123714866	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123714866C>T	uc004bkv.2	-	41						NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	AAATCATTCTCTAATAAAAGC	0.338													3	6	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127764247	127764247	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127764247C>T	uc004bpe.2	-	12	1222	c.1141G>A	c.(1141-1143)GAA>AAA	p.E381K	SCAI_uc004bpd.2_Missense_Mutation_p.E404K|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	381					negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						ATTGTACCTTCACTATCAGAA	0.473													46	158	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128111713	128111713	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128111713G>A	uc010mwx.2	+	21	3594	c.3268G>A	c.(3268-3270)GAA>AAA	p.E1090K	GAPVD1_uc004bpp.2_Missense_Mutation_p.E1099K|GAPVD1_uc004bpq.2_Missense_Mutation_p.E1072K|GAPVD1_uc004bpr.2_Missense_Mutation_p.E1051K|GAPVD1_uc004bps.2_Missense_Mutation_p.E1045K|GAPVD1_uc004bpt.2_Missense_Mutation_p.E105K	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1090					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						TCCCCGTGACGAAGCACTGCA	0.478													38	118	---	---	---	---	PASS
ST6GALNAC6	30815	broad.mit.edu	37	9	130652994	130652994	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130652994T>C	uc004bso.1	-	5	745	c.626A>G	c.(625-627)AAC>AGC	p.N209S	ST6GALNAC6_uc004bsn.1_Missense_Mutation_p.N175S|ST6GALNAC6_uc011man.1_Intron|ST6GALNAC6_uc004bsp.1_Missense_Mutation_p.N209S|ST6GALNAC6_uc004bsq.1_Missense_Mutation_p.N175S|ST6GALNAC6_uc004bsr.2_Missense_Mutation_p.N175S|ST6GALNAC6_uc010mxp.1_RNA	NM_013443	NP_038471	Q969X2	SIA7F_HUMAN	sialytransferase 7F	209	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane|plasma membrane					0						TGCTTCCATGTTGGGGAACAC	0.642													15	76	---	---	---	---	PASS
NAIF1	203245	broad.mit.edu	37	9	130829327	130829327	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130829327C>T	uc004bta.2	-	1	273	c.54G>A	c.(52-54)GAG>GAA	p.E18E	NAIF1_uc004bsz.2_RNA|SLC25A25_uc004btb.2_5'Flank	NM_197956	NP_931045	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	18	Required for nuclear localization and apoptosis-inducing activity.				apoptosis|induction of apoptosis	nucleus					0						CCACGATGATCTCCACCTCCC	0.577													68	240	---	---	---	---	PASS
NAIF1	203245	broad.mit.edu	37	9	130829460	130829460	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130829460C>T	uc004bta.2	-	1					NAIF1_uc004bsz.2_RNA|SLC25A25_uc004btb.2_5'Flank	NM_197956	NP_931045	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1						apoptosis|induction of apoptosis	nucleus					0						TCCTCAGCCTCGCCCCTCACC	0.587													10	57	---	---	---	---	PASS
LCN2	3934	broad.mit.edu	37	9	130914288	130914288	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130914288C>G	uc004bto.1	+	4	532	c.459C>G	c.(457-459)TTC>TTG	p.F153L	LCN2_uc011map.1_Missense_Mutation_p.F153L	NM_005564	NP_005555	P80188	NGAL_HUMAN	lipocalin 2 precursor	153					apoptosis|innate immune response|regulation of apoptosis|siderophore transport		iron ion binding|transporter activity				0						GGGAGTACTTCAAGATCACCC	0.547													36	155	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131395126	131395126	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131395126G>A	uc004bvl.3	+	55	7298	c.7185G>A	c.(7183-7185)ATG>ATA	p.M2395I	SPTAN1_uc004bvm.3_Missense_Mutation_p.M2400I|SPTAN1_uc004bvn.3_Missense_Mutation_p.M2375I|SPTAN1_uc004bvo.3_Missense_Mutation_p.M162I|SPTAN1_uc004bvp.3_Missense_Mutation_p.M138I	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	2395	EF-hand 2.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TGGCTTTCATGATCAGCCGCG	0.602													32	178	---	---	---	---	PASS
ZER1	10444	broad.mit.edu	37	9	131517773	131517773	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131517773G>A	uc004bwa.1	-	2	505	c.72C>T	c.(70-72)ACC>ACT	p.T24T		NM_006336	NP_006327	Q7Z7L7	ZER1_HUMAN	zyg-11 homolog B (C. elegans)-like	24					ATP hydrolysis coupled proton transport|regulation of ubiquitin-protein ligase activity	Cul2-RING ubiquitin ligase complex|vacuolar proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism|ubiquitin-protein ligase activity			ovary(1)	1						GGTAGCCCAGGGTGCCATCCA	0.622													28	105	---	---	---	---	PASS
DOLK	22845	broad.mit.edu	37	9	131709436	131709436	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131709436G>C	uc004bwr.2	-	1	577	c.147C>G	c.(145-147)CTC>CTG	p.L49L	NUP188_uc004bws.1_5'Flank|NUP188_uc004bwq.1_Intron	NM_014908	NP_055723	Q9UPQ8	DOLK_HUMAN	dolichol kinase	49	Cytoplasmic (Potential).				dolichyl diphosphate biosynthetic process|dolichyl monophosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to endoplasmic reticulum membrane|membrane fraction	dolichol kinase activity				0						CCTGCACTGCGAGGGCCACGG	0.602													19	68	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131745618	131745618	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131745618G>A	uc004bws.1	+	18	1865	c.1843G>A	c.(1843-1845)GTC>ATC	p.V615I	NUP188_uc004bwu.2_5'Flank	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	615					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						TGCTTCTTGTGTCAACTGCTT	0.433													26	129	---	---	---	---	PASS
ASS1	445	broad.mit.edu	37	9	133327632	133327632	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133327632C>T	uc004bzm.2	+	3	373	c.17C>T	c.(16-18)TCC>TTC	p.S6F	ASS1_uc004bzn.2_Missense_Mutation_p.S6F|ASS1_uc010mza.2_Missense_Mutation_p.S82F|ASS1_uc004bzo.2_Missense_Mutation_p.S6F|ASS1_uc010mzb.2_Missense_Mutation_p.S44F|ASS1_uc004bzp.2_Missense_Mutation_p.S6F|ASS1_uc010mzc.2_Missense_Mutation_p.S6F	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1	6					arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	AGCAAAGGCTCCGTGGTTCTG	0.627													5	23	---	---	---	---	PASS
ASS1	445	broad.mit.edu	37	9	133376534	133376534	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133376534G>A	uc004bzm.2	+	16					ASS1_uc004bzn.2_3'UTR|ASS1_uc010mza.2_3'UTR|ASS1_uc004bzo.2_3'UTR|ASS1_uc010mzb.2_3'UTR|ASS1_uc004bzp.2_3'UTR|ASS1_uc010mzc.2_3'UTR	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GGGGCTGCCAGGCCCCAGCTT	0.542													10	29	---	---	---	---	PASS
LAMC3	10319	broad.mit.edu	37	9	133907468	133907468	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133907468G>A	uc004caa.1	+	3	813	c.715G>A	c.(715-717)GAC>AAC	p.D239N		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	239	Laminin N-terminal.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CATCTCTCTAGACCGGCTCAA	0.567													36	207	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136266896	136266896	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136266896C>T	uc004cdk.2	+	13	1289	c.1228C>T	c.(1228-1230)CCC>TCC	p.P410S	C9orf96_uc004cdl.2_Intron	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	410							ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AGCCAAGGCTCCCTGCAACCA	0.622													14	37	---	---	---	---	PASS
ADAMTSL2	9719	broad.mit.edu	37	9	136401759	136401759	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136401759C>G	uc011mdl.1	+	2					ADAMTSL2_uc004cei.2_5'UTR	NM_001145320	NP_001138792	Q86TH1	ATL2_HUMAN	ADAMTS-like 2 precursor						negative regulation of transforming growth factor beta receptor signaling pathway	proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CCCGAGGGCTCTTCCCAAAGC	0.448													12	35	---	---	---	---	PASS
MRPS2	51116	broad.mit.edu	37	9	138395832	138395832	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138395832C>G	uc004cfv.3	+	4	818	c.744C>G	c.(742-744)CTC>CTG	p.L248L	MRPS2_uc004cfw.3_Silent_p.L158L|MRPS2_uc004cfx.3_Silent_p.L163L|MRPS2_uc010nat.2_Silent_p.L229L|uc004cfy.2_Intron	NM_016034	NP_057118	Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	248					translation	mitochondrion|small ribosomal subunit	structural constituent of ribosome				0				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		CTGTGCACCTCTACTGCAGGC	0.632													30	113	---	---	---	---	PASS
KCNT1	57582	broad.mit.edu	37	9	138669288	138669288	+	Silent	SNP	C	T	T	rs149452823		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138669288C>T	uc011mdq.1	+	21	2528	c.2454C>T	c.(2452-2454)ATC>ATT	p.I818I	KCNT1_uc011mdr.1_Silent_p.I645I|KCNT1_uc010nbf.2_Silent_p.I773I|KCNT1_uc004cgo.1_Silent_p.I567I	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	818						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		ACAACTTCATCGTGCCACTGC	0.602													17	87	---	---	---	---	PASS
TRAF2	7186	broad.mit.edu	37	9	139802612	139802612	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139802612G>C	uc010nbu.2	+	6	630	c.457G>C	c.(457-459)GAG>CAG	p.E153Q	TRAF2_uc010nbv.1_Missense_Mutation_p.E205Q|TRAF2_uc004cjv.2_Missense_Mutation_p.E153Q|TRAF2_uc011mek.1_Missense_Mutation_p.E142Q|TRAF2_uc010nbw.2_Missense_Mutation_p.E153Q	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	153	TRAF-type 1.				activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		GCGCCACCTGGAGCACGAGTG	0.662													13	35	---	---	---	---	PASS
NPDC1	56654	broad.mit.edu	37	9	139937474	139937474	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139937474C>G	uc004ckt.2	-	2	399	c.164G>C	c.(163-165)AGG>ACG	p.R55T	NPDC1_uc004ckr.2_Missense_Mutation_p.R55T|NPDC1_uc004cks.2_Missense_Mutation_p.R133T|NPDC1_uc004cku.2_Missense_Mutation_p.R55T	NM_015392	NP_056207	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and	55						integral to membrane					0	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		AGGAGGACACCTTGCCCGCCT	0.687													14	30	---	---	---	---	PASS
DIP2C	22982	broad.mit.edu	37	10	395346	395346	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:395346C>G	uc001ifp.2	-	25	3124	c.3034G>C	c.(3034-3036)GAG>CAG	p.E1012Q	DIP2C_uc009xhi.1_Missense_Mutation_p.E398Q	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	1012						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GCGATCTTCTCAGCTCTCTTG	0.622													22	83	---	---	---	---	PASS
RBM17	84991	broad.mit.edu	37	10	6143281	6143281	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6143281G>A	uc001ijb.2	+	3	397	c.171G>A	c.(169-171)CTG>CTA	p.L57L	RBM17_uc010qav.1_Silent_p.L57L	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	57					mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						TCATTGACCTGAAGCGAGGTG	0.483													9	49	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	11994206	11994206	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11994206C>G	uc001ila.2	-	14	3367	c.2893G>C	c.(2893-2895)GAC>CAC	p.D965H	UPF2_uc001ilb.2_Missense_Mutation_p.D965H|UPF2_uc001ilc.2_Missense_Mutation_p.D965H|UPF2_uc009xiz.1_Missense_Mutation_p.D965H	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	965	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				AATGGATGGTCTTTTGTCCAA	0.308													23	80	---	---	---	---	PASS
MSRB2	22921	broad.mit.edu	37	10	23408326	23408326	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23408326G>A	uc001iro.2	+	4	501	c.390G>A	c.(388-390)CTG>CTA	p.L130L		NM_012228	NP_036360	Q9Y3D2	MSRB2_HUMAN	methionine sulfoxide reductase B2 precursor	130					protein repair	mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0					L-Methionine(DB00134)	CAGGGATCCTGAGACGTCTGG	0.512													25	94	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27323766	27323766	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27323766C>G	uc001ith.2	-	24	3782	c.3610G>C	c.(3610-3612)GAA>CAA	p.E1204Q	ANKRD26_uc001itg.2_Missense_Mutation_p.E891Q|ANKRD26_uc009xku.1_Missense_Mutation_p.E1205Q	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1204	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TACTGTCTTTCTTTTAAGTGA	0.289													27	67	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27323874	27323874	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27323874C>T	uc001ith.2	-	24	3674	c.3502G>A	c.(3502-3504)GAC>AAC	p.D1168N	ANKRD26_uc001itg.2_Missense_Mutation_p.D855N|ANKRD26_uc009xku.1_Missense_Mutation_p.D1169N	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1168	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TGAAACTGGTCTTGGATATTA	0.368													59	203	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27536544	27536544	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27536544C>G	uc001its.2	-	1						NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						GCAGCGTTCTCTGCAAATGCC	0.542													14	56	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28151455	28151455	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28151455C>T	uc009xky.2	-	18	2805	c.2707G>A	c.(2707-2709)GCT>ACT	p.A903T	ARMC4_uc010qds.1_Missense_Mutation_p.A428T|ARMC4_uc010qdt.1_Missense_Mutation_p.A595T|ARMC4_uc001itz.2_Missense_Mutation_p.A903T	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	903	ARM 7.						binding			ovary(4)|skin(2)	6						GTAATGGCAGCACATACACTT	0.373													29	96	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33200926	33200926	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33200926G>A	uc001iws.3	-	12	1732	c.1596C>T	c.(1594-1596)GTC>GTT	p.V532V	ITGB1_uc001iwp.3_Silent_p.V532V|ITGB1_uc001iwq.3_Silent_p.V532V|ITGB1_uc001iwr.3_Silent_p.V532V|ITGB1_uc001iwt.3_Silent_p.V532V|ITGB1_uc001iwu.1_Silent_p.V532V	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	532	Extracellular (Potential).|Cysteine-rich tandem repeats.|II.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				ACTGTCCGCAGACGCACTCTC	0.398													48	129	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33224454	33224454	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33224454C>T	uc001iws.3	-	2	169	c.33G>A	c.(31-33)CTG>CTA	p.L11L	ITGB1_uc001iwp.3_Silent_p.L11L|ITGB1_uc001iwq.3_Silent_p.L11L|ITGB1_uc001iwr.3_Silent_p.L11L|ITGB1_uc001iwt.3_Silent_p.L11L|ITGB1_uc001iwu.1_Silent_p.L11L	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	11					axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				CTGAACTGATCAGTCCAATCC	0.294													10	60	---	---	---	---	PASS
PHYHIPL	84457	broad.mit.edu	37	10	61005268	61005268	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61005268G>A	uc001jkk.3	+	5	1314	c.1048G>A	c.(1048-1050)GGT>AGT	p.G350S	PHYHIPL_uc001jkl.3_Missense_Mutation_p.G304S|PHYHIPL_uc001jkm.3_Missense_Mutation_p.G324S	NM_032439	NP_115815	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting	350											0						AGAAATCACTGGTCATCAGCT	0.448													41	96	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63977986	63977986	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63977986C>T	uc001jlw.2	-	8	953	c.856G>A	c.(856-858)GAG>AAG	p.E286K	RTKN2_uc009xpf.1_Missense_Mutation_p.E67K	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	286	PH.				signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					AATGCATCCTCAGCCATACAA	0.393													13	78	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64239677	64239677	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64239677C>T	uc001jmb.3	+	5					ZNF365_uc001jmc.2_Intron	NM_199450	NP_955522	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform B											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					TGATGTGATTCTGGATGAGGA	0.318													17	54	---	---	---	---	PASS
ZNF365	22891	broad.mit.edu	37	10	64415153	64415153	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64415153G>A	uc001jmd.1	+	4	487	c.153G>A	c.(151-153)ATG>ATA	p.M51I	ZNF365_uc001jmc.2_Intron|ZNF365_uc001jme.1_Intron|ZNF365_uc001jmf.1_Intron|ZNF365_uc009xpg.1_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D	51										ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGCCACTGATGAAACAGGCTC	0.468													11	40	---	---	---	---	PASS
PRF1	5551	broad.mit.edu	37	10	72360406	72360406	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72360406G>C	uc009xqg.2	-	2	414	c.253C>G	c.(253-255)CTC>GTC	p.L85V	PRF1_uc001jrf.3_Missense_Mutation_p.L85V	NM_001083116	NP_001076585	P14222	PERF_HUMAN	perforin 1 precursor	85	MACPF.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						AGGCGCTGGAGGGTGCCCTCC	0.667			M			various leukaemia|lymphoma	Type 2 familial hemophagocytic lymphohistiocytosis		Familial_Hemophagocytic_Lymphohistiocytosis				3	28	---	---	---	---	PASS
SLC29A3	55315	broad.mit.edu	37	10	73122191	73122191	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73122191C>T	uc001jrr.3	+	6	1311	c.1254C>T	c.(1252-1254)CTC>CTT	p.L418L	SLC29A3_uc001jrs.3_3'UTR|SLC29A3_uc010qjq.1_Silent_p.L272L|SLC29A3_uc001jrt.3_Silent_p.L212L|SLC29A3_uc001jru.3_Silent_p.L230L	NM_018344	NP_060814	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (nucleoside	418	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|late endosome membrane|lysosomal membrane	nucleoside transmembrane transporter activity				0						CCGCACTCCTCAGCTCCCTGC	0.642													35	111	---	---	---	---	PASS
ZMYND17	118490	broad.mit.edu	37	10	75182465	75182465	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75182465C>G	uc001juc.2	-	6								Q4VC12	ZMY17_HUMAN	RecName: Full=Zinc finger MYND domain-containing protein 17;								zinc ion binding			ovary(1)	1	Prostate(51;0.0119)					TTTGGCCGCTCCTGCTTCAGT	0.433													5	21	---	---	---	---	PASS
CAMK2G	818	broad.mit.edu	37	10	75574801	75574801	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75574801G>A	uc001jvm.1	-	20	1762	c.1643C>T	c.(1642-1644)TCA>TTA	p.S548L	CAMK2G_uc001jvo.1_Missense_Mutation_p.S519L|CAMK2G_uc001jvq.1_Missense_Mutation_p.S496L|CAMK2G_uc001jvr.1_Missense_Mutation_p.S487L|CAMK2G_uc001jvp.1_Missense_Mutation_p.S510L|CAMK2G_uc001jvs.1_Missense_Mutation_p.S531L|CAMK2G_uc001jvt.1_RNA|CAMK2G_uc001jvu.1_Missense_Mutation_p.S488L|CAMK2G_uc009xrp.1_Missense_Mutation_p.S137L	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	550					insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					AGGGGCCCCTGAGCAGTGATA	0.657													10	19	---	---	---	---	PASS
CAMK2G	818	broad.mit.edu	37	10	75574821	75574821	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75574821G>C	uc001jvm.1	-	20	1742	c.1623C>G	c.(1621-1623)CTC>CTG	p.L541L	CAMK2G_uc001jvo.1_Silent_p.L512L|CAMK2G_uc001jvq.1_Silent_p.L489L|CAMK2G_uc001jvr.1_Silent_p.L480L|CAMK2G_uc001jvp.1_Silent_p.L503L|CAMK2G_uc001jvs.1_Silent_p.L524L|CAMK2G_uc001jvt.1_RNA|CAMK2G_uc001jvu.1_Silent_p.L481L|CAMK2G_uc009xrp.1_Silent_p.L130L	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II	543					insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					AGTGGACATTGAGCCACTTGC	0.662													13	27	---	---	---	---	PASS
LRIT2	340745	broad.mit.edu	37	10	85984808	85984808	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85984808T>G	uc001kcy.2	-	2	181	c.173A>C	c.(172-174)AAG>ACG	p.K58T	LRIT2_uc010qmc.1_Missense_Mutation_p.K58T	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	58						integral to membrane				ovary(2)	2						TCTCACTTGCTTGAACTCTTC	0.418													30	126	---	---	---	---	PASS
SNCG	6623	broad.mit.edu	37	10	88718387	88718387	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88718387C>G	uc001keb.2	+	1					MMRN2_uc001kea.2_5'Flank|MMRN2_uc010qmn.1_5'Flank|MMRN2_uc009xtb.2_5'Flank	NM_003087	NP_003078	O76070	SYUG_HUMAN	synuclein, gamma (breast cancer-specific protein							microtubule organizing center|perinuclear region of cytoplasm|spindle	protein binding				0						CGAGCCAGCTCAAGCCCGCAG	0.637													3	12	---	---	---	---	PASS
TNKS2	80351	broad.mit.edu	37	10	93572839	93572839	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93572839C>G	uc001khp.2	+	2	596	c.299C>G	c.(298-300)TCT>TGT	p.S100C		NM_025235	NP_079511	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related	100	ANK 2.				positive regulation of canonical Wnt receptor signaling pathway|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein polyubiquitination|Wnt receptor signaling pathway	Golgi membrane|microsome|nuclear envelope|pericentriolar material|perinuclear region of cytoplasm	NAD+ ADP-ribosyltransferase activity|protein binding			kidney(3)|skin(3)|ovary(1)|lung(1)	8		Colorectal(252;0.162)				AATGCATGCTCTTTTGGTCAT	0.443													26	116	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94405256	94405256	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94405256G>A	uc001kic.2	+	18	2712	c.2404G>A	c.(2404-2406)GAT>AAT	p.D802N	KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	802					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						GAAACACTCTGATAAACTCAA	0.363													17	84	---	---	---	---	PASS
CYP2C19	1557	broad.mit.edu	37	10	96540313	96540313	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96540313C>T	uc010qnz.1	+	4	539	c.539C>T	c.(538-540)TCC>TTC	p.S180F	CYP2C19_uc009xus.1_Missense_Mutation_p.S45F|CYP2C19_uc010qny.1_Missense_Mutation_p.S158F	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	180					exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	GTGATCTGCTCCATTATTTTC	0.373													57	184	---	---	---	---	PASS
LCOR	84458	broad.mit.edu	37	10	98715053	98715053	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98715053G>A	uc001kms.1	+	8	1197	c.676G>A	c.(676-678)GAA>AAA	p.E226K	LCOR_uc001kmr.2_Missense_Mutation_p.E226K|C10orf12_uc009xvg.1_Intron|LCOR_uc001kmt.1_Missense_Mutation_p.E226K|LCOR_uc001kmu.1_Missense_Mutation_p.E226K	NM_032440	NP_115816	Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	226						nucleus	DNA binding			ovary(3)	3		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		TTTTCTTGCAGAAAACTCTGC	0.433													23	69	---	---	---	---	PASS
ZFYVE27	118813	broad.mit.edu	37	10	99519006	99519006	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99519006G>C	uc001koo.2	+	13	1385	c.1185G>C	c.(1183-1185)CAG>CAC	p.Q395H	ZFYVE27_uc001kon.2_Missense_Mutation_p.Q400H|ZFYVE27_uc001koq.2_Missense_Mutation_p.Q302H|ZFYVE27_uc010qpa.1_Missense_Mutation_p.Q270H|ZFYVE27_uc001kop.2_Missense_Mutation_p.Q388H|ZFYVE27_uc010qpb.1_Missense_Mutation_p.Q295H|ZFYVE27_uc010qpc.1_RNA|ZFYVE27_uc010qpd.1_Missense_Mutation_p.Q356H|ZFYVE27_uc001kol.1_Missense_Mutation_p.Q395H|ZFYVE27_uc001kom.1_Missense_Mutation_p.Q388H	NM_144588	NP_653189	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27 isoform	395	Extracellular (Potential).|FYVE-type.				cell death|nerve growth factor receptor signaling pathway|neuron projection development|protein localization in plasma membrane	axon|dendrite|endoplasmic reticulum membrane|growth cone membrane|integral to membrane|recycling endosome membrane	metal ion binding|protein binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		CTGAAGCCCAGAGGGAGACTG	0.557											OREG0020422	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	85	---	---	---	---	PASS
FGF8	2253	broad.mit.edu	37	10	103531253	103531253	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103531253G>C	uc001ktp.1	-	5	548	c.378C>G	c.(376-378)ATC>ATG	p.I126M	FGF8_uc001ktq.1_Missense_Mutation_p.I137M|FGF8_uc001ktr.1_Missense_Mutation_p.I108M|FGF8_uc001kts.1_Missense_Mutation_p.I97M|FGF8_uc009xwr.1_Missense_Mutation_p.I33M	NM_033164	NP_149354	P55075	FGF8_HUMAN	fibroblast growth factor 8 isoform E precursor	126					bone development|dopaminergic neuron differentiation|fibroblast growth factor receptor signaling pathway|gastrulation|gonad development|insulin receptor signaling pathway|mesonephros development|metanephros development|negative regulation of cardiac muscle tissue development|neuroepithelial cell differentiation|odontogenesis|positive regulation of cell division|positive regulation of cell proliferation	extracellular region|extracellular space	growth factor activity|growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		TGTTCATGCAGATGTAGAGGC	0.607													15	69	---	---	---	---	PASS
NT5C2	22978	broad.mit.edu	37	10	104857052	104857052	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104857052G>A	uc001kwo.2	-	11	953	c.767C>T	c.(766-768)ACA>ATA	p.T256I	NT5C2_uc010qqp.1_Missense_Mutation_p.T227I|NT5C2_uc001kwq.2_Missense_Mutation_p.T256I|NT5C2_uc001kwp.2_Missense_Mutation_p.T103I	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	256					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	ACTTACATCTGTATATTTATA	0.348													19	99	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105903397	105903397	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105903397C>T	uc001kxw.2	-	32	4061	c.3945G>A	c.(3943-3945)AGG>AGA	p.R1315R	C10orf79_uc009xxq.2_Silent_p.R594R	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1315											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		GTTTGGAAATCCTGGTATTAC	0.418													3	27	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115985891	115985891	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115985891G>A	uc001lbg.1	+	22	3244	c.3091G>A	c.(3091-3093)GAA>AAA	p.E1031K	TDRD1_uc001lbf.2_Missense_Mutation_p.E908K|TDRD1_uc001lbh.1_Missense_Mutation_p.E1018K|TDRD1_uc001lbi.1_Missense_Mutation_p.E1022K|TDRD1_uc010qsc.1_Missense_Mutation_p.E635K|TDRD1_uc001lbj.2_Missense_Mutation_p.E740K	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1031	Tudor 4.				DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TGGAAACATTGAAACCCTGCC	0.438													28	67	---	---	---	---	PASS
TRUB1	142940	broad.mit.edu	37	10	116702491	116702491	+	Missense_Mutation	SNP	G	A	A	rs143607039		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116702491G>A	uc001lcd.2	+	2	435	c.374G>A	c.(373-375)CGA>CAA	p.R125Q	TRUB1_uc010qsl.1_Missense_Mutation_p.R27Q	NM_139169	NP_631908	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase homolog 1	125					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding				0		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		AGCGCAGCCCGAGGAGTTCTG	0.438													13	52	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120809348	120809348	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120809348C>G	uc001ldu.2	-	17	2769	c.2623G>C	c.(2623-2625)GAG>CAG	p.E875Q	EIF3A_uc010qsu.1_Missense_Mutation_p.E841Q|EIF3A_uc009xzg.1_5'UTR	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	875	Glu-rich.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		AGTCTTCTCTCTTCCTCTCTA	0.358													81	227	---	---	---	---	PASS
PLEKHA1	59338	broad.mit.edu	37	10	124152833	124152833	+	Silent	SNP	C	T	T	rs142005373		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124152833C>T	uc001lge.1	+	2	240	c.117C>T	c.(115-117)TTC>TTT	p.F39F	PLEKHA1_uc001lgf.1_Silent_p.F39F|PLEKHA1_uc001lgg.1_Silent_p.F39F|PLEKHA1_uc001lgh.2_Silent_p.F39F	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A	39	PH 1.				B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AAGATAGTTTCGTGTGGTACA	0.343													22	73	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124358515	124358515	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124358515G>T	uc001lgk.1	+	26	3288	c.3182G>T	c.(3181-3183)CGC>CTC	p.R1061L	DMBT1_uc001lgl.1_Missense_Mutation_p.R1051L|DMBT1_uc001lgm.1_Missense_Mutation_p.R562L|DMBT1_uc009xzz.1_Missense_Mutation_p.R1061L|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Missense_Mutation_p.R22L	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1061	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GATGATGTGCGCTGCTCAGGA	0.592													51	151	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124358521	124358521	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124358521C>G	uc001lgk.1	+	26	3294	c.3188C>G	c.(3187-3189)TCA>TGA	p.S1063*	DMBT1_uc001lgl.1_Nonsense_Mutation_p.S1053*|DMBT1_uc001lgm.1_Nonsense_Mutation_p.S564*|DMBT1_uc009xzz.1_Nonsense_Mutation_p.S1063*|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Nonsense_Mutation_p.S24*	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1063	SRCR 8.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GTGCGCTGCTCAGGACACGAG	0.607													43	146	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127429114	127429114	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127429114G>A	uc001liq.1	+	16	2357	c.2064G>A	c.(2062-2064)CTG>CTA	p.L688L	C10orf137_uc001lin.2_Silent_p.L654L|C10orf137_uc001lio.1_Silent_p.L654L|C10orf137_uc001lip.1_Silent_p.L392L|C10orf137_uc001lir.2_Silent_p.L182L|C10orf137_uc001lis.1_Silent_p.L14L	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	688					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				AACTTCAGCTGATTCTCAAGT	0.413													21	92	---	---	---	---	PASS
LRDD	55367	broad.mit.edu	37	11	804358	804358	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:804358C>G	uc001lro.1	-	2	173	c.31G>C	c.(31-33)GAG>CAG	p.E11Q	LRDD_uc009yck.1_5'Flank|LRDD_uc001lrk.1_Missense_Mutation_p.E11Q|LRDD_uc001lrl.1_5'UTR|LRDD_uc001lrm.1_5'UTR|LRDD_uc001lrn.1_5'UTR|LRDD_uc001lrp.1_5'UTR	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	11					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGCTGCCTCCAGCTCTGGC	0.687													8	22	---	---	---	---	PASS
IGF2	3481	broad.mit.edu	37	11	2154279	2154279	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2154279G>C	uc009yde.2	-	4	584	c.481C>G	c.(481-483)CTA>GTA	p.L161V	IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_Missense_Mutation_p.L161V|IGF2_uc009ydf.2_Missense_Mutation_p.L217V|IGF2_uc001lvh.2_Missense_Mutation_p.L161V|INS-IGF2_uc001lvi.2_RNA	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1	161					glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TGGGTGGGTAGAGCAATCAGG	0.692													25	98	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867346	6867346	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867346C>G	uc001met.1	+	1	433	c.433C>G	c.(433-435)CTG>GTG	p.L145V		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ACGGGCCAAACTGGCTGCTGC	0.527													34	174	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7981789	7981789	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7981789G>A	uc001mfv.1	-	2	1387	c.1370C>T	c.(1369-1371)GCC>GTC	p.A457V		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	457	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTTCTTGATGGCAAGTCCCAA	0.493													43	170	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9200526	9200526	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9200526C>A	uc001mhl.2	-	7	1805	c.1550G>T	c.(1549-1551)CGG>CTG	p.R517L	DENND5A_uc010rbw.1_Missense_Mutation_p.R517L|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	517	dDENN.									liver(1)	1						AAAAACTTCCCGGATCTGAAT	0.438													4	159	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10477872	10477872	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10477872C>T	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfx.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_5'UTR	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		AGCTGAGCCTCCTGGGTGGCA	0.612													12	39	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11942014	11942014	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11942014G>A	uc001mjq.1	+	11	2014	c.1251G>A	c.(1249-1251)ATG>ATA	p.M417I	USP47_uc001mjr.2_Missense_Mutation_p.M329I|USP47_uc001mjs.2_Missense_Mutation_p.M397I	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	417					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		AACTAGATATGAGTACTTTTA	0.318													32	86	---	---	---	---	PASS
ACCS	84680	broad.mit.edu	37	11	44099330	44099330	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44099330C>T	uc009yks.1	+						EXT2_uc010rfo.1_Intron|ACCS_uc010rfm.1_3'UTR|ACCS_uc001mxx.2_Intron	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase								1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						CCTGAGAGTTCATATGTATTT	0.562													6	12	---	---	---	---	PASS
ZNF408	79797	broad.mit.edu	37	11	46727044	46727044	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46727044C>G	uc001nde.1	+	5	2024	c.1794C>G	c.(1792-1794)CTC>CTG	p.L598L	ZNF408_uc010rgw.1_Silent_p.L590L	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	598	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding				0						GGCGCCACCTCAAATCTCACT	0.667													18	50	---	---	---	---	PASS
NDUFS3	4722	broad.mit.edu	37	11	47602301	47602301	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47602301C>T	uc001nga.2	+						NDUFS3_uc001nft.3_Missense_Mutation_p.S28L|KBTBD4_uc001nfw.1_5'Flank|KBTBD4_uc001nfx.2_5'Flank|KBTBD4_uc001nfz.2_5'Flank|KBTBD4_uc001nfy.2_5'Flank|NDUFS3_uc010rhn.1_Intron	NM_004551	NP_004542	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3						induction of apoptosis|mitochondrial electron transport, NADH to ubiquinone|negative regulation of cell growth|reactive oxygen species metabolic process|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	ACTTTTCTCTCAGCATTAAAC	0.488													18	68	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47752962	47752962	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47752962C>G	uc009ylv.2	-	12	2125	c.1972G>C	c.(1972-1974)GAT>CAT	p.D658H	FNBP4_uc001ngj.2_Missense_Mutation_p.D565H|FNBP4_uc001ngl.2_RNA	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	658										ovary(1)	1						GAATTTGAATCAGTGCCAGTT	0.373													51	136	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47753046	47753046	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47753046C>T	uc009ylv.2	-	12	2041	c.1888G>A	c.(1888-1890)GAA>AAA	p.E630K	FNBP4_uc001ngj.2_Missense_Mutation_p.E537K|FNBP4_uc001ngl.2_RNA	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	630	Poly-Glu.									ovary(1)	1						TCTTCCTCTTCACCATCTGGA	0.393													46	163	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47858484	47858484	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47858484G>A	uc001ngm.2	-	6	982	c.897C>T	c.(895-897)ATC>ATT	p.I299I	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	299					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						ACAAAGCAAAGATGAAGGCAT	0.408													19	95	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594852	55594852	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594852C>T	uc001nhy.1	+	1	158	c.158C>T	c.(157-159)TCT>TTT	p.S53F		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				CAGGTCAGCTCTCGGCTCCAC	0.478										HNSCC(27;0.073)			99	289	---	---	---	---	PASS
OR5AK2	390181	broad.mit.edu	37	11	56757051	56757051	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56757051C>T	uc010rjp.1	+	1	663	c.663C>T	c.(661-663)ATC>ATT	p.I221I		NM_001005323	NP_001005323	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						ACATCTACATCATGGCCACCA	0.438													53	196	---	---	---	---	PASS
PRG2	5553	broad.mit.edu	37	11	57156683	57156683	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57156683C>T	uc001njz.2	-	2	193	c.166G>A	c.(166-168)GAA>AAA	p.E56K	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.E56K|PRG2_uc001nkb.2_Missense_Mutation_p.E56K|PRG2_uc001nkd.2_Missense_Mutation_p.E56K|PRG2_uc001nkc.2_Missense_Mutation_p.E56K|PRG2_uc001nke.2_Missense_Mutation_p.E336K	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	56					defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	TCCTCCTCTTCCTCCAGCTCC	0.547													27	82	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58723268	58723268	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58723268C>T	uc001nnf.2	+	8	1053	c.677C>T	c.(676-678)TCT>TTT	p.S226F	uc001nng.1_Intron|GLYATL1_uc001nnh.1_Missense_Mutation_p.S257F|GLYATL1_uc001nni.1_Missense_Mutation_p.S226F|GLYATL1_uc001nnj.1_Missense_Mutation_p.S226F			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;	226						mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	ATGGACCCTTCTTGTGAAGTA	0.517													20	44	---	---	---	---	PASS
CCDC86	79080	broad.mit.edu	37	11	60610305	60610305	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60610305G>A	uc001nqa.2	+	1	877	c.708G>A	c.(706-708)CCG>CCA	p.P236P	CCDC86_uc001nqb.2_5'UTR	NM_024098	NP_077003	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	236					interspecies interaction between organisms	nucleus					0						CTGTAATCCCGAAGGGGAAGC	0.567													9	35	---	---	---	---	PASS
FADS3	3995	broad.mit.edu	37	11	61644427	61644427	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61644427G>C	uc001nsm.2	-	8	1047	c.894C>G	c.(892-894)CTC>CTG	p.L298L	FADS3_uc001nsn.2_Silent_p.L174L	NM_021727	NP_068373	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	298	Lumenal (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	heme binding|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water			ovary(1)|pancreas(1)	2						TGGCGGCCCAGAGCAAATCCT	0.557													3	10	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288785	62288785	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288785G>C	uc001ntl.2	-	5	13404	c.13104C>G	c.(13102-13104)CTC>CTG	p.L4368L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4368					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TTGGACCCTTGAGTTTTGCAT	0.468													55	202	---	---	---	---	PASS
B3GAT3	26229	broad.mit.edu	37	11	62384199	62384199	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62384199G>C	uc001ntw.2	-	4	717	c.688C>G	c.(688-690)CAG>GAG	p.Q230E	B3GAT3_uc009ynz.2_Missense_Mutation_p.Q223E|B3GAT3_uc001ntx.2_RNA|B3GAT3_uc010rlz.1_Missense_Mutation_p.Q230E	NM_012200	NP_036332	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	230	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|manganese ion binding				0						TCCTGTACCTGAGGGCCCTCG	0.647													7	21	---	---	---	---	PASS
MAP4K2	5871	broad.mit.edu	37	11	64564578	64564578	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64564578C>T	uc001obh.2	-	19	1455	c.1363G>A	c.(1363-1365)GAG>AAG	p.E455K	MAP4K2_uc001obg.2_5'Flank|MAP4K2_uc001obi.2_Missense_Mutation_p.E447K	NM_004579	NP_004570	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase	455					activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2						CCTCTTACCTCAGGATCCTCC	0.657													9	62	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65268871	65268871	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65268871G>A	uc010roh.1	+	1		c.3639G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TTCTCACGTTGAGGTCTGTGG	0.403													6	26	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65268881	65268881	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65268881G>A	uc010roh.1	+	1		c.3649G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GAGGTCTGTGGAAGAGATGTC	0.393													6	25	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65268884	65268884	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65268884G>A	uc010roh.1	+	1		c.3652G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GTCTGTGGAAGAGATGTCCAT	0.383													6	24	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65269080	65269080	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269080G>A	uc010roh.1	+	1		c.3848G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TAGTACTATTGACAAACTGGG	0.433													29	74	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65269178	65269178	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269178G>A	uc010roh.1	+	1		c.3946G>A			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						ATTCCCAGTTGAAGCTGAAAA	0.448													8	56	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65269702	65269702	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269702G>C	uc010roh.1	+	1		c.4470G>C			uc001ody.2_RNA|MALAT1_uc001odz.2_RNA	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						ACAATTATGGGAAATGCAAAA	0.363													7	42	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65269914	65269914	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65269914G>C	uc010roh.1	+	1		c.4682G>C			uc001ody.2_RNA|MALAT1_uc001odz.2_Intron	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TTTAGTGTAGGAGAAATACTT	0.279													7	27	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65271095	65271095	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65271095G>C	uc010roh.1	+	1		c.5863G>C			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						TTTTATTAGAGAATGTATACT	0.299													16	43	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65271394	65271394	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65271394G>C	uc010roh.1	+	1		c.6162G>C			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						ATTATGATCAGAGTAAAAGGT	0.338													8	25	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65272844	65272844	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65272844G>C	uc010roh.1	+	1		c.7612G>C			uc001ody.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						AGGAATGCTTGAAGTACCCCT	0.438													16	68	---	---	---	---	PASS
FAM89B	23625	broad.mit.edu	37	11	65340999	65340999	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65340999G>A	uc001oem.2	+	2	739	c.418G>A	c.(418-420)GAC>AAC	p.D140N	FAM89B_uc001oen.2_3'UTR|FAM89B_uc001oel.2_Missense_Mutation_p.D153N|EHBP1L1_uc001oeo.3_5'Flank	NM_152832	NP_690045	Q8N5H3	FA89B_HUMAN	family with sequence similarity 89, member B	140											0						CCTGTCTGACGACGAGGAGCC	0.632													18	49	---	---	---	---	PASS
FAM89B	23625	broad.mit.edu	37	11	65341111	65341111	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65341111G>A	uc001oem.2	+	2	851	c.530G>A	c.(529-531)TGA>TAA	p.*177*	FAM89B_uc001oen.2_3'UTR|FAM89B_uc001oel.2_Silent_p.*190*|EHBP1L1_uc001oeo.3_5'Flank	NM_152832	NP_690045	Q8N5H3	FA89B_HUMAN	family with sequence similarity 89, member B	177											0						ATCAGCCTCTGAAGGGCTGGG	0.662													6	45	---	---	---	---	PASS
FAM89B	23625	broad.mit.edu	37	11	65341248	65341248	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65341248G>C	uc001oem.2	+	2					FAM89B_uc001oen.2_3'UTR|FAM89B_uc001oel.2_3'UTR|EHBP1L1_uc001oeo.3_5'Flank	NM_152832	NP_690045	Q8N5H3	FA89B_HUMAN	family with sequence similarity 89, member B												0						GTATTCCTCAGAGGCGAAACT	0.617													6	9	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65731532	65731532	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65731532C>T	uc001ogl.2	+						SART1_uc009yqy.1_Silent_p.F123F|SART1_uc010rot.1_Intron	NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T						cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						AGCCATGCTTCTTCTTGTTCC	0.552													13	52	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65733797	65733797	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65733797C>T	uc001ogl.2	+						SART1_uc010rot.1_Silent_p.P205P	NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T						cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						GCCTGGGTCCCAACCTGTACC	0.602													16	40	---	---	---	---	PASS
PACS1	55690	broad.mit.edu	37	11	65983668	65983668	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65983668G>C	uc001oha.1	+	5	873	c.739G>C	c.(739-741)GAA>CAA	p.E247Q	PACS1_uc001ogz.1_Missense_Mutation_p.E247Q	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	247					interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						GCCTGTGGCAGAAATAAAGAT	0.517													24	69	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66460711	66460711	+	Silent	SNP	C	T	T	rs146007976	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66460711C>T	uc001ojd.2	-	23	4872	c.4800G>A	c.(4798-4800)GCG>GCA	p.A1600A		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1600	Spectrin 13.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TCCAGGCCTCCGCCTCGGCGG	0.622													34	101	---	---	---	---	PASS
CLCF1	23529	broad.mit.edu	37	11	67133035	67133035	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67133035G>C	uc001okq.2	-	3	446	c.250C>G	c.(250-252)CTG>GTG	p.L84V	LOC100130987_uc010rpo.1_Intron|CLCF1_uc010rpp.1_Missense_Mutation_p.L74V	NM_013246	NP_037378	Q9UBD9	CLCF1_HUMAN	cardiotrophin-like cytokine factor 1 precursor	84					B cell differentiation|cytokine-mediated signaling pathway|JAK-STAT cascade|negative regulation of neuron apoptosis|positive regulation of astrocyte differentiation|positive regulation of B cell proliferation|positive regulation of immunoglobulin production|positive regulation of isotype switching to IgE isotypes|positive regulation of tyrosine phosphorylation of Stat3 protein	extracellular space	ciliary neurotrophic factor receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity				0			BRCA - Breast invasive adenocarcinoma(15;2.39e-06)			GCCCTGGGCAGAGTCTCTGCC	0.587													33	112	---	---	---	---	PASS
PPP1CA	5499	broad.mit.edu	37	11	67166318	67166318	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67166318C>T	uc001okw.1	-	6	880	c.757G>A	c.(757-759)GAC>AAC	p.D253N	PPP1CA_uc009yro.1_Missense_Mutation_p.D71N|PPP1CA_uc001okt.1_Missense_Mutation_p.D258N|PPP1CA_uc001oku.1_Missense_Mutation_p.D264N|PPP1CA_uc001okv.1_Missense_Mutation_p.D209N|PPP1CA_uc001okx.1_Missense_Mutation_p.D341N|PPP1CA_uc001oky.2_Missense_Mutation_p.D253N	NM_002708	NP_002699	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha	253					cell cycle|cell division|glycogen metabolic process|protein dephosphorylation|triglyceride catabolic process	cytosol|MLL5-L complex|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|protein binding|protein phosphatase type 1 regulator activity|protein serine/threonine phosphatase activity			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			TCGTAGCCGTCTTCTACCACC	0.627													33	84	---	---	---	---	PASS
PPP1CA	5499	broad.mit.edu	37	11	67166321	67166321	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67166321C>T	uc001okw.1	-	6	877	c.754G>A	c.(754-756)GAA>AAA	p.E252K	PPP1CA_uc009yro.1_Missense_Mutation_p.E70K|PPP1CA_uc001okt.1_Missense_Mutation_p.E257K|PPP1CA_uc001oku.1_Missense_Mutation_p.E263K|PPP1CA_uc001okv.1_Missense_Mutation_p.E208K|PPP1CA_uc001okx.1_Missense_Mutation_p.E340K|PPP1CA_uc001oky.2_Missense_Mutation_p.E252K	NM_002708	NP_002699	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha	252					cell cycle|cell division|glycogen metabolic process|protein dephosphorylation|triglyceride catabolic process	cytosol|MLL5-L complex|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|protein binding|protein phosphatase type 1 regulator activity|protein serine/threonine phosphatase activity			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			TAGCCGTCTTCTACCACCTGG	0.627													34	85	---	---	---	---	PASS
PPP1CA	5499	broad.mit.edu	37	11	67166578	67166578	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67166578C>T	uc001okw.1	-	5	703	c.580G>A	c.(580-582)GAT>AAT	p.D194N	PPP1CA_uc009yro.1_Missense_Mutation_p.D12N|PPP1CA_uc001okt.1_Missense_Mutation_p.D199N|PPP1CA_uc001oku.1_Missense_Mutation_p.D205N|PPP1CA_uc001okv.1_Missense_Mutation_p.D150N|PPP1CA_uc001okx.1_Missense_Mutation_p.D282N|PPP1CA_uc001oky.2_Missense_Mutation_p.D194N	NM_002708	NP_002699	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha	194					cell cycle|cell division|glycogen metabolic process|protein dephosphorylation|triglyceride catabolic process	cytosol|MLL5-L complex|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|protein binding|protein phosphatase type 1 regulator activity|protein serine/threonine phosphatase activity			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			TCAGGCACATCTGTGGGCCGC	0.622													26	79	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67172956	67172956	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67172956G>A	uc001ola.2	+	4	368	c.339G>A	c.(337-339)AAG>AAA	p.K113K	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_Silent_p.K113K|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	113	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TGTGCCAGAAGAACAGCCCTG	0.647													17	53	---	---	---	---	PASS
NDUFV1	4723	broad.mit.edu	37	11	67378081	67378081	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67378081G>C	uc001omj.2	+						NDUFV1_uc010rpv.1_Intron|NDUFV1_uc001oml.2_Intron|NDUFV1_uc001omk.3_Intron|NDUFV1_uc009yrz.1_Intron|NDUFV1_uc010rpw.1_5'UTR	NM_007103	NP_009034	P49821	NDUV1_HUMAN	NADH dehydrogenase ubiquinone flavoprotein 1						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	TGTGTCCTGTGACACCCGGGA	0.607													4	19	---	---	---	---	PASS
ALDH3B1	221	broad.mit.edu	37	11	67787235	67787235	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67787235G>C	uc010rpy.1	+	7	648	c.532G>C	c.(532-534)GAG>CAG	p.E178Q	ALDH3B1_uc001omz.2_Missense_Mutation_p.E178Q|ALDH3B1_uc001ona.2_Missense_Mutation_p.E141Q|ALDH3B1_uc001onb.2_RNA	NM_001161473	NP_001154945	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3B1 isoform a	178					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase				0					NADH(DB00157)	GCAGCTGCTAGAGCACAGGTT	0.652													25	100	---	---	---	---	PASS
FADD	8772	broad.mit.edu	37	11	70049613	70049613	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70049613G>A	uc001opm.2	+	1	345	c.48G>A	c.(46-48)TCG>TCA	p.S16S		NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain	16	DED.				activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCAGCCTGTCGAGCAGCGAGC	0.697													4	14	---	---	---	---	PASS
FADD	8772	broad.mit.edu	37	11	70049620	70049620	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70049620G>A	uc001opm.2	+	1	352	c.55G>A	c.(55-57)GAG>AAG	p.E19K		NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain	19	DED.				activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GTCGAGCAGCGAGCTGACCGA	0.692													5	15	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82643575	82643575	+	Missense_Mutation	SNP	G	C	C	rs149497860		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82643575G>C	uc001ozt.2	+	6	1439	c.1195G>C	c.(1195-1197)GAA>CAA	p.E399Q	C11orf82_uc010rsr.1_Missense_Mutation_p.E98Q|C11orf82_uc010rss.1_Missense_Mutation_p.E98Q|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	399					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						ACTCAGACTTGAAGAGACAGC	0.468													70	221	---	---	---	---	PASS
ME3	10873	broad.mit.edu	37	11	86160971	86160971	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86160971C>T	uc001pbz.2	-	9	1345	c.1091G>A	c.(1090-1092)AGA>AAA	p.R364K	ME3_uc001pca.2_Missense_Mutation_p.R364K|ME3_uc009yvk.2_Missense_Mutation_p.R364K|ME3_uc010rtr.1_RNA	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor	364					aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	CCAGATCTTTCTTGTGGCCTC	0.522													48	145	---	---	---	---	PASS
PIWIL4	143689	broad.mit.edu	37	11	94335120	94335120	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94335120G>A	uc001pfa.2	+	12	1751	c.1540G>A	c.(1540-1542)GGA>AGA	p.G514R	PIWIL4_uc010rue.1_RNA|PIWIL4_uc009ywk.1_RNA	NM_152431	NP_689644	Q7Z3Z4	PIWL4_HUMAN	piwi-like 4	514					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|meiosis|multicellular organismal development|piRNA metabolic process|regulation of translation|spermatogenesis	nucleus|piP-body	piRNA binding			skin(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGGTTCCATGGGATTTAATGT	0.378													28	119	---	---	---	---	PASS
CCDC82	79780	broad.mit.edu	37	11	96116406	96116406	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96116406G>C	uc009ywp.2	-						CCDC82_uc009ywq.2_Intron|CCDC82_uc001pfx.3_Intron|CCDC82_uc009ywr.2_Intron|CCDC82_uc009yws.2_Missense_Mutation_p.H340D	NM_024725	NP_079001	Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82								protein binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		AACAATTCATGAAACATTTTC	0.254													9	55	---	---	---	---	PASS
YAP1	10413	broad.mit.edu	37	11	102100669	102100669	+	Nonstop_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102100669T>C	uc001pgt.2	+	9	1883	c.1513T>C	c.(1513-1515)TAG>CAG	p.*505Q	YAP1_uc001pgs.2_Nonstop_Mutation_p.*455Q|YAP1_uc001pgu.2_Nonstop_Mutation_p.*489Q|YAP1_uc001pgv.2_Nonstop_Mutation_p.*451Q|YAP1_uc010ruo.1_Nonstop_Mutation_p.*327Q|YAP1_uc001pgw.2_Nonstop_Mutation_p.*329Q|YAP1_uc010rup.1_Nonstop_Mutation_p.*270Q	NM_001130145	NP_001123617	P46937	YAP1_HUMAN	Yes-associated protein 1, 65kDa isoform 1	505					cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TACATGGTTATAGAGCCCTCA	0.433													53	116	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105789548	105789548	+	Missense_Mutation	SNP	C	G	G	rs145685023		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105789548C>G	uc001pix.2	+	11	1826	c.1380C>G	c.(1378-1380)ATC>ATG	p.I460M	GRIA4_uc001piw.2_Missense_Mutation_p.I460M	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	460	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	ATATTGGTATCAAGTATAAAA	0.353													20	53	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108160459	108160459	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108160459G>A	uc001pkb.1	+	29	4752	c.4367G>A	c.(4366-4368)GGC>GAC	p.G1456D	ATM_uc009yxr.1_Missense_Mutation_p.G1456D|ATM_uc001pkd.3_Missense_Mutation_p.G108D|ATM_uc001pke.1_Missense_Mutation_p.G108D|ATM_uc010rvw.1_Missense_Mutation_p.G108D|ATM_uc001pkf.2_Missense_Mutation_p.G108D	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1456					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		ATAAAAAGTGGCTTAGGAGGA	0.313			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			16	62	---	---	---	---	PASS
PPP2R1B	5519	broad.mit.edu	37	11	111636995	111636995	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111636995C>T	uc001plx.1	-	1	175	c.91G>A	c.(91-93)GAG>AAG	p.E31K	PPP2R1B_uc001plw.1_Missense_Mutation_p.E31K|PPP2R1B_uc010rwi.1_Missense_Mutation_p.E31K|PPP2R1B_uc010rwj.1_5'UTR|PPP2R1B_uc010rwk.1_Missense_Mutation_p.E31K|PPP2R1B_uc010rwl.1_Missense_Mutation_p.E31K	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	31	HEAT 1.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		TTGCGGAGCTCGTCGATTAAA	0.637													14	69	---	---	---	---	PASS
USP28	57646	broad.mit.edu	37	11	113697974	113697974	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113697974G>A	uc001poh.2	-	11	1201	c.1168C>T	c.(1168-1170)CAG>TAG	p.Q390*	USP28_uc001pog.2_Nonsense_Mutation_p.Q98*|USP28_uc010rwy.1_Nonsense_Mutation_p.Q265*|USP28_uc001poi.2_5'UTR|USP28_uc001poj.3_Nonsense_Mutation_p.Q390*	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	390					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TAAATAATCTGAGGAAATTCC	0.363													14	70	---	---	---	---	PASS
REXO2	25996	broad.mit.edu	37	11	114320818	114320818	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114320818C>G	uc001poy.2	+	7					REXO2_uc001poz.2_3'UTR	NM_015523	NP_056338	Q9Y3B8	ORN_HUMAN	small fragment nuclease precursor						nucleotide metabolic process	mitochondrion|nucleus	3'-5' exonuclease activity|nucleic acid binding				0		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.65e-06)|Epithelial(105;6.09e-05)|all cancers(92;0.000494)		ATTGATTACTCAAGCAGACAG	0.438													8	33	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118361911	118361911	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118361911G>A	uc001pta.2	+	14	4720	c.4697G>A	c.(4696-4698)GGA>GAA	p.G1566E	MLL_uc001ptb.2_Missense_Mutation_p.G1566E|MLL_uc001pte.1_RNA	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1566	PHD-type 3.				apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TTGCTTTCAGGAAACTTCTGC	0.418			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								13	69	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310898	124310898	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310898G>A	uc010sal.1	-	1	84	c.84C>T	c.(82-84)TTC>TTT	p.F28F		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GAAACAGGAAGAAGAGGGGGA	0.502													13	77	---	---	---	---	PASS
PANX3	116337	broad.mit.edu	37	11	124482954	124482954	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124482954C>A	uc001qah.2	+	2	260	c.260C>A	c.(259-261)TCA>TAA	p.S87*		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	87	Extracellular (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TGCTGGGACTCACTGCTTCAC	0.557													18	70	---	---	---	---	PASS
FOXRED1	55572	broad.mit.edu	37	11	126139077	126139077	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126139077C>T	uc001qdi.2	+	1					SRPR_uc001qdh.2_5'Flank|SRPR_uc010sbm.1_5'Flank|FOXRED1_uc010sbn.1_5'UTR|FOXRED1_uc010sbo.1_RNA|FOXRED1_uc010sbp.1_5'UTR|FOXRED1_uc010sbq.1_5'UTR|FOXRED1_uc001qdj.2_5'UTR|FOXRED1_uc010sbr.1_5'Flank|FOXRED1_uc001qdk.2_5'Flank	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GTGCAGCTTTCAGAGGGTCCG	0.662													5	41	---	---	---	---	PASS
FOXRED1	55572	broad.mit.edu	37	11	126139117	126139117	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126139117C>T	uc001qdi.2	+	1	63	c.16C>T	c.(16-18)CTG>TTG	p.L6L	SRPR_uc001qdh.2_5'Flank|SRPR_uc010sbm.1_5'Flank|FOXRED1_uc010sbn.1_5'UTR|FOXRED1_uc010sbo.1_RNA|FOXRED1_uc010sbp.1_5'UTR|FOXRED1_uc010sbq.1_5'UTR|FOXRED1_uc001qdj.2_5'UTR|FOXRED1_uc010sbr.1_5'UTR|FOXRED1_uc001qdk.2_5'Flank	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing	6						integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		TCGGAGGGTTCTGCCGCACGG	0.617													18	65	---	---	---	---	PASS
KCNJ5	3762	broad.mit.edu	37	11	128781855	128781855	+	Silent	SNP	C	T	T	rs149327599		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128781855C>T	uc001qet.2	+	2	1001	c.687C>T	c.(685-687)ATC>ATT	p.I229I	KCNJ5_uc009zck.2_Silent_p.I229I|KCNJ5_uc001qew.2_Silent_p.I229I	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	229	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	ACTCCCACATCGTGGAGGCCT	0.592													38	119	---	---	---	---	PASS
NFRKB	4798	broad.mit.edu	37	11	129762750	129762750	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129762750C>T	uc001qfi.2	-	3					NFRKB_uc001qfg.2_Missense_Mutation_p.E12K|NFRKB_uc001qfh.2_Missense_Mutation_p.E22K|NFRKB_uc010sbw.1_5'UTR	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein						DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		TCCATTGTTTCTTCTCCACAG	0.488													47	158	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134064592	134064592	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134064592C>T	uc001qhd.1	-	14	2263	c.1657G>A	c.(1657-1659)GAG>AAG	p.E553K	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	553	HEAT 2.				cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTGGTCTTCTCATCCCTGATC	0.418													14	79	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	936320	936320	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:936320G>A	uc001qio.3	+	3	1552	c.1045G>A	c.(1045-1047)GAT>AAT	p.D349N	WNK1_uc001qin.2_Missense_Mutation_p.D349N|WNK1_uc001qip.3_Missense_Mutation_p.D349N	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	349	Protein kinase.	Proton acceptor (By similarity).			intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CATTCACCGCGATCTTAAATG	0.463													69	225	---	---	---	---	PASS
RAD52	5893	broad.mit.edu	37	12	1025667	1025667	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1025667G>A	uc001qis.1	-						RAD52_uc001qit.1_Intron|RAD52_uc010sdt.1_Intron|RAD52_uc001qiu.1_Intron|RAD52_uc001qiv.1_RNA|RAD52_uc001qiw.1_Intron|RAD52_uc010sdu.1_Missense_Mutation_p.R254C	NM_134424	NP_602296	P43351	RAD52_HUMAN	RAD52 homolog						DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)			AGAGGGCGGCGGCGAGGACGG	0.537								Homologous_recombination					5	24	---	---	---	---	PASS
TEAD4	7004	broad.mit.edu	37	12	3103927	3103927	+	5'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3103927G>A	uc010sej.1	+	3					TEAD4_uc010sek.1_5'UTR|TEAD4_uc001qln.2_Intron	NM_003213	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4 isoform 1						hippo signaling cascade|muscle organ development|skeletal system development		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			TCCTCCAAGCGGAGCCTTGGA	0.672													11	40	---	---	---	---	PASS
KCNA1	3736	broad.mit.edu	37	12	5020928	5020928	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5020928G>A	uc001qnh.2	+	2	1489	c.384G>A	c.(382-384)GAG>GAA	p.E128E		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	128					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGGCCATGGAGAAGTTCCGGG	0.632													18	77	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6690250	6690250	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6690250C>G	uc001qpo.2	-	33	5033	c.4869G>C	c.(4867-4869)GTG>GTC	p.V1623V	CHD4_uc001qpn.2_Silent_p.V1616V|CHD4_uc001qpp.2_Silent_p.V1648V|uc001qpq.1_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1623	Required for interaction with PCNT.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TTCTCTCCTTCACCTCTGCCT	0.403													103	357	---	---	---	---	PASS
PHB2	11331	broad.mit.edu	37	12	7079717	7079717	+	5'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7079717G>C	uc001qsd.2	-	1					PHB2_uc010sft.1_5'UTR|PHB2_uc010sfu.1_5'UTR|EMG1_uc009zfo.2_5'Flank|EMG1_uc001qsh.3_5'Flank|EMG1_uc010sfv.1_5'Flank	NM_001144831	NP_001138303	Q99623	PHB2_HUMAN	prohibitin 2 isoform 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial inner membrane|nucleus	estrogen receptor binding|receptor activity			ovary(2)|pancreas(1)	3						GTCTGATCTTGAGGCCGGCGG	0.701													6	20	---	---	---	---	PASS
CLEC2D	29121	broad.mit.edu	37	12	9848477	9848477	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9848477G>A	uc001qwg.1	+	5					CLEC2D_uc001qwf.1_3'UTR|CLEC2D_uc009zgs.1_RNA|CLEC2D_uc001qwh.1_RNA|CLEC2D_uc009zgt.1_RNA|CLEC2D_uc009zgu.1_3'UTR	NM_013269	NP_037401	Q9UHP7	CLC2D_HUMAN	osteoclast inhibitory lectin isoform 1						cell surface receptor linked signaling pathway	cell surface|endoplasmic reticulum|integral to plasma membrane|membrane fraction	sugar binding|transmembrane receptor activity				0						tgaagatgatgatgatgatga	0.338													4	19	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21200106	21200106	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21200106G>C	uc010sin.1	+	7	949	c.949G>C	c.(949-951)GAG>CAG	p.E317Q	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.E364Q	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	317						membrane	transporter activity				0						TAAAATGGTGGAGCAACAGTA	0.338													9	25	---	---	---	---	PASS
C12orf39	80763	broad.mit.edu	37	12	21680080	21680080	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21680080G>A	uc001rfa.1	+	3	250	c.99G>A	c.(97-99)GAG>GAA	p.E33E	C12orf39_uc009ziv.1_5'Flank|C12orf39_uc009ziw.1_5'Flank	NM_030572	NP_085049	Q9BT56	SPXN_HUMAN	spexin precursor	33						extracellular region|nucleus|transport vesicle					0						GACTGTTGGAGAGAAGGAACT	0.433													34	133	---	---	---	---	PASS
C12orf11	55726	broad.mit.edu	37	12	27066551	27066551	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27066551C>T	uc001rhk.3	-	14	2181	c.1644G>A	c.(1642-1644)GAG>GAA	p.E548E	C12orf11_uc001rhj.3_Silent_p.E116E|C12orf11_uc010sjk.1_Silent_p.E447E	NM_018164	NP_060634	Q9NVM9	M89BB_HUMAN	hypothetical protein LOC55726	548					cell division|mitosis|regulation of mitotic cell cycle		protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	Colorectal(261;0.0847)					TTTGATGTTTCTCTGAGTTGT	0.418													115	375	---	---	---	---	PASS
FGD4	121512	broad.mit.edu	37	12	32735372	32735372	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32735372G>A	uc001rkz.2	+	4	1048	c.571G>A	c.(571-573)GAG>AAG	p.E191K	FGD4_uc001rlc.2_Missense_Mutation_p.E276K|FGD4_uc001rky.2_5'UTR|FGD4_uc001rla.2_5'UTR|FGD4_uc010ske.1_Missense_Mutation_p.E303K|FGD4_uc001rlb.1_RNA|FGD4_uc001rkx.3_Missense_Mutation_p.E191K	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	191					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TCTGGAACTGGAGCAGCTGGA	0.498													14	75	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40753217	40753217	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40753217G>C	uc001rmg.3	+	47	7120	c.6999G>C	c.(6997-6999)CAG>CAC	p.Q2333H	LRRK2_uc009zjw.2_Missense_Mutation_p.Q1171H|LRRK2_uc001rmi.2_Missense_Mutation_p.Q1166H	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2333					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCACCATTCAGAAACTCATTG	0.303													16	64	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48369179	48369179	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48369179G>A	uc001rqu.2	-	51	3988	c.3807C>T	c.(3805-3807)ATC>ATT	p.I1269I	COL2A1_uc001rqt.2_Silent_p.I50I|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Silent_p.I1200I	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1269	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CGGGGCTGCGGATGCTCTCAA	0.607													25	91	---	---	---	---	PASS
ADCY6	112	broad.mit.edu	37	12	49176905	49176905	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49176905C>T	uc001rsh.3	-	1	973	c.313G>A	c.(313-315)GAG>AAG	p.E105K	ADCY6_uc001rsj.3_Missense_Mutation_p.E105K|ADCY6_uc001rsi.3_Missense_Mutation_p.E105K	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	105	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						GGCGCCACCTCAGCCGTCCCG	0.711													22	89	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49228219	49228219	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49228219G>C	uc001rsm.2	-	12	1535	c.1444C>G	c.(1444-1446)CAA>GAA	p.Q482E		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	482	Helicase ATP-binding.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						TCAATCTGTTGAGCCAACTCA	0.547													33	110	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49231850	49231850	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49231850G>C	uc001rsm.2	-	6	585	c.494C>G	c.(493-495)TCT>TGT	p.S165C		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	165	Glu-rich.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						TTCTGCTTTAGAGAGGAACTT	0.498													39	164	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49434415	49434415	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49434415G>A	uc001rta.3	-	31	7138	c.7138C>T	c.(7138-7140)CAG>TAG	p.Q2380*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2380	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AATGGGGGCTGAGCATATGGG	0.652			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			19	41	---	---	---	---	PASS
SPRYD3	84926	broad.mit.edu	37	12	53460151	53460151	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53460151C>G	uc001sbt.1	-	10	1162	c.1141G>C	c.(1141-1143)GAG>CAG	p.E381Q		NM_032840	NP_116229	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	381	Glu-rich.									central_nervous_system(1)	1						tcctcttcctcttcctcttcc	0.443											OREG0021856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	73	---	---	---	---	PASS
SPRYD3	84926	broad.mit.edu	37	12	53460160	53460160	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53460160C>T	uc001sbt.1	-	10	1153	c.1132G>A	c.(1132-1134)GAA>AAA	p.E378K		NM_032840	NP_116229	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	378	Glu-rich.									central_nervous_system(1)	1						tcttcctcttcctcctcttcc	0.428											OREG0021856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	71	---	---	---	---	PASS
ATF7	11016	broad.mit.edu	37	12	53911120	53911120	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53911120G>C	uc001sdy.2	-	11	1307	c.1286C>G	c.(1285-1287)TCA>TGA	p.S429*	ATF7_uc010sok.1_RNA|ATF7_uc001sdz.2_Nonsense_Mutation_p.S418*|ATF7_uc010sol.1_Nonsense_Mutation_p.S397*|uc001sdx.2_RNA	NM_001130059	NP_001123531	P17544	ATF7_HUMAN	activating transcription factor 7 isoform 1	429	Essential for binding adenovirus 2 E1A.				interspecies interaction between organisms	cytoplasm|nuclear periphery|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2						CGTTGGCTCTGAGCTTTCCTT	0.547													8	20	---	---	---	---	PASS
GPR84	53831	broad.mit.edu	37	12	54756622	54756622	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54756622G>A	uc001sfu.2	-	2	1104	c.1014C>T	c.(1012-1014)CTC>CTT	p.L338L		NM_020370	NP_065103	Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	338	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			breast(2)	2						CCAGAATGTTGAGCAGCAAGA	0.537													59	168	---	---	---	---	PASS
RDH5	5959	broad.mit.edu	37	12	56118392	56118392	+	3'UTR	SNP	A	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56118392A>C	uc001shk.2	+	5					RDH5_uc001shl.2_3'UTR	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)						response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)	TTCTGCCCCCACCCTGGTACT	0.468											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	17	---	---	---	---	PASS
PA2G4	5036	broad.mit.edu	37	12	56505295	56505295	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56505295G>C	uc001sjm.2	+	12	1520	c.1101G>C	c.(1099-1101)CAG>CAC	p.Q367H	PA2G4_uc009zol.2_Intron|PA2G4_uc009zom.2_Intron	NM_006191	NP_006182	Q9UQ80	PA2G4_HUMAN	ErbB3-binding protein 1	367	Necessary for nucleolar localization.|Interaction with RNA (By similarity).				cell cycle arrest|cell proliferation|negative regulation of transcription, DNA-dependent|regulation of translation|rRNA processing	cytoplasm|nucleolus|ribonucleoprotein complex	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			GAAAAACCCAGAAAAAGAAAA	0.393													33	142	---	---	---	---	PASS
RPL41	6171	broad.mit.edu	37	12	56510496	56510496	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56510496C>T	uc001sjn.2	+						RPL41_uc001sjo.2_5'UTR|ZC3H10_uc001sjp.1_5'Flank	NM_021104		P62945	RL41_HUMAN	ribosomal protein L41						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0			OV - Ovarian serous cystadenocarcinoma(18;0.12)			CCATAGACATCTGACCTCGGC	0.498													40	131	---	---	---	---	PASS
RPL41	6171	broad.mit.edu	37	12	56510503	56510503	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56510503C>T	uc001sjn.2	+						RPL41_uc001sjo.2_5'UTR|ZC3H10_uc001sjp.1_5'Flank	NM_021104		P62945	RL41_HUMAN	ribosomal protein L41						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0			OV - Ovarian serous cystadenocarcinoma(18;0.12)			CATCTGACCTCGGCACTTAGC	0.493													41	145	---	---	---	---	PASS
MIP	4284	broad.mit.edu	37	12	56848060	56848060	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56848060C>G	uc001slh.2	-	1	370	c.338G>C	c.(337-339)CGA>CCA	p.R113P		NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	113	Extracellular (By similarity).				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						TAGGTTTCCTCGGACAGCAGG	0.597													16	60	---	---	---	---	PASS
GLS2	27165	broad.mit.edu	37	12	56868840	56868840	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56868840G>C	uc001slj.2	-	10	1263	c.984C>G	c.(982-984)CTC>CTG	p.L328L	GLS2_uc009zos.2_RNA|GLS2_uc001slk.2_Silent_p.L63L|GLS2_uc009zot.2_Intron	NM_013267	NP_037399	Q9UI32	GLSL_HUMAN	glutaminase 2 precursor	328				LK -> HE (in Ref. 1; AAF21933).	cellular amino acid biosynthetic process|glutamate secretion|glutamine metabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity|protein binding			ovary(1)|central_nervous_system(1)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TCTTTTCCTTGAGATAATAGC	0.502													56	200	---	---	---	---	PASS
MYO1A	4640	broad.mit.edu	37	12	57441538	57441538	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57441538G>A	uc001smw.3	-						MYO1A_uc010sqz.1_5'UTR|MYO1A_uc009zpd.2_Intron	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA						sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						TGACTATTGTGAAACCAGTTC	0.517													7	34	---	---	---	---	PASS
DTX3	196403	broad.mit.edu	37	12	58001129	58001129	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58001129G>C	uc001sow.1	+	5	820	c.483G>C	c.(481-483)GAG>GAC	p.E161D	DTX3_uc001sov.1_Missense_Mutation_p.E154D|DTX3_uc001sox.1_Missense_Mutation_p.E154D|DTX3_uc001soy.1_Missense_Mutation_p.E154D|GEFT_uc009zpy.2_5'Flank|GEFT_uc001soz.1_5'Flank	NM_178502	NP_848597	Q8N9I9	DTX3_HUMAN	deltex homolog 3	161					Notch signaling pathway	cytoplasm	zinc ion binding			breast(1)|central_nervous_system(1)	2	Melanoma(17;0.122)					AAGAGCAGGAGAGCACCTGCC	0.483													6	16	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63963010	63963010	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63963010C>G	uc001srp.1	-	21	2301	c.2120G>C	c.(2119-2121)AGA>ACA	p.R707T	DPY19L2_uc010sso.1_Missense_Mutation_p.R154T	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	707					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCACTTAGTTCTCACAACACA	0.299													37	120	---	---	---	---	PASS
DYRK2	8445	broad.mit.edu	37	12	68052255	68052255	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68052255G>A	uc001str.3	+	3	1970	c.1568G>A	c.(1567-1569)CGC>CAC	p.R523H	DYRK2_uc001sts.3_Missense_Mutation_p.R450H	NM_006482	NP_006473	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	523	Protein kinase.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|positive regulation of glycogen biosynthetic process|smoothened signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|manganese ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(1)|central_nervous_system(1)	4			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		CCTGCAGTGCGCATGACCCCA	0.577													4	151	---	---	---	---	PASS
KRR1	11103	broad.mit.edu	37	12	75900673	75900673	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75900673C>T	uc001sxt.2	-	3	323	c.282G>A	c.(280-282)CTG>CTA	p.L94L	KRR1_uc009zsc.2_Silent_p.L94L|KRR1_uc010stx.1_Silent_p.L94L	NM_007043	NP_008974	Q13601	KRR1_HUMAN	HIV-1 rev binding protein 2	94					rRNA processing	nucleolus|ribonucleoprotein complex	RNA binding			ovary(1)|pancreas(1)	2						TGCCTTCGATCAGGTCCAGGG	0.373													22	56	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78225383	78225383	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78225383G>T	uc001syp.2	+	1	315	c.142G>T	c.(142-144)GAG>TAG	p.E48*	NAV3_uc001syo.2_Nonsense_Mutation_p.E48*	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	48						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TACTGAAACAGAGAGCTCCAT	0.453										HNSCC(70;0.22)			34	115	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88391905	88391905	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88391905G>C	uc001tam.1	-	4	364	c.196C>G	c.(196-198)CTG>GTG	p.L66V	C12orf50_uc001tan.2_Missense_Mutation_p.L120V	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	66										skin(2)|ovary(1)	3						TGAGGTTTCAGAGGTTCTTGA	0.373													22	53	---	---	---	---	PASS
DEPDC4	120863	broad.mit.edu	37	12	100649888	100649888	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100649888C>G	uc001thi.2	-	4	820	c.817G>C	c.(817-819)GAT>CAT	p.D273H	DEPDC4_uc001thh.1_RNA|DEPDC4_uc001thj.1_Missense_Mutation_p.D219H|DEPDC4_uc009ztv.1_Missense_Mutation_p.D273H|DEPDC4_uc001thk.1_Missense_Mutation_p.D84H|DEPDC4_uc001thl.1_RNA	NM_152317	NP_689530	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	273					intracellular signal transduction						0						ATAACAAGATCTTCCTCTTTG	0.328													26	91	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101711260	101711260	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101711260G>C	uc001tia.1	+	22	2713	c.2557G>C	c.(2557-2559)GAG>CAG	p.E853Q		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	853					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						CGGTAGCAATGAGTATTACCC	0.473													16	51	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102036345	102036345	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102036345G>C	uc001tii.2	+	9	841	c.739G>C	c.(739-741)GAG>CAG	p.E247Q	MYBPC1_uc001tif.1_Missense_Mutation_p.E260Q|MYBPC1_uc001tig.2_Missense_Mutation_p.E272Q|MYBPC1_uc010svq.1_Missense_Mutation_p.E234Q|MYBPC1_uc001tih.2_Missense_Mutation_p.E272Q|MYBPC1_uc001tij.2_Missense_Mutation_p.E247Q|MYBPC1_uc010svr.1_Missense_Mutation_p.E247Q|MYBPC1_uc010svs.1_Missense_Mutation_p.E247Q|MYBPC1_uc010svt.1_Missense_Mutation_p.E235Q|MYBPC1_uc010svu.1_Missense_Mutation_p.E228Q|MYBPC1_uc001tik.2_Missense_Mutation_p.E221Q	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	247					cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						CATGCGCAGAGAGGAGAAGAA	0.632													4	9	---	---	---	---	PASS
WSCD2	9671	broad.mit.edu	37	12	108589501	108589501	+	5'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108589501G>A	uc001tms.2	+	2					WSCD2_uc001tmt.2_5'UTR	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						TGAGACTGAGGACCCCCAAGT	0.557													4	19	---	---	---	---	PASS
ANKRD13A	88455	broad.mit.edu	37	12	110463573	110463573	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110463573G>A	uc001tpx.2	+	8	1087	c.828G>A	c.(826-828)GTG>GTA	p.V276V	ANKRD13A_uc009zvl.1_RNA|ANKRD13A_uc010sxw.1_Silent_p.V276V|ANKRD13A_uc001tpy.2_5'UTR|ANKRD13A_uc001tpz.2_5'Flank	NM_033121	NP_149112	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13	276											0						ATGTGAATGTGATCACCAAAA	0.398													57	123	---	---	---	---	PASS
BRAP	8315	broad.mit.edu	37	12	112096587	112096587	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112096587C>T	uc001tsn.3	-	9	1368	c.1174G>A	c.(1174-1176)GAG>AAG	p.E392K	BRAP_uc010syh.1_Missense_Mutation_p.E213K|BRAP_uc009zvv.2_Missense_Mutation_p.E362K	NM_006768	NP_006759	Q7Z569	BRAP_HUMAN	BRCA1 associated protein	392					MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1						GTATCCCCCTCACATTCATAC	0.348													18	73	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117685219	117685219	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117685219C>G	uc001twm.1	-	18	3443	c.2757G>C	c.(2755-2757)ATG>ATC	p.M919I		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	919	Flavodoxin-like.				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CCCCTTCCCTCATCTTCAGGA	0.547													25	97	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120166373	120166373	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120166373C>T	uc001txi.1	-	27	3452	c.3399G>A	c.(3397-3399)ATG>ATA	p.M1133I	CIT_uc001txh.1_Missense_Mutation_p.M667I|CIT_uc001txj.1_Missense_Mutation_p.M1175I	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	1133	Potential.|Interaction with Rho/Rac.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TTCGGGCATTCATTTCAAGCA	0.463													84	280	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	121882022	121882022	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121882022G>C	uc001uat.2	-	16	2348	c.2244C>G	c.(2242-2244)CTC>CTG	p.L748L	KDM2B_uc001uaq.2_Silent_p.L188L|KDM2B_uc010szy.1_Silent_p.L188L|KDM2B_uc001uar.2_Silent_p.L339L|KDM2B_uc001uas.2_Silent_p.L717L|KDM2B_uc001uau.2_Intron|KDM2B_uc001uao.2_5'UTR|KDM2B_uc010szx.1_5'UTR|KDM2B_uc001uap.2_RNA	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	748					embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						TCTGCTCCTTGAGCAGGGAGC	0.572											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	38	90	---	---	---	---	PASS
SETD8	387893	broad.mit.edu	37	12	123875261	123875261	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123875261G>A	uc001uew.2	+	3	259	c.217G>A	c.(217-219)GAG>AAG	p.E73K	SETD8_uc001uex.2_Missense_Mutation_p.E8K	NM_020382	NP_065115	Q9NQR1	SETD8_HUMAN	SET domain-containing 8	114					cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		CCTTCAGGAAGAGAACTCAGT	0.453													24	90	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130830392	130830392	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130830392G>A	uc001uik.2	+	4	375	c.285G>A	c.(283-285)CAG>CAA	p.Q95Q	PIWIL1_uc001uij.1_Silent_p.Q95Q	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	95					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ATACAAGGCAGAACCTAGACC	0.393													19	84	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131498798	131498798	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131498798G>A	uc001uit.3	+	13	1945	c.1386G>A	c.(1384-1386)CTG>CTA	p.L462L	GPR133_uc010tbm.1_Silent_p.L494L	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	462	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CCAGCCACCTGATTTCCCTGG	0.582													8	102	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132515894	132515894	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132515894G>C	uc001ujn.2	+						EP400_uc001ujl.2_Intron|EP400_uc001ujm.2_Intron|SNORA49_uc001ujo.2_RNA	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400						histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CCTACAAGTTGAGCTGACAGT	0.458													35	129	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19412455	19412455	+	RNA	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19412455C>T	uc010tcj.1	-	1		c.33655G>A				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GAAAGTTGTTCAGTAAGAAAC	0.398													7	16	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20077383	20077383	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20077383C>G	uc001umd.2	-	2					TPTE2_uc009zzl.2_5'UTR|TPTE2_uc001ume.2_5'UTR|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid							endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATACGTGCCTCTGGGTTCACT	0.358													3	83	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567555	20567555	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567555G>A	uc001umr.2	+	4	641	c.343G>A	c.(343-345)GAG>AAG	p.E115K	ZMYM2_uc001umq.2_Missense_Mutation_p.E115K|ZMYM2_uc001ums.2_Missense_Mutation_p.E115K|ZMYM2_uc001umt.2_Missense_Mutation_p.E115K|ZMYM2_uc009zzn.1_Missense_Mutation_p.E137K	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	115					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AAGTGTAAGTGAGACAATTGT	0.353													13	33	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567608	20567608	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567608G>C	uc001umr.2	+	4	694	c.396G>C	c.(394-396)GAG>GAC	p.E132D	ZMYM2_uc001umq.2_Missense_Mutation_p.E132D|ZMYM2_uc001ums.2_Missense_Mutation_p.E132D|ZMYM2_uc001umt.2_Missense_Mutation_p.E132D|ZMYM2_uc009zzn.1_Missense_Mutation_p.E154D	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	132					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AAGGGCAAGAGAAAAATTCCT	0.383													17	65	---	---	---	---	PASS
LATS2	26524	broad.mit.edu	37	13	21562246	21562246	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21562246C>T	uc009zzs.2	-	4	2038	c.1673G>A	c.(1672-1674)CGC>CAC	p.R558H	LATS2_uc001unr.3_Missense_Mutation_p.R558H	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN	LATS, large tumor suppressor, homolog 2	558					cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.R558H(1)		lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		GGCGCTTTTGCGGCTCTTGTC	0.612													5	150	---	---	---	---	PASS
MRP63	78988	broad.mit.edu	37	13	21751269	21751269	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21751269G>C	uc001unw.2	+	2	704	c.214G>C	c.(214-216)GAG>CAG	p.E72Q	SKA3_uc001unt.2_5'Flank|SKA3_uc001unv.2_5'Flank|SKA3_uc001unu.2_5'Flank	NM_024026	NP_076931	Q9BQC6	RT63_HUMAN	mitochondrial ribosomal protein 63	72											0		all_cancers(29;2.76e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.43e-05)|Epithelial(112;0.000285)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|Lung(94;0.0932)		GGAGGCCTTCGAGGCCATAAA	0.612													12	41	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	36229746	36229746	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36229746G>A	uc001uvb.2	+	54	8365	c.8159G>A	c.(8158-8160)TGG>TAG	p.W2720*	NBEA_uc010abi.2_Nonsense_Mutation_p.W1376*|NBEA_uc010tef.1_Nonsense_Mutation_p.W513*|NBEA_uc001uvd.2_Nonsense_Mutation_p.W298*	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2720	WD 2.					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTGGCCATTGGGATGTGGTC	0.458													61	214	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41515451	41515451	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41515451G>A	uc001uxs.2	-	8	1235	c.862C>T	c.(862-864)CAG>TAG	p.Q288*	ELF1_uc010tfc.1_Nonsense_Mutation_p.Q264*|ELF1_uc010acd.2_Nonsense_Mutation_p.Q181*	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	288	ETS.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TCTTTAAACTGATACACCAAG	0.368													58	185	---	---	---	---	PASS
KBTBD6	89890	broad.mit.edu	37	13	41705016	41705016	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41705016C>G	uc001uxu.1	-	1	1921	c.1632G>C	c.(1630-1632)TGG>TGC	p.W544C	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.W478C|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	544	Kelch 4.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TCATTTGCCTCCATTCTGCCC	0.448													52	173	---	---	---	---	PASS
KBTBD6	89890	broad.mit.edu	37	13	41705099	41705099	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41705099C>T	uc001uxu.1	-	1	1838	c.1549G>A	c.(1549-1551)GAA>AAA	p.E517K	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.E451K|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	517	Kelch 3.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		ACGCAGGCTTCCTGAAAGTCA	0.433													20	109	---	---	---	---	PASS
KBTBD6	89890	broad.mit.edu	37	13	41706332	41706332	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41706332C>G	uc001uxu.1	-	1	605	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Intron|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	106	BTB.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		TGCTGGCTCTCGTACATGCCA	0.622													17	59	---	---	---	---	PASS
NAA16	79612	broad.mit.edu	37	13	41943355	41943355	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41943355G>C	uc001uyf.2	+	15	2207	c.1883G>C	c.(1882-1884)AGA>ACA	p.R628T	NAA16_uc010tfg.1_RNA	NM_024561	NP_078837	Q6N069	NAA16_HUMAN	NMDA receptor regulated 1-like protein isoform	628					N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding			central_nervous_system(1)	1						aagaaaaaaagagatgaagaa	0.224													13	69	---	---	---	---	PASS
TNFSF11	8600	broad.mit.edu	37	13	43180957	43180957	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43180957G>C	uc001uyu.2	+	5	1006	c.857G>C	c.(856-858)GGA>GCA	p.G286A	TNFSF11_uc001uyt.2_Missense_Mutation_p.G213A	NM_003701	NP_003692	O14788	TNF11_HUMAN	tumor necrosis factor ligand superfamily, member	286	Extracellular (Potential).				immune response|monocyte chemotaxis|osteoclast differentiation|positive regulation of bone resorption|positive regulation of corticotropin-releasing hormone secretion|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of homotypic cell-cell adhesion|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell activation	cytoplasm|extracellular space|integral to plasma membrane	cytokine activity|receptor activity|tumor necrosis factor receptor binding				0		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)		TTACGGTCTGGAGAGGAAATC	0.433													36	135	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50276524	50276524	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50276524C>T	uc001vdj.2	-	16	1880	c.1465G>A	c.(1465-1467)GAT>AAT	p.D489N		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	489					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		CTACTTACATCATCACCAGAG	0.274													9	42	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50299570	50299570	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299570G>A	uc001vdj.2	-	7	866	c.451C>T	c.(451-453)CAA>TAA	p.Q151*		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	151	ARM 3.|NLS binding site (major) (By similarity).				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		ACAACAGCTTGAGTCTGTGCA	0.338													14	44	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50299581	50299581	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50299581G>A	uc001vdj.2	-	7	855	c.440C>T	c.(439-441)TCT>TTT	p.S147F		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	147	ARM 2.|NLS binding site (major) (By similarity).				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		AGTCTGTGCAGAAGTTCCTGA	0.348													15	49	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92560198	92560198	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92560198C>T	uc010tif.1	+	6	1654	c.1288C>T	c.(1288-1290)CAG>TAG	p.Q430*		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	430						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TAGTTATACTCAGCGTGTGGT	0.383													20	74	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103298650	103298650	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103298650G>A	uc001vpi.3	+	20	2503	c.2400G>A	c.(2398-2400)GTG>GTA	p.V800V		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	800					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACAGCCCAGTGAGTGCAAAAA	0.338													11	41	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103701788	103701788	+	Missense_Mutation	SNP	G	A	A	rs145541774		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103701788G>A	uc001vpy.3	-	5	1367	c.770C>T	c.(769-771)ACG>ATG	p.T257M		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	257	Extracellular (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAAAGCAACCGTTCGGCACCT	0.408													18	55	---	---	---	---	PASS
FAM155A	728215	broad.mit.edu	37	13	108518440	108518440	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108518440C>T	uc001vql.2	-	1	1021	c.505G>A	c.(505-507)GAG>AAG	p.E169K		NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	169						integral to membrane	binding			skin(1)	1						TAACAAGTCTCCAGGCGCCAC	0.697													16	66	---	---	---	---	PASS
RAB20	55647	broad.mit.edu	37	13	111213942	111213942	+	5'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111213942G>C	uc001vqy.2	-	1						NM_017817	NP_060287	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			GGCGCAGCTGGAGGAGCGGAC	0.716													8	30	---	---	---	---	PASS
FAM70B	348013	broad.mit.edu	37	13	114469311	114469311	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114469311C>T	uc001vuh.2	+						FAM70B_uc010tkh.1_Silent_p.L90L	NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			CACGCCAGCTCACAGGGCTGG	0.483													11	33	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20841487	20841487	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20841487G>A	uc001vxe.2	-	47	6796	c.6756C>T	c.(6754-6756)CTC>CTT	p.L2252L	TEP1_uc010ahj.1_5'Flank|TEP1_uc010ahk.2_Silent_p.L1595L|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Silent_p.L2144L|TEP1_uc010tlh.1_Silent_p.L590L	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	2252	WD 15.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CGGTCAGCATGAGGCCTGAGG	0.587													38	113	---	---	---	---	PASS
RNASE10	338879	broad.mit.edu	37	14	20978929	20978929	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20978929C>G	uc010tlj.1	+	1	299	c.299C>G	c.(298-300)TCA>TGA	p.S100*	RNASE10_uc001vxp.2_Nonsense_Mutation_p.S128*	NM_001012975	NP_001012993	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	100						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		CTCAGAGCCTCAGCTCTCTTT	0.493													11	35	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21863460	21863460	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21863460C>T	uc001was.1	-	29	4436	c.4342G>A	c.(4342-4344)GAA>AAA	p.E1448K	CHD8_uc001war.1_Missense_Mutation_p.E1344K	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1727					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGTTTACCTTCATCTCCATCA	0.468													7	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22938145	22938145	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22938145C>G	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001web.1_Missense_Mutation_p.D77H					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TGAGTAAAATCTGCACCTTCT	0.413													28	78	---	---	---	---	PASS
CDH24	64403	broad.mit.edu	37	14	23524387	23524387	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23524387G>A	uc001wil.2	-	3	637	c.377C>T	c.(376-378)TCC>TTC	p.S126F	CDH24_uc010akf.2_Missense_Mutation_p.S126F|CDH24_uc001win.3_Missense_Mutation_p.S126F	NM_022478	NP_071923	Q86UP0	CAD24_HUMAN	cadherin-like 24 isoform 1	126	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|cell-cell adhesion|homophilic cell adhesion	cell-cell junction|cell-cell junction|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|delta-catenin binding			central_nervous_system(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		GGGCCGGTTGGAGGCTCGGTC	0.552											OREG0022594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	131	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31574848	31574848	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31574848G>C	uc001wrc.1	-	39	7742	c.7253C>G	c.(7252-7254)TCA>TGA	p.S2418*	HECTD1_uc001wra.1_Nonsense_Mutation_p.S544*|HECTD1_uc001wrb.1_Nonsense_Mutation_p.S544*	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	2418	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ATATATTCTTGAGGAAGGGCA	0.328													35	83	---	---	---	---	PASS
PSMA6	5687	broad.mit.edu	37	14	35786501	35786501	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35786501G>C	uc001wtd.2	+	7	839	c.730G>C	c.(730-732)GAG>CAG	p.E244Q	KIAA0391_uc001wta.2_RNA|PSMA6_uc010tpt.1_Missense_Mutation_p.E165Q|PSMA6_uc010tpu.1_Missense_Mutation_p.E165Q	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit	244					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		TGCTCTAGCAGAGAGAGACTA	0.383													30	168	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39762517	39762517	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39762517G>A	uc001wvg.3	+	6	763	c.427G>A	c.(427-429)GAT>AAT	p.D143N	CTAGE5_uc010tqe.1_Missense_Mutation_p.D105N|CTAGE5_uc001wuz.3_Missense_Mutation_p.D131N|CTAGE5_uc001wuy.3_Missense_Mutation_p.D63N|CTAGE5_uc001wvb.3_Missense_Mutation_p.D114N|CTAGE5_uc001wvc.3_Missense_Mutation_p.D88N|CTAGE5_uc001wva.3_Missense_Mutation_p.D114N|CTAGE5_uc001wve.1_Missense_Mutation_p.D119N|CTAGE5_uc001wvh.3_Missense_Mutation_p.D143N|CTAGE5_uc001wvf.3_Missense_Mutation_p.D68N|CTAGE5_uc001wvi.3_Missense_Mutation_p.D148N|CTAGE5_uc010amz.2_5'UTR|CTAGE5_uc001wvj.3_Missense_Mutation_p.D114N	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	143	Potential.						enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TGAACTTGAGGATGAAATACT	0.323													6	66	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45658401	45658401	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45658401C>G	uc001wwd.3	+	20	5275	c.5176C>G	c.(5176-5178)CCA>GCA	p.P1726A	FANCM_uc010anf.2_Missense_Mutation_p.P1700A|FANCM_uc001wwe.3_Missense_Mutation_p.P1262A|FANCM_uc010ang.2_Missense_Mutation_p.P940A	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1726					DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AAGAGTTAATCCATTAGCAAA	0.408								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				72	222	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51196370	51196370	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51196370C>T	uc001wym.2	-	29	6140	c.5949G>A	c.(5947-5949)CAG>CAA	p.Q1983Q	NIN_uc001wyi.2_Silent_p.Q1983Q|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Silent_p.Q1270Q|NIN_uc010tqp.1_Silent_p.Q1989Q|NIN_uc001wyo.2_Silent_p.Q1983Q|NIN_uc001wyn.2_RNA	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1983	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GACAGGCTTGCTGCTGGAGCA	0.582			T	PDGFRB	MPD								5	19	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51204915	51204915	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51204915C>T	uc001wym.2	-	27	5909	c.5718G>A	c.(5716-5718)TTG>TTA	p.L1906L	NIN_uc001wyi.2_Silent_p.L1906L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Silent_p.L1193L|NIN_uc010tqp.1_Silent_p.L1912L|NIN_uc001wyo.2_Silent_p.L1906L|NIN_uc001wyn.2_RNA	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1906					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					TCTTTAAGCTCAATTTTTCTT	0.413			T	PDGFRB	MPD								46	146	---	---	---	---	PASS
MUDENG	55745	broad.mit.edu	37	14	57741516	57741516	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57741516C>G	uc001xcv.2	+	2	1056	c.629C>G	c.(628-630)TCT>TGT	p.S210C	MUDENG_uc001xcu.3_Missense_Mutation_p.S210C|MUDENG_uc010tri.1_Intron|MUDENG_uc010trj.1_Missense_Mutation_p.S107C	NM_018229	NP_060699	Q9H0R1	MUDEN_HUMAN	Mu-2 related death-inducing protein	210	MHD.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex				ovary(1)	1						CCACAAGTTTCTATTTCTATC	0.378													22	101	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58831340	58831340	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58831340G>A	uc001xdp.2	+	20	2787	c.2533G>A	c.(2533-2535)GAA>AAA	p.E845K	ARID4A_uc001xdo.2_Missense_Mutation_p.E845K|ARID4A_uc001xdq.2_Missense_Mutation_p.E845K|ARID4A_uc010apg.1_Missense_Mutation_p.E523K	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	845					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TACAGAAGATGAAATTGACCA	0.343													8	50	---	---	---	---	PASS
C14orf39	317761	broad.mit.edu	37	14	60923747	60923747	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60923747C>T	uc001xez.3	-	15	1356	c.1246G>A	c.(1246-1248)GAG>AAG	p.E416K	C14orf39_uc010apo.2_Missense_Mutation_p.E127K	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	416										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		GGAAAATTCTCAGCTCTCTCT	0.353													47	158	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73614734	73614734	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73614734G>A	uc001xnr.2	+	3	291	c.7G>A	c.(7-9)GAG>AAG	p.E3K	PSEN1_uc001xnv.2_Missense_Mutation_p.E3K|PSEN1_uc010ark.2_Missense_Mutation_p.E3K|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA|PSEN1_uc001xnq.3_Missense_Mutation_p.E3K	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	3	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TCCAATGACAGAGTTACCTGC	0.428													11	38	---	---	---	---	PASS
ACOT6	641372	broad.mit.edu	37	14	74086448	74086448	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74086448C>T	uc001xop.2	+	2	860	c.529C>T	c.(529-531)CAC>TAC	p.H177Y		NM_001037162	NP_001032239	Q3I5F7	ACOT6_HUMAN	acyl-CoA thioesterase 6	177						cytosol	carboxylesterase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GCCAAAGGCTCACTCAAAGGC	0.423													13	71	---	---	---	---	PASS
PNMA1	9240	broad.mit.edu	37	14	74179622	74179622	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74179622C>G	uc001xor.1	-	1	1507	c.721G>C	c.(721-723)GAG>CAG	p.E241Q		NM_006029	NP_006020	Q8ND90	PNMA1_HUMAN	paraneoplastic antigen MA1	241					apoptosis|central nervous system development|inflammatory response to antigenic stimulus|spermatogenesis	cytoplasm|focal adhesion|nucleolus	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		ctagagctctcaacgctccca	0.000													35	132	---	---	---	---	PASS
PNMA1	9240	broad.mit.edu	37	14	74180243	74180243	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74180243C>T	uc001xor.1	-	1	886	c.100G>A	c.(100-102)GAA>AAA	p.E34K		NM_006029	NP_006020	Q8ND90	PNMA1_HUMAN	paraneoplastic antigen MA1	34					apoptosis|central nervous system development|inflammatory response to antigenic stimulus|spermatogenesis	cytoplasm|focal adhesion|nucleolus	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		tcttcgatttcagcctcatca	0.000													57	171	---	---	---	---	PASS
C14orf115	55237	broad.mit.edu	37	14	74824670	74824670	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74824670C>G	uc001xpw.3	+	2	1375	c.1184C>G	c.(1183-1185)TCA>TGA	p.S395*		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	395					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		CTGGCGGTGTCAAGCCCTGGA	0.607													9	58	---	---	---	---	PASS
TTLL5	23093	broad.mit.edu	37	14	76249706	76249706	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76249706C>T	uc001xrx.2	+	26	3024	c.2819C>T	c.(2818-2820)TCT>TTT	p.S940F	TTLL5_uc010ask.1_Missense_Mutation_p.S954F|TTLL5_uc001xrz.2_Missense_Mutation_p.S515F|TTLL5_uc001xsa.2_Missense_Mutation_p.S13F|TTLL5_uc001xry.1_RNA	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	940					protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		AACACAGTCTCTGCCAGTGCT	0.537													25	90	---	---	---	---	PASS
TTLL5	23093	broad.mit.edu	37	14	76249833	76249833	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76249833C>T	uc001xrx.2	+	26	3151	c.2946C>T	c.(2944-2946)ATC>ATT	p.I982I	TTLL5_uc010ask.1_Silent_p.I996I|TTLL5_uc001xrz.2_Silent_p.I557I|TTLL5_uc001xsa.2_Silent_p.I55I|TTLL5_uc001xry.1_RNA	NM_015072	NP_055887	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	982					protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)		CTGCACACATCTATAGCCAGA	0.532													20	109	---	---	---	---	PASS
C14orf4	64207	broad.mit.edu	37	14	77492255	77492255	+	Silent	SNP	G	C	C	rs142866521		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77492255G>C	uc001xsy.2	-	1	2780	c.1881C>G	c.(1879-1881)CTC>CTG	p.L627L		NM_024496	NP_078772	Q9H1B7	I2BPL_HUMAN	chromosome 14 open reading frame 4	627						nucleus					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.00347)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)		CCACCGACATGAGAGCGGCCA	0.582													6	20	---	---	---	---	PASS
SEL1L	6400	broad.mit.edu	37	14	81950592	81950592	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81950592C>G	uc010tvv.1	-	19	2140	c.2023G>C	c.(2023-2025)GAG>CAG	p.E675Q		NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor	675	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.|Sel1-like 11.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		AGTCCTTTCTCATGCATATAT	0.393													147	551	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96807895	96807895	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96807895G>A	uc001yfi.2	-	6	1253	c.888C>T	c.(886-888)CTC>CTT	p.L296L		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	296										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GTTTCAACGTGAGACTCAACT	0.393													25	94	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96912857	96912857	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96912857G>C	uc001yfn.2	+	8	827	c.783G>C	c.(781-783)GTG>GTC	p.V261V		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	261	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TCTGCAGAGTGATACAAAACG	0.473													25	59	---	---	---	---	PASS
BAG5	9529	broad.mit.edu	37	14	104026370	104026370	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104026370C>A	uc001yni.1	-	2	1366	c.1132G>T	c.(1132-1134)GAG>TAG	p.E378*	KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Nonsense_Mutation_p.E419*|BAG5_uc001ynj.1_Nonsense_Mutation_p.E378*|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	NM_004873	NP_004864	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5 isoform b	378	BAG 5.				apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding			ovary(2)	2		Melanoma(154;0.155)	Epithelial(46;0.144)			CCCTGGATCTCAGACAAGTTT	0.483													39	121	---	---	---	---	PASS
BAG5	9529	broad.mit.edu	37	14	104026577	104026577	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104026577C>T	uc001yni.1	-	2	1159	c.925G>A	c.(925-927)GAA>AAA	p.E309K	KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Missense_Mutation_p.E350K|BAG5_uc001ynj.1_Missense_Mutation_p.E309K|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	NM_004873	NP_004864	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5 isoform b	309	BAG 4.				apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding			ovary(2)	2		Melanoma(154;0.155)	Epithelial(46;0.144)			CCCTGCAATTCTGTTTTGGAG	0.408													31	102	---	---	---	---	PASS
KLC1	3831	broad.mit.edu	37	14	104037964	104037964	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104037964C>G	uc010tyd.1	+	2	168	c.128C>G	c.(127-129)TCA>TGA	p.S43*	C14orf153_uc001ynl.3_RNA|C14orf153_uc010tyc.1_Nonsense_Mutation_p.S56*	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1	Error:Variant_position_missing_in_Q07866_after_alignment					blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				TTAAAGGTCTCAAGATTCTGC	0.299													25	107	---	---	---	---	PASS
INF2	64423	broad.mit.edu	37	14	105169764	105169764	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105169764C>T	uc001ypb.2	+	4	783	c.640C>T	c.(640-642)CGC>TGC	p.R214C	INF2_uc010tyi.1_Missense_Mutation_p.R214C|INF2_uc001ypc.2_Missense_Mutation_p.R214C|INF2_uc001yoy.3_Missense_Mutation_p.R214C|INF2_uc001ypa.2_Missense_Mutation_p.R214C	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1	214	GBD/FH3.		R -> H (in FSGS5).		actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CCTGCGCGCGCGCACCCAGCT	0.652													28	130	---	---	---	---	PASS
INF2	64423	broad.mit.edu	37	14	105177451	105177451	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105177451C>T	uc001ypb.2	+	15	2489	c.2346C>T	c.(2344-2346)ATC>ATT	p.I782I	INF2_uc010tyi.1_Silent_p.I782I|INF2_uc001ypc.2_Silent_p.I782I|INF2_uc010awz.1_RNA	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1	782	FH2.				actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		GCTTCAAGATCAGCACATTGC	0.667													3	7	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35082582	35082582	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35082582G>C	uc001ziu.1	-	7					uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein						apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CCGTCATCCTGACTGGAAGGT	0.448													32	66	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40920870	40920870	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40920870G>C	uc010bbs.1	+	13	5816	c.5655G>C	c.(5653-5655)TTG>TTC	p.L1885F	CASC5_uc010bbt.1_Missense_Mutation_p.L1859F	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1885	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AAGAGAGCTTGAGGGAGGTAT	0.308													12	91	---	---	---	---	PASS
DLL4	54567	broad.mit.edu	37	15	41229093	41229093	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41229093G>C	uc001zng.1	+	9	2228	c.1908G>C	c.(1906-1908)AAG>AAC	p.K636N		NM_019074	NP_061947	Q9NR61	DLL4_HUMAN	delta-like 4 protein precursor	636	Cytoplasmic (Potential).				blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding			breast(2)	2		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		ACAGTGACAAGAGCTTAGGAG	0.612													8	25	---	---	---	---	PASS
VPS39	23339	broad.mit.edu	37	15	42462051	42462051	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42462051C>T	uc001zpd.2	-	13	1288	c.1137G>A	c.(1135-1137)GTG>GTA	p.V379V	VPS39_uc001zpc.2_Silent_p.V368V	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	379					protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ACAGGCCCATCACATGGGTGG	0.468													32	108	---	---	---	---	PASS
GANC	2595	broad.mit.edu	37	15	42568597	42568597	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42568597C>T	uc001zpi.2	+	2	395	c.81C>T	c.(79-81)ATC>ATT	p.I27I	GANC_uc001zph.2_Silent_p.I27I|GANC_uc001zpj.1_5'UTR|TMEM87A_uc010udd.1_5'Flank|TMEM87A_uc001zpf.3_5'Flank|TMEM87A_uc010bcu.1_5'Flank|TMEM87A_uc001zpg.2_5'Flank|GANC_uc010ude.1_Silent_p.I27I	NM_198141	NP_937784	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	27					carbohydrate metabolic process		carbohydrate binding|maltose alpha-glucosidase activity			central_nervous_system(2)	2		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)		GTAACAAGATCGCATTTTACA	0.294													3	31	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43826784	43826784	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43826784G>C	uc001zrw.2	-	31					PPIP5K1_uc001zrx.1_3'UTR|PPIP5K1_uc001zru.2_3'UTR|PPIP5K1_uc001zry.3_3'UTR|PPIP5K1_uc001zrv.2_3'UTR	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A						inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						GACTGGCTCTGAGGGTTTGGA	0.493													25	98	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43873500	43873500	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43873500C>T	uc001zrw.2	-	9	1047	c.864G>A	c.(862-864)GGG>GGA	p.G288G	PPIP5K1_uc001zrx.1_Silent_p.G288G|PPIP5K1_uc001zru.2_Silent_p.G288G|PPIP5K1_uc001zry.3_Silent_p.G288G|PPIP5K1_uc001zrv.2_Silent_p.G288G|PPIP5K1_uc001zrz.1_Silent_p.G288G|PPIP5K1_uc010udr.1_Silent_p.G288G	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	288					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						GAATCTCTTTCCCCTCACTGT	0.512													52	259	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52069173	52069173	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52069173G>A	uc002abk.2	+	5	672	c.451G>A	c.(451-453)GAA>AAA	p.E151K	TMOD2_uc002abl.3_Missense_Mutation_p.E151K|TMOD2_uc010bfb.2_Missense_Mutation_p.E107K	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	151					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		AAAGTTCGATGAAGAAACAGC	0.418													23	59	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53908309	53908309	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53908309G>C	uc002acj.2	-	15	2136	c.2094C>G	c.(2092-2094)CTC>CTG	p.L698L	WDR72_uc010bfi.1_Silent_p.L698L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	698										lung(1)|skin(1)	2				all cancers(107;0.0511)		CAACATCACTGAGTGGAGTTG	0.408													9	83	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56130727	56130727	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56130727C>T	uc002adj.2	-	18	3664	c.3364G>A	c.(3364-3366)GAT>AAT	p.D1122N	NEDD4_uc002adl.2_Missense_Mutation_p.D703N|NEDD4_uc002adi.2_Missense_Mutation_p.D1050N|NEDD4_uc010ugj.1_Missense_Mutation_p.D1106N|NEDD4_uc010bfm.2_Missense_Mutation_p.D1105N|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	1122	HECT.				development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		AGTTCTTCATCTATGATAAAC	0.308													21	66	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59387110	59387110	+	3'UTR	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59387110C>A	uc002afv.2	+	14					RNF111_uc002afs.2_3'UTR|RNF111_uc002aft.2_3'UTR|RNF111_uc002afu.2_3'UTR|RNF111_uc002afw.2_3'UTR|RNF111_uc002afx.2_3'UTR|RNF111_uc002afy.2_3'UTR	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		CACCATGTTTCAGAACTCTTG	0.473													37	115	---	---	---	---	PASS
SPG21	51324	broad.mit.edu	37	15	65255979	65255979	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65255979G>A	uc002aod.2	-	9	1002	c.909C>T	c.(907-909)ATC>ATT	p.I303I	SPG21_uc002aoe.2_Silent_p.I303I|SPG21_uc010bhb.2_Silent_p.I276I|SPG21_uc010bhc.2_Silent_p.I149I	NM_001127889	NP_001121361	Q9NZD8	SPG21_HUMAN	spastic paraplegia 21 isoform a	303					cell death	cytosol|endosome membrane|trans-Golgi network transport vesicle	CD4 receptor binding				0						CCTCCTGGCTGATGCCAAGGC	0.527													48	124	---	---	---	---	PASS
C15orf44	81556	broad.mit.edu	37	15	65871820	65871820	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65871820C>G	uc002apd.2	-	12	1819	c.1483G>C	c.(1483-1485)GAG>CAG	p.E495Q	C15orf44_uc010uix.1_Missense_Mutation_p.E531Q|C15orf44_uc010uiz.1_Missense_Mutation_p.E459Q|C15orf44_uc010uja.1_Missense_Mutation_p.E445Q|C15orf44_uc010ujb.1_Missense_Mutation_p.E416Q|C15orf44_uc002ape.3_Missense_Mutation_p.E495Q|C15orf44_uc010uiy.1_Missense_Mutation_p.E416Q	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	495										ovary(1)	1						GCGGCATACTCAGAGGTGCCG	0.532													38	127	---	---	---	---	PASS
RAB11A	8766	broad.mit.edu	37	15	66161846	66161846	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66161846C>G	uc002apk.2	+	1					RAB11A_uc010ujk.1_5'UTR	NM_004663	NP_004654	P62491	RB11A_HUMAN	Ras-related protein Rab-11A						cell cycle|cytokinesis|neuron projection development|plasma membrane to endosome transport|protein localization in plasma membrane|small GTPase mediated signal transduction|vesicle-mediated transport	cleavage furrow|plasma membrane|recycling endosome membrane|trans-Golgi network	GTP binding|GTPase activity|syntaxin binding				0						GCTCGGCGCTCGGGTTACCCC	0.642													12	47	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73660074	73660074	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73660074C>T	uc002avp.2	-	1	1532	c.538G>A	c.(538-540)GAG>AAG	p.E180K		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	180	Cytoplasmic (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		GAGGGCTGCTCGCAGGAGGCG	0.786													5	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	82620400	82620400	+	RNA	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82620400T>C	uc010bls.1	+	1		c.493T>C								Homo sapiens mRNA for FLJ00317 protein.																		GACCCAAGGGTCAGCCTGAGT	0.672													4	8	---	---	---	---	PASS
TM6SF1	53346	broad.mit.edu	37	15	83776476	83776476	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83776476C>G	uc002bjp.2	+	1	153	c.44C>G	c.(43-45)TCG>TGG	p.S15W	TM6SF1_uc010bmq.2_Missense_Mutation_p.S15W|TM6SF1_uc002bjq.2_Missense_Mutation_p.S15W|TM6SF1_uc010bmr.2_RNA	NM_023003	NP_075379	Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1 isoform 1	15	Helical; (Potential).					integral to membrane				ovary(1)	1						CTGTCCCTCTCGGCCATCCCG	0.567													5	25	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89398115	89398115	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89398115G>A	uc010upo.1	+	12	2673	c.2299G>A	c.(2299-2301)GCA>ACA	p.A767T	ACAN_uc010upp.1_Missense_Mutation_p.A767T|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	767					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CACTGGCGCAGCAACAGAGGA	0.522													3	19	---	---	---	---	PASS
CRTC3	64784	broad.mit.edu	37	15	91083274	91083274	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91083274C>G	uc002bpp.2	+	2	242	c.136C>G	c.(136-138)CAA>GAA	p.Q46E	CRTC3_uc002bpn.2_Missense_Mutation_p.Q46E|CRTC3_uc002bpo.2_Missense_Mutation_p.Q46E	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform	46	Required for interaction with HTLV-1 TAX.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TTTCCAGGTTCAATTTCAGAA	0.443			T	MAML2	salivary gland mucoepidermoid								25	48	---	---	---	---	PASS
FURIN	5045	broad.mit.edu	37	15	91424753	91424753	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91424753G>A	uc002bpu.1	+	16	2246	c.2030G>A	c.(2029-2031)CGG>CAG	p.R677Q	FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	NM_002569	NP_002560	P09958	FURIN_HUMAN	furin preproprotein	677	Cys-rich.				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)|lung(2)|breast(1)	7	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			ACTTGCTCCCGGCAAAGCCAG	0.716													4	22	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1756554	1756554	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1756554G>A	uc002cmk.2	+	1	334	c.214G>A	c.(214-216)GAG>AAG	p.E72K	MAPK8IP3_uc002cmi.1_Missense_Mutation_p.E72K|MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Missense_Mutation_p.E72K|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.E72K	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	72	Potential.				vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						GGTGCTCAGCGAGAACCAGGA	0.637													11	23	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2159441	2159441	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2159441G>A	uc002cos.1	-	15	5936	c.5727C>T	c.(5725-5727)ATC>ATT	p.I1909I	PKD1_uc002cot.1_Silent_p.I1909I	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1909	Extracellular (Potential).|PKD 15.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CAGCCAGCAGGATCTGAAAAT	0.701													6	23	---	---	---	---	PASS
AMDHD2	51005	broad.mit.edu	37	16	2570863	2570863	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2570863G>A	uc002cqq.2	+	2	274	c.177G>A	c.(175-177)GGG>GGA	p.G59G	AMDHD2_uc002cqp.2_Silent_p.G59G|AMDHD2_uc010uwc.1_Silent_p.G59G|AMDHD2_uc010uwd.1_Intron	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2 isoform 1	59					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			skin(2)|large_intestine(1)|breast(1)	4						GGGACTGCGGGGGCCGCATCT	0.687													4	33	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3273910	3273910	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3273910C>G	uc002cuj.2	-	5	1802	c.1170G>C	c.(1168-1170)AAG>AAC	p.K390N	ZNF200_uc002cum.3_Missense_Mutation_p.K389N|ZNF200_uc010bti.2_Missense_Mutation_p.K389N|ZNF200_uc002cuk.2_Missense_Mutation_p.K390N|ZNF200_uc002cui.2_Missense_Mutation_p.K389N|ZNF200_uc002cul.3_Missense_Mutation_p.K389N	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	390					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						GCTTTCGGGTCTTACAGGCTG	0.483													50	307	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3273931	3273931	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3273931C>G	uc002cuj.2	-	5	1781	c.1149G>C	c.(1147-1149)GAG>GAC	p.E383D	ZNF200_uc002cum.3_Missense_Mutation_p.E382D|ZNF200_uc010bti.2_Missense_Mutation_p.E382D|ZNF200_uc002cuk.2_Missense_Mutation_p.E383D|ZNF200_uc002cui.2_Missense_Mutation_p.E382D|ZNF200_uc002cul.3_Missense_Mutation_p.E382D	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	383	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						AGTGGGTTTTCTCATGCCGGG	0.478													44	351	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3273959	3273959	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3273959C>G	uc002cuj.2	-	5	1753	c.1121G>C	c.(1120-1122)GGT>GCT	p.G374A	ZNF200_uc002cum.3_Missense_Mutation_p.G373A|ZNF200_uc010bti.2_Missense_Mutation_p.G373A|ZNF200_uc002cuk.2_Missense_Mutation_p.G374A|ZNF200_uc002cui.2_Missense_Mutation_p.G373A|ZNF200_uc002cul.3_Missense_Mutation_p.G373A	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	374	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						TGACAGCCGACCAAATCTTCT	0.483													46	418	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3273997	3273997	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3273997C>T	uc002cuj.2	-	5	1715	c.1083G>A	c.(1081-1083)GAG>GAA	p.E361E	ZNF200_uc002cum.3_Silent_p.E360E|ZNF200_uc010bti.2_Silent_p.E360E|ZNF200_uc002cuk.2_Silent_p.E361E|ZNF200_uc002cui.2_Silent_p.E360E|ZNF200_uc002cul.3_Silent_p.E360E	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	361					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						CATATGGTCTCTCAGCCTCAT	0.453													87	394	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3339455	3339455	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3339455C>T	uc002cuq.2	+	6	1281	c.949C>T	c.(949-951)CAG>TAG	p.Q317*	ZNF263_uc010uww.1_5'UTR|ZNF263_uc002cur.2_5'UTR	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	317					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						CATCCACCCTCAGGTGCTGCT	0.562													45	163	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3656547	3656547	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3656547C>T	uc002cvp.2	-	3	1315	c.688G>A	c.(688-690)GAG>AAG	p.E230K	BTBD12_uc002cvq.1_Missense_Mutation_p.E230K	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	230	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						AGGGAGCACTCTTCTGAAGCG	0.542								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				81	268	---	---	---	---	PASS
GLIS2	84662	broad.mit.edu	37	16	4382347	4382347	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4382347G>C	uc002cwc.1	+	1	123	c.66G>C	c.(64-66)GAG>GAC	p.E22D		NM_032575	NP_115964	Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	22					cell differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development	cytoplasm|nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|transcription regulatory region DNA binding|zinc ion binding				0						CGGCAAGAGAGAAGCGGGAGA	0.682													10	40	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4412079	4412079	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4412079G>A	uc002cwh.3	-	16	1605	c.1485C>T	c.(1483-1485)CTC>CTT	p.L495L	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Silent_p.L495L|CORO7_uc002cwg.3_Silent_p.L275L|CORO7_uc010uxh.1_Silent_p.L477L|CORO7_uc010uxi.1_Silent_p.L410L|CORO7_uc002cwi.1_Silent_p.L275L|CORO7_uc010uxj.1_RNA|CORO7_uc010btp.1_Silent_p.L275L	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	495						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CAGGTGTGGTGAGGTTGAGCC	0.642													12	46	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4933745	4933745	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4933745C>T	uc002cyd.1	-	22	5001	c.4911G>A	c.(4909-4911)CAG>CAA	p.Q1637Q		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	1637	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						CCAGGCGCTTCTGCAGCTCGT	0.632													16	53	---	---	---	---	PASS
RSL1D1	26156	broad.mit.edu	37	16	11940562	11940562	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11940562G>C	uc002dbp.1	-	4	596	c.523C>G	c.(523-525)CAA>GAA	p.Q175E	RSL1D1_uc010buv.1_Missense_Mutation_p.Q175E|RSL1D1_uc010uyw.1_Translation_Start_Site|RSL1D1_uc010buw.2_RNA	NM_015659	NP_056474	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	175					regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TTCTTTCTTTGATAGAAATGT	0.413													85	262	---	---	---	---	PASS
EARS2	124454	broad.mit.edu	37	16	23543988	23543988	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23543988C>T	uc002dlt.3	-	5	1089	c.1057G>A	c.(1057-1059)GAA>AAA	p.E353K	EARS2_uc002dlr.3_RNA|EARS2_uc002dls.3_RNA|EARS2_uc002dlu.2_Missense_Mutation_p.E353K	NM_001083614	NP_001077083	Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2 precursor	353					glutamyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|glutamate-tRNA ligase activity|RNA binding				0				GBM - Glioblastoma multiforme(48;0.0353)	L-Glutamic Acid(DB00142)	CTGTTGAATTCTGGGAGCTTC	0.512													15	48	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23647411	23647411	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23647411C>G	uc002dlx.1	-	4	656	c.456G>C	c.(454-456)AAG>AAC	p.K152N		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	152	Interaction with RAD51.|Required for its oligomerization and is important for its focal concentration at DNA damage sites.|Interaction with BRCA1.				double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		TAAATGTCCTCTTCTGCTGCT	0.443			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				4	136	---	---	---	---	PASS
DCTN5	84516	broad.mit.edu	37	16	23669929	23669929	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23669929C>G	uc002dly.1	+	3	276	c.219C>G	c.(217-219)TTC>TTG	p.F73L		NM_032486	NP_115875	Q9BTE1	DCTN5_HUMAN	dynactin 5	73						centrosome	transferase activity			upper_aerodigestive_tract(1)	1				GBM - Glioblastoma multiforme(48;0.0156)		GGCCACCATTCAAGAAGTTCA	0.423													36	109	---	---	---	---	PASS
ERN2	10595	broad.mit.edu	37	16	23706204	23706204	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23706204C>G	uc002dma.3	-	17	2258	c.2089G>C	c.(2089-2091)GAC>CAC	p.D697H	ERN2_uc010bxp.2_Missense_Mutation_p.D645H	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	649	Protein kinase.|Cytoplasmic (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		CCCTGGCTGTCAGGCCCGGTG	0.627													15	48	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29883590	29883590	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29883590G>A	uc002duq.3	-	16	2861	c.2621C>T	c.(2620-2622)TCC>TTC	p.S874F	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.S817F|SEZ6L2_uc002dur.3_Missense_Mutation_p.S804F|SEZ6L2_uc002dus.3_Missense_Mutation_p.S773F|SEZ6L2_uc010vec.1_Missense_Mutation_p.S887F|SEZ6L2_uc010ved.1_Missense_Mutation_p.S843F	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	874	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GCCGAAAAGGGACTTTCCCTG	0.602													11	54	---	---	---	---	PASS
FUS	2521	broad.mit.edu	37	16	31195651	31195651	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31195651C>T	uc002ebf.2	+	5	540	c.457C>T	c.(457-459)CAG>TAG	p.Q153*	FUS_uc002ebe.1_Nonsense_Mutation_p.Q153*|FUS_uc002ebh.2_Nonsense_Mutation_p.Q152*|FUS_uc002ebg.2_5'UTR|FUS_uc002ebi.2_Nonsense_Mutation_p.Q153*|FUS_uc002ebj.2_5'UTR|FUS_uc002ebk.1_5'Flank	NM_004960	NP_004951	P35637	FUS_HUMAN	fusion (involved in t(12;16) in malignant	153	Gln/Gly/Ser/Tyr-rich.				cell death|nuclear mRNA splicing, via spliceosome	nucleoplasm	DNA binding|nucleotide binding|protein binding|RNA binding|zinc ion binding		FUS/DDIT3(623)|FUS/ERG(163)|FUS/CREB3L2(158)|FUS/CREB3L1(6)|FUS/ATF1(4)|FUS/FEV(2)	soft_tissue(791)|haematopoietic_and_lymphoid_tissue(153)|bone(12)|breast(2)	958		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		TAATCCCCCTCAGGGCTATGG	0.453			T	DDIT3|ERG|FEV|ATF1|CREB3L2|CREB3L1	liposarcoma|AML|Ewing sarcoma|angiomatoid fibrous histiocytoma|fibromyxoid sarcoma								33	109	---	---	---	---	PASS
PYDC1	260434	broad.mit.edu	37	16	31228069	31228069	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31228069C>T	uc002ebo.2	-	1					TRIM72_uc002ebn.1_Intron	NM_152901	NP_690865	Q8WXC3	PYDC1_HUMAN	pyrin domain containing 1						innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein kinase activity|positive regulation of interleukin-1 beta secretion|proteolysis|tumor necrosis factor-mediated signaling pathway	IkappaB kinase complex|nucleus	cysteine-type endopeptidase activity|protein binding				0						CGTACCAGCTCAGAGTGGCCC	0.677													20	85	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50346030	50346030	+	Silent	SNP	G	A	A	rs138338317	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50346030G>A	uc002egd.1	+	20	2800	c.2532G>A	c.(2530-2532)GTG>GTA	p.V844V		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	844	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	TGGAGAACGTGAACCGCCTTC	0.552													39	93	---	---	---	---	PASS
BRD7	29117	broad.mit.edu	37	16	50384019	50384019	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50384019G>C	uc002egf.1	-	6	573	c.506C>G	c.(505-507)TCC>TGC	p.S169C	BRD7_uc002ege.1_Missense_Mutation_p.S169C	NM_013263	NP_037395	Q9NPI1	BRD7_HUMAN	bromodomain containing 7	169	Bromo.				cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding				0		all_cancers(37;0.0127)				AATGATCATGGAGTAGCCAGG	0.328													24	77	---	---	---	---	PASS
MT3	4504	broad.mit.edu	37	16	56623743	56623743	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56623743C>T	uc002ejf.2	+						MT3_uc002ejg.2_Missense_Mutation_p.R81C	NM_005954	NP_005945	P25713	MT3_HUMAN	metallothionein 3						cell proliferation|cellular metal ion homeostasis|removal of superoxide radicals|response to hypoxia	synaptic vesicle	antioxidant activity|copper ion binding|zinc ion binding				0						GACCCGAGTTCGTCCACATTA	0.617													12	30	---	---	---	---	PASS
MT3	4504	broad.mit.edu	37	16	56623770	56623770	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56623770C>T	uc002ejf.2	+						MT3_uc002ejg.2_3'UTR	NM_005954	NP_005945	P25713	MT3_HUMAN	metallothionein 3						cell proliferation|cellular metal ion homeostasis|removal of superoxide radicals|response to hypoxia	synaptic vesicle	antioxidant activity|copper ion binding|zinc ion binding				0						CCTGTGGCGTCGCCCTCTCTA	0.627													17	45	---	---	---	---	PASS
MT1E	4493	broad.mit.edu	37	16	56659629	56659629	+	5'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56659629G>A	uc002ejl.2	+	1					MT1A_uc002eji.2_Intron|MT1M_uc010vhe.1_Intron|MT1E_uc002ejm.2_5'UTR	NM_175617	NP_783316	P04732	MT1E_HUMAN	metallothionein 1E							cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						TGCAGGCGCGGAGCTGGGCCT	0.692													5	13	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57269103	57269103	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57269103G>A	uc002elb.2	+	14	1875	c.1597G>A	c.(1597-1599)GAG>AAG	p.E533K	RSPRY1_uc002elc.2_Missense_Mutation_p.E533K|RSPRY1_uc002eld.2_Missense_Mutation_p.E533K	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	533	RING-type.					extracellular region	zinc ion binding			ovary(1)	1						TTGTTGTGATGAGGTAGCAGA	0.403													15	44	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57269112	57269112	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57269112G>A	uc002elb.2	+	14	1884	c.1606G>A	c.(1606-1608)GAC>AAC	p.D536N	RSPRY1_uc002elc.2_Missense_Mutation_p.D536N|RSPRY1_uc002eld.2_Missense_Mutation_p.D536N	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	536	RING-type.					extracellular region	zinc ion binding			ovary(1)	1						TGAGGTAGCAGACACACAATT	0.423													12	43	---	---	---	---	PASS
ARL2BP	23568	broad.mit.edu	37	16	57283691	57283691	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57283691G>A	uc002elf.1	+	4	462	c.220G>A	c.(220-222)GAA>AAA	p.E74K	ARL2BP_uc010vhl.1_Missense_Mutation_p.E74K	NM_012106	NP_036238	Q9Y2Y0	AR2BP_HUMAN	binder of Arl Two	74				E->A: Decreases interaction with ARL2.	maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity				0						TTCTTTGGTAGAAAAATACAT	0.418													21	118	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57918280	57918280	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57918280C>T	uc002emt.2	-	33	3609	c.3544G>A	c.(3544-3546)GAC>AAC	p.D1182N	CNGB1_uc010cdh.2_Missense_Mutation_p.D1176N	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	1182	Cytoplasmic (Potential).				sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						GCGGGTGGGTCGGTGGCGGCC	0.721													9	31	---	---	---	---	PASS
ZDHHC1	29800	broad.mit.edu	37	16	67428988	67428988	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67428988G>C	uc010vjm.1	-	10	1451	c.1147C>G	c.(1147-1149)CAG>GAG	p.Q383E	TPPP3_uc002eta.2_5'Flank|TPPP3_uc002etb.2_5'Flank	NM_013304	NP_037436	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	383						integral to membrane	DNA binding|zinc ion binding				0		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		GGGGGAGCCTGAGGGCCCCAC	0.617													4	28	---	---	---	---	PASS
CTCF	10664	broad.mit.edu	37	16	67662356	67662356	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67662356G>A	uc002etl.2	+	9	1892	c.1602G>A	c.(1600-1602)CAG>CAA	p.Q534Q	CTCF_uc010cek.2_Silent_p.Q206Q|CTCF_uc002etm.1_Silent_p.Q23Q	NM_006565	NP_006556	P49711	CTCF_HUMAN	CCCTC-binding factor	534	C2H2-type 10.				chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		CCTTCCGCCAGAAGCAGCTTC	0.557													29	87	---	---	---	---	PASS
VAC14	55697	broad.mit.edu	37	16	70817025	70817025	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70817025C>G	uc002ezm.2	-	7	980	c.722G>C	c.(721-723)GGA>GCA	p.G241A	VAC14_uc010cfw.2_Missense_Mutation_p.G7A|VAC14_uc002ezn.2_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog	241	HEAT 4.				interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				TAAGAATTCTCCAAGAACAAC	0.498													36	109	---	---	---	---	PASS
CHST6	4166	broad.mit.edu	37	16	75512842	75512842	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75512842G>A	uc002fef.2	-	3	1065	c.885C>T	c.(883-885)CTC>CTT	p.L295L	CHST6_uc002feg.1_RNA|CHST6_uc002feh.1_Silent_p.L295L	NM_021615	NP_067628	Q9GZX3	CHST6_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	295	Lumenal (Potential).				keratan sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						GCTGTGGCGTGAGACTGAGCC	0.647													14	58	---	---	---	---	PASS
PLCG2	5336	broad.mit.edu	37	16	81934316	81934316	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81934316G>A	uc002fgt.2	+	14	1445	c.1293G>A	c.(1291-1293)ACG>ACA	p.T431T	PLCG2_uc010chg.1_Silent_p.T431T	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	431	PI-PLC X-box.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TGCTGTTGACGAAGCCCACGG	0.612													19	54	---	---	---	---	PASS
FOXC2	2303	broad.mit.edu	37	16	86600911	86600911	+	5'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86600911G>A	uc002fjq.2	+	1						NM_005251	NP_005242	Q99958	FOXC2_HUMAN	forkhead box C2						anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding				0						GTCCGTGCGCGAGGGCGCCGG	0.458									Late-onset_Hereditary_Lymphedema				5	30	---	---	---	---	PASS
SPG7	6687	broad.mit.edu	37	16	89598329	89598329	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89598329C>G	uc002fnj.2	+	8	1026	c.1005C>G	c.(1003-1005)CTC>CTG	p.L335L	SPG7_uc002fni.2_Silent_p.L335L	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1	335	Mitochondrial matrix (Potential).				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		AACGCTTCCTCCAGCTTGGCG	0.532													6	59	---	---	---	---	PASS
TUBB3	10381	broad.mit.edu	37	16	89998985	89998985	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89998985G>A	uc002fph.1	+	2	129	c.64G>A	c.(64-66)GAA>AAA	p.E22K	TUBB3_uc002fpf.2_Missense_Mutation_p.E369K|TUBB3_uc010ciz.1_5'UTR|TUBB3_uc010cja.1_RNA|TUBB3_uc002fpg.1_5'UTR|TUBB3_uc002fpi.1_5'UTR|TUBB3_uc002fpj.1_5'UTR|TUBB3_uc010cjb.1_5'UTR|TUBB3_uc002fpk.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	22					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		GCAGTTCTGGGAAGTCATCAG	0.587													14	53	---	---	---	---	PASS
KIAA0664	23277	broad.mit.edu	37	17	2593932	2593932	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2593932G>T	uc002fuy.1	-	26	3972	c.3886C>A	c.(3886-3888)CAG>AAG	p.Q1296K	KIAA0664_uc002fux.1_Missense_Mutation_p.Q1229K|KIAA0664_uc010ckc.1_3'UTR	NM_015229	NP_056044	O75153	K0664_HUMAN	hypothetical protein LOC23277	1296							binding			breast(2)	2						GCCGGGGGCTGGGAGCCCAGG	0.716													6	26	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3458046	3458046	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3458046C>T	uc002fvt.1	-	2	421	c.99G>A	c.(97-99)GAG>GAA	p.E33E	TRPV3_uc010vrj.1_5'UTR|TRPV3_uc010vrk.1_RNA|TRPV3_uc002fvr.2_Silent_p.E33E|TRPV3_uc002fvu.2_Silent_p.E33E	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	33	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	TGGGGGTGATCTCCGCCGGCC	0.657													19	68	---	---	---	---	PASS
ALOX15	246	broad.mit.edu	37	17	4544957	4544957	+	Translation_Start_Site	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4544957G>C	uc002fyh.2	-	1	4	c.-10C>G	c.(-12--8)ATCTT>ATGTT		ALOX15_uc010vsd.1_Translation_Start_Site|ALOX15_uc010vse.1_Missense_Mutation_p.S19C	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase						inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	CTTGCTCAAAGATGTTTCGCT	0.612													15	52	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4877697	4877697	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4877697C>T	uc002gah.1	-	12	2107	c.1999G>A	c.(1999-2001)GAT>AAT	p.D667N	CAMTA2_uc010cku.1_Missense_Mutation_p.D690N|CAMTA2_uc002gag.1_Missense_Mutation_p.D666N|CAMTA2_uc002gai.1_Missense_Mutation_p.D669N|CAMTA2_uc010ckv.1_Missense_Mutation_p.D314N	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	667					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						GGAGGAGCATCAGGACCCTGG	0.572													21	103	---	---	---	---	PASS
KIF1C	10749	broad.mit.edu	37	17	4904541	4904541	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4904541C>T	uc002gan.1	+	5	534	c.208C>T	c.(208-210)CAG>TAG	p.Q70*		NM_006612	NP_006603	O43896	KIF1C_HUMAN	kinesin family member 1C	70	Kinesin-motor.				microtubule-based movement|retrograde vesicle-mediated transport, Golgi to ER	endoplasmic reticulum|Golgi apparatus|microtubule	ATP binding|microtubule motor activity			breast(2)	2						GTTTGCATCTCAGCAGCAAGT	0.527													35	117	---	---	---	---	PASS
KIF1C	10749	broad.mit.edu	37	17	4905849	4905849	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4905849C>T	uc002gan.1	+	7	846	c.520C>T	c.(520-522)CTG>TTG	p.L174L		NM_006612	NP_006603	O43896	KIF1C_HUMAN	kinesin family member 1C	174	Kinesin-motor.				microtubule-based movement|retrograde vesicle-mediated transport, Golgi to ER	endoplasmic reticulum|Golgi apparatus|microtubule	ATP binding|microtubule motor activity			breast(2)	2						GCACCCCATCCTGGGCCCGTA	0.577													46	174	---	---	---	---	PASS
KIF1C	10749	broad.mit.edu	37	17	4925875	4925875	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4925875C>G	uc002gan.1	+	22	2825	c.2499C>G	c.(2497-2499)CTC>CTG	p.L833L		NM_006612	NP_006603	O43896	KIF1C_HUMAN	kinesin family member 1C	833	Potential.				microtubule-based movement|retrograde vesicle-mediated transport, Golgi to ER	endoplasmic reticulum|Golgi apparatus|microtubule	ATP binding|microtubule motor activity			breast(2)	2						TGGAGGACCTCCGGGCCCACA	0.672													5	12	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7813673	7813673	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7813673C>G	uc002gje.2	+						CHD3_uc002gjd.2_Intron|CHD3_uc002gjf.2_Intron|CHD3_uc002gjh.2_Intron|CHD3_uc002gjj.2_Missense_Mutation_p.L3V	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				tctgatgcctctcttttcctg	0.234													21	74	---	---	---	---	PASS
AURKB	9212	broad.mit.edu	37	17	8111097	8111097	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8111097G>T	uc002gkm.2	-	3	171	c.110C>A	c.(109-111)TCT>TAT	p.S37Y	AURKB_uc010cnu.2_Translation_Start_Site|AURKB_uc002gkn.2_Missense_Mutation_p.S37Y|AURKB_uc010vuu.1_Translation_Start_Site|AURKB_uc002gko.2_RNA	NM_004217	NP_004208	Q96GD4	AURKB_HUMAN	aurora kinase B	37					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|mitotic prometaphase|protein localization to kinetochore	chromosome passenger complex|condensed nuclear chromosome, centromeric region|cytosol|spindle	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(1)|central_nervous_system(1)	4						GACAAGTGCAGATGGGGTGAC	0.617													11	53	---	---	---	---	PASS
C17orf68	80169	broad.mit.edu	37	17	8131452	8131452	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8131452C>G	uc002gkq.3	-	23					C17orf68_uc010cnv.2_RNA	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN	alpha accessory factor 132						positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding				0						CCTAGGCCTTCAGGTTTTCAG	0.493													18	73	---	---	---	---	PASS
STX8	9482	broad.mit.edu	37	17	9448576	9448576	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9448576C>T	uc002glx.2	-	4	386	c.236G>A	c.(235-237)AGA>AAA	p.R79K		NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8	79	Cytoplasmic (Potential).				transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						GAGGTTCTGTCTTCGGTCCCC	0.398													26	102	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11865486	11865486	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11865486G>C	uc002gne.2	+	68	13214	c.13146G>C	c.(13144-13146)AAG>AAC	p.K4382N	DNAH9_uc010coo.2_Missense_Mutation_p.K3600N|DNAH9_uc002gnf.2_Missense_Mutation_p.K694N	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	4382					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACATGACGAAGAAGAACAGAG	0.547													21	82	---	---	---	---	PASS
FLCN	201163	broad.mit.edu	37	17	17116970	17116970	+	Nonstop_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17116970C>G	uc002gra.3	-	14	2243	c.1739G>C	c.(1738-1740)TGA>TCA	p.*580S	PLD6_uc010cpn.2_Intron	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	580					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						TGTGACGGGTCAGTTCCGAGA	0.582									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				33	104	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	19091383	19091383	+	IGR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19091383G>A								GRAPL (29235 upstream) : EPN2 (49307 downstream)																							aagtttctctgaacgtgtaga	0.129													22	285	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	19091389	19091389	+	IGR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19091389G>A								GRAPL (29241 upstream) : EPN2 (49301 downstream)																							ctctgaacgtgtagagcaccg	0.114													31	376	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19689261	19689261	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19689261C>G	uc002gwm.3	-	21	2749	c.2240G>C	c.(2239-2241)AGA>ACA	p.R747T	ULK2_uc002gwn.2_Missense_Mutation_p.R747T	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	747					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TGAGGTTGTTCTTGTTCGAAG	0.408													18	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	20859999	20859999	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20859999G>A	uc002gyk.1	+	4		c.675G>A								Homo sapiens hypothetical protein LOC339260, mRNA (cDNA clone IMAGE:5168338), partial cds.																		CAGACCTGTGGATGAAGAGCC	0.473													9	32	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26943617	26943617	+	Intron	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26943617C>A	uc002hbu.2	-						SGK494_uc010waq.1_5'Flank|SGK494_uc010war.1_5'Flank|SGK494_uc002hbr.1_5'Flank|uc002hbs.1_RNA|KIAA0100_uc002hbt.2_Intron	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor							extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					TTCTGGGGCTCCACCATAAAA	0.463													60	228	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26945942	26945942	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26945942C>T	uc002hbu.2	-	32	5789	c.5690G>A	c.(5689-5691)CGA>CAA	p.R1897Q	KIAA0100_uc002hbt.2_Missense_Mutation_p.R226Q	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	1897						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					TTGCTGCTTTCGCAGCTCCAT	0.527													18	71	---	---	---	---	PASS
TLCD1	116238	broad.mit.edu	37	17	27051519	27051519	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27051519C>G	uc002hco.2	-	4					TLCD1_uc010waw.1_3'UTR	NM_138463	NP_612472	Q96CP7	TLCD1_HUMAN	TLC domain containing 1 isoform 1							integral to membrane					0	Lung NSC(42;0.00431)					GTCCCAGGCTCTGTGCCCCTC	0.542													98	284	---	---	---	---	PASS
CORO6	84940	broad.mit.edu	37	17	27945892	27945892	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27945892C>T	uc002hel.2	-	4	551	c.549G>A	c.(547-549)TGG>TGA	p.W183*	CORO6_uc002hem.2_5'Flank|CORO6_uc002hen.2_5'Flank	NM_032854	NP_116243	Q6QEF8	CORO6_HUMAN	coronin 6	183	WD 3.				actin cytoskeleton organization	actin cytoskeleton	actin filament binding				0						CGTTGCTGTTCCAGCACACAC	0.577													24	75	---	---	---	---	PASS
RAB11FIP4	84440	broad.mit.edu	37	17	29850554	29850554	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29850554C>A	uc002hgn.1	+	8	1183	c.954C>A	c.(952-954)TTC>TTA	p.F318L	RAB11FIP4_uc002hgo.2_Missense_Mutation_p.F216L	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	318	Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				GCAGCAACTTCAGCAGCAGCA	0.602													34	113	---	---	---	---	PASS
SPACA3	124912	broad.mit.edu	37	17	31318969	31318969	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31318969C>T	uc002hhs.1	+	1	88	c.13C>T	c.(13-15)CTG>TTG	p.L5L	SPACA3_uc010cte.1_5'Flank	NM_173847	NP_776246	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	5	Cytoplasmic (Potential).				cell wall macromolecule catabolic process|defense response to Gram-positive bacterium|monocyte activation|peptidoglycan catabolic process|positive regulation of macrophage activation|positive regulation of phagocytosis|response to virus	acrosomal membrane|extracellular region|integral to membrane|lysosome	bacterial cell surface binding|lysozyme activity|protein binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.193)			GGTCTCAGCTCTGCGGGGAGC	0.607													4	33	---	---	---	---	PASS
CCT6B	10693	broad.mit.edu	37	17	33255056	33255056	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33255056G>C	uc002hig.2	-	14					CCT6B_uc010ctg.2_3'UTR|CCT6B_uc010wcc.1_3'UTR	NM_006584	NP_006575	Q92526	TCPW_HUMAN	chaperonin containing TCP1, subunit 6B						chaperone-mediated protein complex assembly|protein folding|spermatogenesis	cytoplasm	ATP binding|protein transporter activity|unfolded protein binding			pancreas(1)	1		Ovarian(249;0.17)				GGTTGATTTTGAATTCAATCA	0.373													7	76	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33507615	33507615	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33507615G>A	uc002hja.2	+	18	2396	c.2299G>A	c.(2299-2301)GAG>AAG	p.E767K	UNC45B_uc002hjb.2_Missense_Mutation_p.E765K|UNC45B_uc002hjc.2_Missense_Mutation_p.E765K|UNC45B_uc010cto.2_Missense_Mutation_p.E686K	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	767	ARM 3.				cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				GCCAGACATCGAGAACTACAT	0.547													15	66	---	---	---	---	PASS
CCL3	6348	broad.mit.edu	37	17	34416051	34416051	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34416051C>G	uc002hkv.2	-	3	348	c.246G>C	c.(244-246)CAG>CAC	p.Q82H		NM_002983	NP_002974	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3	82					cell-cell signaling|cellular calcium ion homeostasis|cellular component movement|cytoskeleton organization|exocytosis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|regulation of viral genome replication	extracellular space|soluble fraction	chemoattractant activity|chemokine activity|signal transducer activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGACATATTTCTGGACCCACT	0.617													43	161	---	---	---	---	PASS
DUSP14	11072	broad.mit.edu	37	17	35872727	35872727	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35872727C>G	uc002hnx.2	+	3	647	c.353C>G	c.(352-354)TCA>TGA	p.S118*	DUSP14_uc002hny.2_Nonsense_Mutation_p.S105*|DUSP14_uc002hnz.2_Nonsense_Mutation_p.S105*	NM_007026	NP_008957	O95147	DUS14_HUMAN	dual specificity phosphatase 14	118	Tyrosine-protein phosphatase.						MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)				GTGAGCCGCTCAGCCACGCTG	0.592													13	63	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37618767	37618767	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37618767C>T	uc010cvv.2	+	1	1029	c.443C>T	c.(442-444)TCG>TTG	p.S148L	CDK12_uc010wef.1_Missense_Mutation_p.S148L|CDK12_uc002hrw.3_Missense_Mutation_p.S148L	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	148					mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						GACCGGATATCGGGAAGTTCA	0.502										TCGA Ovarian(9;0.13)			21	77	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37884259	37884259	+	Missense_Mutation	SNP	G	C	C	rs144533600	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37884259G>C	uc002hso.2	+	27	3968	c.3730G>C	c.(3730-3732)GAG>CAG	p.E1244Q	ERBB2_uc002hsm.2_Missense_Mutation_p.E1214Q|ERBB2_uc010cwa.2_Missense_Mutation_p.E1229Q|ERBB2_uc002hsp.2_Missense_Mutation_p.E1047Q|ERBB2_uc010cwb.2_3'UTR|ERBB2_uc010wek.1_Missense_Mutation_p.E968Q	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	1244	Cytoplasmic (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	ACCTACGGCAGAGAACCCAGA	0.607		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			22	66	---	---	---	---	PASS
CASC3	22794	broad.mit.edu	37	17	38319905	38319905	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38319905C>T	uc010cwt.1	+	7	1252	c.957C>T	c.(955-957)TTC>TTT	p.F319F	CASC3_uc010cws.1_Silent_p.F319F|CASC3_uc002hue.2_Silent_p.F319F	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51	319					mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						CTGGGGGCTTCAAGGAAGGTC	0.547													96	330	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38512341	38512341	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38512341G>A	uc002huk.1	+	9	1707	c.1252G>A	c.(1252-1254)GAG>AAG	p.E418K	RARA_uc002hul.3_Missense_Mutation_p.E418K|RARA_uc010wfe.1_Missense_Mutation_p.E321K|RARA_uc002hun.1_Missense_Mutation_p.E413K	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	418	Ligand-binding.|Required for binding corepressor NCOR1.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GGAGAACTCAGAGGGCCTGGA	0.617			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								3	20	---	---	---	---	PASS
CCR7	1236	broad.mit.edu	37	17	38711549	38711549	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38711549G>C	uc002huw.2	-	3	645	c.582C>G	c.(580-582)CTC>CTG	p.L194L		NM_001838	NP_001829	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7 precursor	194	Extracellular (Potential).				cell maturation|immunological synapse formation|inflammatory response|interleukin-12 secretion|lymphocyte migration into lymph node|positive regulation of dendritic cell antigen processing and presentation|positive regulation of glycoprotein biosynthetic process|positive regulation of humoral immune response|positive regulation of hypersensitivity|positive regulation of interleukin-12 production|positive regulation of neutrophil chemotaxis|regulation of interferon-gamma production|regulation of interleukin-1 beta secretion|T cell costimulation	integral to membrane|intracellular	C-C chemokine receptor activity|chemokine (C-C motif) ligand 19 binding|chemokine (C-C motif) ligand 21 binding			breast(1)	1		Breast(137;0.000496)				CACTGTACAGGAGCTCTGGGA	0.582													20	34	---	---	---	---	PASS
KRT31	3881	broad.mit.edu	37	17	39550344	39550344	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39550344G>C	uc002hwn.2	-	7	1228	c.1175C>G	c.(1174-1176)TCT>TGT	p.S392C	KRT31_uc010cxn.2_3'UTR	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	392	Tail.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				AGGGACACAAGAGGTACAGGG	0.612													33	108	---	---	---	---	PASS
DHX58	79132	broad.mit.edu	37	17	40260106	40260106	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40260106C>T	uc002hyw.3	-	7	922	c.699G>A	c.(697-699)CTG>CTA	p.L233L	DHX58_uc002hyv.3_RNA|DHX58_uc010wgf.1_Silent_p.L226L	NM_024119	NP_077024	Q96C10	DHX58_HUMAN	RNA helicase LGP2	233					innate immune response	cytoplasm	ATP binding|DNA binding|helicase activity|protein binding|RNA binding|zinc ion binding				0		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGAGCTTCTTCAGCAAGTCCC	0.562													17	70	---	---	---	---	PASS
GHDC	84514	broad.mit.edu	37	17	40345373	40345373	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40345373C>T	uc002hzd.2	-	2	711	c.227G>A	c.(226-228)GGA>GAA	p.G76E	GHDC_uc002hzg.1_Missense_Mutation_p.G76E|GHDC_uc010wgg.1_Missense_Mutation_p.G76E|GHDC_uc002hze.3_Missense_Mutation_p.G76E|GHDC_uc002hzf.3_Missense_Mutation_p.G76E|GHDC_uc010cxz.2_RNA	NM_032484	NP_115873	Q8N2G8	GHDC_HUMAN	LGP1 homolog isoform 1	76						endoplasmic reticulum|nuclear envelope					0		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GCGCTGGGCTCCCTGTAGACA	0.647													4	12	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40622219	40622219	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40622219C>A	uc002hzr.2	+	5	573	c.406C>A	c.(406-408)CAG>AAG	p.Q136K	ATP6V0A1_uc002hzq.2_Missense_Mutation_p.Q136K|ATP6V0A1_uc002hzs.2_Missense_Mutation_p.Q136K|ATP6V0A1_uc010wgj.1_Intron|ATP6V0A1_uc010wgk.1_Intron|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_5'UTR|ATP6V0A1_uc002hzp.1_Missense_Mutation_p.Q136K	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	136	Cytoplasmic (Potential).				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TCGCAAAACTCAGCAATTTTT	0.338													8	37	---	---	---	---	PASS
MLX	6945	broad.mit.edu	37	17	40722180	40722180	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40722180C>G	uc002iag.2	+	7	884	c.819C>G	c.(817-819)ATC>ATG	p.I273M	MLX_uc002iaf.2_Missense_Mutation_p.I219M|MLX_uc002iah.2_Missense_Mutation_p.I189M	NM_170607	NP_733752	Q9UH92	MLX_HUMAN	transcription factor-like protein 4 isoform	273					energy reserve metabolic process|negative regulation of transcription, DNA-dependent|positive regulation of cellular metabolic process	cytoplasm|nucleus	DNA binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding				0		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		TCAGCTGGATCGAGGAGCACT	0.532													11	66	---	---	---	---	PASS
LOC90586	90586	broad.mit.edu	37	17	41020734	41020734	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41020734C>G	uc002ibw.1	+	1					LOC90586_uc002ibx.2_Missense_Mutation_p.P50R	NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						GTCTTCCACCCTAATGGGGCC	0.507													7	37	---	---	---	---	PASS
LOC90586	90586	broad.mit.edu	37	17	41020753	41020753	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41020753C>G	uc002ibw.1	+	1					LOC90586_uc002ibx.2_Missense_Mutation_p.I56M	NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						CCATAGAAATCAGACTCCACA	0.522													6	29	---	---	---	---	PASS
LOC90586	90586	broad.mit.edu	37	17	41020777	41020777	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41020777C>T	uc002ibw.1	+	1					LOC90586_uc002ibx.2_Silent_p.I64I	NR_002773				Homo sapiens amine oxidase pseudogene mRNA, splice variant HLAO1.												0						CCGGCTACATCAGCTCAGCAT	0.527													5	25	---	---	---	---	PASS
ARL4D	379	broad.mit.edu	37	17	41477529	41477529	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41477529G>A	uc002idt.2	+	2	610	c.429G>A	c.(427-429)CTG>CTA	p.L143L		NM_001661	NP_001652	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	143					protein secretion|small GTPase mediated signal transduction	cytoplasm|nucleolus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		CCGGGGCACTGAGCGCTGCTG	0.657													6	11	---	---	---	---	PASS
ITGB3	3690	broad.mit.edu	37	17	45384893	45384893	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45384893C>G	uc002ilj.2	+	14	2211	c.2191C>G	c.(2191-2193)CTG>GTG	p.L731V	ITGB3_uc010wkr.1_RNA	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor	731	Helical; (Potential).				activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	GGGGGCCATTCTGCTCATTGG	0.547													18	53	---	---	---	---	PASS
SKAP1	8631	broad.mit.edu	37	17	46239837	46239837	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46239837C>G	uc002ini.1	-	11	1084	c.972G>C	c.(970-972)CTG>CTC	p.L324L	SKAP1_uc002inj.1_Silent_p.L323L|SKAP1_uc010dbd.1_Silent_p.L229L|SKAP1_uc010dbe.1_Silent_p.L324L	NM_003726	NP_003717	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1 isoform	324	SH3.				positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0						TTACCTTGCTCAGAATACGGA	0.433													10	43	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56083263	56083263	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56083263C>G	uc002ivi.2	-	3	660	c.451G>C	c.(451-453)GAT>CAT	p.D151H	SFRS1_uc002ivj.2_Missense_Mutation_p.D151H	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	151	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		CGGTAAACATCAGCATAACAT	0.403													17	87	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57697484	57697484	+	5'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57697484G>C	uc002ixq.1	+	1					CLTC_uc002ixp.2_5'UTR|CLTC_uc002ixr.1_5'UTR	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CATAACCCCCGACAGCGCCAT	0.378			T	ALK|TFE3	ALCL|renal 								11	44	---	---	---	---	PASS
HEATR6	63897	broad.mit.edu	37	17	58156203	58156203	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58156203C>G	uc002iyk.1	-	1	90	c.73G>C	c.(73-75)GAG>CAG	p.E25Q		NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	25							binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TTGCCTCGCTCAGGGATTGCT	0.662													4	19	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60072581	60072581	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60072581C>T	uc002izo.2	-	10	2190	c.2113G>A	c.(2113-2115)GAG>AAG	p.E705K		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	705					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						AGGAATTCCTCATCTCCTTCA	0.358													51	118	---	---	---	---	PASS
CCDC47	57003	broad.mit.edu	37	17	61842116	61842116	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61842116G>A	uc002jbs.3	-	3	692	c.356C>T	c.(355-357)CCA>CTA	p.P119L	CCDC47_uc010ddx.2_Missense_Mutation_p.P119L|CCDC47_uc002jbt.2_Missense_Mutation_p.P119L	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor	119						integral to membrane	protein binding				0						AATCGTTATTGGGTCTTTATT	0.338													32	96	---	---	---	---	PASS
TEX2	55852	broad.mit.edu	37	17	62290676	62290676	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62290676G>C	uc002jec.2	-	2	1075	c.902C>G	c.(901-903)CCT>CGT	p.P301R	TEX2_uc002jed.2_Missense_Mutation_p.P301R|TEX2_uc002jee.2_Missense_Mutation_p.P301R	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2	301					signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GAGCTGAAAAGGCTCATAGAT	0.433													22	55	---	---	---	---	PASS
POLG2	11232	broad.mit.edu	37	17	62493011	62493011	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62493011C>G	uc002jei.2	-	1	159	c.76G>C	c.(76-78)GAT>CAT	p.D26H	POLG2_uc010deg.1_Missense_Mutation_p.D26H	NM_007215	NP_009146	Q9UHN1	DPOG2_HUMAN	DNA polymerase subunit gamma-2, mitochondrial	26					DNA repair|DNA-dependent DNA replication|glycyl-tRNA aminoacylation	mitochondrial chromosome	ATP binding|DNA-directed DNA polymerase activity|glycine-tRNA ligase activity|identical protein binding|single-stranded DNA binding			central_nervous_system(1)	1	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			TGCCCCGCATCTACTCGACCC	0.612													39	109	---	---	---	---	PASS
SLC16A6	9120	broad.mit.edu	37	17	66270075	66270075	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66270075G>A	uc002jgz.1	-	3	557	c.369C>T	c.(367-369)ATC>ATT	p.I123I	ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_Silent_p.I123I	NM_004694	NP_004685	O15403	MOT7_HUMAN	solute carrier family 16, member 6	123	Helical; (Potential).					integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	TACCAGAGATGATGCCGATGG	0.483													17	49	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66914280	66914280	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66914280C>G	uc002jhp.2	-	14	2014	c.1835G>C	c.(1834-1836)AGA>ACA	p.R612T	ABCA8_uc002jhq.2_Missense_Mutation_p.R652T|ABCA8_uc010wqq.1_Missense_Mutation_p.R652T|ABCA8_uc010wqr.1_Missense_Mutation_p.R591T|ABCA8_uc002jhr.2_Missense_Mutation_p.R652T	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	612	ABC transporter 1.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					TACTTGGTGTCTTGAAAAGGG	0.458													16	71	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67187420	67187420	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67187420G>C	uc010dfa.1	-	18	2787	c.1908C>G	c.(1906-1908)ATC>ATG	p.I636M	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_Missense_Mutation_p.I237M	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	636					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TAAGGGATGTGATTTTTTCTG	0.338													23	68	---	---	---	---	PASS
OTOP2	92736	broad.mit.edu	37	17	72929594	72929594	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72929594G>A	uc010wrp.1	+	8	1732	c.1643G>A	c.(1642-1644)CGC>CAC	p.R548H	OTOP3_uc010wrq.1_5'Flank|OTOP3_uc010wrr.1_5'Flank	NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	548						integral to membrane		p.R548C(1)		ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					ATCTTCTACCGCATGCACGCT	0.607													29	88	---	---	---	---	PASS
C17orf28	283987	broad.mit.edu	37	17	72948414	72948414	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72948414C>T	uc002jmj.3	-	17	2243	c.2094G>A	c.(2092-2094)ATG>ATA	p.M698I	C17orf28_uc002jmi.2_Missense_Mutation_p.M100I|C17orf28_uc010wrs.1_Missense_Mutation_p.M497I	NM_030630	NP_085133	Q8IV36	CQ028_HUMAN	hypothetical protein LOC283987	698						integral to membrane|plasma membrane	protein binding				0	all_lung(278;0.151)|Lung NSC(278;0.185)					GCAGCAGCCTCATGATGGTCT	0.498													10	21	---	---	---	---	PASS
TK1	7083	broad.mit.edu	37	17	76171137	76171137	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76171137C>T	uc002juw.2	-	6	717	c.507G>A	c.(505-507)GAG>GAA	p.E169E	TK1_uc002jux.2_Silent_p.E211E	NM_003258	NP_003249	P04183	KITH_HUMAN	thymidine kinase 1	169					DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)			CTACCTCCTTCTCTGTGCCGA	0.662													12	18	---	---	---	---	PASS
TK1	7083	broad.mit.edu	37	17	76171139	76171139	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76171139C>T	uc002juw.2	-	6	715	c.505G>A	c.(505-507)GAG>AAG	p.E169K	TK1_uc002jux.2_Missense_Mutation_p.E211K	NM_003258	NP_003249	P04183	KITH_HUMAN	thymidine kinase 1	169					DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)			ACCTCCTTCTCTGTGCCGAGC	0.657													12	18	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77078258	77078258	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77078258C>G	uc002jwv.2	+						ENGASE_uc002jwu.1_Missense_Mutation_p.S384C|ENGASE_uc010wtz.1_Missense_Mutation_p.S198C|ENGASE_uc002jww.2_5'UTR	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase							cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						AGCAGCTGTTCTTCCCAGAGT	0.577													8	13	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78353431	78353431	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78353431G>A	uc002jyh.1	+	30	7999	c.7776G>A	c.(7774-7776)CCG>CCA	p.P2592P	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.P974P	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTGGCAGGCCGATGGAACAGA	0.502													26	93	---	---	---	---	PASS
SLC38A10	124565	broad.mit.edu	37	17	79226054	79226054	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79226054C>A	uc002jzz.1	-	13	2261	c.1886G>T	c.(1885-1887)GGA>GTA	p.G629V	SLC38A10_uc002jzy.1_Missense_Mutation_p.G547V|SLC38A10_uc002kab.2_Missense_Mutation_p.G629V	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	629					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TGGCGGCGGTCCCCCCTTGGC	0.711													20	64	---	---	---	---	PASS
RAB40B	10966	broad.mit.edu	37	17	80616472	80616472	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80616472C>G	uc002kft.2	-	5	586	c.460G>C	c.(460-462)GAG>CAG	p.E154Q	RAB40B_uc002kfs.2_RNA	NM_006822	NP_006813	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	154					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GGGCTGACCTCAAAGAAGGTC	0.652													34	82	---	---	---	---	PASS
YES1	7525	broad.mit.edu	37	18	756831	756831	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:756831C>G	uc002kky.2	-	2					YES1_uc002kkz.2_5'UTR	NM_005433	NP_005424	P07947	YES_HUMAN	viral oncogene yes-1 homolog 1						blood coagulation|leukocyte migration|regulation of vascular permeability|T cell costimulation	cytosol|plasma membrane	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|ovary(1)	3					Dasatinib(DB01254)	AGCCCATTATCAAATCTACAG	0.343													14	50	---	---	---	---	PASS
METTL4	64863	broad.mit.edu	37	18	2547371	2547371	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2547371C>G	uc002klh.3	-	6	1837	c.1057G>C	c.(1057-1059)GAG>CAG	p.E353Q	METTL4_uc010dkj.2_Missense_Mutation_p.E150Q	NM_022840	NP_073751	Q8N3J2	METL4_HUMAN	methyltransferase like 4	353					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		methyltransferase activity|nucleic acid binding			kidney(1)|skin(1)	2						CAGTGCCACTCAGCAACTACC	0.388													34	93	---	---	---	---	PASS
EMILIN2	84034	broad.mit.edu	37	18	2892354	2892354	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2892354G>A	uc002kln.2	+	4	2388	c.2229G>A	c.(2227-2229)CAG>CAA	p.Q743Q		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	743					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		GTGTCAGGCAGATGAACGGAA	0.493													20	61	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3508616	3508616	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3508616G>C	uc002kmf.2	-	8	2590	c.2523C>G	c.(2521-2523)CTC>CTG	p.L841L	DLGAP1_uc010wyz.1_Silent_p.L841L|DLGAP1_uc002kme.1_Silent_p.L539L|DLGAP1_uc010dkn.2_Silent_p.L549L|DLGAP1_uc010wyw.1_Silent_p.L547L|DLGAP1_uc010wyx.1_Silent_p.L563L|DLGAP1_uc010wyy.1_Silent_p.L525L|DLGAP1_uc002kmg.2_Silent_p.L539L	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	841					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TCTGGGCCATGAGAAGTTGGG	0.433													15	60	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7023260	7023260	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7023260C>T	uc002knm.2	-	19	2698	c.2604G>A	c.(2602-2604)GGG>GGA	p.G868G	LAMA1_uc010wzj.1_Silent_p.G344G	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	868	Laminin EGF-like 8.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCAGGCACTCCCCGGTGACTG	0.602													13	47	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9255144	9255144	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9255144G>A	uc002knv.2	+	9	2136	c.1879G>A	c.(1879-1881)GAA>AAA	p.E627K	ANKRD12_uc002knw.2_Missense_Mutation_p.E604K|ANKRD12_uc002knx.2_Missense_Mutation_p.E604K|ANKRD12_uc010dkx.1_Missense_Mutation_p.E334K	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	627						nucleus				ovary(2)|central_nervous_system(1)	3						AATAAAGGATGAAGATCATAG	0.184													30	88	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18549123	18549123	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18549123C>G	uc002kte.2	-	24	3808	c.2867G>C	c.(2866-2868)AGA>ACA	p.R956T		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	956	Glu-rich.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					ATTCTCTCTTCTTAATATTTC	0.323													19	49	---	---	---	---	PASS
MEP1B	4225	broad.mit.edu	37	18	29795197	29795197	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29795197G>A	uc002kxj.3	+	12	1779	c.1732G>A	c.(1732-1734)GAT>AAT	p.D578N		NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor	578	Extracellular (Potential).|MATH.				digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						AAAAGGAGATGATGTTTATAT	0.348													3	40	---	---	---	---	PASS
NOL4	8715	broad.mit.edu	37	18	31709969	31709969	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31709969C>G	uc010dmi.2	-	2	509	c.280G>C	c.(280-282)GAT>CAT	p.D94H	NOL4_uc002kxr.3_5'UTR|NOL4_uc010xbt.1_Missense_Mutation_p.D20H|NOL4_uc010dmh.2_Missense_Mutation_p.D20H|NOL4_uc010xbu.1_Missense_Mutation_p.D94H|NOL4_uc002kxt.3_Missense_Mutation_p.D94H|NOL4_uc010xbw.1_5'UTR	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	94						nucleolus	RNA binding			ovary(3)	3						AGCTTCTCATCTACCCCTACG	0.353													18	56	---	---	---	---	PASS
ZNF397OS	100101467	broad.mit.edu	37	18	32833853	32833853	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32833853C>T	uc002kym.2	-	4	1274	c.1046G>A	c.(1045-1047)AGA>AAA	p.R349K	ZNF397_uc010dmq.2_Intron|ZNF397_uc010dmr.2_Intron|ZNF397_uc002kyj.2_Intron|ZNF397OS_uc002kyl.2_5'Flank|ZNF397OS_uc010xce.1_Missense_Mutation_p.R349K	NM_001112734	NP_001106205	Q86W11	ZSC30_HUMAN	zinc finger protein 397 opposite strand	349	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACTATGAATTCTCTGATGTCT	0.438													33	138	---	---	---	---	PASS
ATP5A1	498	broad.mit.edu	37	18	43669842	43669842	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43669842C>T	uc002lbr.1	-	4	520	c.430G>A	c.(430-432)GAG>AAG	p.E144K	ATP5A1_uc010dnl.1_Missense_Mutation_p.E94K|ATP5A1_uc002lbs.1_Missense_Mutation_p.E94K|ATP5A1_uc002lbt.1_Missense_Mutation_p.E144K|ATP5A1_uc010xct.1_Missense_Mutation_p.E94K|ATP5A1_uc010dnm.1_RNA	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	144					ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						AACAGCTCCTCACCAACTGGA	0.418													19	78	---	---	---	---	PASS
SMAD2	4087	broad.mit.edu	37	18	45368266	45368266	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45368266G>C	uc002lcy.2	-	11	1584	c.1336C>G	c.(1336-1338)CTA>GTA	p.L446V	SMAD2_uc002lcz.2_Missense_Mutation_p.L446V|SMAD2_uc010xdc.1_Missense_Mutation_p.L416V	NM_005901	NP_005892	Q15796	SMAD2_HUMAN	Sma- and Mad-related protein 2 isoform 1	446	MH2.				anterior/posterior pattern formation|cell fate commitment|common-partner SMAD protein phosphorylation|intracellular signal transduction|mesoderm formation|negative regulation of transcription, DNA-dependent|palate development|paraxial mesoderm morphogenesis|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|regulation of binding|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|zygotic specification of dorsal/ventral axis	activin responsive factor complex|cytosol	activating transcription factor binding|co-SMAD binding|double-stranded DNA binding|I-SMAD binding|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|type I transforming growth factor beta receptor binding|ubiquitin protein ligase binding			large_intestine(3)|lung(1)|central_nervous_system(1)	5						AACCACTGTAGAGGTCCATTC	0.408													20	72	---	---	---	---	PASS
SMAD4	4089	broad.mit.edu	37	18	48591846	48591846	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48591846G>A	uc010xdp.1	+	9	1547	c.1009G>A	c.(1009-1011)GAG>AAG	p.E337K	SMAD4_uc002lfb.3_Missense_Mutation_p.E182K	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	337	MH2.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(2)|p.E337E(1)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TCAGGTAGGAGAGACATTTAA	0.418									Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				45	121	---	---	---	---	PASS
PRTN3	5657	broad.mit.edu	37	19	847830	847830	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:847830G>A	uc002lqa.1	+	5	656	c.632G>A	c.(631-633)GGC>GAC	p.G211D		NM_002777	NP_002768	P24158	PRTN3_HUMAN	myeloblastin	211	Peptidase S1.				collagen catabolic process|positive regulation of cell proliferation|proteolysis		protein binding|serine-type endopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCTGTGATGGCATCATCCAA	0.612													3	30	---	---	---	---	PASS
SBNO2	22904	broad.mit.edu	37	19	1111584	1111584	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1111584G>A	uc002lrk.3	-	24	2968	c.2730C>T	c.(2728-2730)CTC>CTT	p.L910L	SBNO2_uc002lri.3_5'Flank|SBNO2_uc002lrj.3_Silent_p.L853L|SBNO2_uc010dse.2_Silent_p.L893L|SBNO2_uc010xgj.1_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1	910					macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGATGGTGGTGAGGACACAGT	0.662													3	9	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2116613	2116613	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2116613C>T	uc002luz.2	-	17	2215	c.1992G>A	c.(1990-1992)GAG>GAA	p.E664E	AP3D1_uc002luy.2_Silent_p.E573E|AP3D1_uc002lva.2_Silent_p.E664E	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	664	Potential.				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGAGCCAGCTCTTCCTCGT	0.692													4	9	---	---	---	---	PASS
MCOLN1	57192	broad.mit.edu	37	19	7591755	7591755	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7591755C>T	uc002mgo.2	+	4	639	c.514C>T	c.(514-516)CGA>TGA	p.R172*	MCOLN1_uc002mgp.2_Silent_p.T58T	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN	mucolipin 1	172				ALCQRYYHRGHVDPANDTFDIDPMVVTD -> LSASGTTTE ATWTRPTTHLTLIRWWLLVN (in Ref. 3; AAG42242).	calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity			breast(1)	1						GTACTACCACCGAGGCCACGT	0.607													24	99	---	---	---	---	PASS
TIMM44	10469	broad.mit.edu	37	19	8000015	8000015	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8000015C>G	uc002miz.2	-	4	330	c.328G>C	c.(328-330)GAA>CAA	p.E110Q	TIMM44_uc002mja.2_5'UTR|TIMM44_uc010dvx.1_RNA	NM_006351	NP_006342	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44	110					protein targeting to mitochondrion	mitochondrial inner membrane presequence translocase complex|mitochondrial matrix	ATP binding|P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1						CGCACGGTTTCTGACTCGATG	0.423													8	17	---	---	---	---	PASS
MARCH2	51257	broad.mit.edu	37	19	8503337	8503337	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8503337G>A	uc002mjv.2	+	6	1089	c.648G>A	c.(646-648)CTG>CTA	p.L216L	MARCH2_uc002mjw.2_Silent_p.L216L|MARCH2_uc002mjx.2_Silent_p.L146L	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2	216					endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						AAGTTCGCCTGAAGATCCGGG	0.617													30	75	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8999056	8999056	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8999056G>A	uc002mkp.2	-	57	40992	c.40788C>T	c.(40786-40788)TTC>TTT	p.F13596F	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.F413F|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13598	Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCGCTGTGTGAAACCTGCAT	0.537													6	20	---	---	---	---	PASS
ZNF562	54811	broad.mit.edu	37	19	9767306	9767306	+	Missense_Mutation	SNP	C	T	T	rs140829241		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9767306C>T	uc010xks.1	-	5	428	c.265G>A	c.(265-267)GAA>AAA	p.E89K	ZNF562_uc002mly.2_Missense_Mutation_p.E89K|ZNF562_uc002mlx.2_Missense_Mutation_p.E17K|ZNF562_uc010xkt.1_Missense_Mutation_p.E52K|ZNF562_uc010xku.1_Missense_Mutation_p.E20K|ZNF562_uc010xkv.1_Missense_Mutation_p.E89K|ZNF562_uc010xkw.1_5'UTR	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a	89	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATTTCCCATTCTGAAGTTAAG	0.328													44	120	---	---	---	---	PASS
PPAN-P2RY11	692312	broad.mit.edu	37	19	10221062	10221062	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10221062G>A	uc002mna.2	+	9	885	c.885G>A	c.(883-885)GTG>GTA	p.V295V	PPAN-P2RY11_uc010xla.1_Silent_p.V295V|P2RY11_uc002mnc.2_5'Flank|PPAN_uc002mmz.1_Silent_p.V295V|PPAN_uc002mnb.1_Silent_p.V242V	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	PPAN-P2RY11 protein	295					RNA splicing	nucleolus	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			AGGGCAAAGTGATGTTCCACA	0.657													14	31	---	---	---	---	PASS
ATG4D	84971	broad.mit.edu	37	19	10657634	10657634	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10657634G>A	uc002mov.2	+	4	733	c.613G>A	c.(613-615)GAG>AAG	p.E205K	ATG4D_uc010xlg.1_Missense_Mutation_p.E228K|ATG4D_uc010xlh.1_Missense_Mutation_p.E142K|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_Intron|ATG4D_uc010dxj.2_Intron	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	205					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GGGTGCCCCTGAGCTGGAGCA	0.716													9	15	---	---	---	---	PASS
ATG4D	84971	broad.mit.edu	37	19	10663639	10663639	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10663639G>T	uc002mov.2	+	10	1441	c.1321G>T	c.(1321-1323)GAC>TAC	p.D441Y	ATG4D_uc010xlh.1_Missense_Mutation_p.D378Y|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_RNA|ATG4D_uc010dxj.2_Missense_Mutation_p.D108Y	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	441					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			CCACAGCCTGGACGACCTCTG	0.657													34	96	---	---	---	---	PASS
AP1M2	10053	broad.mit.edu	37	19	10692042	10692042	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10692042C>T	uc002mpc.2	-	6	657	c.573G>A	c.(571-573)CTG>CTA	p.L191L	AP1M2_uc002mpd.2_Silent_p.L191L	NM_005498	NP_005489	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	191	MHD.				cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(2)	2			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CGATTTCGCTCAGAAGGACGC	0.592											OREG0025241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	30	---	---	---	---	PASS
ELAVL3	1995	broad.mit.edu	37	19	11591439	11591439	+	5'UTR	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11591439G>T	uc002mry.1	-	1					ELAVL3_uc002mrx.1_5'UTR	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						TGTGCCCGGCGGGCGCGGTCC	0.721													3	41	---	---	---	---	PASS
FBXW9	84261	broad.mit.edu	37	19	12805444	12805444	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12805444G>C	uc010dyx.2	-	3	612	c.612C>G	c.(610-612)ATC>ATG	p.I204M	FBXW9_uc010xmp.1_RNA|FBXW9_uc002mum.1_Missense_Mutation_p.I214M|FBXW9_uc002mun.1_Missense_Mutation_p.I51M	NM_032301	NP_115677	Q5XUX1	FBXW9_HUMAN	F-box and WD-40 domain protein 9	214							protein binding			ovary(1)	1						CTAAGGTCTTGATCAGAACCT	0.498													5	52	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13409682	13409682	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13409682C>T	uc010dze.2	-	19	3004	c.2768G>A	c.(2767-2769)CGA>CAA	p.R923Q	CACNA1A_uc010dzc.2_Missense_Mutation_p.R448Q|CACNA1A_uc002mwy.3_Missense_Mutation_p.R922Q|CACNA1A_uc010xne.1_Missense_Mutation_p.R451Q	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	923	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding	p.R923Q(1)		large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GGCCTTGCCTCGCTCGGCCTC	0.776													6	21	---	---	---	---	PASS
LPHN1	22859	broad.mit.edu	37	19	14269281	14269281	+	Missense_Mutation	SNP	C	T	T	rs146726289		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14269281C>T	uc010xnn.1	-	13	2544	c.2248G>A	c.(2248-2250)GAA>AAA	p.E750K	LPHN1_uc010xno.1_Missense_Mutation_p.E745K|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	750	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						GGGCCTGCTTCGCCGGCCAGC	0.597													16	45	---	---	---	---	PASS
OR7A5	26659	broad.mit.edu	37	19	14938601	14938601	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938601C>G	uc002mzw.2	-	1	676	c.453G>C	c.(451-453)ATG>ATC	p.M151I	OR7A5_uc010xoa.1_Missense_Mutation_p.M151I	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2						ACAGAGCACTCATGGTCCAGG	0.488													23	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	15871693	15871693	+	RNA	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15871693G>A	uc002nbo.2	-	9		c.1314C>T								Homo sapiens cDNA FLJ60024 complete cds, highly similar to Cytochrome P450 4F12 (EC 1.14.14.1).																		AGTTGAAGCGGAAGGGGTTGT	0.577													13	41	---	---	---	---	PASS
C19orf44	84167	broad.mit.edu	37	19	16611956	16611956	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16611956C>G	uc002neh.1	+	2	426	c.353C>G	c.(352-354)TCT>TGT	p.S118C	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.S118C|C19orf44_uc002neg.2_Missense_Mutation_p.S118C|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	118											0						GACACGGAATCTGACTCAATG	0.552													44	97	---	---	---	---	PASS
F2RL3	9002	broad.mit.edu	37	19	17000940	17000940	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17000940C>T	uc002nfa.2	+	2	841	c.666C>T	c.(664-666)CGC>CGT	p.R222R		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	222	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						GGCTGGCGCGCTCCGATCGCG	0.706													8	18	---	---	---	---	PASS
MPV17L2	84769	broad.mit.edu	37	19	18305832	18305832	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18305832G>C	uc002nid.2	+	4	552	c.500G>C	c.(499-501)CGA>CCA	p.R167P	MPV17L2_uc010ebj.2_Silent_p.S77S	NM_032683	NP_116072	Q567V2	M17L2_HUMAN	MPV17 mitochondrial membrane protein-like 2	167						integral to membrane					0						CCCCAATTTCGAGTCACCTAC	0.502													26	96	---	---	---	---	PASS
CILP2	148113	broad.mit.edu	37	19	19651906	19651906	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19651906C>G	uc002nmv.3	+	4	528	c.443C>G	c.(442-444)TCG>TGG	p.S148W	CILP2_uc002nmw.3_Missense_Mutation_p.S154W	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	148	TSP type-1.					proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						GCAGAAGCCTCGTGGGGCGCG	0.716													5	3	---	---	---	---	PASS
ZNF507	22847	broad.mit.edu	37	19	32844356	32844356	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32844356G>T	uc002nte.2	+	3	892	c.620G>T	c.(619-621)AGA>ATA	p.R207I	ZNF507_uc002ntc.2_Missense_Mutation_p.R207I|ZNF507_uc010xrn.1_Missense_Mutation_p.R207I|ZNF507_uc002ntd.2_Missense_Mutation_p.R207I	NM_001136156	NP_001129628	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	207					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)|kidney(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(110;0.162)					ACCACAGAAAGAAATGAAACC	0.458													24	64	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36349402	36349402	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36349402G>A	uc002ocb.3	+	3	516	c.304G>A	c.(304-306)GAA>AAA	p.E102K	KIRREL2_uc002obz.3_Missense_Mutation_p.E102K|KIRREL2_uc002oca.3_Missense_Mutation_p.E52K|KIRREL2_uc002occ.3_Missense_Mutation_p.E49K|KIRREL2_uc002ocd.3_Missense_Mutation_p.E99K	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	102	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGCATCATATGAATGTCAGGC	0.592													20	98	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36349660	36349660	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36349660G>C	uc002ocb.3	+	4	628	c.416G>C	c.(415-417)GGA>GCA	p.G139A	KIRREL2_uc002obz.3_Missense_Mutation_p.G139A|KIRREL2_uc002oca.3_Missense_Mutation_p.G89A|KIRREL2_uc002occ.3_Missense_Mutation_p.G86A|KIRREL2_uc002ocd.3_Missense_Mutation_p.G136A	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	139	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGGTTGCTGGAGTTCCTGCG	0.617													34	118	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37130933	37130933	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37130933C>G	uc002oem.2	-	6	542	c.314G>C	c.(313-315)AGA>ACA	p.R105T	ZNF461_uc002oen.2_Missense_Mutation_p.R74T|ZNF461_uc010xtj.1_Missense_Mutation_p.R82T	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	105					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GGGCTCATCTCTGGATGCCAA	0.343													23	83	---	---	---	---	PASS
GGN	199720	broad.mit.edu	37	19	38877342	38877342	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38877342C>T	uc002oij.1	-	3	695	c.560G>A	c.(559-561)AGA>AAA	p.R187K	GGN_uc002oik.1_Intron|GGN_uc010efy.1_Missense_Mutation_p.R104K	NM_152657	NP_689870	Q86UU5	GGN_HUMAN	gametogenetin	187	Interaction with GGNBP1 (By similarity).|Pro-rich.				cell differentiation|multicellular organismal development|spermatogenesis						0	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGAGTGATTCTGCGGTCCGC	0.692													4	7	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39008108	39008108	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39008108G>A	uc002oit.2	+	66	9925	c.9795G>A	c.(9793-9795)GAG>GAA	p.E3265E	RYR1_uc002oiu.2_Silent_p.E3265E|RYR1_uc002oiv.1_Silent_p.E185E|RYR1_uc010xuf.1_Silent_p.E185E	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3265					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCTACACAGAGATGCCGCATG	0.672													16	45	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39061261	39061261	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39061261G>A	uc002oit.2	+	94	13804	c.13674G>A	c.(13672-13674)CGG>CGA	p.R4558R	RYR1_uc002oiu.2_Silent_p.R4553R	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4558			R -> Q (in CCD; autosomal recessive form).		muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	ACCTGTCCCGGAACTTTTACA	0.483													39	144	---	---	---	---	PASS
SIRT2	22933	broad.mit.edu	37	19	39390309	39390309	+	5'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39390309G>A	uc002ojt.1	-	1					SIRT2_uc002oju.1_5'UTR|SIRT2_uc010egj.1_5'UTR|SIRT2_uc002ojv.1_5'UTR|NFKBIB_uc010egk.1_5'Flank|NFKBIB_uc002ojw.2_5'Flank|NFKBIB_uc002ojx.2_5'Flank|NFKBIB_uc002ojy.2_5'Flank	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1						cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			ATAGGGCACAGAACTACAACT	0.597													3	3	---	---	---	---	PASS
HNRNPUL1	11100	broad.mit.edu	37	19	41770632	41770632	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41770632C>T	uc002oqb.3	+	1	513	c.224C>T	c.(223-225)ACC>ATC	p.T75I	CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Missense_Mutation_p.T75I|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_5'Flank|HNRNPUL1_uc010eho.2_5'Flank|HNRNPUL1_uc010xvy.1_5'Flank|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	75	Necessary for interaction with HRMT1L1.				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						CTGGAGGGGACCGCGCAGCCA	0.766													4	3	---	---	---	---	PASS
EXOSC5	56915	broad.mit.edu	37	19	41892596	41892596	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41892596G>C	uc002oqo.2	-	6	673	c.650C>G	c.(649-651)TCG>TGG	p.S217W	CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron	NM_020158	NP_064543	Q9NQT4	EXOS5_HUMAN	exosome component Rrp46	217					DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|rRNA processing	cytosol|exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding				0						GACGTGTTGCGAAGCGGCCTG	0.662													5	9	---	---	---	---	PASS
PSG3	5671	broad.mit.edu	37	19	43233301	43233301	+	Missense_Mutation	SNP	G	C	C	rs141177217	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43233301G>C	uc002oue.2	-	5	1349	c.1217C>G	c.(1216-1218)TCC>TGC	p.S406C	PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Missense_Mutation_p.S406C|PSG3_uc010eil.2_Missense_Mutation_p.S428C	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	406	Ig-like C2-type 3.				defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				CATGGATTTGGAGCTTTCCAT	0.473													67	259	---	---	---	---	PASS
LYPD5	284348	broad.mit.edu	37	19	44301925	44301925	+	Missense_Mutation	SNP	C	T	T	rs114185213	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44301925C>T	uc002oxm.3	-	5	655	c.574G>A	c.(574-576)GAG>AAG	p.E192K	LYPD5_uc002oxn.3_Missense_Mutation_p.E149K	NM_001031749	NP_001026919	Q6UWN5	LYPD5_HUMAN	LY6/PLAUR domain containing 5 isoform A	192	UPAR/Ly6.					anchored to membrane|plasma membrane					0		Prostate(69;0.0352)				GTGGTGCCCTCGGTGGTGCAG	0.612													11	57	---	---	---	---	PASS
ZNF222	7673	broad.mit.edu	37	19	44537161	44537161	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44537161C>G	uc002oyc.2	+	4	1517	c.1334C>G	c.(1333-1335)TCA>TGA	p.S445*	ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Nonsense_Mutation_p.S485*|ZNF222_uc002oyd.2_Nonsense_Mutation_p.S391*	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN	zinc finger protein 222 isoform 2	445					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Prostate(69;0.0435)				ATAATTTTATCAttattttta	0.219													6	31	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44739461	44739461	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44739461G>A	uc002oyu.2	+	6	1083	c.878G>A	c.(877-879)GGA>GAA	p.G293E	ZNF227_uc010xwu.1_Missense_Mutation_p.G242E|ZNF227_uc002oyv.2_Missense_Mutation_p.G293E|ZNF227_uc010xwv.1_Missense_Mutation_p.G242E|ZNF227_uc010xww.1_Missense_Mutation_p.G214E|ZNF227_uc002oyw.2_Missense_Mutation_p.G265E|ZNF227_uc010ejh.2_Missense_Mutation_p.G286E|ZNF235_uc002oyx.1_Intron	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	293					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				ATTCACCCAGGAGAGAAACTC	0.398													18	43	---	---	---	---	PASS
PVRL2	5819	broad.mit.edu	37	19	45391663	45391663	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45391663C>G	uc002ozw.1	+	9					TOMM40_uc002ozx.3_5'Flank|TOMM40_uc002ozy.3_5'Flank|TOMM40_uc002paa.3_5'Flank|TOMM40_uc002ozz.2_5'Flank	NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta						adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		CGTCTCACATCTCACCTGTTG	0.532													7	27	---	---	---	---	PASS
RELB	5971	broad.mit.edu	37	19	45541150	45541150	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45541150C>T	uc002paj.1	+	13					SFRS16_uc002pak.2_5'Flank|SFRS16_uc002pal.2_5'Flank|SFRS16_uc010xxh.1_5'Flank|SFRS16_uc002pam.2_5'Flank|SFRS16_uc002pan.1_5'Flank	NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GGCCCTTCCTCATGCTTCTGA	0.507													4	8	---	---	---	---	PASS
NKPD1	284353	broad.mit.edu	37	19	45655522	45655522	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45655522G>A	uc010xxi.1	-	4	2173	c.2173C>T	c.(2173-2175)CTG>TTG	p.L725L		NM_198478	NP_940880			NTPase, KAP family P-loop domain containing 1												0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		TCGGCGCCCAGGAAGCGCTCG	0.672													5	11	---	---	---	---	PASS
CARD8	22900	broad.mit.edu	37	19	48735085	48735085	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48735085G>C	uc002pie.3	-						CARD8_uc002pii.3_Intron|CARD8_uc010xzi.1_Intron|CARD8_uc010els.2_Missense_Mutation_p.S58C|CARD8_uc010xzj.1_Intron|CARD8_uc010xzk.1_Intron|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_Intron|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Intron	NM_014959	NP_055774	Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		GAAAATACTAGACATGTAAGA	0.403													9	34	---	---	---	---	PASS
KCNJ14	3770	broad.mit.edu	37	19	48967834	48967834	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48967834G>C	uc002pje.1	+	3	1516	c.1111G>C	c.(1111-1113)GAG>CAG	p.E371Q	KCNJ14_uc002pjf.1_Missense_Mutation_p.E371Q	NM_013348	NP_037480	Q9UNX9	IRK14_HUMAN	potassium inwardly-rectifying channel J14	371	Cytoplasmic (By similarity).					voltage-gated potassium channel complex	inward rectifier potassium channel activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)		TGAACGGGCAGAGCAGGCTTC	0.552													17	68	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49132338	49132338	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49132338C>G	uc002pjr.2	+	7	1639	c.1273C>G	c.(1273-1275)CTT>GTT	p.L425V	SPHK2_uc010xzt.1_Missense_Mutation_p.L366V|SPHK2_uc002pjs.2_Missense_Mutation_p.L425V|SPHK2_uc002pjt.2_Missense_Mutation_p.L219V|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Missense_Mutation_p.L389V|SPHK2_uc002pjw.2_Missense_Mutation_p.L487V	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	425					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		tgacctgcctcttcccctgcc	0.348													9	45	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49132817	49132817	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49132817C>G	uc002pjr.2	+	7	2118	c.1752C>G	c.(1750-1752)TTC>TTG	p.F584L	SPHK2_uc010xzt.1_Missense_Mutation_p.F525L|SPHK2_uc002pjs.2_Missense_Mutation_p.F584L|SPHK2_uc002pjt.2_Missense_Mutation_p.F378L|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.2_Missense_Mutation_p.F548L|SPHK2_uc002pjw.2_Missense_Mutation_p.F646L	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	584					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TGCGCCTTTTCTTGGCCATGG	0.701													2	6	---	---	---	---	PASS
PLEKHA4	57664	broad.mit.edu	37	19	49362759	49362759	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49362759G>C	uc002pkx.2	-	7	1210	c.659C>G	c.(658-660)TCT>TGT	p.S220C	PLEKHA4_uc002pkw.1_5'Flank|PLEKHA4_uc010eml.2_Missense_Mutation_p.S220C	NM_020904	NP_065955	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing family A	220	Pro-rich.					cytoplasm|membrane	1-phosphatidylinositol binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		CTGGAGTCCAGAGTGGAGGTC	0.632													17	62	---	---	---	---	PASS
BAX	581	broad.mit.edu	37	19	49464356	49464356	+	Intron	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49464356C>G	uc002plk.2	+						BAX_uc002plf.1_3'UTR|BAX_uc002plg.1_3'UTR|BAX_uc002plh.1_3'UTR|BAX_uc010xzx.1_Intron|BAX_uc002plj.2_Intron|BAX_uc002pll.2_Intron|BAX_uc002plm.2_Intron	NM_138761	NP_620116	Q07812	BAX_HUMAN	BCL2-associated X protein isoform alpha						activation of caspase activity by cytochrome c|activation of pro-apoptotic gene products|B cell apoptosis|cleavage of lamin|DNA fragmentation involved in apoptotic nuclear change|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|induction of retinal programmed cell death|mitochondrial fragmentation involved in apoptosis|mitochondrial fusion|negative regulation of protein binding|negative regulation of survival gene product expression|nuclear fragmentation involved in apoptotic nuclear change|positive regulation of neuron apoptosis|protein homooligomerization|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria|release of matrix enzymes from mitochondria|response to toxin|transformed cell apoptosis	cytosol|endoplasmic reticulum membrane|mitochondrial outer membrane|mitochondrial permeability transition pore complex|nucleus	BH3 domain binding|channel activity|lipid binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		CGTGTCTGATCAATCCCCGAT	0.552													5	69	---	---	---	---	PASS
SLC6A16	28968	broad.mit.edu	37	19	49814319	49814319	+	Missense_Mutation	SNP	C	G	G	rs148710394	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49814319C>G	uc002pmz.2	-	2	520	c.286G>C	c.(286-288)GAG>CAG	p.E96Q	SLC6A16_uc002pna.2_Missense_Mutation_p.E96Q|hsa-mir-4324|MI0015854_5'Flank	NM_014037	NP_054756	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	96	Cytoplasmic (Potential).					integral to membrane|intracellular	neurotransmitter:sodium symporter activity			skin(2)|ovary(1)|kidney(1)	4		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		ACCTCACTCTCTTTCTTCTCT	0.517													27	92	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50099726	50099726	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50099726G>A	uc002poo.3	+	4	2134	c.2134G>A	c.(2134-2136)GAG>AAG	p.E712K		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CAGCCTGGATGAGGGTGCCAC	0.682													7	12	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50209292	50209292	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50209292G>A	uc002ppj.2	+	10	1296	c.1091G>A	c.(1090-1092)AGA>AAA	p.R364K	CPT1C_uc002ppl.3_Missense_Mutation_p.R330K|CPT1C_uc002ppi.2_Missense_Mutation_p.R281K|CPT1C_uc002ppk.2_Missense_Mutation_p.R353K|CPT1C_uc010eng.2_Missense_Mutation_p.R364K|CPT1C_uc010enh.2_Missense_Mutation_p.R364K|CPT1C_uc010ybc.1_Missense_Mutation_p.R235K|CPT1C_uc010eni.1_Missense_Mutation_p.R21K	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	364	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		CAGTTTCAGAGAATCCTGGAT	0.632													22	69	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53855026	53855026	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53855026C>G	uc010ydv.1	+	4	1215	c.1098C>G	c.(1096-1098)TTC>TTG	p.F366L	ZNF845_uc010ydw.1_Missense_Mutation_p.F366L	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	366	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTTCAGTTTCAAATCAAACC	0.398													24	71	---	---	---	---	PASS
MIR520A	574467	broad.mit.edu	37	19	54194177	54194177	+	RNA	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54194177G>C	hsa-mir-520a|MI0003149	+			c.43G>C																				0						TCTGTTGTCTGAGAGAAAAGA	0.443													48	175	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54646543	54646543	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54646543G>A	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_Intron|CNOT3_uc002qdk.1_5'UTR|CNOT3_uc010ere.1_5'Flank	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TCTCTTGTCAGATAGCAAATG	0.483													5	9	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54646674	54646674	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54646674C>G	uc002qdj.1	+	2					CNOT3_uc010yel.1_5'UTR|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_5'UTR|CNOT3_uc010ere.1_5'Flank	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCGTCCGTCTCCAAGAGAGTA	0.522													28	94	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54646863	54646863	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54646863G>C	uc002qdj.1	+	3	345	c.34G>C	c.(34-36)GAT>CAT	p.D12H	CNOT3_uc010yel.1_Missense_Mutation_p.D12H|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Missense_Mutation_p.D12H|CNOT3_uc010ere.1_5'Flank	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	12					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					AGGTGAGATTGATCGCTGCCT	0.537													36	247	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54646887	54646887	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54646887G>A	uc002qdj.1	+	3	369	c.58G>A	c.(58-60)GAG>AAG	p.E20K	CNOT3_uc010yel.1_Missense_Mutation_p.E20K|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Missense_Mutation_p.E20K|CNOT3_uc010ere.1_5'Flank	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	20					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding	p.E20K(1)		ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAAGGTGTCCGAGGGCGTGGA	0.557													32	239	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54647511	54647511	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54647511G>C	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_Intron	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTGAGTCCCAGAGAGGTGGGA	0.552													15	34	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54647616	54647616	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54647616G>A	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_Translation_Start_Site|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_Intron	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCTAAGGGAAGTGAAGAGGCA	0.577													12	51	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54647621	54647621	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54647621G>A	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_5'UTR|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_Intron	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGGAAGTGAAGAGGCAGCGGA	0.577													14	49	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54649277	54649277	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54649277G>A	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_Intron|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_Splice_Site	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGTGGGGGCAGGAGGGGCCAA	0.662													5	10	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54649308	54649308	+	Intron	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54649308G>A	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_Intron|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_RNA	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGCAGCCCCTGAGCCTGGCCC	0.647													5	16	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54724400	54724400	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54724400G>A	uc002qef.1	-	6	1367	c.1256C>T	c.(1255-1257)TCA>TTA	p.S419L	LILRB3_uc002qee.1_Missense_Mutation_p.S419L|LILRB3_uc002qeh.1_Missense_Mutation_p.S419L|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Missense_Mutation_p.S419L|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Missense_Mutation_p.S419L|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Missense_Mutation_p.S419L|LILRB3_uc002qep.1_Missense_Mutation_p.S419L|LILRB3_uc002qeq.1_Missense_Mutation_p.S419L|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Missense_Mutation_p.S419L|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	419	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GCCCTCACCTGAGACCACGAG	0.667													10	33	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54746131	54746131	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54746131C>T	uc010erh.1	-	3	250	c.126G>A	c.(124-126)GGG>GGA	p.G42G	LILRA6_uc002qew.1_Silent_p.G42G|LILRB3_uc002qeh.1_Silent_p.G42G|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Silent_p.G42G|LILRA6_uc002qek.1_Silent_p.G42G|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Silent_p.G42G|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Silent_p.G42G|LILRB3_uc002qep.1_Silent_p.G42G|LILRB3_uc002qeq.1_Silent_p.G42G|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Silent_p.G42G|LILRA6_uc010yep.1_Silent_p.G42G|LILRA6_uc010yeq.1_Silent_p.G42G|LILRA6_uc002qet.3_RNA|LILRA6_uc002qeu.1_Silent_p.G42G|LILRA6_uc002qev.1_5'Flank	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	42	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCACGGGGCTCCCCCAGCTGA	0.602													27	169	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55610164	55610164	+	Silent	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55610164C>A	uc002qix.2	-	6	955	c.939G>T	c.(937-939)CGG>CGT	p.R313R	PPP1R12C_uc010yfs.1_Silent_p.R239R|PPP1R12C_uc002qiy.2_Silent_p.R313R	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	313	Potential.					cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CCTCCTGTTTCCGGGCCAGTT	0.637													22	86	---	---	---	---	PASS
SYT5	6861	broad.mit.edu	37	19	55689630	55689630	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55689630C>T	uc002qjm.1	-	2	1246	c.186G>A	c.(184-186)AAG>AAA	p.K62K	SYT5_uc002qjp.2_Intron|SYT5_uc002qjn.1_Silent_p.K62K|SYT5_uc002qjo.1_Silent_p.K62K	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	62	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGGCCTGGCTCTTCTTGCCTG	0.632													3	12	---	---	---	---	PASS
ZNF580	51157	broad.mit.edu	37	19	56153796	56153796	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56153796C>T	uc002qlo.2	+						ZNF580_uc002qlm.2_Intron|ZNF581_uc002qln.2_Intron|ZNF580_uc002qlp.2_5'UTR|ZNF580_uc010ygd.1_Intron|ZNF581_uc002qlq.2_5'Flank	NM_207115	NP_996998	Q9UK33	ZN580_HUMAN	zinc finger protein 580						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GGGATGCTTTCCATTTTAGGA	0.537													10	29	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57932476	57932476	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57932476C>G	uc002qoo.1	+	3	1847	c.1616C>G	c.(1615-1617)TCA>TGA	p.S539*	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Nonsense_Mutation_p.S541*	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	539	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		AGGCACAACTCAAATCATATT	0.423													26	96	---	---	---	---	PASS
ZNF324	25799	broad.mit.edu	37	19	58982927	58982927	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58982927C>G	uc002qsw.1	+	4	1162	c.1068C>G	c.(1066-1068)CTC>CTG	p.L356L	ZNF324_uc002qsx.1_Silent_p.L133L	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	356	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GCTCCAACCTCAGCCAGCACC	0.662													4	14	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10632342	10632342	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10632342G>T	uc002wnw.2	-	8	1523	c.1007C>A	c.(1006-1008)GCT>GAT	p.A336D	JAG1_uc010gcd.1_5'Flank	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	336	Extracellular (Potential).|EGF-like 4.				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						GGCGTGCTCAGCTGCAAAAAC	0.607									Alagille_Syndrome				6	20	---	---	---	---	PASS
ISM1	140862	broad.mit.edu	37	20	13251215	13251215	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13251215C>A	uc010gce.1	+	2	209	c.203C>A	c.(202-204)CCA>CAA	p.P68Q	TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor	68						extracellular region					0						AAAGAAGCACCAAGGGAGCAT	0.502													12	42	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13850838	13850838	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13850838G>C	uc010gcf.2	-	13	1198	c.1116C>G	c.(1114-1116)ATC>ATG	p.I372M	SEL1L2_uc002woq.3_Missense_Mutation_p.I233M|SEL1L2_uc010zrl.1_Missense_Mutation_p.I372M|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	372	Extracellular (Potential).|Sel1-like 7.					integral to membrane	binding			ovary(2)	2						CATGAAGGCCGATTGCATTGC	0.333													26	85	---	---	---	---	PASS
FOXA2	3170	broad.mit.edu	37	20	22563340	22563340	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22563340C>G	uc002wsn.2	-	3	712	c.522G>C	c.(520-522)CAG>CAC	p.Q174H	FOXA2_uc002wsm.2_Missense_Mutation_p.Q180H	NM_153675	NP_710141	Q9Y261	FOXA2_HUMAN	forkhead box A2 isoform 2	174	Fork-head.				cell differentiation in hindbrain|central nervous system myelin formation|chromatin modification|dorsal/ventral neural tube patterning|ectoderm formation|endocrine pancreas development|endoderm development|epithelial tube branching involved in lung morphogenesis|in utero embryonic development|lung epithelial cell differentiation|negative regulation of neuron differentiation|neuron fate specification|oligodendrocyte cell fate commitment|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of neuron differentiation|primitive streak formation|regulation of blood coagulation|regulation of sequence-specific DNA binding transcription factor activity|response to interleukin-6	cytoplasm|transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4	Lung NSC(19;0.188)					TGTTGGGGCTCTGCTGGATGG	0.617													41	117	---	---	---	---	PASS
ABHD12	26090	broad.mit.edu	37	20	25295601	25295601	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25295601C>G	uc002wus.1	-	6	717	c.579G>C	c.(577-579)CTG>CTC	p.L193L	ABHD12_uc002wuq.2_Silent_p.L193L|ABHD12_uc002wur.2_Silent_p.L193L|ABHD12_uc002wut.1_Silent_p.L193L|ABHD12_uc002wuu.1_5'UTR	NM_001042472	NP_001035937	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12 isoform a	193	Extracellular (Potential).					integral to membrane	acylglycerol lipase activity			skin(1)	1						CAAGGGAACTCAGCACCTGTA	0.448													22	91	---	---	---	---	PASS
ID1	3397	broad.mit.edu	37	20	30193153	30193153	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30193153C>T	uc002wwg.1	+	1					ID1_uc002wwh.1_5'UTR|hsa-mir-3193|MI0014238_5'Flank	NM_002165	NP_002156	P41134	ID1_HUMAN	inhibitor of DNA binding 1 isoform a						angiogenesis|blood vessel endothelial cell migration|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription by transcription factor localization|transforming growth factor beta receptor signaling pathway	cytoplasm	protein binding			ovary(1)	1	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.99e-05)|all cancers(5;0.000169)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TCATTTTTTTCGCTTTGCCCA	0.557													13	38	---	---	---	---	PASS
C20orf70	140683	broad.mit.edu	37	20	31760844	31760844	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31760844C>T	uc002wyo.1	+	3	335	c.264C>T	c.(262-264)GTC>GTT	p.V88V		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	88						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2						TGAACAATGTCATTTCTAAGC	0.463													26	62	---	---	---	---	PASS
C20orf71	128861	broad.mit.edu	37	20	31813019	31813019	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31813019G>C	uc002wyr.2	+	4	710	c.502G>C	c.(502-504)GAG>CAG	p.E168Q	C20orf71_uc002wys.2_Missense_Mutation_p.E132Q	NM_178466	NP_848561	Q9BQP9	SPLC3_HUMAN	short long palate, lung and nasal epithelium	168						extracellular region	lipid binding			ovary(1)|skin(1)	2						ATGCGATGCAGAGCCCAGCAG	0.572													42	132	---	---	---	---	PASS
GDF5	8200	broad.mit.edu	37	20	34021568	34021568	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34021568C>T	uc002xck.1	-	2					GDF5_uc010gfc.1_Intron|uc002xcj.2_Intron|GDF5_uc010zvc.1_3'UTR	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein						cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			ACTCAGAGAGCGAGCAAGCTT	0.562													6	21	---	---	---	---	PASS
CPNE1	8904	broad.mit.edu	37	20	34220101	34220101	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34220101C>G	uc002xdf.2	-	7	803	c.440G>C	c.(439-441)AGA>ACA	p.R147T	CPNE1_uc002xdc.2_5'Flank|CPNE1_uc010zvj.1_Missense_Mutation_p.R152T|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdg.2_Missense_Mutation_p.R147T|CPNE1_uc010gfi.2_RNA|CPNE1_uc010gfj.2_RNA|CPNE1_uc002xdh.2_Missense_Mutation_p.R147T|CPNE1_uc002xdi.2_Missense_Mutation_p.R147T|CPNE1_uc002xdj.2_Missense_Mutation_p.R147T|CPNE1_uc002xdk.2_Missense_Mutation_p.R147T|CPNE1_uc002xdl.2_Missense_Mutation_p.R147T|CPNE1_uc002xdm.2_Missense_Mutation_p.R147T|CPNE1_uc010gfk.1_Missense_Mutation_p.R147T	NM_152931	NP_690908	Q99829	CPNE1_HUMAN	copine I isoform a	147	C2 2.				lipid metabolic process|vesicle-mediated transport		calcium-dependent phospholipid binding|phosphatidylserine binding|transporter activity			upper_aerodigestive_tract(1)	1	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ATCTAGGTTTCTGGCCTCTAC	0.483													21	69	---	---	---	---	PASS
CTNNBL1	56259	broad.mit.edu	37	20	36488327	36488327	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36488327C>T	uc010zvw.1	+	15	1510	c.1419C>T	c.(1417-1419)ATC>ATT	p.I473I	CTNNBL1_uc002xhh.2_Silent_p.I286I|CTNNBL1_uc002xhi.2_RNA|CTNNBL1_uc002xhj.2_Silent_p.I221I	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1	473					apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				GAGAGATCATCGACAATGACA	0.522													8	52	---	---	---	---	PASS
BPI	671	broad.mit.edu	37	20	36948673	36948673	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36948673G>A	uc002xib.2	+	7	827	c.765G>A	c.(763-765)ATG>ATA	p.M255I		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	255					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				ATGTACAGATGAAGGTGAGGC	0.468													6	42	---	---	---	---	PASS
TOP1	7150	broad.mit.edu	37	20	39708734	39708734	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39708734A>T	uc002xjl.2	+	6	591	c.345A>T	c.(343-345)CAA>CAT	p.Q115H	TOP1_uc010gge.1_RNA	NM_003286	NP_003277	P11387	TOP1_HUMAN	DNA topoisomerase I	115	Lys-rich.				DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)	GTCCACCACAAATTAAAGATG	0.348			T	NUP98	AML*								13	52	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43850714	43850714	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43850714G>A	uc010ggz.2	+	2	498	c.441G>A	c.(439-441)GGG>GGA	p.G147G	SEMG2_uc002xnk.2_Silent_p.G147G|SEMG2_uc002xnl.2_Silent_p.G147G	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	147	Repeat-rich region.|2-1.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AAGATCAGGGGAATAGCCCAT	0.408													22	65	---	---	---	---	PASS
SEMG2	6407	broad.mit.edu	37	20	43850728	43850728	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43850728G>A	uc010ggz.2	+	2	512	c.455G>A	c.(454-456)GGA>GAA	p.G152E	SEMG2_uc002xnk.2_Missense_Mutation_p.G152E|SEMG2_uc002xnl.2_Missense_Mutation_p.G152E	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	152	Repeat-rich region.|2-1.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				AGCCCATCTGGAAAGGGATTA	0.408													23	70	---	---	---	---	PASS
ZNF335	63925	broad.mit.edu	37	20	44577600	44577600	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44577600C>T	uc002xqw.2	-	28	4144	c.4021G>A	c.(4021-4023)GAT>AAT	p.D1341N	ZNF335_uc002xqv.2_Missense_Mutation_p.D453N|ZNF335_uc010zxk.1_Missense_Mutation_p.D1186N	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1341					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				GCTCAGTCATCGGCCAGGGTG	0.607													23	68	---	---	---	---	PASS
PTGIS	5740	broad.mit.edu	37	20	48130897	48130897	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48130897G>C	uc002xut.2	-	7	945	c.891C>G	c.(889-891)CTC>CTG	p.L297L	PTGIS_uc010zyi.1_Silent_p.L158L	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	297					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	TGAGAAGGAAGAGCAGGAGCC	0.597													14	54	---	---	---	---	PASS
SLC9A8	23315	broad.mit.edu	37	20	48497480	48497480	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48497480G>C	uc002xuv.1	+	13	1388	c.1178G>C	c.(1177-1179)AGA>ACA	p.R393T	SLC9A8_uc010zym.1_Missense_Mutation_p.R93T|SLC9A8_uc010gic.2_Missense_Mutation_p.R93T|SLC9A8_uc010gid.2_Missense_Mutation_p.R17T	NM_015266	NP_056081	Q9Y2E8	SL9A8_HUMAN	sodium/hydrogen exchanger 8	393	Helical; (Potential).					Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			CTATTTGGCAGAGCGGTAAAC	0.413													33	127	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50408216	50408216	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50408216G>C	uc002xwh.3	-	2	907	c.806C>G	c.(805-807)TCT>TGT	p.S269C	SALL4_uc010gii.2_Missense_Mutation_p.S269C|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	269					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CACAGCTGCAGAAACCTGCTG	0.592													5	30	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50768648	50768648	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50768648C>G	uc002xwl.2	-	6					ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_3'UTR|ZFP64_uc002xwn.2_3'UTR	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						TTCTTTTTCTCAATTCCTTTC	0.313													9	40	---	---	---	---	PASS
C20orf177	63939	broad.mit.edu	37	20	58520007	58520007	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58520007G>C	uc002yba.2	+	5	1424	c.1009G>C	c.(1009-1011)GAT>CAT	p.D337H	C20orf177_uc010zzx.1_Missense_Mutation_p.D180H|C20orf177_uc002ybc.2_Missense_Mutation_p.D337H	NM_022106	NP_071389	Q9NTX9	CT177_HUMAN	hypothetical protein LOC63939	337										ovary(2)|breast(1)	3	all_lung(29;0.00693)		BRCA - Breast invasive adenocarcinoma(7;1.22e-08)			GGACTCAGCAGATTCCTGTAA	0.517													17	54	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60921260	60921260	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60921260C>T	uc002ycq.2	-	10	1361	c.1294G>A	c.(1294-1296)GAG>AAG	p.E432K		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	432	Laminin EGF-like 3.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AAGTCGGACTCGCAGTTGCAG	0.647													11	19	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61959482	61959482	+	Intron	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61959482G>C	uc011aau.1	+						COL20A1_uc011aav.1_Missense_Mutation_p.E1027Q	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CCAGGCCTGTGAGTCTGCCAT	0.647													6	22	---	---	---	---	PASS
UCKL1	54963	broad.mit.edu	37	20	62577259	62577259	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62577259C>T	uc010gkn.2	-	4	524	c.481G>A	c.(481-483)GAC>AAC	p.D161N	UCKL1_uc011abm.1_Missense_Mutation_p.D146N|UCKL1_uc011abn.1_RNA|UCKL1_uc011abo.1_RNA	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	161					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AGGTCGAAGTCAAAGGCATCT	0.562													86	284	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10973742	10973742	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10973742C>G	uc002yip.1	-	4					TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_5'UTR|TPTE_uc002yir.1_5'UTR|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATACGTGCCTCTGGGTTCACT	0.368													17	149	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15561577	15561577	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15561577G>A	uc002yjm.2	-	2	283	c.273C>T	c.(271-273)TTC>TTT	p.F91F	LIPI_uc010gkw.1_Silent_p.F24F	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	70					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TTTGTGTGTTGAAATTAACAT	0.383													31	89	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22910264	22910264	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22910264G>C	uc002yld.1	+	18	2749	c.2500G>C	c.(2500-2502)GAC>CAC	p.D834H	NCAM2_uc011acb.1_Missense_Mutation_p.D692H	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	834	Cytoplasmic (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AAAAGAAGACGACAGCAAAGC	0.358													10	64	---	---	---	---	PASS
KRTAP13-2	337959	broad.mit.edu	37	21	31744044	31744044	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31744044C>G	uc002ynz.3	-	1	514	c.488G>C	c.(487-489)AGA>ACA	p.R163T		NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	163						intermediate filament					0						ATAGGCTGGTCTGTAACAAGG	0.493													12	47	---	---	---	---	PASS
SH3BGR	6450	broad.mit.edu	37	21	40883722	40883722	+	3'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40883722C>T	uc002yya.2	+	6					SH3BGR_uc002yxz.2_3'UTR	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		TGCTTCATTTCTTCCACTTCT	0.493													20	63	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45514011	45514011	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45514011C>G	uc002zea.2	+	20	3234	c.3065C>G	c.(3064-3066)TCT>TGT	p.S1022C	TRAPPC10_uc010gpo.2_Missense_Mutation_p.S733C|TRAPPC10_uc011afa.1_Missense_Mutation_p.S400C|TRAPPC10_uc011afb.1_Missense_Mutation_p.S127C	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1022					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CCTCCCCCTTCTCTGCATTGC	0.478													39	176	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45514050	45514050	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45514050C>G	uc002zea.2	+	20	3273	c.3104C>G	c.(3103-3105)TCT>TGT	p.S1035C	TRAPPC10_uc010gpo.2_Missense_Mutation_p.S746C|TRAPPC10_uc011afa.1_Missense_Mutation_p.S413C|TRAPPC10_uc011afb.1_Missense_Mutation_p.S140C	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1035					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						TCCCCAGCTTCTGAGGAACAG	0.448													40	181	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45518306	45518306	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45518306C>G	uc002zea.2	+	21	3406	c.3237C>G	c.(3235-3237)CTC>CTG	p.L1079L	TRAPPC10_uc010gpo.2_Silent_p.L790L|TRAPPC10_uc011afa.1_Silent_p.L457L|TRAPPC10_uc011afb.1_Silent_p.L184L	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1079					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAGGCTCCCTCTGCTCCCTGG	0.473													54	188	---	---	---	---	PASS
AIRE	326	broad.mit.edu	37	21	45706995	45706995	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45706995C>G	uc002zei.2	+	3	569	c.442C>G	c.(442-444)CCA>GCA	p.P148A		NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1	148					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		AGCCCTGACTCCAAGGGGCAC	0.716									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				4	23	---	---	---	---	PASS
PEX26	55670	broad.mit.edu	37	22	18566266	18566266	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18566266C>T	uc002znp.3	+	4	644	c.435C>T	c.(433-435)CTC>CTT	p.L145L	TUBA8_uc002znr.2_Intron|PEX26_uc002znq.3_Silent_p.L145L|PEX26_uc002znt.2_Silent_p.L145L	NM_017929	NP_060399	Q7Z412	PEX26_HUMAN	peroxisome biogenesis factor 26	145	Cytoplasmic (Potential).				protein import into peroxisome matrix|protein import into peroxisome membrane	integral to peroxisomal membrane	protein C-terminus binding|protein complex binding			skin(1)	1						GTGCCTGGCTCCAAGACCCAG	0.527													45	175	---	---	---	---	PASS
ZNF70	7621	broad.mit.edu	37	22	24086954	24086954	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24086954G>C	uc002zxs.2	-	2	835	c.374C>G	c.(373-375)TCA>TGA	p.S125*	ZNF70_uc002zxr.1_5'Flank	NM_021916	NP_068735	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	125						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						GTTAGGTCCTGAGTCCCCTCT	0.562													44	159	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24615767	24615767	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24615767G>A	uc002zzo.3	-	12					GGT5_uc002zzp.3_3'UTR|GGT5_uc002zzr.3_3'UTR|GGT5_uc002zzq.3_3'UTR|GGT5_uc011ajm.1_3'UTR	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b						glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						GGTTAGGGATGAGGCTCAGCC	0.652													3	6	---	---	---	---	PASS
CRYBB1	1414	broad.mit.edu	37	22	27003913	27003913	+	Missense_Mutation	SNP	C	A	A	rs141811471		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27003913C>A	uc003acy.1	-	4	442	c.372G>T	c.(370-372)TGG>TGT	p.W124C		NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1	124	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens			ovary(1)	1						ACCATGTGTTCCAGCGAGGGT	0.592													21	53	---	---	---	---	PASS
CRYBB1	1414	broad.mit.edu	37	22	27003914	27003914	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27003914C>T	uc003acy.1	-	4	441	c.371G>A	c.(370-372)TGG>TAG	p.W124*		NM_001887	NP_001878	P53674	CRBB1_HUMAN	crystallin, beta B1	124	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens			ovary(1)	1						CCATGTGTTCCAGCGAGGGTA	0.592													22	54	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29752417	29752417	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29752417C>T	uc003afj.2	-	6	898	c.714G>A	c.(712-714)CAG>CAA	p.Q238Q	AP1B1_uc003afi.2_Silent_p.Q238Q|AP1B1_uc003afk.2_Silent_p.Q238Q|AP1B1_uc003afl.2_Silent_p.Q238Q	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	238					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						CCGCTCACCTCTGGGCCTCGC	0.637													11	23	---	---	---	---	PASS
ASCC2	84164	broad.mit.edu	37	22	30188508	30188508	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30188508G>A	uc003agr.2	-	18	2041	c.1936C>T	c.(1936-1938)CAG>TAG	p.Q646*	ASCC2_uc003ags.2_RNA|ASCC2_uc003agt.2_Nonsense_Mutation_p.Q646*|ASCC2_uc011akr.1_Nonsense_Mutation_p.Q570*	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	646					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			CTCAGCACCTGAGGGATGGTG	0.562													39	484	---	---	---	---	PASS
ELFN2	114794	broad.mit.edu	37	22	37770273	37770273	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37770273G>A	uc003asq.3	-	3	2088	c.1302C>T	c.(1300-1302)GTC>GTT	p.V434V		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	434	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					TGGTCTTCTTGACGTTGACAG	0.617													58	197	---	---	---	---	PASS
EIF3L	51386	broad.mit.edu	37	22	38273809	38273809	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38273809G>C	uc003auf.2	+	11	1293	c.1206G>C	c.(1204-1206)CAG>CAC	p.Q402H	EIF3L_uc003aue.1_Missense_Mutation_p.Q402H|EIF3L_uc011ann.1_Missense_Mutation_p.Q354H|EIF3L_uc003aug.2_Missense_Mutation_p.Q294H|EIF3L_uc003auh.2_Missense_Mutation_p.Q135H	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3	402						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						TGCGCATGCAGAAAGGTGACC	0.517													25	80	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40815081	40815081	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40815081G>C	uc003ayv.1	-	9	1568	c.1361C>G	c.(1360-1362)TCT>TGT	p.S454C	MKL1_uc003ayw.1_Missense_Mutation_p.S454C|MKL1_uc010gye.1_Missense_Mutation_p.S454C|MKL1_uc010gyf.1_Missense_Mutation_p.S404C	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	454					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GGGGGTGGGAGACACGGGGGG	0.667			T	RBM15	acute megakaryocytic leukemia								4	18	---	---	---	---	PASS
L3MBTL2	83746	broad.mit.edu	37	22	41626166	41626166	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41626166G>C	uc003azo.2	+	17	2083	c.2029G>C	c.(2029-2031)GAG>CAG	p.E677Q	L3MBTL2_uc003azn.2_RNA|CHADL_uc003azq.3_Intron|CHADL_uc010gyj.2_Intron	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2	677					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3						TGTGAAGGAAGAGCATCTAGA	0.602													20	74	---	---	---	---	PASS
RIBC2	26150	broad.mit.edu	37	22	45818177	45818177	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45818177C>T	uc011aqs.1	+	5	758	c.549C>T	c.(547-549)CTC>CTT	p.L183L		NM_015653	NP_056468	Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	115											0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CAGAGGCCCTCTACACAGAGA	0.547													68	225	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46693369	46693369	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46693369G>A	uc011aqy.1	+	2	284	c.72G>A	c.(70-72)AAG>AAA	p.K24K	CN5H6.4_uc003bhj.3_5'Flank|GTSE1_uc011aqz.1_5'UTR	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	5					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		ATGACCCTAAGAAGGAAGGCA	0.547													23	97	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46725133	46725133	+	Intron	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46725133C>T	uc011aqy.1	+						GTSE1_uc011aqz.1_Intron|GTSE1_uc003bhn.2_RNA|uc011ara.1_5'Flank|uc003bho.3_5'Flank	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		ACCAAGGCCCCGCCTGATTCC	0.592													10	37	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50721499	50721499	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50721499G>A	uc003bkv.3	-	17	2902	c.2796C>T	c.(2794-2796)CTC>CTT	p.L932L	PLXNB2_uc003bkt.1_5'Flank|PLXNB2_uc003bku.1_5'Flank	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	932	Extracellular (Potential).|IPT/TIG 2.				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGACGCCGTTGAGGGTCACCC	0.677													11	17	---	---	---	---	PASS
CHKB	1120	broad.mit.edu	37	22	51020725	51020725	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51020725C>T	uc003bms.2	-	2	504	c.286G>A	c.(286-288)GAG>AAG	p.E96K	CHKB-CPT1B_uc003bmp.2_5'Flank|CHKB-CPT1B_uc003bmt.1_5'UTR|CHKB-CPT1B_uc003bmu.2_5'UTR|CHKB_uc003bmv.2_Missense_Mutation_p.E96K|LOC100144603_uc003bmw.3_5'Flank	NM_005198	NP_005189	Q9Y259	CHKB_HUMAN	choline kinase beta	96					phosphatidylethanolamine biosynthetic process		ATP binding|choline kinase activity|ethanolamine kinase activity				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	CGGGGCTCCTCGCCAACGCTG	0.701													3	8	---	---	---	---	PASS
ARSE	415	broad.mit.edu	37	X	2876407	2876407	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2876407G>A	uc004crc.3	-	3	343	c.93C>T	c.(91-93)AGC>AGT	p.S31S	ARSE_uc011mhi.1_Intron|ARSE_uc011mhh.1_Silent_p.S56S	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	31					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGGAAATGTCGCTGGAAGCTG	0.552													20	58	---	---	---	---	PASS
PIGA	5277	broad.mit.edu	37	X	15339616	15339616	+	3'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15339616C>G	uc004cwr.2	-	6					PIGA_uc010neu.2_3'UTR|PIGA_uc004cwq.2_3'UTR|PIGA_uc010nev.2_3'UTR|PIGA_uc004cws.2_3'UTR|PIGA_uc011miq.1_3'UTR	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol						C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)					ATCTTACAATCTAGGCTTCCT	0.363													39	151	---	---	---	---	PASS
PHKA2	5256	broad.mit.edu	37	X	18926150	18926150	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18926150G>C	uc004cyv.3	-	22	2815	c.2385C>G	c.(2383-2385)CTC>CTG	p.L795L	PHKA2_uc004cyu.3_Silent_p.L93L|PHKA2_uc010nfe.1_5'Flank|PHKA2_uc010nff.1_5'Flank	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	795					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					GCTGTCCAGAGAGATTTGTGT	0.517													67	321	---	---	---	---	PASS
SAT1	6303	broad.mit.edu	37	X	23803975	23803975	+	3'UTR	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23803975G>C	uc004dau.2	+	6					SAT1_uc004dav.2_RNA	NM_002970	NP_002961	P21673	SAT1_HUMAN	diamine N-acetyltransferase 1						angiogenesis|polyamine biosynthetic process	cytosol	diamine N-acetyltransferase activity|protein binding				0					Spermine(DB00127)	GAGGAGTGAGGAGTGCTGCTG	0.408													10	32	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32429880	32429880	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32429880G>A	uc004dda.1	-	30	4466	c.4222C>T	c.(4222-4224)CAG>TAG	p.Q1408*	DMD_uc004dcw.2_Nonsense_Mutation_p.Q64*|DMD_uc004dcx.2_Nonsense_Mutation_p.Q67*|DMD_uc004dcz.2_Nonsense_Mutation_p.Q1285*|DMD_uc004dcy.1_Nonsense_Mutation_p.Q1404*|DMD_uc004ddb.1_Nonsense_Mutation_p.Q1400*|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1408					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGGGCTTCCTGAGGCATTTGA	0.398													29	98	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39933287	39933287	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39933287C>T	uc004den.3	-	4	1604	c.1312G>A	c.(1312-1314)GAT>AAT	p.D438N	BCOR_uc004dep.3_Missense_Mutation_p.D438N|BCOR_uc004deo.3_Missense_Mutation_p.D438N|BCOR_uc004dem.3_Missense_Mutation_p.D438N|BCOR_uc004deq.3_Missense_Mutation_p.D438N	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	438					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						AGTGGCTTATCTGTGACGTCT	0.532													18	67	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40568682	40568682	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40568682C>G	uc004dex.3	-	10	1343	c.1203G>C	c.(1201-1203)CTG>CTC	p.L401L	MED14_uc010nhe.1_Silent_p.L285L	NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	401	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						CACTGTCAATCAGGAGTTTTT	0.353													13	73	---	---	---	---	PASS
USP9X	8239	broad.mit.edu	37	X	41077663	41077663	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41077663A>T	uc004dfb.2	+	37	6881	c.6248A>T	c.(6247-6249)AAT>ATT	p.N2083I	USP9X_uc004dfc.2_Missense_Mutation_p.N2083I	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	2083					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						CACAGCAAGAATGTACGTTTT	0.373													59	196	---	---	---	---	PASS
TBC1D25	4943	broad.mit.edu	37	X	48418785	48418785	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48418785G>A	uc004dka.1	+	6	1600	c.1489G>A	c.(1489-1491)GGT>AGT	p.G497S	TBC1D25_uc011mly.1_Missense_Mutation_p.G439S|TBC1D25_uc004dkb.1_Missense_Mutation_p.G243S|TBC1D25_uc011mlz.1_Missense_Mutation_p.G243S|TBC1D25_uc011mma.1_Missense_Mutation_p.G243S|TBC1D25_uc004dkc.1_Missense_Mutation_p.G243S|TBC1D25_uc011mmb.1_Missense_Mutation_p.G501S|TBC1D25_uc011mmc.1_Missense_Mutation_p.G243S|TBC1D25_uc011mmd.1_Missense_Mutation_p.G243S	NM_002536	NP_002527	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	497	Poly-Gly.					intracellular	Rab GTPase activator activity			ovary(1)	1						GGGGCCTGGTGGTGGGGGGCG	0.642													16	61	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48542214	48542214	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48542214C>T	uc004dkm.3	+	1						NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein						blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				CCCAGAGCCTCGCCAGAGAAG	0.577			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				7	18	---	---	---	---	PASS
PPP1R3F	89801	broad.mit.edu	37	X	49143574	49143574	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49143574G>A	uc004dnh.1	+	4					PPP1R3F_uc011mnd.1_3'UTR|PPP1R3F_uc004dni.2_3'UTR|PPP1R3F_uc004dnj.1_3'UTR	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)							integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					GGGATCAGCAGAGGCTTAAGA	0.567													13	46	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53587226	53587226	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53587226C>T	uc004dsp.2	-	56	8061	c.7659G>A	c.(7657-7659)CTG>CTA	p.L2553L	HUWE1_uc004dsn.2_Silent_p.L1377L|uc004dss.2_5'Flank|MIRLET7F2_hsa-let-7f-2|MI0000068_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2553					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TATTGGCCGTCAGCTGCCTTA	0.562													8	27	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54781511	54781511	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54781511C>T	uc004dtj.2	-	9	3171	c.3141G>A	c.(3139-3141)GAG>GAA	p.E1047E		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	1047					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						CTCCCAGGATCTCCTCAGAAT	0.488													38	119	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54956580	54956580	+	Silent	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54956580T>C	uc004dtq.2	+	12	3530	c.3423T>C	c.(3421-3423)GGT>GGC	p.G1141G	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Silent_p.G672G|TRO_uc004dtw.2_Silent_p.G744G|TRO_uc004dtx.2_Silent_p.G524G	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1141	34.|62 X 10 AA approximate tandem repeats.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						GCTTTGGTGGTGCTCATGGCA	0.567													17	68	---	---	---	---	PASS
OTUD6A	139562	broad.mit.edu	37	X	69283279	69283279	+	3'UTR	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69283279G>A	uc004dxu.1	+	1						NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A											lung(1)|skin(1)	2						AACTGTCGCCGTCGCCGCATC	0.458													3	8	---	---	---	---	PASS
DLG3	1741	broad.mit.edu	37	X	69719849	69719849	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69719849G>A	uc004dyi.1	+	16	2423	c.2095G>A	c.(2095-2097)GAT>AAT	p.D699N	DLG3_uc004dyj.1_Missense_Mutation_p.D394N|DLG3_uc011mpn.1_Missense_Mutation_p.D247N	NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a	699	Guanylate kinase-like.				axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)					CCAATTTAATGATAACCTCTA	0.493													9	38	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73070386	73070386	+	RNA	SNP	C	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73070386C>A	uc004ebm.1	-	1		c.2203G>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						GGCAGGAATTCCTCTTCTGCC	0.507													6	33	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83723964	83723964	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83723964C>T	uc004eek.1	-	3	876	c.767G>A	c.(766-768)AGA>AAA	p.R256K	HDX_uc011mqv.1_Missense_Mutation_p.R256K|HDX_uc004eel.1_Missense_Mutation_p.R198K	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	256						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GTTTTGTGTTCTACAGTAAGG	0.453													47	163	---	---	---	---	PASS
LOC442459	442459	broad.mit.edu	37	X	98975778	98975778	+	RNA	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98975778C>T	uc011mrd.1	-	7		c.821G>A				NR_024608				Homo sapiens DNA repair protein mRNA, complete cds.												0						CATGGCCCATCAGGTCTTCGA	0.413													3	13	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100497935	100497935	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100497935C>T	uc004egz.2	+	9	1387	c.1018C>T	c.(1018-1020)CGG>TGG	p.R340W	DRP2_uc011mrh.1_Missense_Mutation_p.R262W	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	340					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						GGATGCCCACCGGGACTTTGG	0.512													43	181	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100537423	100537423	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100537423C>T	uc004ehb.2	-	5	568	c.556G>A	c.(556-558)GAT>AAT	p.D186N	TAF7L_uc004eha.2_Missense_Mutation_p.D100N|TAF7L_uc004ehc.1_Missense_Mutation_p.D100N	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	186					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						ATATCACCATCAGCAGTGCAC	0.393													18	87	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101097818	101097818	+	5'UTR	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097818C>T	uc011mrk.1	-	3					NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ATTTGATCTTCACTATGTCAT	0.388													49	135	---	---	---	---	PASS
GLRA4	441509	broad.mit.edu	37	X	102974114	102974114	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102974114G>C	uc011mse.1	-	7	1225	c.804C>G	c.(802-804)CTC>CTG	p.L268L	GLRA4_uc010nou.2_Silent_p.L268L	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	268	Helical; (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0						GGATGACGATGAGTAGGCTGG	0.557													60	248	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109695177	109695177	+	Silent	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109695177C>G	uc004eor.1	+	3	1578	c.1332C>G	c.(1330-1332)GTC>GTG	p.V444V	RGAG1_uc011msr.1_Silent_p.V444V	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	444										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						TGATGACAGTCCCAAGCTCTG	0.512													60	239	---	---	---	---	PASS
UBE2A	7319	broad.mit.edu	37	X	118708669	118708669	+	5'UTR	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118708669C>G	uc004erl.2	+	1					UBE2A_uc004erm.2_5'UTR|UBE2A_uc004ern.2_RNA|UBE2A_uc004ero.2_5'Flank	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						TGACCCCGCTCGCGACATGTC	0.711								Direct_reversal_of_damage|Rad6_pathway					5	12	---	---	---	---	PASS
LAMP2	3920	broad.mit.edu	37	X	119581866	119581866	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119581866T>C	uc004est.3	-	5	751	c.571A>G	c.(571-573)AAA>GAA	p.K191E	LAMP2_uc004ess.3_Missense_Mutation_p.K191E|LAMP2_uc011mtz.1_Missense_Mutation_p.K80E|LAMP2_uc011mua.1_Missense_Mutation_p.K144E|LAMP2_uc010nqp.1_Missense_Mutation_p.K191E	NM_002294	NP_002285	P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2 isoform	191	Lumenal (Potential).|First lumenal domain.				platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane				ovary(1)	1						GTTTTGTCTTTATCACACAGG	0.408													46	132	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129185834	129185834	+	Splice_Site	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129185834G>A	uc004evb.1	+	12	4811	c.4697_splice	c.e12-1	p.E1566_splice	BCORL1_uc004evc.1_Splice_Site_p.E402_splice	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						TCCCCTTACAGAGGAAAAAGA	0.473													78	292	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649816	136649816	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649816C>G	uc004fak.2	+	1	1471	c.966C>G	c.(964-966)CAC>CAG	p.H322Q		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	322	Nuclear localization signal.|C2H2-type 2; atypical.				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TCCGAGTGCACACGGGCGAGA	0.597													55	186	---	---	---	---	PASS
MAGEA10	4109	broad.mit.edu	37	X	151303655	151303655	+	Silent	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151303655G>C	uc004ffk.2	-	5	846	c.438C>G	c.(436-438)CTC>CTG	p.L146L	MAGEA10_uc004ffl.2_Silent_p.L146L	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	146	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					GATACTTGAAGAGCAGAAACT	0.443													67	183	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153040417	153040417	+	Silent	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153040417G>A	uc004fii.2	+	24	4188	c.4014G>A	c.(4012-4014)GAG>GAA	p.E1338E	PLXNB3_uc010nuk.2_Silent_p.E1361E|PLXNB3_uc011mzd.1_Silent_p.E977E|PLXNB3_uc004fij.1_RNA|SRPK3_uc004fik.2_5'Flank	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	1338	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTACGCCGAGCGCGCCTTCT	0.706													24	86	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153577785	153577785	+	Silent	SNP	C	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153577785C>T	uc004fkk.2	-	47	7950	c.7701G>A	c.(7699-7701)CTG>CTA	p.L2567L	FLNA_uc004fki.2_Silent_p.L607L|FLNA_uc011mzn.1_Silent_p.L700L|FLNA_uc010nuu.1_Silent_p.L2559L	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2567	Self-association site, tail.|Filamin 24.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGCCTTGCTCAGCCCCAGGC	0.657													51	119	---	---	---	---	PASS
RPL10	6134	broad.mit.edu	37	X	153629109	153629109	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153629109G>A	uc004fkm.2	+	7	747	c.559G>A	c.(559-561)GAA>AAA	p.E187K	uc010nuv.1_5'Flank|RPL10_uc004fko.2_Silent_p.L132L|RPL10_uc004fkn.1_Missense_Mutation_p.E187K|RPL10_uc004fkp.1_3'UTR|RPL10_uc004fkq.1_Intron|RPL10_uc004fkr.1_Intron	NM_006013	NP_006004	P27635	RL10_HUMAN	ribosomal protein L10	187					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|endoplasmic reticulum	structural constituent of ribosome				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CATGGTGGCTGAAAAGCGGCT	0.527													10	37	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154157864	154157864	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154157864G>C	uc004fmt.2	-	14	4372	c.4201C>G	c.(4201-4203)CAA>GAA	p.Q1401E		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1401	B.				acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CTATTTGCTTGAGGGATGCTA	0.443													50	229	---	---	---	---	PASS
PRAMEF16	654348	broad.mit.edu	37	1	13497435	13497435	+	Intron	DEL	G	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13497435delG	uc001aux.2	+							NM_001045480	NP_001038945	Q5VWM1	PRA16_HUMAN	PRAME family member 16												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCATTGCAGGTTACTACAA	0.473													2	4	---	---	---	---	
UBR4	23352	broad.mit.edu	37	1	19474752	19474752	+	Intron	DEL	A	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19474752delA	uc001bbi.2	-						UBR4_uc001bbk.1_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTGCAAAGAGAAAAAAAAAAA	0.448													4	2	---	---	---	---	
YBX1	4904	broad.mit.edu	37	1	43162183	43162183	+	Intron	DEL	C	-	-	rs113762321		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43162183delC	uc001chs.2	+							NM_004559	NP_004550	P67809	YBOX1_HUMAN	nuclease sensitive element binding protein 1						CRD-mediated mRNA stabilization|negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|positive regulation of cell division|transcription from RNA polymerase II promoter	CRD-mediated mRNA stability complex|extracellular region|histone pre-mRNA 3'end processing complex|nucleoplasm|stress granule|U12-type spliceosomal complex	double-stranded DNA binding|protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(4)|upper_aerodigestive_tract(1)	5	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CGCAGTTGCGCCCCCCCCCCC	0.418													3	3	---	---	---	---	
SPAG17	200162	broad.mit.edu	37	1	118570820	118570825	+	Intron	DEL	ATGAAA	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118570820_118570825delATGAAA	uc001ehk.2	-							NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTTAACTGGCATGAAAATACACAATT	0.286													66	10	---	---	---	---	
TRAF5	7188	broad.mit.edu	37	1	211545459	211545459	+	Intron	DEL	C	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211545459delC	uc001hih.2	+						TRAF5_uc001hii.2_Intron|TRAF5_uc010psx.1_Intron|TRAF5_uc010psy.1_Intron|TRAF5_uc001hij.2_Intron	NM_004619	NP_004610	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis	CD40 receptor complex|centrosome|internal side of plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(2)|ovary(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		TTTTTTTTTTCTTATTTGCAG	0.313													65	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223352884	223352885	+	IGR	INS	-	CTTT	CTTT	rs61837572	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223352884_223352885insCTTT								TLR5 (36260 upstream) : SUSD4 (41278 downstream)																							ttccttccttcctttctttctt	0.045													3	3	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44900648	44900663	+	Intron	DEL	GGAAGGAAGGAAGGAG	-	-	rs3106839		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44900648_44900663delGGAAGGAAGGAAGGAG	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				aaggaaggaaggaaggaaggaaggagggaaggaaga	0.185													1	5	---	---	---	---	
C2orf34	79823	broad.mit.edu	37	2	44933753	44933753	+	Intron	DEL	T	-	-	rs35364346		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44933753delT	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				AGCGAAAGCATTTTTTTTTTT	0.408													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79423063	79423066	+	Intron	DEL	TTTG	-	-	rs3979543		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79423063_79423066delTTTG	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AACTCAGttttttgtttgtttgtt	0.201													5	5	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200173273	200173274	+	Intron	DEL	AC	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200173273_200173274delAC	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GTGTGTGcatacacacacacac	0.347													3	3	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203149027	203149027	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203149027delT	uc002uzb.2	+						NOP58_uc010zhv.1_Intron	NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						CAGGAAAGTCttttttttttt	0.174													8	4	---	---	---	---	
OTOS	150677	broad.mit.edu	37	2	241078958	241078960	+	Intron	DEL	GAA	-	-	rs10526200		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241078958_241078960delGAA	uc002vyv.2	-							NM_148961	NP_683764	Q8NHW6	OTOSP_HUMAN	otospiralin precursor							extracellular region					0		all_epithelial(40;2.79e-15)|Breast(86;3.04e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|Hepatocellular(293;0.148)|all_hematologic(139;0.158)|Melanoma(123;0.16)		Epithelial(32;2.56e-30)|all cancers(36;7.18e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.37e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;8.07e-06)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		GGAGACAGAGGAAGAAGAAGAAG	0.581													1	5	---	---	---	---	
QARS	5859	broad.mit.edu	37	3	49141711	49141712	+	Intron	INS	-	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49141711_49141712insA	uc003cvx.2	-						QARS_uc011bcd.1_Intron|QARS_uc003cvy.2_Intron|QARS_uc011bce.1_Intron|QARS_uc011bcf.1_Intron	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase						glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	GGTCTTGGCTGAAGGGAGGCAT	0.540													215	51	---	---	---	---	
RAB7A	7879	broad.mit.edu	37	3	128517689	128517689	+	Intron	DEL	G	-	-	rs35124528		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128517689delG	uc003eks.1	+						RAB7A_uc010hsv.1_Intron|RAB7A_uc003ekt.2_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		aaaaaaaaaagaATCCCAGGA	0.209													9	4	---	---	---	---	
TOPBP1	11073	broad.mit.edu	37	3	133372474	133372474	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133372474delT	uc003eps.2	-							NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1						DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						CAGGTTAATAttttttttttt	0.134								Other_conserved_DNA_damage_response_genes					4	2	---	---	---	---	
FAM194A	131831	broad.mit.edu	37	3	150421899	150421900	+	5'Flank	INS	-	C	C	rs148177227	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150421899_150421900insC	uc003eyg.2	-						FAM194A_uc003eyh.2_5'Flank	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831											skin(2)|ovary(1)	3						TTCTGTCCCTGCTCTTCAGCGT	0.545													6	3	---	---	---	---	
DHX36	170506	broad.mit.edu	37	3	154017854	154017854	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154017854delT	uc003ezy.3	-						DHX36_uc010hvq.2_Intron|DHX36_uc003ezz.3_Intron	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36							cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GTATATAAGCttttttttttt	0.139													4	2	---	---	---	---	
ACAP2	23527	broad.mit.edu	37	3	195029738	195029739	+	Intron	INS	-	AAAGT	AAAGT	rs10636354		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195029738_195029739insAAAGT	uc003fun.3	-							NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GAAAACTACTGAAAGAACAAAC	0.282													4	4	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AAAGACTTCTCTGTGAGCTTTG	0.381													2	5	---	---	---	---	
FBXW7	55294	broad.mit.edu	37	4	153249367	153249367	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153249367delC	uc003ims.2	-	9	1560	c.1411delG	c.(1411-1413)GAAfs	p.E471fs	FBXW7_uc011cii.1_Frame_Shift_Del_p.E471fs|FBXW7_uc003imt.2_Frame_Shift_Del_p.E471fs|FBXW7_uc011cih.1_Frame_Shift_Del_p.E295fs|FBXW7_uc003imq.2_Frame_Shift_Del_p.E391fs|FBXW7_uc003imr.2_Frame_Shift_Del_p.E353fs	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	471	WD 3.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TACCTTTTTTCATGAAGATGC	0.413			Mis|N|D|F		colorectal|endometrial|T-ALL								179	51	---	---	---	---	
NEIL3	55247	broad.mit.edu	37	4	178243570	178243571	+	Intron	DEL	TG	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178243570_178243571delTG	uc003iut.2	+						NEIL3_uc010irs.2_Intron	NM_018248	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3						base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		GCTTAGAGTTTGTGTGTGTGTG	0.366								BER_DNA_glycosylases					262	8	---	---	---	---	
CEP72	55722	broad.mit.edu	37	5	634242	634243	+	Intron	INS	-	G	G	rs16900934	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:634242_634243insG	uc003jbf.2	+						CEP72_uc011clz.1_Intron	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			GAGTTATAAATGAGAAAGTTAA	0.366													4	3	---	---	---	---	
SLC6A3	6531	broad.mit.edu	37	5	1402886	1402887	+	Intron	DEL	CA	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1402886_1402887delCA	uc003jck.2	-							NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter						cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	cacacacacgcacacacacaca	0.470													4	2	---	---	---	---	
LOC100132354	100132354	broad.mit.edu	37	6	43872702	43872703	+	Intron	INS	-	CTCCCTCT	CTCCCTCT	rs66493662		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43872702_43872703insCTCCCTCT	uc011dvm.1	+							NR_024478				Homo sapiens cDNA FLJ38229 fis, clone FCBBF2004256.												0						ttccttcctccctccctctctt	0.089													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	50864684	50864687	+	IGR	DEL	CTTC	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50864684_50864687delCTTC								TFAP2B (49359 upstream) : PKHD1 (615458 downstream)																							tccttcctttcttccttccttcct	0.025													3	3	---	---	---	---	
KPNA5	3841	broad.mit.edu	37	6	117047230	117047231	+	Intron	INS	-	GC	GC			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117047230_117047231insGC	uc003pxh.2	+							NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		ATCAAgtgtgtgtgtgtgtgtg	0.252													4	2	---	---	---	---	
KCNU1	157855	broad.mit.edu	37	8	36779848	36779849	+	Intron	INS	-	A	A	rs139758339	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36779848_36779849insA	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		GGAAAGGAAAGAAAAAAAAAAT	0.446													6	3	---	---	---	---	
ASPH	444	broad.mit.edu	37	8	62538943	62538943	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62538943delT	uc003xuj.2	-						ASPH_uc011leg.1_Intron|ASPH_uc003xuo.2_Intron|ASPH_uc011leh.1_Intron|ASPH_uc003xul.2_Intron|ASPH_uc011lei.1_Intron|ASPH_uc011lej.1_Intron|ASPH_uc003xun.2_Intron|ASPH_uc011lek.1_Intron|ASPH_uc003xum.2_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	AACAAAGTAATTTTTTTTTTT	0.353													4	2	---	---	---	---	
KANK1	23189	broad.mit.edu	37	9	710630	710630	+	Intron	DEL	C	-	-	rs68161748		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:710630delC	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron|KANK1_uc003zgs.1_Intron	NM_015158	NP_055973	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		aaaaaaaaaacaaaaaaaaac	0.000													4	2	---	---	---	---	
RECK	8434	broad.mit.edu	37	9	36100673	36100684	+	Intron	DEL	CCACTTTTTCCT	-	-	rs35712498		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36100673_36100684delCCACTTTTTCCT	uc003zyv.2	+						RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AAATGCTTTCCCACTTTTTCCTCCTCTAGTTG	0.472													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45568537	45568537	+	5'Flank	DEL	T	-	-	rs35080476		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45568537delT	uc001jbx.1	-											Homo sapiens zinc finger protein 22 (KOX 15), mRNA (cDNA clone IMAGE:4826621).																		ATCCAGCTAATTTTTTTTTTT	0.214													4	2	---	---	---	---	
MIR606	693191	broad.mit.edu	37	10	77312184	77312184	+	5'Flank	DEL	C	-	-	rs1367290		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77312184delC	hsa-mir-606|MI0003619	+																							0						ttttttttttcccccccctct	0.000													1	5	---	---	---	---	
MYOF	26509	broad.mit.edu	37	10	95132825	95132827	+	In_Frame_Del	DEL	AGG	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95132825_95132827delAGG	uc001kin.2	-	24	2440_2442	c.2317_2319delCCT	c.(2317-2319)CCTdel	p.P773del	MYOF_uc001kio.2_In_Frame_Del_p.P760del|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	773	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						TGATGATGTCAGGCATGCTGTTC	0.537													118	20	---	---	---	---	
SORBS1	10580	broad.mit.edu	37	10	97131604	97131604	+	Intron	DEL	A	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97131604delA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTACCTAACCAAAAAAAAAAA	0.264													6	3	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128794800	128794801	+	Intron	DEL	TT	-	-	rs71488600		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128794800_128794801delTT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AAATTGAGGAtttttttttttt	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													4	2	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31648802	31648802	+	Intron	DEL	G	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31648802delG	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					CAAATTCTCTGGGGGGGGGGG	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49327167	49327167	+	IGR	DEL	A	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49327167delA								FOLH1 (96945 upstream) : LOC440040 (252913 downstream)																							TAAAGTTAGcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59260136	59260136	+	IGR	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59260136delT								OR4D10 (14298 upstream) : OR4D11 (10913 downstream)																							TTTCTAATTATTTTTTAGTCT	0.353													4	2	---	---	---	---	
RIMKLB	57494	broad.mit.edu	37	12	8926417	8926420	+	3'UTR	DEL	CTTT	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8926417_8926420delCTTT	uc001quu.2	+	6					RIMKLB_uc009zgf.1_Intron|RIMKLB_uc001qux.2_3'UTR|RIMKLB_uc010sgl.1_3'UTR|RIMKLB_uc001quw.2_Intron	NM_020734	NP_065785	Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CCTTGTAAAACTTTCTTTCTTCTT	0.417													46	15	---	---	---	---	
KLF5	688	broad.mit.edu	37	13	73636362	73636362	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73636362delA	uc001vje.2	+	2	949	c.625delA	c.(625-627)AAAfs	p.K209fs	KLF5_uc001vjd.2_Frame_Shift_Del_p.K118fs	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	209					transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		TATTTTCATCAAACAAGAACT	0.532													81	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	79033151	79033152	+	IGR	DEL	AC	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79033151_79033152delAC								CHRNB4 (80277 upstream) : ADAMTS7 (18394 downstream)																							GGGTTGGGGGACACACACACAC	0.579													4	2	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92638333	92638333	+	Intron	DEL	T	-	-	rs67561474		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92638333delT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			CCTGCCTCTGTAGCTGGGGCT	0.328													7	5	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7567825	7567826	+	Intron	INS	-	A	A			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7567825_7567826insA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		AAGGATCTGCCAAAAAAAAAAA	0.277													3	3	---	---	---	---	
GDE1	51573	broad.mit.edu	37	16	19522426	19522426	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19522426delT	uc002dgh.2	-						GDE1_uc002dgi.2_Intron	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						TACTTTAAGAttttttttttt	0.164													4	3	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													6	3	---	---	---	---	
MYBBP1A	10514	broad.mit.edu	37	17	4443460	4443470	+	Intron	DEL	GAGGGTCCTGT	-	-	rs3833100	by1000genomes	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4443460_4443470delGAGGGTCCTGT	uc002fyb.3	-						MYBBP1A_uc002fxz.3_Intron|MYBBP1A_uc002fya.3_Intron|MYBBP1A_uc010vsa.1_Intron	NM_014520	NP_055335	Q9BQG0	MBB1A_HUMAN	MYB binding protein 1a isoform 2						nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NLS-dependent protein nuclear import complex|nucleolus	DNA binding|DNA-directed DNA polymerase activity|transcription factor binding			ovary(1)|skin(1)	2						AGGCTCCTGCGAGGGTCCTGTGAGGGTCCTA	0.455													4	2	---	---	---	---	
RABEP1	9135	broad.mit.edu	37	17	5286274	5286274	+	Intron	DEL	A	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5286274delA	uc002gbm.3	+						RABEP1_uc010vsw.1_Intron|RABEP1_uc002gbl.3_Intron|NUP88_uc002gbn.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						aattatttttaaaatttttaa	0.358													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39063535	39063542	+	IGR	DEL	TTCCTTCC	-	-	rs71764584		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39063535_39063542delTTCCTTCC								KRT20 (22056 upstream) : KRT23 (15410 downstream)																							cctccctcctttccttccttccttcctt	0.178													4	2	---	---	---	---	
DHX8	1659	broad.mit.edu	37	17	41585987	41585987	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41585987delT	uc002idu.1	+						DHX8_uc010wif.1_Intron|DHX8_uc010wig.1_Intron	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8							catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TATGCAAGTCttttttttttt	0.239													4	3	---	---	---	---	
HOXB5	3215	broad.mit.edu	37	17	46671172	46671173	+	5'Flank	INS	-	G	G			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46671172_46671173insG	uc002inr.2	-							NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5							nucleus	sequence-specific DNA binding				0						CGGCCAAATATGGGGGGGGGGT	0.470											OREG0024519	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
FADS6	283985	broad.mit.edu	37	17	72888542	72888542	+	Intron	DEL	C	-	-	rs34317584		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72888542delC	uc002jmd.1	-							NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6						fatty acid biosynthetic process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)					CAGCGGCCTGCCCCCCGTGGG	0.617													2	4	---	---	---	---	
PRCD	768206	broad.mit.edu	37	17	74536335	74536336	+	Intron	INS	-	T	T	rs111326198		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74536335_74536336insT	uc002jrx.2	+						CYGB_uc002jru.1_5'Flank|CYGB_uc002jrv.1_Intron|PRCD_uc002jrw.1_Intron|PRCD_uc002jry.1_5'Flank	NM_001077620	NP_001071088	Q00LT1	PRCD_HUMAN	progressive rod-cone degeneration						response to stimulus|visual perception	cytoplasm|integral to membrane					0						CGGTTGGTCGGGGGGGGGGGGC	0.653													4	2	---	---	---	---	
NAPG	8774	broad.mit.edu	37	18	10548537	10548537	+	Intron	DEL	T	-	-	rs1662154		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10548537delT	uc002kon.2	+						NAPG_uc010wzr.1_Intron|NAPG_uc002koo.2_Intron|NAPG_uc002kop.2_Intron	NM_003826	NP_003817	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein complex assembly|protein stabilization	membrane|membrane fraction|mitochondrion	protein binding				0						GTTTTACACCTTTTTTTTTTT	0.358													6	4	---	---	---	---	
ZNF793	390927	broad.mit.edu	37	19	38028814	38028814	+	3'UTR	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38028814delT	uc010efm.2	+	8					ZNF793_uc010xts.1_3'UTR|ZNF793_uc010efo.2_Intron	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGTAGGGAAttttttttttt	0.174													6	3	---	---	---	---	
CYP2A7	1549	broad.mit.edu	37	19	41448328	41448329	+	Intron	INS	-	T	T			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41448328_41448329insT	uc002opo.2	-						CYP2B7P1_uc002opq.2_Intron	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			ACTCAAGGATCttttttttttt	0.233													4	2	---	---	---	---	
CD3EAP	10849	broad.mit.edu	37	19	45910365	45910365	+	Frame_Shift_Del	DEL	C	-	-	rs117289933	byFrequency	TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45910365delC	uc002pbq.1	+	2	524	c.36delC	c.(34-36)TTCfs	p.F12fs	PPP1R13L_uc002pbn.2_5'Flank|PPP1R13L_uc002pbo.2_5'Flank|PPP1R13L_uc002pbp.2_5'Flank|CD3EAP_uc002pbr.1_Frame_Shift_Del_p.F14fs	NM_012099	NP_036231	O15446	RPA34_HUMAN	CD3E antigen, epsilon polypeptide associated	12					rRNA transcription|transmembrane receptor protein tyrosine kinase signaling pathway	chromosome|RNA polymerase I transcription factor complex	DNA-directed RNA polymerase activity			large_intestine(2)|ovary(2)	4		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		CTGCTCGGTTCTCTTGTCCCC	0.592													163	52	---	---	---	---	
GIPR	2696	broad.mit.edu	37	19	46177122	46177122	+	Intron	DEL	A	-	-	rs35790297		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46177122delA	uc002pcu.1	+						GIPR_uc002pct.1_Intron|GIPR_uc010xxp.1_Intron|GIPR_uc010xxq.1_Intron|MIR642_hsa-mir-642|MI0003657_5'Flank	NM_000164	NP_000155	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						generation of precursor metabolites and energy|response to nutrient	integral to membrane|plasma membrane				skin(1)	1		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		accatgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47265475	47265476	+	IGR	INS	-	GT	GT	rs112622467		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47265475_47265476insGT								FKRP (3643 upstream) : SLC1A5 (12666 downstream)																							actaaaaatacgtgtgtgtgtg	0.000													3	3	---	---	---	---	
CNOT3	4849	broad.mit.edu	37	19	54647886	54647886	+	Intron	DEL	G	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54647886delG	uc002qdj.1	+						CNOT3_uc010yel.1_Intron|CNOT3_uc002qdi.2_Intron|CNOT3_uc002qdk.1_Intron|CNOT3_uc010ere.1_Intron	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TTGGGGTAGAGAAGAGGAGGT	0.582													53	15	---	---	---	---	
PCSK2	5126	broad.mit.edu	37	20	17437280	17437281	+	Intron	DEL	AC	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17437280_17437281delAC	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GCGTGTGCATACACACACACAC	0.510													4	2	---	---	---	---	
DHX35	60625	broad.mit.edu	37	20	37652159	37652159	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37652159delT	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				gccctgctgattttttttttt	0.000													4	2	---	---	---	---	
MED15	51586	broad.mit.edu	37	22	20929656	20929656	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929656delT	uc002zsp.2	+						MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Intron|MED15_uc002zst.2_Intron	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CCACAGTCCCTTTTTTTTTTT	0.433													9	4	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16716680	16716682	+	Intron	DEL	TTT	-	-	rs72307111		TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16716680_16716682delTTT	uc004cxk.2	-						CTPS2_uc004cxl.2_Intron|CTPS2_uc004cxm.2_Intron	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					ctttgttttgtttttttttttta	0.138													5	3	---	---	---	---	
IL1RAPL2	26280	broad.mit.edu	37	X	105010791	105010791	+	Intron	DEL	T	-	-			TCGA-BT-A0YX-01	TCGA-BT-A0YX-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105010791delT	uc004elz.1	+							NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						TTATAAGCAGTTTTTTTTTTT	0.348													3	4	---	---	---	---	
