Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TAS1R3	83756	broad.mit.edu	37	1	1268732	1268732	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1268732G>A	uc010nyk.1	+	5	1573	c.1573G>A	c.(1573-1575)GAG>AAG	p.E525K		NM_152228	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3 precursor	525	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste|sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)	Aspartame(DB00168)	TGTGGACTGCGAGGCGGGCAG	0.692													4	11	---	---	---	---	PASS
NADK	65220	broad.mit.edu	37	1	1688188	1688188	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1688188C>T	uc009vkw.2	-						NADK_uc001aic.2_Intron|NADK_uc001aid.3_Intron|NADK_uc001aie.2_Intron|NADK_uc010nyv.1_Intron|NADK_uc009vkx.1_5'UTR	NM_023018	NP_075394	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process|NAD metabolic process|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|NAD+ kinase activity|protein binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		gctgaaacttcatcaccaacg	0.204													3	11	---	---	---	---	PASS
ACTRT2	140625	broad.mit.edu	37	1	2939420	2939420	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2939420C>G	uc001ajz.2	+	1						NM_080431	NP_536356	Q8TDY3	ACTT2_HUMAN	actin-related protein M2							cytoplasm|cytoskeleton					0	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		GGGGGTGAACCCTAGCCCCAG	0.587													9	91	---	---	---	---	PASS
CCDC27	148870	broad.mit.edu	37	1	3670737	3670737	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3670737G>A	uc001akv.2	+	2	455	c.374G>A	c.(373-375)CGA>CAA	p.R125Q		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	125										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		ATGGAACTTCGAAGGGTCTTC	0.592													27	139	---	---	---	---	PASS
AJAP1	55966	broad.mit.edu	37	1	4772146	4772146	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4772146G>A	uc001alm.1	+	2	597	c.216G>A	c.(214-216)GCG>GCA	p.A72A	AJAP1_uc001aln.2_Silent_p.A72A	NM_001042478	NP_001035943	Q9UKB5	AJAP1_HUMAN	adherens junction associated protein 1	72	Extracellular (Potential).				cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GACAGCCAGCGCGGGTCCCGG	0.632													5	17	---	---	---	---	PASS
SPATA21	374955	broad.mit.edu	37	1	16735685	16735685	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16735685C>T	uc001ayn.2	-	7	1084	c.601G>A	c.(601-603)GAG>AAG	p.E201K	SPATA21_uc001ayl.1_RNA|SPATA21_uc010occ.1_Missense_Mutation_p.E178K	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	201	Potential.						calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		AGGCTCTGCTCTTCCGGCTCC	0.627													3	36	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17413062	17413062	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17413062G>C	uc001baf.2	-	7	870	c.788C>G	c.(787-789)TCA>TGA	p.S263*	PADI2_uc010ocm.1_Missense_Mutation_p.Q182E|PADI2_uc001bag.1_Nonsense_Mutation_p.S263*	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	263					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GACCAGGCCTGAGAAGCCCTC	0.652													6	33	---	---	---	---	PASS
PQLC2	54896	broad.mit.edu	37	1	19653820	19653820	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19653820G>A	uc001bby.2	+	8	1070	c.718G>A	c.(718-720)GAG>AAG	p.E240K	PQLC2_uc001bbz.2_Missense_Mutation_p.E175K|PQLC2_uc001bca.2_Missense_Mutation_p.E240K|PQLC2_uc001bcb.2_Missense_Mutation_p.E129K|PQLC2_uc001bcc.2_Missense_Mutation_p.E129K	NM_017765	NP_060235	Q6ZP29	PQLC2_HUMAN	PQ loop repeat containing 2 isoform 1	240	PQ-loop 2.|Extracellular (Potential).					integral to membrane					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CAAAAACCCCGAGGAGGGCCA	0.637													14	41	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21307591	21307591	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21307591G>A	uc001bec.2	-	4	416	c.160C>T	c.(160-162)CTG>TTG	p.L54L	EIF4G3_uc010odj.1_Silent_p.L54L|EIF4G3_uc009vpz.2_Silent_p.L54L|EIF4G3_uc001bed.2_Silent_p.L54L|EIF4G3_uc001bef.2_Silent_p.L54L|EIF4G3_uc001bee.2_Silent_p.L61L|EIF4G3_uc001beg.2_Silent_p.L54L|EIF4G3_uc010odk.1_Silent_p.L54L|EIF4G3_uc001beh.2_Silent_p.L65L	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4	54					interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGCATGGGCAGATGGTTAACC	0.517													13	45	---	---	---	---	PASS
CELA3B	23436	broad.mit.edu	37	1	22307617	22307617	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22307617G>T	uc001bfk.2	+	4	429	c.314G>T	c.(313-315)GGG>GTG	p.G105V	CELA3B_uc009vqf.2_Intron	NM_007352	NP_031378	P08861	CEL3B_HUMAN	elastase 3B, pancreatic preproprotein	105	Peptidase S1.				cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						ATCAACTCTGGGGACCTCTTT	0.627											OREG0013210	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	92	---	---	---	---	PASS
CDC42	998	broad.mit.edu	37	1	22404924	22404924	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22404924C>T	uc001bfq.2	+	3					CDC42_uc009vqg.1_5'UTR|CDC42_uc001bfp.2_5'UTR|CDC42_uc001bfr.2_5'UTR|CDC42_uc010odr.1_5'UTR|CDC42_uc010ods.1_5'UTR|CDC42_uc009vqh.2_5'UTR	NM_001039802	NP_001034891	P60953	CDC42_HUMAN	cell division cycle 42 isoform 1						actin cytoskeleton organization|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|establishment or maintenance of cell polarity|macrophage differentiation|muscle cell differentiation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of protein complex assembly|positive regulation of muscle cell differentiation|positive regulation of pseudopodium assembly|regulation of filopodium assembly|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|filopodium|plasma membrane	GTP binding|GTPase activity|protein binding|thioesterase binding			haematopoietic_and_lymphoid_tissue(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		TTTTGCAGGTCATCATCAGAT	0.348													4	17	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27087921	27087921	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27087921C>T	uc001bmv.1	+	6	2581	c.2208C>T	c.(2206-2208)ATC>ATT	p.I736I	ARID1A_uc001bmt.1_Silent_p.I736I|ARID1A_uc001bmu.1_Silent_p.I736I|ARID1A_uc001bmw.1_Silent_p.I353I	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	736					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CGGACAGCATCATGCATCCTT	0.547			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								13	40	---	---	---	---	PASS
WASF2	10163	broad.mit.edu	37	1	27744801	27744801	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27744801G>A	uc001bof.1	-	4	604	c.388C>T	c.(388-390)CCT>TCT	p.P130S	WASF2_uc010ofl.1_Missense_Mutation_p.P130S	NM_006990	NP_008921	Q9Y6W5	WASF2_HUMAN	WAS protein family, member 2	130					actin cytoskeleton organization|G-protein signaling, coupled to cAMP nucleotide second messenger	actin cytoskeleton|lamellipodium	actin binding			skin(2)|ovary(1)	3		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0446)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.7e-08)|COAD - Colon adenocarcinoma(152;2e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00139)|KIRC - Kidney renal clear cell carcinoma(1967;0.00204)|STAD - Stomach adenocarcinoma(196;0.00325)|READ - Rectum adenocarcinoma(331;0.0481)		AGAGGGGGAGGAGTATCACAG	0.423													9	28	---	---	---	---	PASS
OPRD1	4985	broad.mit.edu	37	1	29185686	29185686	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29185686G>T	uc001brf.1	+	2	690	c.448G>T	c.(448-450)GTC>TTC	p.V150F		NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1	150	Cytoplasmic (Potential).				immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	CTACATCGCTGTCTGCCACCC	0.577													10	40	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39797292	39797292	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797292C>G	uc010oiu.1	+	1	483	c.352C>G	c.(352-354)CAA>GAA	p.Q118E	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1683	Plectin 2.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGCTTTTCATCAAGGCCTCAT	0.413													5	551	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39827347	39827347	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39827347C>T	uc010oiu.1	+	13	8220	c.8089C>T	c.(8089-8091)CAG>TAG	p.Q2697*	MACF1_uc010ois.1_Nonsense_Mutation_p.Q2195*|MACF1_uc001cda.1_Nonsense_Mutation_p.Q2103*|MACF1_uc001cdc.1_Nonsense_Mutation_p.Q1282*|MACF1_uc001cdb.1_Nonsense_Mutation_p.Q1282*	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	4262	LRR 15.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCAACAGATCCAGGTGAGGAT	0.358													299	46	---	---	---	---	PASS
TRIT1	54802	broad.mit.edu	37	1	40310268	40310268	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40310268C>T	uc010oiz.1	-	9	1065	c.1051G>A	c.(1051-1053)GAT>AAT	p.D351N	TRIT1_uc001cec.3_RNA|TRIT1_uc001ced.3_Missense_Mutation_p.D47N|TRIT1_uc001cee.3_RNA|TRIT1_uc001cef.3_RNA|TRIT1_uc001ceg.3_Missense_Mutation_p.D105N|TRIT1_uc001ceh.3_Missense_Mutation_p.D105N|TRIT1_uc009vvv.2_Missense_Mutation_p.D184N|TRIT1_uc001cei.3_Missense_Mutation_p.D105N|TRIT1_uc001ceq.2_Missense_Mutation_p.D47N|TRIT1_uc001cek.2_Missense_Mutation_p.D47N|TRIT1_uc009vvx.2_RNA|TRIT1_uc001cel.2_Intron|TRIT1_uc001cem.2_Missense_Mutation_p.D269N|TRIT1_uc001cen.2_Missense_Mutation_p.D105N|TRIT1_uc001ceo.2_Missense_Mutation_p.D105N|TRIT1_uc001cep.2_Missense_Mutation_p.D105N	NM_017646	NP_060116	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1 precursor	351					tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTCGAGACATCAGATACCTCT	0.433													6	265	---	---	---	---	PASS
CCDC30	728621	broad.mit.edu	37	1	43011099	43011099	+	Missense_Mutation	SNP	G	C	C	rs12746482		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43011099G>C	uc009vwk.1	+	4	384	c.274G>C	c.(274-276)GAA>CAA	p.E92Q	CCDC30_uc001chm.2_5'UTR|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_RNA|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	92	Potential.										0						GCTTTCACAAGAATTTGCACA	0.289													5	412	---	---	---	---	PASS
ELAVL4	1996	broad.mit.edu	37	1	50666507	50666507	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50666507C>T	uc001csb.2	+	7	1068	c.800C>T	c.(799-801)TCT>TTT	p.S267F	ELAVL4_uc001cry.3_Intron|ELAVL4_uc001crz.3_Intron|ELAVL4_uc001csa.3_Intron|ELAVL4_uc001csc.3_Intron|ELAVL4_uc010omz.1_Intron	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1	267					mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						GTCCCCCCTTCTGCTTGTCCC	0.522													16	60	---	---	---	---	PASS
TTC39A	22996	broad.mit.edu	37	1	51778567	51778567	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51778567C>G	uc001csl.2	-	3	303	c.198G>C	c.(196-198)GAG>GAC	p.E66D	TTC39A_uc001csk.2_Missense_Mutation_p.E66D|TTC39A_uc010ond.1_Missense_Mutation_p.E38D|TTC39A_uc010one.1_Missense_Mutation_p.E65D|TTC39A_uc010onf.1_Missense_Mutation_p.E69D|TTC39A_uc001csn.2_Missense_Mutation_p.E65D|TTC39A_uc001cso.1_Missense_Mutation_p.E62D|TTC39A_uc009vyy.1_Missense_Mutation_p.E38D	NM_001080494	NP_001073963	Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A isoform 2	66							binding			skin(1)	1						TGGCCTGCATCTCCAGGATGG	0.542													32	136	---	---	---	---	PASS
KTI12	112970	broad.mit.edu	37	1	52499439	52499439	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52499439C>G	uc001ctj.1	-	1					TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated								ATP binding			central_nervous_system(2)	2						GGCATCCTCTCAGGGAGCGAC	0.652													3	8	---	---	---	---	PASS
TMEM48	55706	broad.mit.edu	37	1	54233563	54233563	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54233563C>G	uc001cvs.2	-	18					TMEM48_uc010onu.1_3'UTR|TMEM48_uc001cvt.2_3'UTR|TMEM48_uc009vzk.2_RNA|TMEM48_uc010onv.1_3'UTR	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						CCGTTTTCTTCTGATCCAAGA	0.343													3	5	---	---	---	---	PASS
USP24	23358	broad.mit.edu	37	1	55534708	55534708	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55534708G>A	uc001cyg.3	-	65						NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						CTCAGGCTGGGCATGTTCCTC	0.458													3	63	---	---	---	---	PASS
FAM73A	374986	broad.mit.edu	37	1	78249010	78249010	+	Missense_Mutation	SNP	C	G	G	rs146841294		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78249010C>G	uc001dhx.2	+	2	201	c.169C>G	c.(169-171)CTG>GTG	p.L57V	FAM73A_uc010ork.1_Missense_Mutation_p.L57V|FAM73A_uc010orl.1_Intron	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986	57						integral to membrane				ovary(1)	1				Colorectal(170;0.226)		TGATCTTCCTCTGACTTGGTA	0.358													21	325	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82456581	82456581	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82456581C>G	uc001dit.3	+	21	4145	c.3964C>G	c.(3964-3966)CTT>GTT	p.L1322V	LPHN2_uc001dis.2_Missense_Mutation_p.L302V|LPHN2_uc001diu.2_Missense_Mutation_p.L1322V|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.L949V	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1378	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CATGCCCAATCTTAGAGACTC	0.473													3	88	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86954697	86954697	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86954697C>T	uc001dlt.2	+	8	1330	c.1201C>T	c.(1201-1203)CCA>TCA	p.P401S	CLCA1_uc001dls.1_Missense_Mutation_p.P340S	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	401	VWFA.				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GAAGAAATATCCAACTGATGG	0.433													43	50	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86961284	86961284	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86961284G>A	uc001dlt.2	+	12	2168	c.2039G>A	c.(2038-2040)GGA>GAA	p.G680E		NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	680					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GCTCTGGGAGGAGTTAACGCA	0.463													9	74	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92446495	92446495	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92446495G>A	uc001dok.3	+	10	1859	c.1510G>A	c.(1510-1512)GAA>AAA	p.E504K	BRDT_uc001dol.3_Missense_Mutation_p.E504K|BRDT_uc010osz.1_Missense_Mutation_p.E508K|BRDT_uc009wdf.2_Missense_Mutation_p.E431K|BRDT_uc010ota.1_Missense_Mutation_p.E458K|BRDT_uc010otb.1_Missense_Mutation_p.E458K|BRDT_uc001dom.3_Missense_Mutation_p.E504K	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	504					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		ATCTGAAGATGAAGATAATGC	0.333													9	82	---	---	---	---	PASS
RWDD3	25950	broad.mit.edu	37	1	95712512	95712512	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95712512C>G	uc009wdu.2	+	4					RWDD3_uc001drf.3_3'UTR|RWDD3_uc001drh.3_3'UTR|RWDD3_uc009wdv.2_RNA|RWDD3_uc001drg.3_RNA|RWDD3_uc001dri.3_3'UTR	NM_015485	NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3 isoform a							cytoplasm|nucleus	protein binding			ovary(1)	1		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		TTGAAATAGTCAATTTTAAAG	0.313													2	7	---	---	---	---	PASS
CHI3L2	1117	broad.mit.edu	37	1	111772386	111772386	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111772386G>A	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_5'UTR|CHI3L2_uc009wga.2_5'UTR	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		TCTTGTATGTGAGCACACCCA	0.388													8	20	---	---	---	---	PASS
BCAS2	10286	broad.mit.edu	37	1	115124224	115124224	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115124224C>G	uc001efa.2	-	1					DENND2C_uc001eez.2_Intron	NM_005872	NP_005863	O75934	SPF27_HUMAN	breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGAGGACCTCAGGTTTGCCT	0.522													4	8	---	---	---	---	PASS
VANGL1	81839	broad.mit.edu	37	1	116206759	116206759	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116206759G>C	uc001efv.1	+	4	953	c.682G>C	c.(682-684)GAT>CAT	p.D228H	VANGL1_uc009wgy.1_Missense_Mutation_p.D226H|VANGL1_uc001efw.1_Missense_Mutation_p.D228H	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1	228	Helical; Name=4; (Potential).				multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CTCCCTTGTGGATGCCCTCCT	0.557													18	67	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	146397376	146397376	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146397376G>C	uc001emp.3	+						uc010ozk.1_5'UTR	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGAGTGTAAAGACCTCATAAA	0.522													27	172	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149905798	149905798	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149905798C>G	uc001etl.3	-	8	972	c.721G>C	c.(721-723)GAC>CAC	p.D241H	MTMR11_uc001etm.1_Missense_Mutation_p.D169H|MTMR11_uc010pbm.1_Missense_Mutation_p.D213H|MTMR11_uc010pbn.1_Missense_Mutation_p.D83H	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	241	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			ACCTCACTGTCCAGAATTCGG	0.493													55	194	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149916075	149916075	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149916075C>T	uc001etn.2	-	12	2569	c.2213G>A	c.(2212-2214)CGA>CAA	p.R738Q		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	738					negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GGGGTAGGGTCGCCCAGGAGG	0.642													22	58	---	---	---	---	PASS
ANP32E	81611	broad.mit.edu	37	1	150193030	150193030	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150193030C>T	uc001etw.2	-	7	1140	c.770G>A	c.(769-771)CGA>CAA	p.R257Q	ANP32E_uc010pbt.1_RNA|ANP32E_uc010pbu.1_Missense_Mutation_p.R209Q|ANP32E_uc010pbv.1_Missense_Mutation_p.R216Q|ANP32E_uc001etv.3_Missense_Mutation_p.R256Q	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	257	Asp/Glu-rich (highly acidic).					cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity				0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCAGCATCTCGTTTCCTCTT	0.383													38	317	---	---	---	---	PASS
C1orf51	148523	broad.mit.edu	37	1	150259343	150259343	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150259343G>A	uc001euh.2	+	6	1271	c.1135G>A	c.(1135-1137)GAT>AAT	p.D379N	C1orf51_uc001eui.2_Missense_Mutation_p.D291N|C1orf51_uc001euj.2_Missense_Mutation_p.D379N	NM_144697	NP_653298	Q8N365	CA051_HUMAN	hypothetical protein LOC148523	379											0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTTGCTGCTGATGCTCATCT	0.458													20	74	---	---	---	---	PASS
THEM4	117145	broad.mit.edu	37	1	151861806	151861806	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151861806G>A	uc001ezj.1	-	3	509	c.330C>T	c.(328-330)CTC>CTT	p.L110L	THEM4_uc001ezk.1_RNA	NM_053055	NP_444283	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	110					insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane					0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCTGGTGAAGAGCTGGGCCT	0.438													10	116	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152192570	152192570	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192570C>T	uc001ezt.1	-	3	1611	c.1535G>A	c.(1534-1536)GGT>GAT	p.G512D		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	512	5.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAAGATGAACCTGCACTAGA	0.572													120	236	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153906268	153906268	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153906268C>G	uc001fdd.1	-	20	3422	c.3021G>C	c.(3019-3021)CTG>CTC	p.L1007L	uc001fdc.1_Intron	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1007										ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCTCCCCTGTCAGGCTCAGGT	0.647													8	13	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153907219	153907219	+	Intron	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153907219C>A	uc001fdd.1	-						uc001fdc.1_RNA	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B											ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGCCTGTCTCACCAGGCCCT	0.438													5	9	---	---	---	---	PASS
UBAP2L	9898	broad.mit.edu	37	1	154223614	154223614	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154223614G>C	uc001fep.3	+	13	1478	c.1311G>C	c.(1309-1311)GAG>GAC	p.E437D	UBAP2L_uc009wot.2_Missense_Mutation_p.E437D|UBAP2L_uc010pek.1_Missense_Mutation_p.E429D|UBAP2L_uc010pel.1_Missense_Mutation_p.E447D|UBAP2L_uc010pen.1_Missense_Mutation_p.E351D	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	437					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCTTCAGGAGAAGTCACCTG	0.532													15	128	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155319163	155319163	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155319163C>T	uc009wqq.2	-	19	8004	c.7524G>A	c.(7522-7524)GTG>GTA	p.V2508V	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Silent_p.V2503V|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2508	Bromo.				cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CAAAAGCTTCCACTGTCTTAT	0.383													24	58	---	---	---	---	PASS
KIAA0907	22889	broad.mit.edu	37	1	155896471	155896471	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155896471G>A	uc001fmi.1	-	6	701	c.677C>T	c.(676-678)TCA>TTA	p.S226L	KIAA0907_uc001fmj.1_Missense_Mutation_p.S226L|KIAA0907_uc009wrk.1_Intron|KIAA0907_uc009wrl.1_RNA|KIAA0907_uc001fml.1_Missense_Mutation_p.S226L|KIAA0907_uc001fmm.2_Intron|SCARNA4_uc001fmn.1_5'Flank|KIAA0907_uc001fmo.2_Missense_Mutation_p.S226L	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889	226											0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			ACATACCCCTGACTGGAAGGG	0.363													23	59	---	---	---	---	PASS
MEF2D	4209	broad.mit.edu	37	1	156446809	156446809	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156446809G>A	uc001fpc.2	-	7	1240	c.850C>T	c.(850-852)CAC>TAC	p.H284Y	MEF2D_uc001fpb.2_Missense_Mutation_p.H284Y|MEF2D_uc001fpd.2_Missense_Mutation_p.H284Y|MEF2D_uc001fpe.1_Missense_Mutation_p.H284Y|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	284					apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTTACCAAGTGATGCATTAAC	0.607													7	61	---	---	---	---	PASS
CD1A	909	broad.mit.edu	37	1	158226807	158226807	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158226807G>A	uc001frt.2	+	4	1369	c.836G>A	c.(835-837)CGG>CAG	p.R279Q		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	279	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CTGTCCTGTCGGGTGAAGCAC	0.612													13	50	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160282929	160282929	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160282929G>T	uc009wti.2	-	10	1265	c.871C>A	c.(871-873)CAT>AAT	p.H291N	COPA_uc001fvv.3_Missense_Mutation_p.H291N|COPA_uc009wtj.1_Missense_Mutation_p.H237N	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	291					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAACGATCATGGTCTCTGCGG	0.403													11	53	---	---	---	---	PASS
UFC1	51506	broad.mit.edu	37	1	161123631	161123631	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161123631C>G	uc001fyd.3	+	1						NM_016406	NP_057490	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1						protein ufmylation		protein binding|UFM1 conjugating enzyme activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCGATGCACTCACAAGCGGGT	0.428													4	4	---	---	---	---	PASS
FCGR3B	2215	broad.mit.edu	37	1	161600882	161600882	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161600882C>T	uc009wul.2	-	1	277	c.3G>A	c.(1-3)ATG>ATA	p.M1I		NM_000570	NP_000561	O75015	FCG3B_HUMAN	low affinity immunoglobulin gamma Fc region	1					immune response	anchored to membrane|extracellular region|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GCAGCTGCCACATGATGCCAC	0.542													7	27	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173834683	173834683	+	5'Flank	SNP	G	C	C	rs14262	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173834683G>C	uc009wwp.1	+						GAS5_uc001gji.2_RNA|GAS5_uc001gjj.2_RNA|GAS5_uc001gjk.2_RNA|SNORD81_uc009wwi.1_5'Flank|SNORD47_uc001gjl.2_5'Flank|SNORD80_uc009wwj.1_5'Flank|SNORD79_uc009wwk.1_5'Flank|ZBTB37_uc001gjp.1_5'Flank|ZBTB37_uc001gjq.3_5'Flank|ZBTB37_uc001gjr.2_5'Flank	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACGTTACCAGGAGCTGGAATA	0.368													7	30	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173839952	173839952	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173839952C>T	uc009wwp.1	+	3	865	c.589C>T	c.(589-591)CAG>TAG	p.Q197*	GAS5_uc001gjj.2_5'Flank|GAS5_uc001gjk.2_5'Flank|ZBTB37_uc001gjp.1_Nonsense_Mutation_p.Q197*|ZBTB37_uc001gjq.3_Nonsense_Mutation_p.Q197*|ZBTB37_uc001gjr.2_Nonsense_Mutation_p.Q197*	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACCAGCCCTCAGATCATTGA	0.552													12	43	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173839957	173839957	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173839957C>T	uc009wwp.1	+	3	870	c.594C>T	c.(592-594)ATC>ATT	p.I198I	GAS5_uc001gjj.2_5'Flank|GAS5_uc001gjk.2_5'Flank|ZBTB37_uc001gjp.1_Silent_p.I198I|ZBTB37_uc001gjq.3_Silent_p.I198I|ZBTB37_uc001gjr.2_Silent_p.I198I	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	198					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCCTCAGATCATTGAACCAA	0.557													11	40	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180775291	180775291	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180775291G>C	uc001goi.2	+	5	733	c.541G>C	c.(541-543)GAG>CAG	p.E181Q	XPR1_uc009wxm.2_Missense_Mutation_p.E181Q|XPR1_uc009wxn.2_Missense_Mutation_p.E181Q	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor	181	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0						GGCTCACGTAGAGGTGGCCCC	0.398													9	71	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197112229	197112229	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197112229C>G	uc001gtu.2	-	3	1410	c.1153G>C	c.(1153-1155)GAG>CAG	p.E385Q	ASPM_uc001gtv.2_Missense_Mutation_p.E385Q|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	385					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TTAACTGACTCTGATTCTAGA	0.289													11	58	---	---	---	---	PASS
CNTN2	6900	broad.mit.edu	37	1	205027639	205027639	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205027639G>A	uc001hbr.2	+						CNTN2_uc001hbq.1_Missense_Mutation_p.R3Q|CNTN2_uc009xbi.2_Missense_Mutation_p.R3Q|CNTN2_uc001hbs.2_5'Flank	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGGATGAGTCGGGGAGGGGCT	0.572													5	19	---	---	---	---	PASS
RAB7L1	8934	broad.mit.edu	37	1	205741642	205741642	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205741642G>C	uc001hdf.3	-	3	518	c.178C>G	c.(178-180)CAG>GAG	p.Q60E	RAB7L1_uc009xbp.2_5'UTR|RAB7L1_uc001hde.3_Missense_Mutation_p.Q60E|RAB7L1_uc010prr.1_Intron|RAB7L1_uc009xbq.2_Intron	NM_003929	NP_003920	O14966	RAB7L_HUMAN	RAB7, member RAS oncogene family-like 1 isoform	60					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			TCCCACAGCTGAAGCCGCACT	0.383													92	102	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216243607	216243607	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216243607C>T	uc001hku.1	-	30	6272	c.5885G>A	c.(5884-5886)AGA>AAA	p.R1962K		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1962	Extracellular (Potential).|Fibronectin type-III 6.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGCGGACTCTTGAGGGAGT	0.428										HNSCC(13;0.011)			6	44	---	---	---	---	PASS
TLR5	7100	broad.mit.edu	37	1	223286345	223286345	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223286345C>T	uc001hnv.1	-	4	475	c.29G>A	c.(28-30)GGA>GAA	p.G10E	TLR5_uc001hnw.1_Missense_Mutation_p.G10E	NM_003268	NP_003259	O60602	TLR5_HUMAN	toll-like receptor 5 precursor	10					cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity			ovary(2)|lung(1)|skin(1)	4				GBM - Glioblastoma multiforme(131;0.0851)		GAGCACCACTCCTAGGAGAAG	0.517													4	29	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568092	229568092	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568092C>T	uc001htm.2	-	4	646	c.541G>A	c.(541-543)GAC>AAC	p.D181N		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	181			D -> H (in NEM3).|D -> G (in NEM3).|D -> N (in NEM3).		muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	CCCGCCAGGTCCAGGCGCATG	0.577													5	35	---	---	---	---	PASS
ERO1LB	56605	broad.mit.edu	37	1	236390014	236390014	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236390014G>C	uc001hxt.2	-	11	994	c.738C>G	c.(736-738)TTC>TTG	p.F246L		NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta	246					electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			TAAGCTTATAGAAGACTCTTT	0.318													21	59	---	---	---	---	PASS
ZNF695	57116	broad.mit.edu	37	1	247150452	247150452	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247150452C>G	uc009xgu.2	-	4	1510	c.1365G>C	c.(1363-1365)AAG>AAC	p.K455N	ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron|ZNF695_uc009xgt.1_Intron|ZNF695_uc001ibx.2_Intron|ZNF695_uc001iby.2_Intron	NM_020394	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein SBZF3	455	C2H2-type 11.				regulation of transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TATGAATTCTCTTATGATTAG	0.373													30	22	---	---	---	---	PASS
SH3BP5L	80851	broad.mit.edu	37	1	249108823	249108823	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249108823G>C	uc001iew.1	-						SH3BP5L_uc010pzp.1_Missense_Mutation_p.S14C|SH3BP5L_uc010pzq.1_Intron|SH3BP5L_uc001iev.1_Intron	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like												0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GGGGGAGAGGGATATCAGGAT	0.582													10	31	---	---	---	---	PASS
GRHL1	29841	broad.mit.edu	37	2	10126392	10126392	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10126392C>T	uc002raa.2	+	9	1422	c.1251C>T	c.(1249-1251)ATC>ATT	p.I417I	GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Silent_p.I228I|GRHL1_uc010yjb.1_Silent_p.I266I	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1	417					cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		ACTGCCAGATCAAGGTCTTCT	0.468													41	219	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11427791	11427791	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11427791G>C	uc002rbd.1	-	2	662	c.213C>G	c.(211-213)TTC>TTG	p.F71L		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	71					axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		ATCTATTTAAGAAATTATCTA	0.264													3	13	---	---	---	---	PASS
ATAD2B	54454	broad.mit.edu	37	2	24011422	24011422	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24011422G>C	uc002rek.3	-	20	3030	c.2736C>G	c.(2734-2736)CTC>CTG	p.L912L	ATAD2B_uc010yki.1_RNA|ATAD2B_uc002rei.3_Silent_p.L157L|ATAD2B_uc002rej.3_Silent_p.L80L	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	912							ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCCTGATTGAGAATCAATT	0.358													4	44	---	---	---	---	PASS
PPM1G	5496	broad.mit.edu	37	2	27616063	27616063	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27616063G>A	uc002rkl.2	-						PPM1G_uc002rkm.2_Intron|FTHL3_uc002rkn.1_RNA	NM_002707	NP_002698	O15355	PPM1G_HUMAN	protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TGAGATTGGTGAAGAAAGTAT	0.463													16	34	---	---	---	---	PASS
CAPN13	92291	broad.mit.edu	37	2	30976031	30976031	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30976031G>A	uc002rnn.2	-	10	1151	c.975C>T	c.(973-975)ATC>ATT	p.I325I	CAPN13_uc002rnp.1_Silent_p.I325I	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	325	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TAAACATGGCGATGAATTTCT	0.438													5	113	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33412110	33412110	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33412110C>T	uc002ros.2	+	6	1389	c.1389C>T	c.(1387-1389)ACC>ACT	p.T463T	LTBP1_uc002rot.2_Silent_p.T137T|LTBP1_uc002rou.2_Silent_p.T137T|LTBP1_uc002rov.2_Silent_p.T137T|LTBP1_uc010ymz.1_Silent_p.T137T|LTBP1_uc010yna.1_Silent_p.T137T	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	463					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CAACACATACCTTGCCTCTGA	0.517													13	31	---	---	---	---	PASS
VIT	5212	broad.mit.edu	37	2	37000939	37000939	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37000939T>C	uc002rpl.2	+	8	906	c.685T>C	c.(685-687)TGG>CGG	p.W229R	VIT_uc010ynf.1_Missense_Mutation_p.W158R|VIT_uc002rpm.2_Missense_Mutation_p.W222R|VIT_uc010ezv.2_Missense_Mutation_p.W222R|VIT_uc010ezw.2_Missense_Mutation_p.W222R	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin	229						proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				TACAGATCTCTGGTCCACTGC	0.328													8	7	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37283642	37283642	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37283642G>C	uc002rpp.1	-	16	2436	c.2340C>G	c.(2338-2340)GTC>GTG	p.V780V		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	780							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				AAGCATCAATGACTGAGACTC	0.433													23	83	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37284473	37284473	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37284473G>A	uc002rpp.1	-	15	2306	c.2210C>T	c.(2209-2211)TCA>TTA	p.S737L		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	737							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GTCTTCAATTGATTTATGATC	0.358													4	36	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37310575	37310575	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37310575C>G	uc002rpp.1	-	2					CCDC75_uc010ezz.2_5'Flank|CCDC75_uc002rpr.3_5'Flank	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				GTTTGAAATTCACACCTTAAA	0.318													5	58	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39234309	39234309	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39234309C>T	uc002rrk.3	-	16	2577	c.2536G>A	c.(2536-2538)GAA>AAA	p.E846K	SOS1_uc002rrj.3_Missense_Mutation_p.E460K	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	846	Ras-GEF.		E -> K (in NS4).		apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ACTCTTTCTTCTAAATTTTCA	0.308									Noonan_syndrome				30	76	---	---	---	---	PASS
HAAO	23498	broad.mit.edu	37	2	42996988	42996988	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42996988G>C	uc002rst.3	-	7	570	c.495C>G	c.(493-495)CTC>CTG	p.L165L		NM_012205	NP_036337	P46952	3HAO_HUMAN	3-hydroxyanthranilate 3,4-dioxygenase	165	Linker (By similarity).				neuron homeostasis|pyridine nucleotide biosynthetic process|quinolinate biosynthetic process|response to cadmium ion|response to zinc ion|tryptophan catabolic process	cytosol|soluble fraction	3-hydroxyanthranilate 3,4-dioxygenase activity|electron carrier activity|ferrous iron binding			ovary(1)	1						GTGGCTCCTTGAGCAGCTGGT	0.637													16	75	---	---	---	---	PASS
MSH2	4436	broad.mit.edu	37	2	47693913	47693913	+	Missense_Mutation	SNP	G	A	A	rs63750675		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47693913G>A	uc002rvy.1	+	10	1695	c.1627G>A	c.(1627-1629)GAT>AAT	p.D543N	MSH2_uc010yoh.1_Missense_Mutation_p.D477N|MSH2_uc002rvz.2_Missense_Mutation_p.D543N|MSH2_uc010fbg.2_Missense_Mutation_p.D353N|MSH2_uc010fbh.1_RNA|MSH2_uc010fbi.1_Intron	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2	543					B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding	p.?(2)		large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAGTACTGTAGATATCCAGAA	0.323			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				20	72	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48573510	48573510	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48573510G>C	uc002rwh.1	+	3	472	c.157G>C	c.(157-159)GAT>CAT	p.D53H		NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor	53					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TGAGTCAGCAGATGATGAACT	0.448													11	62	---	---	---	---	PASS
ERLEC1	27248	broad.mit.edu	37	2	54035547	54035547	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54035547G>A	uc002rxl.2	+	9	1271	c.991G>A	c.(991-993)GAT>AAT	p.D331N	ASB3_uc002rxi.3_Intron|ERLEC1_uc002rxm.2_Missense_Mutation_p.D331N|ERLEC1_uc002rxn.2_Intron	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1	331				D -> G (in Ref. 3; BAA91974).	ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2						CAAATTGACAGATGACCAACT	0.398													14	57	---	---	---	---	PASS
RPL23AP32	56969	broad.mit.edu	37	2	54756736	54756736	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54756736T>C	uc010yot.1	+	1	378	c.254T>C	c.(253-255)TTT>TCT	p.F85S	SPTBN1_uc002rxu.2_Intron|SPTBN1_uc002rxv.1_Intron	NR_002229				SubName: Full=Putative uncharacterized protein DKFZp547I014;												0						ACCACTGAGTTTGCCATGAAG	0.483													3	38	---	---	---	---	PASS
RPL23AP32	56969	broad.mit.edu	37	2	54756737	54756737	+	Silent	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54756737T>C	uc010yot.1	+	1	379	c.255T>C	c.(253-255)TTT>TTC	p.F85F	SPTBN1_uc002rxu.2_Intron|SPTBN1_uc002rxv.1_Intron	NR_002229				SubName: Full=Putative uncharacterized protein DKFZp547I014;												0						CCACTGAGTTTGCCATGAAGA	0.478													3	37	---	---	---	---	PASS
FBXO48	554251	broad.mit.edu	37	2	68691345	68691345	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68691345C>G	uc002seo.2	-	4	872	c.464G>C	c.(463-465)AGA>ACA	p.R155T		NM_001024680	NP_001019851	Q5FWF7	FBX48_HUMAN	F-box protein 48	155											0						TTCCCCTTATCTTTCCAGTTC	0.358													37	185	---	---	---	---	PASS
EXOC6B	23233	broad.mit.edu	37	2	72968519	72968519	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72968519C>T	uc010fep.2	-	2	331	c.193G>A	c.(193-195)GAG>AAG	p.E65K	EXOC6B_uc002sij.2_Missense_Mutation_p.E65K	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	65	Potential.				protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2						CACATTTTCTCAATTTCTCGG	0.408													12	114	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88874949	88874949	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88874949G>A	uc002stc.3	-	13	2254	c.2052C>T	c.(2050-2052)CTC>CTT	p.L684L		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	684	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						TAGGAGAGCTGAGTGGCCAGT	0.408													6	54	---	---	---	---	PASS
KIAA1310	55683	broad.mit.edu	37	2	97276603	97276603	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97276603G>C	uc002swn.3	-	11	1325	c.1179C>G	c.(1177-1179)CTC>CTG	p.L393L	KIAA1310_uc002swh.3_Silent_p.L281L|KIAA1310_uc002swi.3_Silent_p.L294L|KIAA1310_uc002swj.3_RNA|KIAA1310_uc002swk.3_Silent_p.L306L|KIAA1310_uc010fhz.2_Silent_p.L187L|KIAA1310_uc002swl.3_Silent_p.L294L|KIAA1310_uc002swm.3_RNA|KIAA1310_uc010yur.1_Silent_p.L187L|KIAA1310_uc002swp.1_Silent_p.L294L|KIAA1310_uc002swq.1_Silent_p.L165L|KIAA1310_uc010fhy.1_Silent_p.L294L	NM_001115016	NP_001108488	Q9P2N6	K1310_HUMAN	hypothetical protein LOC55683 isoform a	393											0						TCATATCCAAGAGGGGATCAT	0.458													19	92	---	---	---	---	PASS
CNNM3	26505	broad.mit.edu	37	2	97483169	97483169	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97483169C>G	uc002swy.2	+	1	1179	c.1155C>G	c.(1153-1155)TTC>TTG	p.F385L	CNNM3_uc002swz.2_Missense_Mutation_p.F385L	NM_017623	NP_060093	Q8NE01	CNNM3_HUMAN	cyclin M3 isoform 1	385					ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1						TCACTCGTTTCTACAACCATC	0.592													11	71	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100199373	100199373	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100199373C>T	uc002tag.2	-	16	2916	c.2680G>A	c.(2680-2682)GAG>AAG	p.E894K	AFF3_uc002taf.2_Missense_Mutation_p.E919K|AFF3_uc010fiq.1_Missense_Mutation_p.E894K|AFF3_uc010yvr.1_Missense_Mutation_p.E1047K|AFF3_uc002tah.1_Missense_Mutation_p.E919K	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	894					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						GTTAAGTCCTCGCTGGTGTAT	0.463													13	52	---	---	---	---	PASS
RGPD4	285190	broad.mit.edu	37	2	108479195	108479195	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108479195G>T	uc010ywk.1	+	16	2345	c.2263G>T	c.(2263-2265)GAA>TAA	p.E755*	RGPD4_uc002tdu.2_5'UTR|RGPD4_uc010ywl.1_RNA	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	755					intracellular transport		binding			skin(2)	2						GCAGGAACTCGAAAACTATAG	0.363													3	37	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112740456	112740456	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112740456G>A	uc002thk.1	+	8	1304	c.1182G>A	c.(1180-1182)CTG>CTA	p.L394L	MERTK_uc002thl.1_Silent_p.L218L	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	394	Fibronectin type-III 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						CTGTGTTTCTGAATGAATCTA	0.448													36	123	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112740460	112740460	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112740460G>A	uc002thk.1	+	8	1308	c.1186G>A	c.(1186-1188)GAA>AAA	p.E396K	MERTK_uc002thl.1_Missense_Mutation_p.E220K	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	396	Fibronectin type-III 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						GTTTCTGAATGAATCTAGTGA	0.453													34	116	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112740501	112740501	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112740501G>A	uc002thk.1	+	8	1349	c.1227G>A	c.(1225-1227)CCG>CCA	p.P409P	MERTK_uc002thl.1_Silent_p.P233P	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	409	Fibronectin type-III 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TGAAGCCTCCGACTAAGCAGC	0.463													20	84	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112740537	112740537	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112740537G>C	uc002thk.1	+	8	1385	c.1263G>C	c.(1261-1263)CGG>CGC	p.R421R	MERTK_uc002thl.1_Silent_p.R245R	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	421	Fibronectin type-III 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TGGGCTACCGGATATCCCACG	0.453													13	68	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128260414	128260414	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128260414C>T	uc002ton.2	-	5	1747	c.1444G>A	c.(1444-1446)GAT>AAT	p.D482N	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	482	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCCTCTTCATCACCAGATTCT	0.308													13	36	---	---	---	---	PASS
UGGT1	56886	broad.mit.edu	37	2	128918082	128918082	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128918082G>A	uc002tps.2	+	24	2789	c.2611G>A	c.(2611-2613)GAT>AAT	p.D871N	UGGT1_uc010fme.1_Missense_Mutation_p.D746N|UGGT1_uc002tpr.2_Missense_Mutation_p.D847N	NM_020120	NP_064505	Q9NYU2	UGGG1_HUMAN	UDP-glucose ceramide glucosyltransferase-like 1	871					'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1						TTCCAAAATGGATTTCATTTT	0.403													5	40	---	---	---	---	PASS
RAB6C	84084	broad.mit.edu	37	2	130738132	130738132	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130738132G>A	uc002tpx.1	+	1	898	c.444G>A	c.(442-444)CTG>CTA	p.L148L	uc002tpw.1_5'Flank	NM_032144	NP_115520	Q9H0N0	RAB6C_HUMAN	RAB6C, member RAS oncogene family	148					protein transport|response to drug|small GTPase mediated signal transduction		GTP binding|GTPase activity			lung(1)	1	Colorectal(110;0.1)					CCAAAGGGCTGAATGTTACGT	0.463													35	158	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133543084	133543084	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133543084C>T	uc002ttp.2	-	14	1674	c.1300G>A	c.(1300-1302)GAA>AAA	p.E434K	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	434							protein binding				0						TATATTCCTTCATTCGAGTTC	0.458													12	55	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145161507	145161507	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145161507C>T	uc002tvu.2	-	6	1263	c.783G>A	c.(781-783)GTG>GTA	p.V261V	ZEB2_uc002tvv.2_Silent_p.V255V|ZEB2_uc010zbm.1_Silent_p.V232V|ZEB2_uc010fnp.2_Silent_p.V169V|ZEB2_uc010fnq.1_Silent_p.V290V	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	261	C2H2-type 2.					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GCTTGTGTGTCACCATATGCC	0.418													10	97	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152496556	152496556	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152496556G>C	uc010fnx.2	-	62	8895	c.8704C>G	c.(8704-8706)CTC>GTC	p.L2902V	NEB_uc002txu.2_Missense_Mutation_p.L6V	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2902	Nebulin 78.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATCCACTGGAGATCAGACTTG	0.378													25	89	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165947272	165947272	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165947272C>T	uc002ucx.2	-	28	5883	c.5391G>A	c.(5389-5391)TGG>TGA	p.W1797*	SCN3A_uc010zcy.1_Nonsense_Mutation_p.W280*|SCN3A_uc002ucy.2_Nonsense_Mutation_p.W1748*|SCN3A_uc002ucz.2_Nonsense_Mutation_p.W1748*	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1797						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	CAAACTTTTCCCAAACCTCAT	0.463													8	72	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166747011	166747011	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166747011C>G	uc002udk.2	-	24	3374	c.3241G>C	c.(3241-3243)GAA>CAA	p.E1081Q	TTC21B_uc002udj.1_RNA	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	1081						cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TCCAGGTTTTCAAATACTTCA	0.358													16	23	---	---	---	---	PASS
KBTBD10	10324	broad.mit.edu	37	2	170359659	170359659	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170359659G>C	uc010zdh.1	+	10	929	c.871G>C	c.(871-873)GAC>CAC	p.D291H	BBS5_uc002uet.2_Missense_Mutation_p.D291H|BBS5_uc010fpw.2_Missense_Mutation_p.D270H	NM_152384	NP_689597	O60662	KBTBA_HUMAN	Bardet-Biedl syndrome 5	356	Kelch 1.				striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						TGTAGAAATAGACTCTGATGG	0.373													9	17	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170506887	170506887	+	Silent	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170506887T>C	uc002ufe.2	-	7	1198	c.1104A>G	c.(1102-1104)GAA>GAG	p.E368E		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	368	Potential.										0						CTTTGTTTTTTTCATCTTTTT	0.308													2	16	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179402447	179402447	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179402447C>T	uc010zfg.1	-	304	92007	c.91783G>A	c.(91783-91785)GAG>AAG	p.E30595K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E24290K|TTN_uc010zfi.1_Missense_Mutation_p.E24223K|TTN_uc010zfj.1_Missense_Mutation_p.E24098K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31522							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTGTTCCTCTGTCATTACT	0.428													9	31	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179481355	179481355	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179481355G>A	uc010zfg.1	-	206	40683	c.40459C>T	c.(40459-40461)CGC>TGC	p.R13487C	TTN_uc010zfh.1_Missense_Mutation_p.R7182C|TTN_uc010zfi.1_Missense_Mutation_p.R7115C|TTN_uc010zfj.1_Missense_Mutation_p.R6990C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14414							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACTTGGGCGAGCTGAAAAA	0.383													10	32	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179528787	179528787	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179528787C>A	uc010zfk.1	-	14	1305	c.757G>T	c.(757-759)GTG>TTG	p.V253L	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	11465							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCACCGACACTTTCTTTTCA	0.383													9	48	---	---	---	---	PASS
PDE1A	5136	broad.mit.edu	37	2	183094834	183094834	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183094834C>T	uc002uos.2	-	7	706	c.622G>A	c.(622-624)GAA>AAA	p.E208K	PDE1A_uc010zfp.1_Missense_Mutation_p.E104K|PDE1A_uc002uoq.1_Missense_Mutation_p.E208K|PDE1A_uc010zfq.1_Missense_Mutation_p.E208K|PDE1A_uc002uor.2_Missense_Mutation_p.E192K|PDE1A_uc002uou.2_Missense_Mutation_p.E174K	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	208	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			TAACCAACTTCTAAAGCTTCT	0.333													6	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186670996	186670996	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186670996G>A	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.E153K					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		ATCAAGCAATGAGGGGAGAAG	0.373													3	12	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187455093	187455093	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187455093C>T	uc002upq.2	+	1	304	c.28C>T	c.(28-30)CGC>TGC	p.R10C	ITGAV_uc010frs.2_Missense_Mutation_p.R10C	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	10					angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		GCGACGGCTGCGCCTCGGTCC	0.706													5	21	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187516805	187516805	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187516805C>G	uc002upq.2	+	15	1770	c.1494C>G	c.(1492-1494)CTC>CTG	p.L498L	ITGAV_uc010frs.2_Silent_p.L462L|ITGAV_uc010zfv.1_Silent_p.L452L	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	498	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		GAACAGCTCTCAAAGTTTCCT	0.378													8	16	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198498569	198498569	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198498569C>T	uc002uuo.3	-	4	993	c.591G>A	c.(589-591)TGG>TGA	p.W197*		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	197						plasma membrane					0						TCCCTTCATTCCAACTTCTAC	0.408													16	139	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201468754	201468754	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201468754C>T	uc002uvx.2	+	8	704	c.603C>T	c.(601-603)CTC>CTT	p.L201L		NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	201					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTCCAAAACTCTTCGCAGAAG	0.303													4	50	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201721702	201721702	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201721702T>A	uc002uwe.2	-	8	1020	c.839A>T	c.(838-840)CAC>CTC	p.H280L	CLK1_uc002uwd.2_Missense_Mutation_p.H103L|CLK1_uc010zhi.1_Missense_Mutation_p.H322L|CLK1_uc002uwf.2_Missense_Mutation_p.H54L|CLK1_uc002uwg.2_Missense_Mutation_p.H129L|CLK1_uc010fsv.2_RNA	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1	280	Protein kinase.				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						CTTATTACTGTGCAAAACTGA	0.328													3	40	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203420557	203420557	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203420557C>T	uc002uzf.3	+	12	3317	c.2169C>T	c.(2167-2169)TTC>TTT	p.F723F	BMPR2_uc010ftr.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	723	Cytoplasmic (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						AGCAGGACTTCACACAGACTG	0.473													9	68	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209218754	209218754	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209218754C>T	uc002vcz.2	+	40	6135	c.5977C>T	c.(5977-5979)CAT>TAT	p.H1993Y		NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	1993	Catalytic.|PIPK.				cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TATTCGTTCTCATTCCAAAGC	0.418													24	107	---	---	---	---	PASS
ANKZF1	55139	broad.mit.edu	37	2	220094995	220094995	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220094995G>A	uc002vkg.2	+	2	190	c.16G>A	c.(16-18)GAT>AAT	p.D6N	ATG9A_uc002vke.1_5'Flank|ATG9A_uc002vkf.1_5'Flank|ANKZF1_uc010zkv.1_Missense_Mutation_p.D6N|ANKZF1_uc010zkw.1_Intron|ANKZF1_uc002vkh.2_Intron|ANKZF1_uc002vki.2_Missense_Mutation_p.D6N|ANKZF1_uc002vkj.1_5'Flank	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing	6						intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCGGCTCCAGATGCAGCCCC	0.602													5	24	---	---	---	---	PASS
DES	1674	broad.mit.edu	37	2	220290810	220290810	+	3'UTR	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220290810C>A	uc002vll.2	+	9						NM_001927	NP_001918	P17661	DESM_HUMAN	desmin						cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CACCCAGCCTCAGTCCTCCCC	0.632													3	11	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227924258	227924258	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227924258G>A	uc010zlt.1	-	28	2900	c.2246C>T	c.(2245-2247)TCA>TTA	p.S749L		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	749	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CACTCCTGGTGAGCCGGGAGG	0.552													13	61	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231090498	231090498	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231090498C>T	uc002vql.2	+	1					SP140_uc010zma.1_RNA|SP140_uc002vqj.2_5'UTR|SP140_uc002vqk.2_5'UTR|SP140_uc002vqn.2_5'UTR|SP140_uc002vqm.2_5'UTR|SP140_uc010fxl.2_5'UTR	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1						defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGCTTCACCTCAGAGCTGCAG	0.557													4	14	---	---	---	---	PASS
SP100	6672	broad.mit.edu	37	2	231407626	231407626	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231407626C>G	uc002vqu.1	+	29	2764	c.2623C>G	c.(2623-2625)CAG>GAG	p.Q875E	SP100_uc010fxp.1_Missense_Mutation_p.Q193E	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1	Error:Variant_position_missing_in_P23497_after_alignment					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TTTTGCAATTCAGGAAACAAG	0.373													8	56	---	---	---	---	PASS
SP100	6672	broad.mit.edu	37	2	231407741	231407741	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231407741C>G	uc002vqu.1	+	29					SP100_uc010fxp.1_3'UTR	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGTGACTGCTCCTGTGGAAAC	0.333													3	15	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234622344	234622344	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234622344C>G	uc002vuw.2	+	1	707	c.707C>G	c.(706-708)TCT>TGT	p.S236C	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Missense_Mutation_p.S236C	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	236					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		AGCCTTGCCTCTGAGCTTTTT	0.527													39	161	---	---	---	---	PASS
HJURP	55355	broad.mit.edu	37	2	234749538	234749538	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234749538C>T	uc002vvg.2	-	8	1954	c.1888G>A	c.(1888-1890)GAC>AAC	p.D630N	HJURP_uc010znd.1_Missense_Mutation_p.D569N|HJURP_uc010zne.1_Missense_Mutation_p.D538N	NM_018410	NP_060880	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	630					cell cycle|CenH3-containing nucleosome assembly at centromere|centromeric core chromatin assembly|chromosome segregation|regulation of DNA binding|regulation of protein complex assembly	condensed chromosome kinetochore|cytoplasm|nucleolus|nucleoplasm	DNA binding|histone binding			ovary(1)	1		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		AAGTGAGGGTCTGGATTTAAT	0.448													16	61	---	---	---	---	PASS
PER2	8864	broad.mit.edu	37	2	239184478	239184478	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239184478C>T	uc002vyc.2	-	4	591	c.354G>A	c.(352-354)CTG>CTA	p.L118L	PER2_uc010znv.1_Silent_p.L118L|PER2_uc010znw.1_Silent_p.L118L|PER2_uc010fyx.1_Silent_p.L118L	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	118					circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GGTGGACCTTCAGCTCCTTTA	0.517													12	65	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241468765	241468765	+	Silent	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241468765G>T	uc002vyz.1	-	4	604	c.375C>A	c.(373-375)ATC>ATA	p.I125I	ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Silent_p.I214I|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	125							zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGCTGTGGGTGATGAAGCTGG	0.562													4	28	---	---	---	---	PASS
MTERFD2	130916	broad.mit.edu	37	2	242035439	242035439	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242035439C>T	uc002wan.1	-	3	1700	c.1207G>A	c.(1207-1209)GAT>AAT	p.D403N	MTERFD2_uc010zoj.1_Missense_Mutation_p.D186N	NM_182501	NP_872307	Q7Z6M4	MTER2_HUMAN	MTERF domain containing 2	374										ovary(1)	1		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		tcgtcctcatcctcatcattg	0.189													16	68	---	---	---	---	PASS
TRNT1	51095	broad.mit.edu	37	3	3189210	3189210	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3189210G>A	uc003bpp.3	+	7	981	c.879G>A	c.(877-879)GTG>GTA	p.V293V	TRNT1_uc010hbv.2_Silent_p.V273V|TRNT1_uc003bpm.2_RNA	NM_182916	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	293					protein targeting to mitochondrion|tRNA 3'-end processing	mitochondrion	ATP binding|tRNA adenylyltransferase activity|tRNA binding				0				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		CAAAGCCAGTGACTCTTTTGG	0.353													22	47	---	---	---	---	PASS
C3orf31	132001	broad.mit.edu	37	3	11831945	11831945	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11831945C>T	uc003bwh.2	-	7					C3orf31_uc003bwj.2_3'UTR|C3orf31_uc003bwi.2_RNA	NM_138807	NP_620162	Q96BW9	MMP37_HUMAN	MMP37-like protein, mitochondrial precursor						protein import into mitochondrial matrix	extrinsic to mitochondrial inner membrane					0						ACACTTTATTCATCTACACAT	0.338													9	142	---	---	---	---	PASS
ZFYVE20	64145	broad.mit.edu	37	3	15124116	15124116	+	Splice_Site	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15124116C>G	uc003bzm.1	-	9	1213	c.599_splice	c.e9-1	p.N200_splice	ZFYVE20_uc010hek.1_Splice_Site_p.N200_splice|ZFYVE20_uc011avn.1_Intron	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN	FYVE-finger-containing Rab5 effector protein						blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2						GTGAGCTTGTCTGTAACCACA	0.572													10	18	---	---	---	---	PASS
EAF1	85403	broad.mit.edu	37	3	15475961	15475961	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15475961C>T	uc003bzu.2	+	4	665	c.442C>T	c.(442-444)CCA>TCA	p.P148S	EAF1_uc011avq.1_Missense_Mutation_p.P47S	NM_033083	NP_149074	Q96JC9	EAF1_HUMAN	ELL associated factor 1	148	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cajal body|nuclear speck	protein binding			central_nervous_system(1)	1						ATTCAGAGCTCCAACGAAGCC	0.522													38	244	---	---	---	---	PASS
VIPR1	7433	broad.mit.edu	37	3	42573763	42573763	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42573763C>T	uc003clf.2	+	10	1072	c.948C>T	c.(946-948)ATC>ATT	p.I316I	VIPR1_uc011azl.1_Silent_p.I268I|VIPR1_uc011azm.1_Silent_p.I106I|VIPR1_uc011azn.1_Silent_p.I289I|VIPR1_uc003clg.2_5'UTR	NM_004624	NP_004615	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	316	Helical; Name=5; (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TTTGCATCATCCGAATCCTGC	0.567													18	29	---	---	---	---	PASS
CCRL2	9034	broad.mit.edu	37	3	46450087	46450087	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46450087C>G	uc003cpp.3	+	2	802	c.517C>G	c.(517-519)CAG>GAG	p.Q173E	CCRL2_uc010hjg.2_Missense_Mutation_p.Q185E|CCRL2_uc010hjf.2_Missense_Mutation_p.Q173E	NM_003965	NP_003956	O00421	CCRL2_HUMAN	chemokine (C-C motif) receptor-like 2 isoform 1	173	Extracellular (Potential).				chemotaxis|inflammatory response	integral to plasma membrane	CCR chemokine receptor binding|chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)		TTATAAACCTCAGATGGAAGA	0.463													13	68	---	---	---	---	PASS
APEH	327	broad.mit.edu	37	3	49713611	49713611	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49713611G>A	uc003cxf.2	+	6	965	c.565G>A	c.(565-567)GAT>AAT	p.D189N	APEH_uc010hkw.1_Missense_Mutation_p.D189N	NM_001640	NP_001631	P13798	ACPH_HUMAN	N-acylaminoacyl-peptide hydrolase	189					proteolysis	cytoplasm|nuclear membrane	serine-type endopeptidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGCCAGCGATGATGAGATAGC	0.592													6	46	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49933757	49933757	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49933757C>T	uc003cxy.3	-	10	2784	c.2520G>A	c.(2518-2520)GGG>GGA	p.G840G	MST1R_uc011bdd.1_Silent_p.G841G|MST1R_uc011bdc.1_5'UTR	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	840	IPT/TIG 3.|Extracellular (Potential).				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CACTCAGATTCCCTGCCACCC	0.597													22	75	---	---	---	---	PASS
TLR9	54106	broad.mit.edu	37	3	52264889	52264889	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52264889C>T	uc003ddb.2	-	2	228	c.18G>A	c.(16-18)CAG>CAA	p.Q6Q	TLR9_uc003ddc.1_5'Flank|TWF2_uc003ddd.2_Silent_p.Q202Q|TWF2_uc010hmc.2_Silent_p.Q202Q	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	Error:Variant_position_missing_in_Q9NR96_after_alignment					defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	CACCCACCATCTGGATGTAGT	0.617													3	15	---	---	---	---	PASS
GLYCTK	132158	broad.mit.edu	37	3	52325046	52325046	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52325046G>A	uc003ddo.2	+	3	544	c.448G>A	c.(448-450)GAT>AAT	p.D150N	GLYCTK_uc003ddq.2_Missense_Mutation_p.D150N|GLYCTK_uc003ddm.2_RNA|GLYCTK_uc003ddn.2_RNA|GLYCTK_uc003ddp.1_Missense_Mutation_p.D150N|GLYCTK_uc003ddr.2_5'Flank	NM_145262	NP_660305	Q8IVS8	GLCTK_HUMAN	glycerate kinase isoform 1	150					protein phosphorylation	Golgi apparatus|mitochondrion	ATP binding|glycerate kinase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		CCCGGACCGCGATGCGCTGCG	0.617													6	42	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52523592	52523592	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52523592G>C	uc011beg.1	+	18	3426	c.3354G>C	c.(3352-3354)GAG>GAC	p.E1118D	NISCH_uc003ded.3_Missense_Mutation_p.E1118D|NISCH_uc003dee.3_Missense_Mutation_p.E607D|NISCH_uc003deg.1_RNA|NISCH_uc003deh.3_5'Flank	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1118					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCTCGGAGGAGAATCAGATCC	0.458													12	77	---	---	---	---	PASS
PRKCD	5580	broad.mit.edu	37	3	53212459	53212459	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53212459C>T	uc003dgl.2	+	3	374	c.21C>T	c.(19-21)ATC>ATT	p.I7I	PRKCD_uc003dgm.2_Silent_p.I7I|PRKCD_uc003dgn.2_Silent_p.I7I	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	7	C2.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		TCCTGCGCATCGCCTTCAACT	0.682													6	42	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73438983	73438983	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73438983C>T	uc003dpl.1	-	7	1496	c.1400G>A	c.(1399-1401)GGA>GAA	p.G467E	PDZRN3_uc011bgh.1_Missense_Mutation_p.G124E|PDZRN3_uc010hoe.1_Missense_Mutation_p.G165E|PDZRN3_uc011bgf.1_Missense_Mutation_p.G184E|PDZRN3_uc011bgg.1_Missense_Mutation_p.G187E	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	467	PDZ 2.						ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AATGCGGTCTCCTTCTCGGAT	0.468													13	39	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74350684	74350684	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74350684C>A	uc003dpm.1	-	15	2040	c.1960G>T	c.(1960-1962)GAT>TAT	p.D654Y		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	654	Fibronectin type-III 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		GTCTTCCCATCGATGACCTCA	0.443													3	71	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108203941	108203941	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108203941C>G	uc003dxa.1	-	12	1228	c.1171G>C	c.(1171-1173)GAA>CAA	p.E391Q		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	391	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TTCTTACTTTCTGTGCCATCT	0.383													19	48	---	---	---	---	PASS
TMPRSS7	344805	broad.mit.edu	37	3	111769523	111769523	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111769523G>A	uc010hqb.2	+	7	888	c.718G>A	c.(718-720)GAA>AAA	p.E240K	TMPRSS7_uc011bhr.1_Missense_Mutation_p.E95K	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	366	Extracellular (Potential).|CUB 2.				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2						TCCAGAGTGTGAAAACACAGT	0.398													32	207	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112546253	112546253	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112546253C>T	uc003dzi.1	-	3	617	c.391G>A	c.(391-393)GAT>AAT	p.D131N	CD200R1L_uc011bhw.1_Missense_Mutation_p.D110N|CD200R1L_uc010hqf.1_Missense_Mutation_p.D110N	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2	131	Ig-like V-type.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)	1						AAATTCCCATCAGGTGTTACC	0.453													20	90	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112546398	112546398	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112546398C>T	uc003dzi.1	-	3	472	c.246G>A	c.(244-246)AAG>AAA	p.K82K	CD200R1L_uc011bhw.1_Silent_p.K61K|CD200R1L_uc010hqf.1_Silent_p.K61K	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2	82	Ig-like V-type.|Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)	1						TTGTTTCTTTCTTGTAGGCTT	0.438													13	74	---	---	---	---	PASS
CCDC52	152185	broad.mit.edu	37	3	113172624	113172624	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113172624C>T	uc003eag.3	-	14	2122	c.1831G>A	c.(1831-1833)GAA>AAA	p.E611K	CCDC52_uc003eaf.3_RNA|CCDC52_uc003eah.1_Missense_Mutation_p.E507K	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	611					cell division|mitosis	centriole|spindle	protein binding				0						TCCAAATCTTCTCCCATGTGA	0.438													34	93	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113528247	113528247	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113528247G>A	uc003eao.2	+	15	1893	c.1827G>A	c.(1825-1827)CAG>CAA	p.Q609Q	ATP6V1A_uc011bik.1_Silent_p.Q576Q	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	609					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						AAGACATGCAGAATGCATTCC	0.393													7	48	---	---	---	---	PASS
LSAMP	4045	broad.mit.edu	37	3	116163937	116163937	+	5'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163937G>C	uc003ebt.2	-	1					LSAMP_uc011bis.1_5'UTR|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CGCTGCTCGCGAGGAGAGGCT	0.632													3	18	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121206874	121206874	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121206874G>C	uc003eee.3	-	16	5033	c.4904C>G	c.(4903-4905)TCA>TGA	p.S1635*	POLQ_uc003eed.2_Nonsense_Mutation_p.S807*	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1635					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TAGATCAAATGATGCCCCTGA	0.373								DNA_polymerases_(catalytic_subunits)					63	166	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121411306	121411306	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121411306C>T	uc003eei.3	-	14	7016	c.6890G>A	c.(6889-6891)CGC>CAC	p.R2297H	GOLGB1_uc010hrc.2_Missense_Mutation_p.R2302H|GOLGB1_uc003eej.3_Missense_Mutation_p.R2263H	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2297	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		GTATAGGTGGCGTGTCTCTTC	0.433													13	90	---	---	---	---	PASS
ILDR1	286676	broad.mit.edu	37	3	121725918	121725918	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121725918G>A	uc003ees.2	-	2	255	c.149C>T	c.(148-150)TCT>TTT	p.S50F	ILDR1_uc003eeq.2_Missense_Mutation_p.S62F|ILDR1_uc003eer.2_Missense_Mutation_p.S50F|ILDR1_uc010hrg.2_Missense_Mutation_p.S50F	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor	50	Extracellular (Potential).|Ig-like V-type.					cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)		GAGCTGGGCAGAGGTGGTGTA	0.527													9	58	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127831851	127831851	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127831851G>A	uc003ekh.2	-	3	345	c.241C>T	c.(241-243)CTG>TTG	p.L81L	RUVBL1_uc003ekf.2_Silent_p.L21L|RUVBL1_uc010hss.2_Silent_p.L81L	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	81					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		GCAATAGCCAGAGCCAGAGCT	0.483													9	82	---	---	---	---	PASS
MRPL3	11222	broad.mit.edu	37	3	131217033	131217033	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131217033G>A	uc003eoh.2	-	4	622	c.458C>T	c.(457-459)TCA>TTA	p.S153L	MRPL3_uc011blo.1_Missense_Mutation_p.S48L|MRPL3_uc011blp.1_Missense_Mutation_p.S180L	NM_007208	NP_009139	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	153					translation	mitochondrial large ribosomal subunit	RNA binding|structural constituent of ribosome				0						ACGAAAACGTGATACAGTTTT	0.348													18	71	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133494392	133494392	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133494392C>T	uc003epu.1	+	20	3531	c.1803C>T	c.(1801-1803)GCC>GCT	p.A601A	TF_uc011blt.1_Silent_p.A474A|TF_uc003epw.1_Silent_p.T40T|TF_uc003epv.1_Silent_p.A601A	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	601	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	TGGCCAGAGCCCCGAATCACG	0.512													13	179	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142188970	142188970	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142188970G>C	uc003eux.3	-	37	6399	c.6277C>G	c.(6277-6279)CTA>GTA	p.L2093V	ATR_uc003euy.1_5'Flank	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2093	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TCAAGCCATAGAGTTAACATT	0.318								Other_conserved_DNA_damage_response_genes					4	22	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147131226	147131226	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147131226C>T	uc003ewe.2	+	3	1951	c.1232C>T	c.(1231-1233)TCT>TTT	p.S411F		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	411	Ser-rich.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						ACCATCGTGTCTCCCTCCACA	0.607													11	72	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151163978	151163978	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151163978G>C	uc011bod.1	-	4	3791	c.3791C>G	c.(3790-3792)TCT>TGT	p.S1264C		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1264					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAAGGTATTAGATGGAATTTG	0.458													24	114	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151164002	151164002	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151164002G>A	uc011bod.1	-	4	3767	c.3767C>T	c.(3766-3768)TCA>TTA	p.S1256L		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1256					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CACACTTGTTGAAAGTGTGGT	0.418													23	123	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155232674	155232674	+	Splice_Site	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155232674C>G	uc011bok.1	-	11	1712	c.1435_splice	c.e11-1	p.S479_splice	PLCH1_uc011boj.1_Splice_Site_p.S479_splice|PLCH1_uc011bol.1_Splice_Site_p.S461_splice	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TCCCATTACTCTGCAAAGAAT	0.348													5	36	---	---	---	---	PASS
GFM1	85476	broad.mit.edu	37	3	158383171	158383171	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158383171G>C	uc003fce.2	+	12	1533	c.1426G>C	c.(1426-1428)GAA>CAA	p.E476Q	GFM1_uc003fcd.2_Missense_Mutation_p.E476Q|GFM1_uc003fcf.2_RNA|GFM1_uc003fcg.2_Missense_Mutation_p.E407Q	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor	476					mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GTTTACAAGAGAAGATCCCAC	0.348													8	36	---	---	---	---	PASS
GFM1	85476	broad.mit.edu	37	3	158384153	158384153	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158384153G>T	uc003fce.2	+	13	1686	c.1579G>T	c.(1579-1581)GAG>TAG	p.E527*	GFM1_uc003fcd.2_Nonsense_Mutation_p.E527*|GFM1_uc003fcf.2_RNA|GFM1_uc003fcg.2_Nonsense_Mutation_p.E458*	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor	527					mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TGCCTTTCGAGAGACCATTAC	0.358													7	31	---	---	---	---	PASS
LXN	56925	broad.mit.edu	37	3	158384379	158384379	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158384379G>A	uc003fch.2	-	6					GFM1_uc003fcd.2_Intron|GFM1_uc003fce.2_Intron|GFM1_uc003fcf.2_Intron|GFM1_uc003fcg.2_Intron	NM_020169	NP_064554	Q9BS40	LXN_HUMAN	latexin							cytoplasm	metalloendopeptidase inhibitor activity|protein binding				0			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			AGATGCCAGTGAAATTGGCAT	0.343													4	17	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167245664	167245664	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167245664C>T	uc003fev.1	-	11	1798	c.1492G>A	c.(1492-1494)GAC>AAC	p.D498N	WDR49_uc003feu.1_Missense_Mutation_p.D323N|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	498	WD 8.									large_intestine(1)|ovary(1)|skin(1)	3						ATACTGCAGTCTGCAGAGGAG	0.413													5	25	---	---	---	---	PASS
PDCD10	11235	broad.mit.edu	37	3	167414891	167414891	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167414891G>A	uc003fex.2	-	5	572	c.174C>T	c.(172-174)CTC>CTT	p.L58L	PDCD10_uc003fez.2_Silent_p.L58L|PDCD10_uc003fey.2_Silent_p.L58L	NM_007217	NP_009148	Q9BUL8	PDC10_HUMAN	programmed cell death 10	58					angiogenesis|apoptosis|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of MAP kinase activity	cytosol|Golgi membrane|plasma membrane	protein homodimerization activity|protein N-terminus binding			lung(1)|central_nervous_system(1)	2						TGTCTTGTGTGAGACCTGGAT	0.333									Familial_Cerebral_Cavernous_Angioma				10	42	---	---	---	---	PASS
SKIL	6498	broad.mit.edu	37	3	170108952	170108952	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170108952G>C	uc003fgu.2	+	6	2512	c.1800G>C	c.(1798-1800)CAG>CAC	p.Q600H	SKIL_uc011bps.1_Missense_Mutation_p.Q580H|SKIL_uc003fgv.2_Missense_Mutation_p.Q554H|SKIL_uc003fgw.2_Missense_Mutation_p.Q600H	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	600	Potential.				cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			ATGTTGAACAGAAAGACTTAG	0.348													7	52	---	---	---	---	PASS
KCNMB3	27094	broad.mit.edu	37	3	178977440	178977440	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178977440C>G	uc003fjo.2	-	1					KCNMB3_uc003fjl.3_RNA|KCNMB3_uc011bqc.1_Intron|KCNMB3_uc003fjp.1_Intron	NM_171829	NP_741980	Q9NPA1	KCMB3_HUMAN	calcium-activated potassium channel beta 3						detection of calcium ion|platelet activation|regulation of action potential in neuron	voltage-gated potassium channel complex	calcium-activated potassium channel activity|potassium channel regulator activity				0	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)			AATCTGTGTTCTGATAAGTTA	0.308													5	17	---	---	---	---	PASS
EIF2B5	8893	broad.mit.edu	37	3	183860565	183860565	+	Splice_Site	SNP	A	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183860565A>C	uc003fmp.2	+	11	1911	c.1547_splice	c.e11-2	p.G516_splice	EIF2B5_uc003fmq.2_Splice_Site_p.G237_splice|EIF2B5_uc003fmr.2_5'Flank	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,						astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			ATGGCTTCTCAGGACTCAAGA	0.458													6	13	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184570306	184570306	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184570306C>G	uc003fpb.1	+	10	937	c.766C>G	c.(766-768)CTT>GTT	p.L256V	VPS8_uc010hyd.1_Missense_Mutation_p.L256V	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	258							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TGATCCAACTCTTGCAATTTG	0.313													4	35	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185191489	185191489	+	Silent	SNP	C	T	T	rs148543279	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185191489C>T	uc010hyf.2	+	12	2636	c.2370C>T	c.(2368-2370)CTC>CTT	p.L790L	MAP3K13_uc011brt.1_Silent_p.L583L|MAP3K13_uc011bru.1_Silent_p.L646L|MAP3K13_uc003fpi.2_Silent_p.L790L|MAP3K13_uc010hyg.2_Silent_p.L480L	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	790					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AGTCATCCCTCGGCACCTCTC	0.512													44	132	---	---	---	---	PASS
HRG	3273	broad.mit.edu	37	3	186395041	186395041	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186395041C>T	uc003fqq.2	+	7	970	c.947C>T	c.(946-948)CCT>CTT	p.P316L		NM_000412	NP_000403	P04196	HRG_HUMAN	histidine-rich glycoprotein precursor	316	Pro-rich.				fibrinolysis|platelet activation|platelet degranulation	extracellular region|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding			ovary(1)|central_nervous_system(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		CCACAAGGCCCTCCTCCACTA	0.493													13	70	---	---	---	---	PASS
LOC100128023	100128023	broad.mit.edu	37	3	193711614	193711614	+	RNA	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193711614C>T	uc011bss.1	-	1		c.414G>A				NR_027764				Homo sapiens developmental pluripotency associated 2 pseudogene (LOC100128023), non-coding RNA.												0						TCAGGCGTATCTTGCTGTTGT	0.458													7	12	---	---	---	---	PASS
LOC100128023	100128023	broad.mit.edu	37	3	193711626	193711626	+	RNA	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193711626C>T	uc011bss.1	-	1		c.402G>A				NR_027764				Homo sapiens developmental pluripotency associated 2 pseudogene (LOC100128023), non-coding RNA.												0						TGCTGTTGTTCAGGGAAAGCA	0.478													8	10	---	---	---	---	PASS
C3orf21	152002	broad.mit.edu	37	3	194790491	194790491	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194790491C>T	uc003fum.3	-	4	1243	c.1135G>A	c.(1135-1137)GTC>ATC	p.V379I	C3orf21_uc003ful.2_Missense_Mutation_p.V176I|C3orf21_uc003fuk.2_Missense_Mutation_p.V173I	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002	379						integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		TAGATCTTGACGTGGCCCTCA	0.627													12	101	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197593030	197593030	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197593030C>G	uc011bul.1	+	17	1818	c.1813C>G	c.(1813-1815)CAG>GAG	p.Q605E	LRCH3_uc003fyj.1_Missense_Mutation_p.Q605E|LRCH3_uc011bum.1_Missense_Mutation_p.Q553E|LRCH3_uc011bun.1_Missense_Mutation_p.Q451E|LRCH3_uc003fyk.2_Missense_Mutation_p.Q200E	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	605						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CCAGAGAAATCAGCCTCAGCG	0.433													11	83	---	---	---	---	PASS
ZNF721	170960	broad.mit.edu	37	4	435805	435805	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:435805C>T	uc003gag.2	-	3	3142	c.2451G>A	c.(2449-2451)GCG>GCA	p.A817A	ABCA11P_uc003gac.2_Intron|ABCA11P_uc003gad.2_Intron|ABCA11P_uc011buv.1_Intron|ABCA11P_uc003gae.2_Intron|ABCA11P_uc010ibd.1_Intron|ZNF721_uc003gaf.3_Silent_p.A849A|ZNF721_uc010ibe.2_Silent_p.A805A	NM_133474	NP_597731	D9N162	D9N162_HUMAN	zinc finger protein 721	817						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						AACTAGTAAACGCTTTACCAC	0.393													12	44	---	---	---	---	PASS
KIAA1530	57654	broad.mit.edu	37	4	1347183	1347183	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1347183G>A	uc003gde.3	+	5	1363	c.916G>A	c.(916-918)GAT>AAT	p.D306N		NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	306											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			GTACACGCTGGATGTGGAGCT	0.667													4	5	---	---	---	---	PASS
MSX1	4487	broad.mit.edu	37	4	4864675	4864675	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4864675G>C	uc003gif.2	+	2	952	c.717G>C	c.(715-717)AAG>AAC	p.K239N		NM_002448	NP_002439	P28360	MSX1_HUMAN	msh homeobox 1	233					apoptotic nuclear change|face morphogenesis|negative regulation of cell growth|odontogenesis of dentine-containing tooth|positive regulation of apoptosis|protein localization to nucleus|protein stabilization	nucleus	p53 binding|sequence-specific DNA binding transcription factor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		AGAAGCTGAAGATGGCCGCCA	0.657													7	26	---	---	---	---	PASS
SEL1L3	23231	broad.mit.edu	37	4	25789920	25789920	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25789920C>G	uc003gru.3	-	13	2295	c.2143G>C	c.(2143-2145)GAG>CAG	p.E715Q	SEL1L3_uc003grv.2_Missense_Mutation_p.E122Q	NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	715	Sel1-like 3.					integral to membrane	binding				0						GCGTACCACTCAATTGCTGCT	0.468													15	87	---	---	---	---	PASS
TLR10	81793	broad.mit.edu	37	4	38776503	38776503	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38776503G>C	uc003gti.2	-	2	1088	c.709C>G	c.(709-711)CTT>GTT	p.L237V	TLR10_uc003gtj.2_Missense_Mutation_p.L237V|TLR10_uc003gtk.2_Missense_Mutation_p.L237V	NM_030956	NP_112218	Q9BXR5	TLR10_HUMAN	toll-like receptor 10 precursor	237	Extracellular (Potential).				inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway	integral to membrane|plasma membrane	transmembrane receptor activity			lung(1)|breast(1)	2						TCTAAACTAAGATTTCGTTGC	0.328													14	24	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39308303	39308303	+	Missense_Mutation	SNP	G	A	A	rs55727832		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39308303G>A	uc003gty.1	-	14	2041	c.1907C>T	c.(1906-1908)TCC>TTC	p.S636F	RFC1_uc003gtx.1_Missense_Mutation_p.S635F	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	636					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						ATCTTTGCCGGAAAATTTACC	0.458													9	25	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72204900	72204900	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72204900G>A	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_5'UTR|SLC4A4_uc003hga.2_Intron|SLC4A4_uc003hgb.3_5'UTR	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			AGAACCAAAGGAATAGAGAAG	0.448													7	79	---	---	---	---	PASS
CXCL13	10563	broad.mit.edu	37	4	78527049	78527049	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78527049C>T	uc003hkr.2	+	2	108	c.30C>T	c.(28-30)CTC>CTT	p.L10L		NM_006419	NP_006410	O43927	CXL13_HUMAN	chemokine (C-X-C motif) ligand 13 (B-cell	10					activation of Rap GTPase activity|B cell chemotaxis|cell-cell signaling|chronic inflammatory response|defense response to bacterium|elevation of cytosolic calcium ion concentration|endothelial cell chemotaxis to fibroblast growth factor|germinal center formation|lymphocyte chemotaxis across high endothelial venule|negative regulation of apoptosis|positive regulation of cell-cell adhesion mediated by integrin|positive regulation of integrin activation|positive regulation of T cell chemotaxis|regulation of angiogenesis|regulation of humoral immune response	extracellular space|soluble fraction	CCR10 chemokine receptor binding|chemokine activity|CXCR3 chemokine receptor binding|CXCR5 chemokine receptor binding|fibroblast growth factor 2 binding|heparin binding|protein heterodimerization activity|receptor agonist activity				0						CTCTGCTTCTCATGCTGCTGG	0.443													8	48	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85662946	85662946	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85662946G>C	uc003hpd.2	-	38	6610	c.6202C>G	c.(6202-6204)CTT>GTT	p.L2068V		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2068						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAATCTATAAGAAGTTTAGAT	0.368													11	66	---	---	---	---	PASS
ARHGAP24	83478	broad.mit.edu	37	4	86893235	86893235	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86893235C>T	uc003hpk.2	+	6	1095	c.646C>T	c.(646-648)CGA>TGA	p.R216*	ARHGAP24_uc003hpj.2_Nonsense_Mutation_p.R216*|ARHGAP24_uc003hpl.2_Nonsense_Mutation_p.R121*|ARHGAP24_uc010ikf.2_Nonsense_Mutation_p.R131*|ARHGAP24_uc003hpm.2_Nonsense_Mutation_p.R123*	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	216	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GCTGTACCTCCGAGAACTTCC	0.418													11	43	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95155124	95155124	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95155124G>C	uc003htc.3	+	4	643	c.388G>C	c.(388-390)GAA>CAA	p.E130Q	SMARCAD1_uc003htb.3_Missense_Mutation_p.E130Q|SMARCAD1_uc003htd.3_Missense_Mutation_p.E130Q|SMARCAD1_uc010ila.2_5'UTR	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	130					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		ATCTGAAGATGAAGAGTCCCA	0.274													6	37	---	---	---	---	PASS
RG9MTD2	93587	broad.mit.edu	37	4	100479303	100479303	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100479303G>C	uc003huy.2	-	3	564	c.251C>G	c.(250-252)TCA>TGA	p.S84*	RG9MTD2_uc003huz.3_Nonsense_Mutation_p.S84*|RG9MTD2_uc003hva.3_Nonsense_Mutation_p.S84*	NM_152292	NP_689505	Q8TBZ6	RG9D2_HUMAN	RNA (guanine-9-) methyltransferase domain	84							methyltransferase activity			ovary(2)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.7e-08)		ATGTCCATCTGAGTTTGGTTC	0.338													8	47	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102981490	102981490	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102981490C>G	uc003hvy.3	+	12	2366	c.2092C>G	c.(2092-2094)CTG>GTG	p.L698V	BANK1_uc003hvx.3_Missense_Mutation_p.L683V|BANK1_uc010ill.2_Missense_Mutation_p.L565V|BANK1_uc003hvz.3_Missense_Mutation_p.L668V	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	698					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GGATGAAGCTCTGGAGAAATT	0.453													4	63	---	---	---	---	PASS
BDH2	56898	broad.mit.edu	37	4	104013836	104013836	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104013836G>A	uc003hwz.2	-	4	274	c.169C>T	c.(169-171)CTT>TTT	p.L57F	BDH2_uc003hxa.2_RNA	NM_020139	NP_064524	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	57					fatty acid beta-oxidation|heme metabolic process|iron ion homeostasis|siderophore biosynthetic process	cytoplasm	3-hydroxybutyrate dehydrogenase activity|NAD binding|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		GTGACATCAAGGACACGAGTT	0.338													4	9	---	---	---	---	PASS
INTS12	57117	broad.mit.edu	37	4	106614616	106614616	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106614616C>G	uc003hxw.2	-	5	595	c.337G>C	c.(337-339)GAT>CAT	p.D113H	INTS12_uc010ilr.2_Missense_Mutation_p.D113H	NM_020395	NP_065128	Q96CB8	INT12_HUMAN	integrator complex subunit 12	113					snRNA processing	integrator complex	protein binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		TTTGGAATATCAACTCCTTCA	0.373													36	114	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110882118	110882118	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110882118C>T	uc003hzy.3	+	7	1614	c.1162C>T	c.(1162-1164)CTG>TTG	p.L388L	EGF_uc011cfu.1_Silent_p.L346L|EGF_uc011cfv.1_Silent_p.L388L	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	388	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	AGGATTTGTTCTGCTTCCTGA	0.388													12	54	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113362208	113362208	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113362208G>A	uc003iap.3	+	15	3953	c.3674G>A	c.(3673-3675)TGT>TAT	p.C1225Y	ALPK1_uc003ian.3_Missense_Mutation_p.C1225Y|ALPK1_uc011cfx.1_Missense_Mutation_p.C1147Y|ALPK1_uc003iao.3_RNA|ALPK1_uc010imo.2_Missense_Mutation_p.C1053Y	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1225	Alpha-type protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CATGTGGAATGTAATGAAATC	0.383													16	132	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121738027	121738027	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121738027G>A	uc003idn.2	-	6	953	c.703C>T	c.(703-705)CAG>TAG	p.Q235*	PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron|PRDM5_uc010inf.2_Intron	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	235	C2H2-type 3; atypical.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						ACAGAGCACTGAAAACTTCGC	0.378													31	165	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072563	134072563	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072563G>A	uc003iha.2	+	1	2094	c.1268G>A	c.(1267-1269)CGA>CAA	p.R423Q	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.R423Q	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	423	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CCCCTGGACCGAGAGGCGGGG	0.592													34	155	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507837	155507837	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507837C>G	uc003iod.1	-	5	802	c.744G>C	c.(742-744)TGG>TGC	p.W248C	FGA_uc003ioe.1_Missense_Mutation_p.W248C|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	248	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TTAATGCCTTCCACTCTGGGG	0.473													10	77	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169208323	169208323	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169208323C>T	uc003irp.2	-	10	1507	c.1215G>A	c.(1213-1215)ATG>ATA	p.M405I		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	405							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CATAATCTTTCATAATGGTAT	0.353													5	28	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183664474	183664474	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183664474G>A	uc003ivd.1	+	18	3568	c.3531G>A	c.(3529-3531)GCG>GCA	p.A1177A	ODZ3_uc003ive.1_Silent_p.A583A	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1177	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CCCCAGTGGCGCTAGCTTGTG	0.512													10	44	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184614842	184614842	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184614842G>A	uc003ivx.2	+	21	2514	c.2338G>A	c.(2338-2340)GAA>AAA	p.E780K	C4orf41_uc003ivw.2_Missense_Mutation_p.E780K|C4orf41_uc010isc.2_Missense_Mutation_p.E124K|C4orf41_uc003ivy.2_Missense_Mutation_p.E386K	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	780											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		TCAGTCCCATGAAAAGACCCA	0.393													37	89	---	---	---	---	PASS
SLC12A7	10723	broad.mit.edu	37	5	1076837	1076837	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1076837G>A	uc003jbu.2	-	13	1786	c.1720C>T	c.(1720-1722)CTG>TTG	p.L574L		NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride	574	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	ACGCTGTCCAGAGAGGCGATG	0.667													6	21	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5235258	5235258	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5235258G>C	uc003jdl.2	+	13	2120	c.1982G>C	c.(1981-1983)AGA>ACA	p.R661T	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R661T|ADAMTS16_uc010itk.1_RNA	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	661	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						AGACGATTCAGAGGGCGGCAC	0.483													13	35	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5476188	5476188	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5476188G>C	uc003jdm.3	+	17	6738	c.6516G>C	c.(6514-6516)CTG>CTC	p.L2172L		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	2172										ovary(1)|central_nervous_system(1)	2						TACTGAGGCTGATTGGTAAGT	0.353													3	10	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14472765	14472765	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14472765G>A	uc003jff.2	+	39	5983	c.5977G>A	c.(5977-5979)GAG>AAG	p.E1993K	TRIO_uc003jfg.2_RNA|TRIO_uc003jfh.1_Missense_Mutation_p.E1642K	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	1993	DH 2.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					CTATGTGGTTGAGGTGTGTAT	0.393													15	62	---	---	---	---	PASS
RAD1	5810	broad.mit.edu	37	5	34913668	34913668	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34913668C>T	uc003jix.2	-	3	543	c.214G>A	c.(214-216)GAG>AAG	p.E72K	RAD1_uc003jiw.2_Intron|RAD1_uc003jiy.2_Missense_Mutation_p.E72K|BRIX1_uc003jiz.2_5'Flank|BRIX1_uc011col.1_5'Flank|BRIX1_uc003jja.2_5'Flank	NM_002853	NP_002844	O60671	RAD1_HUMAN	RAD1 homolog	72					DNA damage checkpoint|DNA repair|DNA replication|meiotic prophase I	nucleoplasm	3'-5' exonuclease activity|damaged DNA binding|exodeoxyribonuclease III activity|protein binding				0	all_lung(31;0.000107)	Lung NSC(810;5.19e-05)|Ovarian(839;0.0448)|Breast(839;0.198)	COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			ACTTTAAACTCCTGAAATATT	0.284								Other_conserved_DNA_damage_response_genes					12	32	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35876677	35876677	+	3'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35876677G>C	uc003jjs.2	+	8					IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor						immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TCACAGCACAGAGAAGACAAA	0.433													2	12	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37371030	37371030	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37371030G>A	uc003jku.1	-	1	168	c.50C>T	c.(49-51)GCA>GTA	p.A17V	NUP155_uc003jkt.1_5'Flank|NUP155_uc010iuz.1_Missense_Mutation_p.A17V	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	17					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTGCAGGGCTGCGGCAGATGT	0.557													11	55	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37371140	37371140	+	Translation_Start_Site	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37371140G>C	uc003jku.1	-	1	58	c.-60C>G	c.(-62--58)ATCTT>ATGTT		NUP155_uc003jkt.1_5'Flank|NUP155_uc010iuz.1_Translation_Start_Site	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AACAAGAAAAGATCCAAGAAG	0.567													5	16	---	---	---	---	PASS
PTGER4	5734	broad.mit.edu	37	5	40681862	40681862	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40681862G>A	uc003jlz.2	+	2	1359	c.767G>A	c.(766-768)CGC>CAC	p.R256H		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	256	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						GACTTTCGGCGCCGCCGGAGC	0.716													6	26	---	---	---	---	PASS
PPAP2A	8611	broad.mit.edu	37	5	54826424	54826424	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54826424G>A	uc003jqa.2	-						PPAP2A_uc003jpz.2_Intron|PPAP2A_uc003jqb.2_Intron|RNF138P1_uc003jqc.1_RNA	NM_003711	NP_003702	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|androgen receptor signaling pathway|germ cell migration|negative regulation of cell proliferation|phospholipid dephosphorylation|regulation of lipid metabolic process|sphingolipid metabolic process	integral to plasma membrane|membrane fraction	phosphatidate phosphatase activity|sphingosine-1-phosphate phosphatase activity			ovary(2)	2		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				TTGCAATGAAGTCTCATGCGA	0.383													4	33	---	---	---	---	PASS
MIER3	166968	broad.mit.edu	37	5	56219227	56219227	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56219227A>T	uc003jrd.1	-	13	1406	c.1381T>A	c.(1381-1383)TAT>AAT	p.Y461N	MIER3_uc003jqz.1_Missense_Mutation_p.Y398N|MIER3_uc003jra.1_Missense_Mutation_p.Y460N|MIER3_uc003jrb.1_Missense_Mutation_p.Y285N|MIER3_uc003jrc.1_Missense_Mutation_p.Y466N	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family	461					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TCCGAGTGATAAAATCCAGTC	0.423													19	37	---	---	---	---	PASS
PIK3R1	5295	broad.mit.edu	37	5	67590446	67590446	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67590446G>T	uc003jva.2	+	12	2068	c.1508G>T	c.(1507-1509)CGG>CTG	p.R503L	PIK3R1_uc003jvb.2_Missense_Mutation_p.R503L|PIK3R1_uc003jvc.2_Missense_Mutation_p.R203L|PIK3R1_uc003jvd.2_Missense_Mutation_p.R233L|PIK3R1_uc003jve.2_Missense_Mutation_p.R182L|PIK3R1_uc011crb.1_Missense_Mutation_p.R173L	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	503					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	ACCCAAGAGCGGTACAGCAAA	0.343			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			3	38	---	---	---	---	PASS
COL4A3BP	10087	broad.mit.edu	37	5	74675245	74675245	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74675245C>G	uc011csu.1	-	17	2223	c.1801G>C	c.(1801-1803)GAG>CAG	p.E601Q	COL4A3BP_uc003kds.2_Missense_Mutation_p.E575Q|COL4A3BP_uc003kdt.2_Missense_Mutation_p.E729Q|COL4A3BP_uc003kdu.2_Missense_Mutation_p.E601Q	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform	601	START.				ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TTAGGATACTCTCGCTTTGCC	0.373													13	20	---	---	---	---	PASS
MSH3	4437	broad.mit.edu	37	5	79950603	79950603	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79950603G>A	uc003kgz.2	+	1	310	c.57G>A	c.(55-57)GCG>GCA	p.A19A	DHFR_uc011ctl.1_5'UTR|DHFR_uc011ctm.1_5'UTR|DHFR_uc010jap.1_RNA|DHFR_uc003kgx.1_Silent_p.L51L|DHFR_uc003kgy.1_5'UTR	NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	19					maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CAGCCCCTGCGAGGCAAGCGG	0.667								MMR					6	12	---	---	---	---	PASS
MSH3	4437	broad.mit.edu	37	5	80024675	80024675	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80024675C>G	uc003kgz.2	+	10	1712	c.1459C>G	c.(1459-1461)CAA>GAA	p.Q487E		NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	487					maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		TCTAGGTTCTCAAATTATTTC	0.264								MMR					15	53	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82832829	82832829	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82832829G>A	uc003kii.3	+	8	4363	c.4007G>A	c.(4006-4008)CGA>CAA	p.R1336Q	VCAN_uc003kij.3_Missense_Mutation_p.R349Q|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_5'UTR	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1336	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TTTTCAGGTCGAATGAGTGAT	0.368													8	7	---	---	---	---	PASS
LNPEP	4012	broad.mit.edu	37	5	96349455	96349455	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96349455C>T	uc003kmv.1	+	12	2653	c.2139C>T	c.(2137-2139)ATC>ATT	p.I713I	LNPEP_uc003kmw.1_Silent_p.I699I	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	713	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AAGCACTAATCCATCAGTTGA	0.358													11	65	---	---	---	---	PASS
RIOK2	55781	broad.mit.edu	37	5	96503505	96503505	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96503505C>A	uc003kmz.2	-	8	1173	c.1063G>T	c.(1063-1065)GAA>TAA	p.E355*	RIOK2_uc003kna.3_Nonsense_Mutation_p.E355*	NM_018343	NP_060813	Q9BVS4	RIOK2_HUMAN	RIO kinase 2 isoform 1	355	Protein kinase.						ATP binding|protein serine/threonine kinase activity			kidney(1)	1		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		CAGTTCCGTTCACTTTCATTT	0.398													4	122	---	---	---	---	PASS
TMED7	51014	broad.mit.edu	37	5	114951919	114951919	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114951919C>T	uc003krf.2	-	3	1043	c.662G>A	c.(661-663)CGT>CAT	p.R221H	TMED7-TICAM2_uc003krd.2_Intron|TMED7-TICAM2_uc003kre.2_Intron|TMED7_uc011cwd.1_Missense_Mutation_p.R133H	NM_181836	NP_861974	Q9Y3B3	TMED7_HUMAN	transmembrane emp24 protein transport domain	221	Cytoplasmic (Potential).				transport	endoplasmic reticulum membrane|integral to membrane					0		all_cancers(142;0.0223)|all_epithelial(76;0.000869)|Prostate(80;0.0115)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;3.34e-07)|Epithelial(69;1.08e-06)|all cancers(49;4.56e-05)		TGATCCAACACGAGTTGTGGT	0.378													12	24	---	---	---	---	PASS
PCDHA1	56147	broad.mit.edu	37	5	140167237	140167237	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140167237G>A	uc003lhb.2	+	1	1362	c.1362G>A	c.(1360-1362)GCG>GCA	p.A454A	PCDHA1_uc003lha.2_Silent_p.A454A|PCDHA1_uc003lgz.2_Silent_p.A454A	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	454	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCGCCTGCGTTCGCGCAGC	0.677													25	62	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140237249	140237249	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140237249G>C	uc003lhx.2	+	1	1616	c.1616G>C	c.(1615-1617)GGG>GCG	p.G539A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Missense_Mutation_p.G539A	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	539	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGCGATGGGGGCGTGCCG	0.687													4	32	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140503600	140503600	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140503600G>A	uc003lip.1	+	1	2020	c.2020G>A	c.(2020-2022)GAG>AAG	p.E674K		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	674	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCTCTCCCTGAGGCGGCCCC	0.677													43	76	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140574015	140574015	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574015G>A	uc003lix.2	+	1	2064	c.1890G>A	c.(1888-1890)CTG>CTA	p.L630L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	630	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGGCTGCTGAGCGAGCGCG	0.682													5	24	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712087	140712087	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712087C>T	uc003lji.1	+	1	1836	c.1836C>T	c.(1834-1836)AGC>AGT	p.S612S	PCDHGA1_uc011dan.1_Silent_p.S612S	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	612	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAAGGCCAGCGAGCCGGGAC	0.692													16	46	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147040379	147040379	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147040379G>C	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron|uc003lop.1_3'UTR|JAKMIP2_uc010jgo.1_Intron	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTTGGATAGAGCACTGGAC	0.413													5	13	---	---	---	---	PASS
HTR4	3360	broad.mit.edu	37	5	147928298	147928298	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147928298G>A	uc003lpn.2	-	4	450	c.286C>T	c.(286-288)CGG>TGG	p.R96W	HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_Missense_Mutation_p.R96W|HTR4_uc003lpj.1_Missense_Mutation_p.R96W|HTR4_uc003lpk.2_Missense_Mutation_p.R96W|HTR4_uc011dby.1_Missense_Mutation_p.R96W|HTR4_uc003lpl.2_Missense_Mutation_p.R96W|HTR4_uc003lpm.2_Missense_Mutation_p.R96W|HTR4_uc010jgv.2_RNA|HTR4_uc003lpo.1_Missense_Mutation_p.R96W	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b	96	Helical; Name=3; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	AGAGATGTCCGAACAAGACAA	0.502													3	13	---	---	---	---	PASS
FAM50B	26240	broad.mit.edu	37	6	3850759	3850759	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3850759C>T	uc003mvu.2	+	2	826	c.714C>T	c.(712-714)ATC>ATT	p.I238I		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	238						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				TCATGTTCATCAAGGAGGACC	0.627													18	35	---	---	---	---	PASS
PRPF4B	8899	broad.mit.edu	37	6	4049306	4049306	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4049306C>G	uc003mvv.2	+	8	2083	c.1992C>G	c.(1990-1992)CTC>CTG	p.L664L	PRPF4B_uc003mvw.2_RNA|PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	664						catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				ATCCCAACCTCAGAGATAACT	0.408													10	39	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7581110	7581110	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7581110C>G	uc003mxp.1	+	23	4966	c.4687C>G	c.(4687-4689)CTG>GTG	p.L1563V	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1563	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCAGAACTCTCTGAAAGAGCT	0.542													32	51	---	---	---	---	PASS
HFE	3077	broad.mit.edu	37	6	26092939	26092939	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26092939C>T	uc003nfx.1	+	4	803	c.643C>T	c.(643-645)CAT>TAT	p.H215Y	HFE_uc003nfy.1_Missense_Mutation_p.H192Y|HFE_uc010jqe.1_Intron|HFE_uc003nfz.1_Missense_Mutation_p.H127Y|HFE_uc003ngd.1_Intron|HFE_uc003nga.1_Intron|HFE_uc003ngb.1_Intron|HFE_uc003ngc.1_Missense_Mutation_p.H123Y|HFE_uc003nge.1_Missense_Mutation_p.H35Y|HFE_uc003ngf.1_Intron	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor	215	Alpha-3.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						GGTGACACATCATGTGACCTC	0.512									Hemochromatosis				16	99	---	---	---	---	PASS
HIST1H2BH	8345	broad.mit.edu	37	6	26252142	26252142	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26252142G>C	uc003nhh.2	+	1	264	c.264G>C	c.(262-264)TCG>TCC	p.S88S	HIST1H3F_uc003nhg.1_5'Flank	NM_003524	NP_003515	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	88					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)	3						ACAAGCGTTCGACCATCACCT	0.597													6	97	---	---	---	---	PASS
HIST1H4I	8294	broad.mit.edu	37	6	27107244	27107244	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27107244G>C	uc003niy.1	+	1	157	c.157G>C	c.(157-159)GAG>CAG	p.E53Q	HIST1H2BK_uc003nix.1_Intron	NM_003495	NP_003486	P62805	H4_HUMAN	histone cluster 1, H4i	53					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			lung(1)	1						CCTCATCTATGAGGAGACCCG	0.632			T	BCL6	NHL								7	65	---	---	---	---	PASS
HLA-E	3133	broad.mit.edu	37	6	30457338	30457338	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30457338C>G	uc003nqg.2	+	1	68	c.30C>G	c.(28-30)CTC>CTG	p.L10L	HLA-E_uc011dmg.1_RNA|HLA-E_uc011dmh.1_Missense_Mutation_p.S8C	NM_005516	NP_005507	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	10				L -> S (in Ref. 1; AAA52655).	antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			central_nervous_system(4)|ovary(1)	5						TTTTACTCCTCTCGGAGGCCC	0.537													35	77	---	---	---	---	PASS
VARS2	57176	broad.mit.edu	37	6	30886770	30886770	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30886770C>T	uc003nsc.1	+						VARS2_uc011dmx.1_Intron|VARS2_uc011dmy.1_Intron|VARS2_uc011dmz.1_Intron|VARS2_uc011dna.1_Intron|VARS2_uc011dnb.1_Intron|VARS2_uc011dnc.1_Intron|VARS2_uc011dnd.1_5'UTR|VARS2_uc010jsg.1_5'Flank	NM_020442	NP_065175	Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial						valyl-tRNA aminoacylation	mitochondrion	ATP binding|valine-tRNA ligase activity			ovary(3)|central_nervous_system(1)	4						AATGGTGGCTCTTTCTCTCTT	0.473													3	11	---	---	---	---	PASS
BAT1	7919	broad.mit.edu	37	6	31498646	31498646	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31498646C>T	uc003ntt.2	-	10	1811	c.1180G>A	c.(1180-1182)GAG>AAG	p.E394K	BAT1_uc003ntq.2_Missense_Mutation_p.E127K|BAT1_uc003ntr.2_Missense_Mutation_p.E201K|BAT1_uc003nts.2_Missense_Mutation_p.M401I|BAT1_uc011dnn.1_Missense_Mutation_p.E316K|BAT1_uc003ntu.2_Missense_Mutation_p.E394K|BAT1_uc003ntv.2_Missense_Mutation_p.E394K	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	394	Helicase C-terminal.				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						GCATCATTCTCATCGGACACA	0.512													11	48	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32016366	32016366	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32016366C>T	uc003nzl.2	-	29	10015	c.9813G>A	c.(9811-9813)GTG>GTA	p.V3271V	TNXB_uc003nzg.1_5'Flank|TNXB_uc003nzh.1_5'Flank	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3318	Fibronectin type-III 25.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						AGTCCGAGGTCACGGCCGCCA	0.701													4	22	---	---	---	---	PASS
HSD17B8	7923	broad.mit.edu	37	6	33173008	33173008	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33173008C>G	uc003odi.1	+	3	308	c.281C>G	c.(280-282)TCT>TGT	p.S94C	uc003odj.1_5'Flank|MIR219-1_hsa-mir-219-1|MI0000296_5'Flank	NM_014234	NP_055049	Q92506	DHB8_HUMAN	estradiol 17 beta-dehydrogenase 8	94					estrogen biosynthetic process|fatty acid biosynthetic process	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NAD+) activity			breast(1)|central_nervous_system(1)	2					NADH(DB00157)	GCCTGCTTTTCTCGCCCACCA	0.547													5	44	---	---	---	---	PASS
HSD17B8	7923	broad.mit.edu	37	6	33173950	33173950	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33173950G>A	uc003odi.1	+	7	718	c.691G>A	c.(691-693)GAG>AAG	p.E231K	uc003odj.1_5'Flank|MIR219-1_hsa-mir-219-1|MI0000296_5'Flank|RING1_uc011dqw.1_5'Flank|RING1_uc011dqx.1_5'Flank|RING1_uc003odk.2_5'Flank	NM_014234	NP_055049	Q92506	DHB8_HUMAN	estradiol 17 beta-dehydrogenase 8	231					estrogen biosynthetic process|fatty acid biosynthetic process	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NAD+) activity			breast(1)|central_nervous_system(1)	2					NADH(DB00157)	GGGGGACCCTGAGGGTGAGCA	0.488													6	39	---	---	---	---	PASS
RNF8	9025	broad.mit.edu	37	6	37328350	37328350	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37328350G>T	uc003onq.3	+	2	433	c.240G>T	c.(238-240)AAG>AAT	p.K80N	RNF8_uc003onr.3_Missense_Mutation_p.K80N|RNF8_uc011dtx.1_5'UTR	NM_003958	NP_003949	O76064	RNF8_HUMAN	ring finger protein 8 isoform 1	80	FHA.				cell division|double-strand break repair|histone H2A ubiquitination|histone H2B ubiquitination|mitosis|positive regulation of DNA repair|response to ionizing radiation	midbody|nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						TGGACAACAAGGTACAGGAAT	0.323													10	28	---	---	---	---	PASS
TSPO2	222642	broad.mit.edu	37	6	41011326	41011326	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41011326G>C	uc003opj.2	+	3	505	c.204G>C	c.(202-204)CTG>CTC	p.L68L	UNC5CL_uc010jxe.1_Intron|TSPO2_uc003opk.2_Intron|TSPO2_uc011dub.1_Silent_p.L68L	NM_001010873	NP_001010873	Q5TGU0	TSPO2_HUMAN	benzodiazapine receptor (peripheral)-like 1	68					transport	endoplasmic reticulum membrane|integral to membrane	cholesterol binding|receptor activity				0						GGAAGGACCTGGGAGGGGGCT	0.582													11	86	---	---	---	---	PASS
FRS3	10817	broad.mit.edu	37	6	41739006	41739006	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41739006G>C	uc003orc.1	-	7	1074	c.830C>G	c.(829-831)TCT>TGT	p.S277C		NM_006653	NP_006644	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	277					fibroblast growth factor receptor signaling pathway	plasma membrane	fibroblast growth factor receptor binding|insulin receptor binding			ovary(2)	2	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGACACTCAGAAGGGGCCTC	0.647													5	45	---	---	---	---	PASS
CUL7	9820	broad.mit.edu	37	6	43008354	43008354	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43008354C>G	uc003otq.2	-	21	4240	c.3937G>C	c.(3937-3939)GAG>CAG	p.E1313Q	CUL7_uc010jyg.2_Missense_Mutation_p.E592Q|CUL7_uc011dvb.1_Missense_Mutation_p.E1397Q|CUL7_uc010jyh.2_Missense_Mutation_p.E306Q|KLC4_uc003otr.1_5'Flank	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	1313					interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CGCTGCAGCTCCTTAGAGGTG	0.602													27	129	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46801038	46801038	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46801038C>T	uc010jzh.1	+	11	1414	c.1372C>T	c.(1372-1374)CGA>TGA	p.R458*	MEP1A_uc011dwg.1_Nonsense_Mutation_p.R180*|MEP1A_uc011dwh.1_Nonsense_Mutation_p.R486*|MEP1A_uc011dwi.1_Nonsense_Mutation_p.R358*	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	458	MATH.|Extracellular (Potential).				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			TCAGAGCCCTCGATTCTACAA	0.498													23	46	---	---	---	---	PASS
CD2AP	23607	broad.mit.edu	37	6	47576971	47576971	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47576971C>G	uc003oyw.2	+	16	2201	c.1745C>G	c.(1744-1746)TCC>TGC	p.S582C		NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	582	Potential.				cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			AAAAAAAATTCCCTGGATGAA	0.393													8	61	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524156	51524156	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524156T>C	uc003pah.1	-	61	11044	c.10768A>G	c.(10768-10770)ATT>GTT	p.I3590V		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3590	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTTTGGCCAATCTGTAAGAAG	0.433													4	41	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524157	51524157	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524157C>A	uc003pah.1	-	61	11043	c.10767G>T	c.(10765-10767)CAG>CAT	p.Q3589H		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3589	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTTGGCCAATCTGTAAGAAGT	0.433													4	40	---	---	---	---	PASS
PAQR8	85315	broad.mit.edu	37	6	52268302	52268302	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268302C>T	uc003pao.3	+	2	465	c.291C>T	c.(289-291)GCC>GCT	p.A97A		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	97	Extracellular (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					GGGCCTTTGCCGAGGCTGAGG	0.577													13	84	---	---	---	---	PASS
GSTA5	221357	broad.mit.edu	37	6	52701092	52701092	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52701092G>T	uc003pba.1	-	4	284	c.214C>A	c.(214-216)CTT>ATT	p.L72I		NM_153699	NP_714543	Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	72	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.0912)				Glutathione(DB00143)	ATGTAGTTAAGAATGGCTCTG	0.423													51	174	---	---	---	---	PASS
GSTA4	2941	broad.mit.edu	37	6	52850346	52850346	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52850346C>T	uc003pbc.2	-	3	239	c.175G>A	c.(175-177)GAA>AAA	p.E59K	GSTA4_uc003pbd.2_5'UTR|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Missense_Mutation_p.E59K	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	59	GST N-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	CCGTCAATTTCAACCATGGGC	0.468													13	62	---	---	---	---	PASS
SMAP1	60682	broad.mit.edu	37	6	71566608	71566608	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71566608C>T	uc003pfr.2	+	9	1084	c.836C>T	c.(835-837)TCT>TTT	p.S279F	SMAP1_uc003pfs.2_Missense_Mutation_p.S252F|SMAP1_uc010kao.2_Missense_Mutation_p.S252F|SMAP1_uc010kap.2_Missense_Mutation_p.S269F	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating	279					regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						ACAGTAACATCTGGGGATCTA	0.428													7	82	---	---	---	---	PASS
FAM46A	55603	broad.mit.edu	37	6	82459984	82459984	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82459984C>T	uc003pjg.2	-	3	1075	c.757G>A	c.(757-759)GAG>AAG	p.E253K	FAM46A_uc003pjf.2_Missense_Mutation_p.E272K	NM_017633	NP_060103	Q96IP4	FA46A_HUMAN	hypothetical protein LOC55603	253											0		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		TGAAATGTCTCAGTCATTGGG	0.438													16	70	---	---	---	---	PASS
NT5E	4907	broad.mit.edu	37	6	86181054	86181054	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86181054C>T	uc003pko.3	+	3	1218	c.662C>T	c.(661-663)TCG>TTG	p.S221L	NT5E_uc003pkn.2_Missense_Mutation_p.S221L|NT5E_uc010kbr.2_Missense_Mutation_p.S221L	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	221					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	CTGGGACATTCGGGTTTTGAA	0.393													8	37	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88362934	88362934	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88362934G>C	uc003pmh.2	+	14	1527	c.1483G>C	c.(1483-1485)GAG>CAG	p.E495Q	ORC3L_uc011dzl.1_Missense_Mutation_p.E495Q|ORC3L_uc011dzm.1_Missense_Mutation_p.E495Q|ORC3L_uc011dzn.1_RNA|ORC3L_uc003pmg.2_Missense_Mutation_p.E495Q|ORC3L_uc003pmi.2_Missense_Mutation_p.E457Q|ORC3L_uc011dzo.1_Missense_Mutation_p.E352Q|ORC3L_uc011dzp.1_Missense_Mutation_p.E352Q	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2	495					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		TAAGAGAATAGAGGAGTTCCT	0.403													6	55	---	---	---	---	PASS
BACH2	60468	broad.mit.edu	37	6	90718326	90718326	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90718326C>T	uc011eab.1	-	6	1047	c.238G>A	c.(238-240)GAG>AAG	p.E80K	BACH2_uc003pnw.2_Missense_Mutation_p.E80K|BACH2_uc010kch.2_Missense_Mutation_p.E80K	NM_021813	NP_068585	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper	80	BTB.					nucleus	protein dimerization activity|sequence-specific DNA binding			ovary(3)|pancreas(1)|lung(1)|skin(1)	6		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		TGTACCTCCTCAGGCAAGCTG	0.473													6	52	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102516423	102516423	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102516423C>G	uc003pqp.3	+	16					GRIK2_uc003pqo.3_3'UTR|GRIK2_uc010kcw.2_3'UTR	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	AAACTGTCGTCTTTTTCCAAA	0.418													2	4	---	---	---	---	PASS
RTN4IP1	84816	broad.mit.edu	37	6	107035677	107035677	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107035677G>C	uc003prj.2	-	7	1344	c.867C>G	c.(865-867)CTC>CTG	p.L289L	RTN4IP1_uc010kdd.2_Intron|RTN4IP1_uc003prk.2_Silent_p.L189L	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor	289						mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		ACCATTTCTTGAGAAAATCTG	0.458													7	194	---	---	---	---	PASS
FRK	2444	broad.mit.edu	37	6	116360231	116360231	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116360231G>C	uc003pwi.1	-						TPI1P3_uc011ebd.1_RNA	NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase						negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)		TGGGGAGTCAGATAAGCTGAT	0.537													13	20	---	---	---	---	PASS
MAP3K5	4217	broad.mit.edu	37	6	136977457	136977457	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136977457C>G	uc003qhc.2	-	10	2029	c.1668G>C	c.(1666-1668)GTG>GTC	p.V556V	MAP3K5_uc011edj.1_5'UTR|MAP3K5_uc011edk.1_Silent_p.V401V|MAP3K5_uc010kgw.1_Silent_p.V556V	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	556					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GAAACCTAACCACAGTAACAT	0.408													9	78	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144803392	144803392	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144803392C>T	uc003qkt.2	+	26	3647	c.3555C>T	c.(3553-3555)CTC>CTT	p.L1185L		NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	1185	Spectrin 8.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGAAGATTCTCAAGGACAACA	0.458													9	37	---	---	---	---	PASS
RMND1	55005	broad.mit.edu	37	6	151742433	151742433	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151742433C>T	uc003qoi.2	-	9	1206	c.1026G>A	c.(1024-1026)GTG>GTA	p.V342V	RMND1_uc011eeq.1_Silent_p.V131V	NM_017909	NP_060379	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog	342											0		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		GAGATAGTTTCACTTTCTTCC	0.328													6	35	---	---	---	---	PASS
CNKSR3	154043	broad.mit.edu	37	6	154771348	154771348	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154771348C>G	uc003qpy.2	-	2	602	c.97G>C	c.(97-99)GAG>CAG	p.E33Q		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	33	SAM.				negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TTGATCTTCTCTCGTTCAAAC	0.517													11	37	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163899843	163899843	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163899843G>C	uc003qui.2	+	3	868	c.317G>C	c.(316-318)AGA>ACA	p.R106T	QKI_uc003que.2_Missense_Mutation_p.R106T|QKI_uc003quf.2_Missense_Mutation_p.R106T|QKI_uc003qug.2_Missense_Mutation_p.R106T|QKI_uc003quh.2_Missense_Mutation_p.R106T|QKI_uc003quj.2_Missense_Mutation_p.R106T	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	106	KH.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		CTTGGACCTAGAGGACTTACA	0.358													14	68	---	---	---	---	PASS
FRMD1	79981	broad.mit.edu	37	6	168464360	168464360	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168464360G>C	uc003qwo.3	-	6	790	c.725C>G	c.(724-726)CCC>CGC	p.P242R	FRMD1_uc003qwm.3_Missense_Mutation_p.P13R|FRMD1_uc011egs.1_Missense_Mutation_p.P13R|FRMD1_uc011egt.1_Missense_Mutation_p.P154R|FRMD1_uc003qwn.3_Missense_Mutation_p.P174R	NM_024919	NP_079195	Q8N878	FRMD1_HUMAN	FERM domain containing 1 isoform 1	242	FERM.					cytoskeleton	binding			ovary(1)	1		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCCTCCTTGGGGCTCAGGCC	0.652													8	24	---	---	---	---	PASS
SMOC2	64094	broad.mit.edu	37	6	169051384	169051384	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169051384G>A	uc003qws.1	+	10	951	c.931G>A	c.(931-933)GAG>AAG	p.E311K	SMOC2_uc003qwr.1_Missense_Mutation_p.E322K|SMOC2_uc011egu.1_5'UTR	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	311					signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CAAAAAGCATGAGTTTCTGAC	0.512													7	11	---	---	---	---	PASS
MIOS	54468	broad.mit.edu	37	7	7628157	7628157	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7628157G>C	uc003srf.2	+	8	2155	c.1847G>C	c.(1846-1848)AGA>ACA	p.R616T	MIOS_uc003srg.2_Missense_Mutation_p.R151T|MIOS_uc010ktq.2_Missense_Mutation_p.E14Q	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	616											0						GTACGTGACAGAGTGGCATTT	0.343													13	37	---	---	---	---	PASS
NPVF	64111	broad.mit.edu	37	7	25264716	25264716	+	3'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25264716G>C	uc003sxo.2	-	3						NM_022150	NP_071433	Q9HCQ7	RFRP_HUMAN	neuropeptide VF precursor						neuropeptide signaling pathway	extracellular region|membrane	G-protein coupled receptor activity			ovary(1)	1						ACAGGCCACAGCTTTAGGGAC	0.388													11	23	---	---	---	---	PASS
FAM183B	340286	broad.mit.edu	37	7	38725115	38725115	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38725115C>T	uc011kbd.1	-	2						NR_028347				Homo sapiens cDNA FLJ42138 fis, clone TESTI2036684.												0						GGATGGGGGACGGGGGGTTAA	0.408													8	39	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	82072745	82072745	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82072745G>C	uc003uhr.1	-	1	287	c.31C>G	c.(31-33)CTG>GTG	p.L11V		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	11						voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AAAAGTGTCAGAGTCAAGGCC	0.537													4	26	---	---	---	---	PASS
TAF6	6878	broad.mit.edu	37	7	99707583	99707583	+	Missense_Mutation	SNP	C	G	G	rs145206628		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99707583C>G	uc003uti.2	-	12	1353	c.1272G>C	c.(1270-1272)CAG>CAC	p.Q424H	AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_Missense_Mutation_p.Q346H|TAF6_uc003uth.2_Missense_Mutation_p.Q481H|TAF6_uc003utk.2_Missense_Mutation_p.Q424H|TAF6_uc011kji.1_Missense_Mutation_p.Q461H|TAF6_uc003utj.2_Missense_Mutation_p.Q414H|TAF6_uc003utl.2_Missense_Mutation_p.Q424H|TAF6_uc003utm.2_Missense_Mutation_p.Q424H	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	424					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAGGAGGCTCTGCACATGGT	0.572													10	72	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106509785	106509785	+	Silent	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106509785T>C	uc003vdv.3	+	2	1864	c.1779T>C	c.(1777-1779)TTT>TTC	p.F593F	PIK3CG_uc003vdu.2_Silent_p.F593F|PIK3CG_uc003vdw.2_Silent_p.F593F	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	593					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CTAAGCTATTTAGTTCAGTGA	0.433													27	68	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114304340	114304340	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114304340G>T	uc003vhb.2	+	16	2226	c.1852G>T	c.(1852-1854)GAG>TAG	p.E618*	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Nonsense_Mutation_p.E643*|FOXP2_uc003vha.2_Nonsense_Mutation_p.E526*|FOXP2_uc011kmu.1_Nonsense_Mutation_p.E635*|FOXP2_uc011kmv.1_Nonsense_Mutation_p.E617*|FOXP2_uc010ljz.1_Nonsense_Mutation_p.E433*	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	618					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TGCCTTGGCAGAGAGCAGTTT	0.388													7	16	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116409824	116409824	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116409824G>C	uc003vij.2	+	12	2896	c.2709G>C	c.(2707-2709)TTG>TTC	p.L903F	MET_uc010lkh.2_Missense_Mutation_p.L921F|MET_uc011knj.1_Missense_Mutation_p.L473F	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	903	Extracellular (Potential).				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TGCTGAAATTGAACAGCGAGC	0.373			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				5	26	---	---	---	---	PASS
MET	4233	broad.mit.edu	37	7	116436028	116436028	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116436028C>T	uc003vij.2	+	21	4210	c.4023C>T	c.(4021-4023)TTC>TTT	p.F1341F	MET_uc010lkh.2_Silent_p.F1359F|MET_uc011knj.1_Silent_p.F911F	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	1341	Protein kinase.|Interaction with MUC20.|Interaction with RANBP9.|Cytoplasmic (Potential).				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAGCGATCTTCTCTACTTTCA	0.443			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				18	75	---	---	---	---	PASS
TTC26	79989	broad.mit.edu	37	7	138863036	138863036	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138863036C>G	uc003vus.2	+	13	1260	c.1146C>G	c.(1144-1146)CTC>CTG	p.L382L	TTC26_uc011kqn.1_Silent_p.L382L|TTC26_uc011kqo.1_Silent_p.L351L|TTC26_uc011kqp.1_Silent_p.L277L|TTC26_uc003vut.2_Silent_p.L242L|TTC26_uc011kqq.1_Silent_p.L251L	NM_024926	NP_079202	A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26 isoform 1	382							binding			ovary(1)	1						TGATTTACCTCAACTCATTTA	0.373													10	55	---	---	---	---	PASS
TRY6	154754	broad.mit.edu	37	7	142481238	142481238	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481238G>C	uc011ksq.1	+	3	395	c.312G>C	c.(310-312)CTG>CTC	p.L104L	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						GGATTATTCTGAACAATGACA	0.527													5	38	---	---	---	---	PASS
TRY6	154754	broad.mit.edu	37	7	142481259	142481259	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142481259C>T	uc011ksq.1	+	3	416	c.333C>T	c.(331-333)ATC>ATT	p.I111I	uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc003wan.1_Intron|TRY6_uc011ksr.1_RNA	NR_001296				SubName: Full=Protease, serine, 3; Flags: Fragment;												0						TCATGCTGATCAAGCTCTCCA	0.542													15	24	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147183114	147183114	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147183114T>G	uc003weu.1	+	11	2274	c.1758T>G	c.(1756-1758)AGT>AGG	p.S586R		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	586	EGF-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGGATACAGTGGGGCCACCT	0.468										HNSCC(39;0.1)			6	49	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151927069	151927069	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927069C>T	uc003wla.2	-	18	3134	c.2915G>A	c.(2914-2916)GGA>GAA	p.G972E	MLL3_uc003wkz.2_Missense_Mutation_p.G33E	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	972	PHD-type 4.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAGTAATCTTCCTTCTGCTCC	0.353			N		medulloblastoma								10	165	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	8	12427894	12427894	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12427894C>T	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		TCCTATCCATCAGCTCATTCA	0.413													4	16	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18622977	18622977	+	Silent	SNP	G	A	A	rs139539737	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18622977G>A	uc003wza.2	-	9	2257	c.2154C>T	c.(2152-2154)TTC>TTT	p.F718F	PSD3_uc003wyy.2_Silent_p.F184F|PSD3_uc003wyz.2_Silent_p.F19F	NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	719	SEC7.				regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		GATCCTTGGAGAAATCAACAC	0.393													17	83	---	---	---	---	PASS
EPB49	2039	broad.mit.edu	37	8	21926966	21926966	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21926966C>T	uc011kyt.1	+	6	560	c.331C>T	c.(331-333)CAG>TAG	p.Q111*	EPB49_uc010ltl.2_Nonsense_Mutation_p.Q111*|EPB49_uc011kys.1_Nonsense_Mutation_p.Q71*|EPB49_uc010ltn.2_Nonsense_Mutation_p.Q86*|EPB49_uc011kyu.1_Nonsense_Mutation_p.Q111*|EPB49_uc011kyv.1_Nonsense_Mutation_p.Q111*|EPB49_uc010ltq.2_Nonsense_Mutation_p.Q111*	NM_001114136	NP_001107608	Q08495	DEMA_HUMAN	erythrocyte membrane protein band 4.9 isoform 1	111					actin filament bundle assembly|actin filament capping	actin cytoskeleton|nucleus	actin binding			central_nervous_system(1)	1				Colorectal(74;9.05e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0631)		AATCATCTCTCAGGCCTCGGC	0.632													14	22	---	---	---	---	PASS
BMP1	649	broad.mit.edu	37	8	22058657	22058657	+	Intron	SNP	C	T	T	rs145042921		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22058657C>T	uc003xbg.2	+						BMP1_uc003xba.2_3'UTR|BMP1_uc003xbb.2_Missense_Mutation_p.R712W|BMP1_uc003xbe.2_RNA|BMP1_uc003xbc.2_Missense_Mutation_p.R461W|BMP1_uc003xbd.2_RNA|BMP1_uc003xbf.2_Missense_Mutation_p.R461W|BMP1_uc011kzc.1_Intron|BMP1_uc003xbh.2_RNA|BMP1_uc003xbi.2_RNA	NM_006129	NP_006120	P13497	BMP1_HUMAN	bone morphogenetic protein 1 isoform 3						cartilage condensation|cell differentiation|lipid metabolic process|lipoprotein metabolic process|ossification|positive regulation of cartilage development|proteolysis	extracellular space	calcium ion binding|cytokine activity|growth factor activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|breast(1)	3				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GCAGCCCCCTCGGGGACGCCC	0.627													23	99	---	---	---	---	PASS
CHMP7	91782	broad.mit.edu	37	8	23112846	23112846	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23112846C>T	uc003xdc.2	+	4	1206	c.558C>T	c.(556-558)CTC>CTT	p.L186L	CHMP7_uc011kzs.1_RNA|CHMP7_uc003xdd.2_Silent_p.L76L|CHMP7_uc003xde.2_Silent_p.L44L	NM_152272	NP_689485	Q8WUX9	CHMP7_HUMAN	CHMP family, member 7	186					cellular membrane organization|late endosome to vacuole transport	cytosol|ESCRT III complex	protein transporter activity				0		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		TCAGCACCCTCTGTGCTAACT	0.582													18	21	---	---	---	---	PASS
LOC728024	728024	broad.mit.edu	37	8	37604983	37604983	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37604983C>T	uc010lvx.1	-	1	539	c.393G>A	c.(391-393)CAG>CAA	p.Q131Q	ERLIN2_uc003xke.3_Intron	NR_003671				SubName: Full=cDNA FLJ38978 fis, clone NT2RI2004209; SubName: Full=Chromosome X open reading frame 56, isoform CRA_b; SubName: Full=Putative uncharacterized protein CXorf56;												0						CTTTGGCATTCTGTGCATACG	0.483													19	121	---	---	---	---	PASS
CYP7A1	1581	broad.mit.edu	37	8	59409297	59409297	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59409297G>C	uc003xtm.3	-	3	837	c.774C>G	c.(772-774)AGC>AGG	p.S258R		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	258					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				ACATGCGCAGGCTGATCAGTT	0.517									Neonatal_Giant_Cell_Hepatitis				12	177	---	---	---	---	PASS
MTFR1	9650	broad.mit.edu	37	8	66619459	66619459	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66619459G>A	uc003xvm.2	+	6	944	c.732G>A	c.(730-732)GAG>GAA	p.E244E	MTFR1_uc011lep.1_Silent_p.E244E|MTFR1_uc003xvn.2_Silent_p.E211E|MTFR1_uc003xvo.1_Silent_p.E234E	NM_014637	NP_055452	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1 isoform 1	244						mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			TCCTTAAAGAGATGAACAGTG	0.378													6	83	---	---	---	---	PASS
CRISPLD1	83690	broad.mit.edu	37	8	75941732	75941732	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75941732G>C	uc003yan.2	+	14	1806	c.1431G>C	c.(1429-1431)CAG>CAC	p.Q477H	CRISPLD1_uc011lfk.1_Missense_Mutation_p.Q289H|CRISPLD1_uc011lfl.1_Missense_Mutation_p.Q289H	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	477	LCCL 2.					extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTTCTTTTCAGAATGGAATCT	0.373													4	30	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87076269	87076269	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076269G>C	uc011lfy.1	-	2	777	c.777C>G	c.(775-777)TTC>TTG	p.F259L		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	259	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			CAAAAGGCAGGAATCCGCTAA	0.408													10	58	---	---	---	---	PASS
BAALC	79870	broad.mit.edu	37	8	104240391	104240391	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104240391C>T	uc003yld.2	+	3					BAALC_uc003yle.2_3'UTR|uc003ylf.2_Intron|BAALC_uc003ylg.2_3'UTR|BAALC_uc010mcc.2_RNA	NM_024812	NP_079088	Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic isoform 1							centrosome|membrane|nucleus					0			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			TGGATCCCATCAAAGAACCTT	0.498													3	10	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814193	106814193	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814193C>G	uc003ymd.2	+	8	1906	c.1883C>G	c.(1882-1884)TCT>TGT	p.S628C	ZFPM2_uc011lhs.1_Missense_Mutation_p.S359C	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	628					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TGCATCAATTCTTCCACTGTC	0.448													18	33	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110587905	110587905	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110587905C>G	uc003ynj.3	-	7	1385	c.1222G>C	c.(1222-1224)GAC>CAC	p.D408H	SYBU_uc003yni.3_Missense_Mutation_p.D405H|SYBU_uc003ynk.3_Missense_Mutation_p.D289H|SYBU_uc010mco.2_Missense_Mutation_p.D407H|SYBU_uc003ynl.3_Missense_Mutation_p.D407H|SYBU_uc010mcp.2_Missense_Mutation_p.D408H|SYBU_uc010mcq.2_Missense_Mutation_p.D408H|SYBU_uc003yno.3_Missense_Mutation_p.D289H|SYBU_uc010mcr.2_Missense_Mutation_p.D408H|SYBU_uc003ynm.3_Missense_Mutation_p.D407H|SYBU_uc003ynn.3_Missense_Mutation_p.D407H|SYBU_uc010mcs.2_Missense_Mutation_p.D289H|SYBU_uc010mct.2_Missense_Mutation_p.D408H|SYBU_uc010mcu.2_Missense_Mutation_p.D407H|SYBU_uc003ynp.3_Missense_Mutation_p.D340H|SYBU_uc010mcv.2_Missense_Mutation_p.D408H|SYBU_uc003ynh.3_Missense_Mutation_p.D202H|SYBU_uc011lhw.1_Missense_Mutation_p.D278H	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	408	Sufficient for interaction with STX1A.|Sufficient for interaction with KIF5B.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						GCCATTGTGTCAAGAGGGGGG	0.537													9	77	---	---	---	---	PASS
EXT1	2131	broad.mit.edu	37	8	119122991	119122991	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119122991G>A	uc003yok.1	-	1	1068	c.295C>T	c.(295-297)CGC>TGC	p.R99C		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	99	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			GACTCCATGCGGCACTTCTTG	0.498			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				13	71	---	---	---	---	PASS
TRIB1	10221	broad.mit.edu	37	8	126448548	126448548	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126448548C>G	uc003yrx.2	+	3	1536	c.954C>G	c.(952-954)CTC>CTG	p.L318L	TRIB1_uc011lis.1_Silent_p.L152L|TRIB1_uc010mdn.2_Silent_p.L87L	NM_025195	NP_079471	Q96RU8	TRIB1_HUMAN	G-protein-coupled receptor induced protein	318	Protein kinase.				JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			TTCGCAGCCTCTTGAGACGGG	0.562													7	94	---	---	---	---	PASS
MYC	4609	broad.mit.edu	37	8	128750661	128750661	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128750661G>A	uc003ysh.1	+	3	666	c.153G>A	c.(151-153)AAG>AAA	p.K51K	MYC_uc003ysi.2_Silent_p.K66K	NM_002467	NP_002458	P01106	MYC_HUMAN	myc proto-oncogene protein	51					branching involved in ureteric bud morphogenesis|cell cycle arrest|cell proliferation|cellular iron ion homeostasis|positive regulation of metanephric cap mesenchymal cell proliferation|positive regulation of transcription, DNA-dependent|regulation of telomere maintenance|regulation of transcription from RNA polymerase II promoter|response to drug	nucleolus|nucleoplasm	E-box binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(3)|ovary(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)		ATATCTGGAAGAAATTCGAGC	0.657		3	A|T	IGK@|BCL5|BCL7A |BTG1|TRA@|IGH@	Burkitt lymphoma| amplified in other cancers|B-CLL						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	36	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141774419	141774419	+	Intron	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141774419G>T	uc003yvu.2	-						PTK2_uc003yvo.2_Missense_Mutation_p.S11Y|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TATGTTGAAAGAGGTTAAACA	0.338													9	49	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141856744	141856744	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141856744G>C	uc003yvu.2	-	6	714	c.484C>G	c.(484-486)CAA>GAA	p.Q162E	PTK2_uc003yvq.2_5'Flank|PTK2_uc003yvr.2_Missense_Mutation_p.Q61E|PTK2_uc003yvs.2_Missense_Mutation_p.Q162E|PTK2_uc003yvt.2_Missense_Mutation_p.Q184E|PTK2_uc003yvv.2_Missense_Mutation_p.Q49E|PTK2_uc011ljr.1_Missense_Mutation_p.Q162E	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	162	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			TGGTCCACTTGATCAGCTATC	0.299													4	46	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144943483	144943483	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144943483C>G	uc003zaa.1	-	1	3952	c.3939G>C	c.(3937-3939)CTG>CTC	p.L1313L		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1313	Plectin 22.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCTGCTCACTCAGCTCCCTGC	0.652													21	74	---	---	---	---	PASS
BOP1	23246	broad.mit.edu	37	8	145512853	145512853	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145512853C>T	uc003zbr.1	-	2	300	c.232G>A	c.(232-234)GAC>AAC	p.D78N	HSF1_uc003zbt.3_5'Flank|HSF1_uc003zbu.3_5'Flank	NM_015201	NP_056016	Q14137	BOP1_HUMAN	block of proliferation 1	78					cell proliferation|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	nucleoplasm|PeBoW complex	protein binding				0	all_cancers(97;4.06e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;2.61e-39)|all cancers(56;1.37e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.087)			CCCTCCTCGTCGCCTTCGTCA	0.612													9	50	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	422095	422095	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:422095G>C	uc003zgf.2	+	33	4313	c.4201G>C	c.(4201-4203)GAG>CAG	p.E1401Q	DOCK8_uc010mgu.2_Missense_Mutation_p.E703Q|DOCK8_uc010mgv.2_Missense_Mutation_p.E1301Q|DOCK8_uc003zgk.2_Missense_Mutation_p.E859Q	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1401	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ATGGAAGAAAGAGCAGACACA	0.413													3	38	---	---	---	---	PASS
RPS6	6194	broad.mit.edu	37	9	19376290	19376290	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19376290C>G	uc003znv.1	-	6					RPS6_uc003znu.1_3'UTR	NM_001010	NP_001001	P62753	RS6_HUMAN	ribosomal protein S6						endocrine pancreas development|glucose homeostasis|insulin receptor signaling pathway|positive regulation of apoptosis|rRNA processing|TOR signaling cascade|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding			ovary(1)	1		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CTCAAAAAATCTTATTTCTGA	0.388													26	32	---	---	---	---	PASS
RPS6	6194	broad.mit.edu	37	9	19376351	19376351	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19376351C>G	uc003znv.1	-	6	732	c.690G>C	c.(688-690)AAG>AAC	p.K230N	RPS6_uc003znu.1_Missense_Mutation_p.K199N	NM_001010	NP_001001	P62753	RS6_HUMAN	ribosomal protein S6	230					endocrine pancreas development|glucose homeostasis|insulin receptor signaling pathway|positive regulation of apoptosis|rRNA processing|TOR signaling cascade|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	protein binding			ovary(1)	1		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		GTCTGCGTCTCTTCGCAATTT	0.408													23	53	---	---	---	---	PASS
ELAVL2	1993	broad.mit.edu	37	9	23731071	23731071	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23731071C>G	uc003zpu.2	-	3	557	c.282G>C	c.(280-282)GAG>GAC	p.E94D	ELAVL2_uc003zps.2_Missense_Mutation_p.E94D|ELAVL2_uc003zpt.2_Missense_Mutation_p.E94D|ELAVL2_uc003zpv.2_Missense_Mutation_p.E94D|ELAVL2_uc003zpw.2_Missense_Mutation_p.E94D	NM_004432	NP_004423	Q12926	ELAV2_HUMAN	ELAV (embryonic lethal, abnormal vision,	94	RRM 1.				regulation of transcription, DNA-dependent		mRNA 3'-UTR binding|nucleotide binding|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TGATAGCTTTCTCTGCATCCT	0.358													6	16	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32543021	32543021	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32543021G>A	uc003zrb.2	-	3	1669	c.1502C>T	c.(1501-1503)TCT>TTT	p.S501F	TOPORS_uc003zrc.2_Missense_Mutation_p.S434F	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	501	Interaction with p53/TP53.|Required for sumoylation and localization to discrete nuclear foci.|Interaction with SUMO1.|Interaction with TOP1.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TAAGTCCTCAGAATCAGAGGA	0.403													32	41	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32544192	32544192	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32544192C>G	uc003zrb.2	-	3	498	c.331G>C	c.(331-333)GAT>CAT	p.D111H	TOPORS_uc003zrc.2_Missense_Mutation_p.D44H	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	111	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.|RING-type.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GACACATTATCAAATCTATCC	0.413													14	61	---	---	---	---	PASS
GRHPR	9380	broad.mit.edu	37	9	37429803	37429803	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37429803G>C	uc003zzu.1	+	6	609	c.568G>C	c.(568-570)GAG>CAG	p.E190Q	GRHPR_uc010mlv.1_Missense_Mutation_p.E110Q|GRHPR_uc003zzt.1_Missense_Mutation_p.E110Q|GRHPR_uc003zzv.1_Missense_Mutation_p.E47Q|GRHPR_uc003zzw.1_Missense_Mutation_p.E47Q	NM_012203	NP_036335	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	190					cellular nitrogen compound metabolic process|excretion|glyoxylate metabolic process	peroxisomal matrix	glycerate dehydrogenase activity|glyoxylate reductase (NADP) activity|hydroxypyruvate reductase activity|NAD binding|protein binding				0				GBM - Glioblastoma multiforme(29;0.00687)		GCCCAGGCCTGAGGAAGCAGC	0.537													5	22	---	---	---	---	PASS
TMEM2	23670	broad.mit.edu	37	9	74319522	74319522	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74319522G>C	uc011lsa.1	-	18	3723	c.3183C>G	c.(3181-3183)GTC>GTG	p.V1061V	TMEM2_uc011lrz.1_Silent_p.V54V|TMEM2_uc010mos.2_Silent_p.V998V|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	1061						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TGTTGAAGTTGACGAGGTATA	0.433													27	38	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532425	84532425	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532425G>A	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						GTCTAACTCTGAGAGAGACCT	0.468													7	49	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94486310	94486310	+	Silent	SNP	G	A	A	rs146432734		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94486310G>A	uc004arj.1	-	9	2665	c.2466C>T	c.(2464-2466)AAC>AAT	p.N822N	ROR2_uc004ari.1_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	822	Cytoplasmic (Potential).|Pro-rich.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GCTGGTAGCCGTTGACGGGGA	0.662													38	32	---	---	---	---	PASS
SPTLC1	10558	broad.mit.edu	37	9	94809522	94809522	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94809522G>T	uc004arl.1	-	11	1051	c.1013C>A	c.(1012-1014)TCA>TAA	p.S338*	SPTLC1_uc011ltv.1_Nonsense_Mutation_p.S338*	NM_006415	NP_006406	O15269	SPTC1_HUMAN	serine palmitoyltransferase subunit 1 isoform a	338	Cytoplasmic (Potential).					integral to membrane|SPOTS complex	protein binding|pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			ovary(1)|breast(1)	2					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	TAACGAAGCTGAAAAGCAGTA	0.438													9	48	---	---	---	---	PASS
KIAA1529	57653	broad.mit.edu	37	9	100079488	100079488	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100079488G>T	uc011lut.1	+	21	2259	c.1486G>T	c.(1486-1488)GAG>TAG	p.E496*	KIAA1529_uc004axe.1_Nonsense_Mutation_p.E496*|KIAA1529_uc004axg.1_Nonsense_Mutation_p.E357*|KIAA1529_uc011lus.1_Nonsense_Mutation_p.E314*|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Nonsense_Mutation_p.E357*|KIAA1529_uc011luv.1_Nonsense_Mutation_p.E354*	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				TCTCAAGAAGGAGGCCCTGCT	0.632													4	29	---	---	---	---	PASS
ZFP37	7539	broad.mit.edu	37	9	115805729	115805729	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115805729G>C	uc004bgm.1	-	4	1197	c.1169C>G	c.(1168-1170)TCA>TGA	p.S390*	ZFP37_uc011lwz.1_Nonsense_Mutation_p.S405*|ZFP37_uc011lxa.1_Nonsense_Mutation_p.S391*	NM_003408	NP_003399	Q9Y6Q3	ZFP37_HUMAN	zinc finger protein 37 homolog	390	C2H2-type 4.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AATAAGGTTTGAGCTGTGTCT	0.413													16	84	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119770438	119770438	+	Silent	SNP	T	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119770438T>G	uc004bjs.1	-	7	1625	c.1524A>C	c.(1522-1524)CCA>CCC	p.P508P	ASTN2_uc004bjr.1_Silent_p.P508P|ASTN2_uc004bjt.1_Silent_p.P457P	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	508	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CCCTCACCCATGGGGAGGTGG	0.577													3	55	---	---	---	---	PASS
GARNL3	84253	broad.mit.edu	37	9	130111209	130111209	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130111209G>A	uc011mae.1	+	17	1839	c.1438G>A	c.(1438-1440)GAG>AAG	p.E480K	GARNL3_uc011mad.1_Missense_Mutation_p.E458K	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	480					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ACAGCCGTGGGAGCCCCAGTG	0.517													5	27	---	---	---	---	PASS
SH2D3C	10044	broad.mit.edu	37	9	130536540	130536540	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130536540G>A	uc004bsc.2	-	2	386	c.244C>T	c.(244-246)CGC>TGC	p.R82C	SH2D3C_uc004bsa.2_5'Flank|SH2D3C_uc004bsb.2_5'Flank|SH2D3C_uc004bsd.1_Missense_Mutation_p.R26C	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	82					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						ATGCTGGGGCGAGGCATGGTG	0.637													16	29	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134003045	134003045	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134003045G>T	uc004cag.2	+	2	291	c.180G>T	c.(178-180)CAG>CAT	p.Q60H	NUP214_uc004cah.2_Missense_Mutation_p.Q60H|NUP214_uc004caf.1_Missense_Mutation_p.Q60H	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	60					carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		GTGGCTTGCAGATTTTTCCTA	0.448			T	DEK|SET|ABL1	AML|T-ALL								19	83	---	---	---	---	PASS
UCK1	83549	broad.mit.edu	37	9	134400393	134400393	+	3'UTR	SNP	G	A	A	rs138572120	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134400393G>A	uc004cay.2	-	7					UCK1_uc010mzk.2_3'UTR|UCK1_uc004cba.2_3'UTR|UCK1_uc004caz.2_RNA	NM_031432	NP_113620	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1 isoform a						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		CACACATGCCGGGCGGGAGAC	0.662													10	7	---	---	---	---	PASS
NACC2	138151	broad.mit.edu	37	9	138903719	138903719	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138903719G>A	uc004cgw.2	-	6	1563	c.1407C>T	c.(1405-1407)GTC>GTT	p.V469V	NACC2_uc010nbh.2_Silent_p.V108V|uc004cgv.3_5'Flank	NM_144653	NP_653254	Q96BF6	NACC2_HUMAN	BTB (POZ) domain containing 14A	469					negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0						CGGAGCCCATGACCGTGCGGT	0.711													5	2	---	---	---	---	PASS
SEC16A	9919	broad.mit.edu	37	9	139371368	139371368	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139371368C>A	uc004chx.2	-	3	1009	c.700G>T	c.(700-702)GAA>TAA	p.E234*	SEC16A_uc004chv.3_5'Flank|SEC16A_uc004chw.2_Nonsense_Mutation_p.E234*|SEC16A_uc010nbn.2_Nonsense_Mutation_p.E234*|SEC16A_uc010nbo.1_Nonsense_Mutation_p.E234*	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	56					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		ACAGGTCCTTCAGGGCAGGGT	0.652													11	28	---	---	---	---	PASS
PHPT1	29085	broad.mit.edu	37	9	139743859	139743859	+	5'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139743859G>C	uc004cjp.2	+	2					PHPT1_uc011mei.1_5'UTR|PHPT1_uc004cjq.3_5'UTR|MAMDC4_uc004cjs.2_5'Flank|MAMDC4_uc011mej.1_5'Flank	NM_014172	NP_054891	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1 isoform 3							cytosol	phosphohistidine phosphatase activity|phosphoprotein phosphatase activity				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TCGGGTGGGAGGAGGGGACTC	0.662													17	27	---	---	---	---	PASS
ZMYND19	116225	broad.mit.edu	37	9	140477494	140477494	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140477494C>T	uc004cno.1	-	5	703	c.481G>A	c.(481-483)GAG>AAG	p.E161K		NM_138462	NP_612471	Q96E35	ZMY19_HUMAN	zinc finger, MYND domain containing 19	161	Poly-Glu.					Golgi apparatus|plasma membrane	zinc ion binding			skin(1)	1	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		CAAGAGTTCTCCTCCTCTTCC	0.527													27	126	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3205933	3205933	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3205933G>A	uc010qah.1	-	6	711	c.679C>T	c.(679-681)CAC>TAC	p.H227Y	PITRM1_uc001igr.1_Missense_Mutation_p.H259Y|PITRM1_uc001igt.1_Missense_Mutation_p.H259Y|PITRM1_uc001igu.1_Missense_Mutation_p.H251Y|PITRM1_uc010qai.1_Missense_Mutation_p.H230Y|PITRM1_uc001igw.1_Missense_Mutation_p.H259Y|uc001igx.1_5'Flank			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	227					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						TTGCTTGGGTGATAGTGAGTG	0.463													16	76	---	---	---	---	PASS
PITRM1	10531	broad.mit.edu	37	10	3205948	3205948	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3205948G>A	uc010qah.1	-	6	696	c.664C>T	c.(664-666)CAT>TAT	p.H222Y	PITRM1_uc001igr.1_Missense_Mutation_p.H254Y|PITRM1_uc001igt.1_Missense_Mutation_p.H254Y|PITRM1_uc001igu.1_Missense_Mutation_p.H246Y|PITRM1_uc010qai.1_Missense_Mutation_p.H225Y|PITRM1_uc001igw.1_Missense_Mutation_p.H254Y|uc001igx.1_5'Flank			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;	222					proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						TGAGTGGCATGAAACTGCTTA	0.458													15	72	---	---	---	---	PASS
PFKFB3	5209	broad.mit.edu	37	10	6274988	6274988	+	3'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6274988G>C	uc001ije.2	+	15					PFKFB3_uc001ijd.2_3'UTR|PFKFB3_uc009xii.2_RNA|PFKFB3_uc010qaw.1_3'UTR|PFKFB3_uc001ijf.2_3'UTR|PFKFB3_uc001ijg.2_RNA|PFKFB3_uc009xij.2_RNA|PFKFB3_uc009xik.2_RNA|PFKFB3_uc009xil.2_RNA	NM_004566	NP_004557	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						AACGTATCCTGAGGACTTCTT	0.602													9	49	---	---	---	---	PASS
MRC1	4360	broad.mit.edu	37	10	17949694	17949694	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17949694A>G	uc001ipk.2	+	28	4161	c.4058A>G	c.(4057-4059)TAT>TGT	p.Y1353C		NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor	1353	Extracellular (Potential).|C-type lectin 8.				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						TACAAAGGATATATTTGTAAA	0.378													28	121	---	---	---	---	PASS
SVIL	6840	broad.mit.edu	37	10	29820209	29820209	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29820209G>C	uc001iut.1	-	10	2771	c.2018C>G	c.(2017-2019)TCA>TGA	p.S673*	SVIL_uc001iuu.1_Nonsense_Mutation_p.S279*	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	673					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TTCTGAATGTGAAGTGCACCT	0.333													11	51	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37430971	37430971	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37430971G>T	uc001iza.1	+	7	1077	c.978G>T	c.(976-978)AAG>AAT	p.K326N		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	382						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GACCTAGGAAGATCGCATGGG	0.433													6	81	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43297618	43297618	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43297618G>A	uc001jaj.2	+	13	2639	c.2281G>A	c.(2281-2283)GGA>AGA	p.G761R		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	761					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						CTTCGTGACTGGAAAGTGGGA	0.413													5	36	---	---	---	---	PASS
MAPK8	5599	broad.mit.edu	37	10	49632597	49632597	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49632597C>T	uc009xnz.2	+	7	881	c.657C>T	c.(655-657)ATC>ATT	p.I219I	MAPK8_uc001jgl.2_Silent_p.I219I|MAPK8_uc001jgm.2_Silent_p.I219I|MAPK8_uc001jgo.2_Silent_p.I219I|MAPK8_uc009xoa.2_Intron|MAPK8_uc001jgn.2_Silent_p.I219I|MAPK8_uc010qgk.1_Silent_p.I219I|MAPK8_uc001jgp.2_Intron|MAPK8_uc001jgq.2_Intron	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	219	Protein kinase.				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		GAGAAATGATCAAAGGTGGTG	0.338													6	66	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	52390060	52390060	+	RNA	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52390060G>C	uc001jjf.1	+	2		c.753G>C								Homo sapiens cDNA FLJ12320 fis, clone MAMMA1002082.																		ATGATATCATGAACATTAGTC	0.428													4	23	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72489913	72489913	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72489913G>A	uc001jrh.2	+	6	1010	c.1010G>A	c.(1009-1011)CGC>CAC	p.R337H	ADAMTS14_uc001jrg.2_Missense_Mutation_p.R337H	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	337	Peptidase M12B.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CAGGTGTGTCGCTGGGCACAC	0.652													9	49	---	---	---	---	PASS
PPP3CB	5532	broad.mit.edu	37	10	75214185	75214185	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75214185C>T	uc001jue.2	-	10	1306	c.1171G>A	c.(1171-1173)GAA>AAA	p.E391K	PPP3CB_uc001juf.2_Missense_Mutation_p.E391K|PPP3CB_uc001jug.2_Missense_Mutation_p.E391K|PPP3CB_uc001jui.2_Missense_Mutation_p.E409K|PPP3CB_uc001juh.2_Missense_Mutation_p.E305K|PPP3CB_uc010qkj.1_Missense_Mutation_p.E19K	NM_021132	NP_066955	P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta	391										skin(1)	1	Prostate(51;0.0119)					AACTGGTCTTCACCTTCAGTC	0.328													11	55	---	---	---	---	PASS
LOC650623	650623	broad.mit.edu	37	10	81443781	81443781	+	RNA	SNP	A	T	T	rs143569743	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81443781A>T	uc010qlu.1	+	1		c.1051A>T				NR_027512				Homo sapiens BEN domain containing 3 pseudogene (LOC650623), non-coding RNA.												0						GACCACAAAGACGAGGAGGAG	0.622													3	15	---	---	---	---	PASS
SFTPD	6441	broad.mit.edu	37	10	81701777	81701777	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81701777G>A	uc001kbh.2	-	5	526	c.483C>T	c.(481-483)CTC>CTT	p.L161L	MBL1P_uc001kbf.2_Intron	NM_003019	NP_003010	P35247	SFTPD_HUMAN	pulmonary surfactant-associated protein D	161	Collagen-like.				cell junction assembly|innate immune response|lung alveolus development|macrophage chemotaxis|negative regulation of interleukin-2 biosynthetic process|negative regulation of T cell proliferation|positive regulation of phagocytosis|reactive oxygen species metabolic process|receptor-mediated endocytosis|respiratory gaseous exchange|surfactant homeostasis	collagen|endocytic vesicle|extracellular space|lysosome	bacterial cell surface binding|protein binding|sugar binding			skin(1)	1	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TAGGGCCTGCGAGGCCTCTTG	0.622													20	79	---	---	---	---	PASS
HIF1AN	55662	broad.mit.edu	37	10	102304781	102304781	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102304781C>G	uc001krj.3	+	4	726	c.651C>G	c.(649-651)ATC>ATG	p.I217M		NM_017902	NP_060372	Q9NWT6	HIF1N_HUMAN	hypoxia-inducible factor 1, alpha subunit	217	JmjC.|Interaction with HIF1A.|Interaction with VHL.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|protein binding				0		Colorectal(252;0.234)		Epithelial(162;6.75e-10)|all cancers(201;4.88e-08)		AACGATGCATCTTATTCCCTC	0.453													3	91	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104119055	104119055	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104119055C>T	uc001kux.1	+	11	1280	c.1040C>T	c.(1039-1041)TCA>TTA	p.S347L	GBF1_uc001kuw.2_3'UTR|GBF1_uc001kuy.1_Missense_Mutation_p.S347L|GBF1_uc001kuz.1_Missense_Mutation_p.S348L	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	347					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		AAGTCCCAGTCAGCATCTGTG	0.537													20	40	---	---	---	---	PASS
XPNPEP1	7511	broad.mit.edu	37	10	111640657	111640657	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111640657G>A	uc001kyp.1	-	11	1085	c.945C>T	c.(943-945)ATC>ATT	p.I315I	XPNPEP1_uc009xxt.1_Silent_p.I358I|XPNPEP1_uc001kyq.1_Silent_p.I244I|XPNPEP1_uc010qrb.1_Silent_p.I358I|XPNPEP1_uc010qra.1_Silent_p.I82I	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	315					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TGGCGATGCAGATGGGGGTGT	0.567													4	19	---	---	---	---	PASS
ZDHHC6	64429	broad.mit.edu	37	10	114205095	114205095	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114205095A>T	uc001kzv.2	-	2	524	c.100T>A	c.(100-102)TGT>AGT	p.C34S	VTI1A_uc001kzy.2_5'Flank|VTI1A_uc001kzz.2_5'Flank|ZDHHC6_uc001kzw.2_Missense_Mutation_p.C34S|ZDHHC6_uc009xya.1_Missense_Mutation_p.C34S|VTI1A_uc001kzx.2_5'Flank	NM_022494	NP_071939	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	34	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding				0		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		ATGGTAGAACATATTGCTATA	0.398													11	32	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115947866	115947866	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115947866C>T	uc001lbg.1	+	2	429	c.276C>T	c.(274-276)ATC>ATT	p.I92I	TDRD1_uc001lbf.2_Silent_p.I83I|TDRD1_uc001lbh.1_Silent_p.I83I|TDRD1_uc001lbi.1_Silent_p.I83I	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	92					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		CGAATGGCATCAACGGAGAAG	0.398													13	51	---	---	---	---	PASS
ABLIM1	3983	broad.mit.edu	37	10	116361688	116361688	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116361688C>G	uc010qsg.1	-	2	376	c.277G>C	c.(277-279)GAG>CAG	p.E93Q	ABLIM1_uc010qsh.1_Missense_Mutation_p.E33Q|ABLIM1_uc010qsi.1_Missense_Mutation_p.E33Q|ABLIM1_uc010qsk.1_Missense_Mutation_p.E17Q|ABLIM1_uc009xyp.2_Missense_Mutation_p.E27Q|ABLIM1_uc001lbz.1_Missense_Mutation_p.E16Q	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a	93					axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		ACAGGCTTCTCTGATGGGTGG	0.493													5	39	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126631257	126631257	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126631257G>C	uc001lic.2	+	1	566	c.195G>C	c.(193-195)TTG>TTC	p.L65F	ZRANB1_uc010qug.1_Missense_Mutation_p.L91F	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	65					positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		GTAGTCCTTTGATATGTCCAG	0.413													35	69	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134013904	134013904	+	Missense_Mutation	SNP	G	C	C	rs145582956		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134013904G>C	uc009ybb.2	+	9	1010	c.856G>C	c.(856-858)GAC>CAC	p.D286H		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	286					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides	p.D286D(2)		central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CCTGGGCACCGACGGTTCACA	0.677													10	51	---	---	---	---	PASS
PDDC1	347862	broad.mit.edu	37	11	771391	771391	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:771391G>A	uc001lrc.2	-	6	511	c.486C>T	c.(484-486)TTC>TTT	p.F162F	PDDC1_uc010qwm.1_Silent_p.F112F|PDDC1_uc001lrd.2_Silent_p.F162F|PDDC1_uc001lrf.1_Missense_Mutation_p.S140L|PDDC1_uc001lrg.1_RNA|PDDC1_uc009ycg.2_Silent_p.F112F|PDDC1_uc010qwn.1_RNA|PDDC1_uc010qwo.1_RNA|PDDC1_uc010qwp.1_Silent_p.F126F|PDDC1_uc010qwq.1_Silent_p.F76F|PDDC1_uc010qwr.1_Silent_p.F162F|PDDC1_uc010qws.1_Silent_p.F112F	NM_182612	NP_872418	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1	162						extracellular region					0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGGCGGGCGAAGCCGGGGG	0.701													9	13	---	---	---	---	PASS
OR51D1	390038	broad.mit.edu	37	11	4661760	4661760	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4661760C>T	uc010qyk.1	+	1	740	c.740C>T	c.(739-741)GCA>GTA	p.A247V		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	247	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGAGGGCAGCACTCAAGGCT	0.537													9	73	---	---	---	---	PASS
NLRP10	338322	broad.mit.edu	37	11	7982182	7982182	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7982182G>A	uc001mfv.1	-	2	994	c.977C>T	c.(976-978)TCC>TTC	p.S326F		NM_176821	NP_789791	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	326	NACHT.						ATP binding			lung(4)|ovary(2)|pancreas(1)|kidney(1)|skin(1)	9				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGTGAAATAGGAGCTGAAGTA	0.517													22	55	---	---	---	---	PASS
ST5	6764	broad.mit.edu	37	11	8715632	8715632	+	3'UTR	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8715632G>C	uc001mgt.2	-	20					ST5_uc009yfr.2_3'UTR|ST5_uc001mgu.2_3'UTR|ST5_uc001mgv.2_3'UTR|ST5_uc010rbp.1_3'UTR	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CTCTGCTACTGAGAAGGAGGC	0.547													5	37	---	---	---	---	PASS
TMEM41B	440026	broad.mit.edu	37	11	9304976	9304976	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9304976C>G	uc001mhm.2	-	7	1179	c.871G>C	c.(871-873)GAG>CAG	p.E291Q	TMEM41B_uc001mhn.1_Missense_Mutation_p.E291Q	NM_015012	NP_055827	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B isoform 1	291						integral to membrane					0				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		TATTTTTACTCAAATTTCTGC	0.333													2	16	---	---	---	---	PASS
TMEM41B	440026	broad.mit.edu	37	11	9308127	9308127	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9308127C>G	uc001mhm.2	-	6	889	c.581G>C	c.(580-582)AGA>ACA	p.R194T	TMEM41B_uc001mhn.1_Missense_Mutation_p.R194T	NM_015012	NP_055827	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B isoform 1	194						integral to membrane					0				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		GAGATGTTCTCTATGACGTTC	0.303													25	127	---	---	---	---	PASS
IPO7	10527	broad.mit.edu	37	11	9450660	9450660	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9450660G>A	uc001mho.2	+	14	1650	c.1508G>A	c.(1507-1509)AGA>AAA	p.R503K		NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7	503					interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CTAACAAGAAGATGTCTGATT	0.373													19	63	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10820632	10820632	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820632G>C	uc001mjc.2	-	21	2982	c.2565C>G	c.(2563-2565)TTC>TTG	p.F855L	EIF4G2_uc001mjb.2_Missense_Mutation_p.F649L|EIF4G2_uc009ygf.2_Missense_Mutation_p.F649L|EIF4G2_uc001mjd.2_Missense_Mutation_p.F817L	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	855	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CCATGTCATAGAAGTGCACAA	0.343													20	57	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10820954	10820954	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820954G>A	uc001mjc.2	-	20	2759	c.2342C>T	c.(2341-2343)TCT>TTT	p.S781F	EIF4G2_uc001mjb.2_Missense_Mutation_p.S575F|EIF4G2_uc009ygf.2_Missense_Mutation_p.S575F|EIF4G2_uc001mjd.2_Missense_Mutation_p.S743F	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	781	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TACTTCACTAGAAATGTACTG	0.423													12	32	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10821742	10821742	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10821742G>T	uc001mjc.2	-	18	2431	c.2014C>A	c.(2014-2016)CCT>ACT	p.P672T	EIF4G2_uc001mjb.2_Missense_Mutation_p.P466T|EIF4G2_uc009ygf.2_Missense_Mutation_p.P466T|EIF4G2_uc001mjd.2_Missense_Mutation_p.P634T	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	672					cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AGGAAGAGAGGAAAATGGGTG	0.408													15	40	---	---	---	---	PASS
EIF4G2	1982	broad.mit.edu	37	11	10825066	10825066	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10825066C>T	uc001mjc.2	-	9	1191	c.774G>A	c.(772-774)ATG>ATA	p.M258I	EIF4G2_uc001mjb.2_Missense_Mutation_p.M52I|EIF4G2_uc009ygf.2_Missense_Mutation_p.M52I|EIF4G2_uc001mjd.2_Missense_Mutation_p.M258I|EIF4G2_uc001mjf.1_Missense_Mutation_p.M52I|SNORD97_uc009yge.2_5'Flank	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	258	MIF4G.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CCACTGTCCTCATTATCTGAC	0.403													10	56	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12283985	12283985	+	Intron	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12283985C>G	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron|MICAL2_uc001mkb.2_3'UTR|MICAL2_uc001mkc.2_3'UTR|MICAL2_uc001mkd.2_3'UTR|MICAL2_uc010rcj.1_3'UTR|MICAL2_uc001mkf.2_Intron	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		GCTCTCTTTTCTATCTTTCTC	0.448													22	45	---	---	---	---	PASS
PLEKHA7	144100	broad.mit.edu	37	11	16812671	16812671	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16812671G>A	uc001mmo.2	-	20	2836	c.2821C>T	c.(2821-2823)CTG>TTG	p.L941L	PLEKHA7_uc010rcu.1_Silent_p.L942L|PLEKHA7_uc001mmm.2_Silent_p.L44L|PLEKHA7_uc010rcv.1_Silent_p.L516L|PLEKHA7_uc001mmn.2_Silent_p.L650L	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	941	Pro-rich.				epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						TCTCTTGGCAGAGGCGGCACA	0.637													7	29	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20676504	20676504	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20676504C>T	uc001mqd.2	+	16					SLC6A5_uc009yic.2_3'UTR	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter						synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	CATTTTTCTTCATCTTTCTTC	0.453													6	34	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28045346	28045346	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28045346T>A	uc001msc.2	-	16	2738	c.2556A>T	c.(2554-2556)AAA>AAT	p.K852N		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	852					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GTCGAACACGTTTGGCAAATC	0.323													6	44	---	---	---	---	PASS
CAT	847	broad.mit.edu	37	11	34470812	34470812	+	Missense_Mutation	SNP	G	A	A	rs148918137	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34470812G>A	uc001mvm.2	+	2	223	c.140G>A	c.(139-141)CGT>CAT	p.R47H	CAT_uc009ykc.1_RNA	NM_001752	NP_001743	P04040	CATA_HUMAN	catalase	47					hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GTAGGGCCCCGTGGGCCCCTT	0.473													17	72	---	---	---	---	PASS
PSMC3	5702	broad.mit.edu	37	11	47446777	47446777	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47446777C>G	uc001nfh.2	-	3	374	c.180G>C	c.(178-180)TTG>TTC	p.L60F	PSMC3_uc009ylr.1_Intron	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3	60					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGGTGACTCTCAACACTTCAC	0.473													15	89	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48134415	48134415	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48134415C>G	uc001ngp.3	+	3	587	c.232C>G	c.(232-234)CAG>GAG	p.Q78E	PTPRJ_uc001ngo.3_Missense_Mutation_p.Q78E	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	78	Extracellular (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						TGGAACACCTCAGGTGGAAAC	0.468													19	44	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49229913	49229913	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49229913G>A	uc001ngy.2	-	1	310	c.49C>T	c.(49-51)CGC>TGC	p.R17C	FOLH1_uc001ngz.2_Missense_Mutation_p.R17C|FOLH1_uc009yly.2_5'UTR|FOLH1_uc009ylz.2_5'UTR|FOLH1_uc009yma.2_5'UTR|FOLH1_uc001nha.2_5'UTR	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	17	Cytoplasmic (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	CAGCGCGGGCGGCGCGCGGTG	0.711													3	7	---	---	---	---	PASS
LOC646813	646813	broad.mit.edu	37	11	50379363	50379363	+	RNA	SNP	G	A	A	rs117448715	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50379363G>A	uc001nhe.2	+	6		c.846G>A			LOC646813_uc001nhf.1_RNA|LOC646813_uc001nhg.1_RNA|LOC646813_uc001nhh.1_RNA|LOC646813_uc010rib.1_RNA	NR_024504				Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit09-11-09-R.												0						AAACAAGGTTGAGCAGGTCTC	0.368													4	26	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56344784	56344784	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56344784C>G	uc001niz.1	-	1	414	c.414G>C	c.(412-414)AAG>AAC	p.K138N		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGCAAATGTTCTTGGACATCC	0.468													4	91	---	---	---	---	PASS
YPEL4	219539	broad.mit.edu	37	11	57413388	57413388	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57413388G>A	uc001nkv.3	-	5					uc001nkt.1_Intron|YPEL4_uc009ymk.2_RNA	NM_145008	NP_659445	Q96NS1	YPEL4_HUMAN	yippee-like 4							nucleolus					0						TGCTGGTATAGACTGCTTGGC	0.622													5	20	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886441	57886441	+	Missense_Mutation	SNP	C	T	T	rs139300657	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886441C>T	uc001nml.1	-	1	476	c.476G>A	c.(475-477)CGT>CAT	p.R159H	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	159	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				GCAAGTGGTACGCAGGATGGC	0.542													7	53	---	---	---	---	PASS
OR1S2	219958	broad.mit.edu	37	11	57970695	57970695	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57970695C>G	uc010rkb.1	-	1	959	c.959G>C	c.(958-960)AGA>ACA	p.R320T		NM_001004459	NP_001004459	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S,	320	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				AGAAATTTTTCTATTGATGAG	0.428													10	97	---	---	---	---	PASS
CCDC86	79080	broad.mit.edu	37	11	60617418	60617418	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60617418G>T	uc001nqa.2	+	3	1063	c.894G>T	c.(892-894)AAG>AAT	p.K298N	CCDC86_uc001nqb.2_Missense_Mutation_p.K42N	NM_024098	NP_077003	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	298	Potential.				interspecies interaction between organisms	nucleus					0						TCCAGGAGAAGAAACAGCGCC	0.607													5	18	---	---	---	---	PASS
FADS1	3992	broad.mit.edu	37	11	61580081	61580081	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61580081C>T	uc010rlm.1	-	3	674	c.546G>A	c.(544-546)ATG>ATA	p.M182I	FADS1_uc001nsh.2_Missense_Mutation_p.M41I|FADS1_uc010rln.1_Missense_Mutation_p.M41I	NM_013402	NP_037534	O60427	FADS1_HUMAN	fatty acid desaturase 1	125	Helical; (Potential).				cell-cell signaling|cellular response to starvation|electron transport chain|icosanoid biosynthetic process|phospholipid biosynthetic process|regulation of cell differentiation|regulation of transcription, DNA-dependent|transport	endoplasmic reticulum membrane|integral to membrane|microsome	C-5 sterol desaturase activity|heme binding|protein binding			central_nervous_system(1)	1					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GGTTGGCCTTCATGAGCCCCA	0.552													6	23	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62296060	62296060	+	Silent	SNP	C	A	A	rs601430		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62296060C>A	uc001ntl.2	-	5	6129	c.5829G>T	c.(5827-5829)TCG>TCT	p.S1943S	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1943					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATTTTGGCACCGACACATCCA	0.512													5	275	---	---	---	---	PASS
C11orf48	79081	broad.mit.edu	37	11	62437250	62437250	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62437250G>C	uc001nue.2	-	3	611	c.176C>G	c.(175-177)CCG>CGG	p.P59R	C11orf48_uc001nuf.2_Missense_Mutation_p.P59R|C11orf48_uc010rmd.1_Missense_Mutation_p.P59R|C11orf83_uc001nui.3_5'Flank	NM_024099	NP_077004	Q9BQE6	CK048_HUMAN	hypothetical protein LOC79081	85											0						CACAATAGACGGCAGATGGGA	0.532													6	111	---	---	---	---	PASS
NXF1	10482	broad.mit.edu	37	11	62569095	62569095	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62569095C>G	uc001nvf.1	-	7	784	c.648G>C	c.(646-648)ATG>ATC	p.M216I	NXF1_uc001nvg.1_Missense_Mutation_p.M216I|NXF1_uc009yog.1_Missense_Mutation_p.M259I|NXF1_uc010rmh.1_Missense_Mutation_p.M79I	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	216	Interaction with THOC4.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						ATCGTTTGCTCATGATCAGCT	0.493													23	80	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63487538	63487538	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63487538G>A	uc001nxq.2	+	3	1751	c.1564G>A	c.(1564-1566)GAA>AAA	p.E522K	RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Missense_Mutation_p.E503K|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Missense_Mutation_p.E410K|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	522					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						AATTCAGGCTGAAAAACCTGT	0.368													3	32	---	---	---	---	PASS
KCNK4	50801	broad.mit.edu	37	11	64067068	64067068	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64067068C>G	uc001nzj.1	+	7	1375	c.1052C>G	c.(1051-1053)TCG>TGG	p.S351W	KCNK4_uc001nzk.1_Silent_p.L235L|KCNK4_uc010rnk.1_Missense_Mutation_p.S179W|KCNK4_uc001nzl.1_Silent_p.L235L|KCNK4_uc001nzm.3_RNA|KCNK4_uc001nzn.1_Missense_Mutation_p.S351W|KCNK4_uc001nzo.2_Missense_Mutation_p.S351W|KCNK4_uc001nzp.1_Missense_Mutation_p.S237W|C11orf20_uc009ypm.2_5'Flank	NM_033310	NP_201567	Q9NYG8	KCNK4_HUMAN	TRAAK	351	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						GACGAGTCCTCGGATACGCAG	0.652													11	32	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64669472	64669472	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64669472C>T	uc001obx.2	-	29	4196	c.4081G>A	c.(4081-4083)GAG>AAG	p.E1361K	ATG2A_uc001obw.2_Missense_Mutation_p.E126K	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1361							protein binding			ovary(1)|central_nervous_system(1)	2						ATGCAGAACTCATCACTGTCC	0.622													9	74	---	---	---	---	PASS
C11orf85	283129	broad.mit.edu	37	11	64708057	64708057	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64708057A>C	uc001ocb.1	-	8	609	c.535T>G	c.(535-537)TCC>GCC	p.S179A	C11orf85_uc001occ.1_RNA|C11orf85_uc001ocd.1_Missense_Mutation_p.V122G	NM_001037225	NP_001032302	Q3KP22	CK085_HUMAN	hypothetical protein LOC283129	179											0						TTGTTTCTGGACATCAGTGAT	0.408													17	78	---	---	---	---	PASS
FIBP	9158	broad.mit.edu	37	11	65651873	65651873	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65651873C>T	uc001ogd.2	-	9	1136	c.1015G>A	c.(1015-1017)GAT>AAT	p.D339N	FIBP_uc009yqu.2_Missense_Mutation_p.R324Q|FIBP_uc001oge.2_Missense_Mutation_p.D332N	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a	339					fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		CGGAAGCCATCGAGGGAGTGG	0.627											OREG0021089	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	25	---	---	---	---	PASS
RBM4B	83759	broad.mit.edu	37	11	66436149	66436149	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66436149C>T	uc001oja.2	-	2	1695	c.1026G>A	c.(1024-1026)ATG>ATA	p.M342I	RBM4B_uc001ojb.2_Missense_Mutation_p.M342I	NM_031492	NP_113680	Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	342	Interaction with TNPO3 (By similarity).				circadian regulation of gene expression|entrainment of circadian clock by photoperiod|mRNA processing|RNA splicing	nucleolus	nucleotide binding|RNA binding|zinc ion binding				0						CATACCGGGCCATGTCATACA	0.517													12	32	---	---	---	---	PASS
ALDH3B2	222	broad.mit.edu	37	11	67431965	67431965	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67431965G>T	uc001omr.2	-	8	1214	c.775C>A	c.(775-777)CTG>ATG	p.L259M	ALDH3B2_uc001oms.2_Missense_Mutation_p.L259M|ALDH3B2_uc009ysa.1_Missense_Mutation_p.L259M	NM_000695	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3B2	259					alcohol metabolic process|cellular aldehyde metabolic process|lipid metabolic process		3-chloroallyl aldehyde dehydrogenase activity|aldehyde dehydrogenase			lung(1)|kidney(1)	2					NADH(DB00157)	ACGATGGGCAGGATGGGCCCG	0.652													14	67	---	---	---	---	PASS
CPT1A	1374	broad.mit.edu	37	11	68525189	68525189	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68525189G>A	uc001oog.3	-	19	2415	c.2245C>T	c.(2245-2247)CGC>TGC	p.R749C	CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform	749	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	CTTCCAAAGCGATGAGAATCC	0.398													8	74	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68703931	68703931	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68703931C>T	uc001ook.1	+	13	2085	c.1983C>T	c.(1981-1983)CAC>CAT	p.H661H	IGHMBP2_uc001ool.1_Silent_p.H285H|IGHMBP2_uc001oom.1_Silent_p.H239H	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	661	SS DNA-binding (By similarity).				cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GTTCCAGCCACGCTGCCACCA	0.597													18	72	---	---	---	---	PASS
CCND1	595	broad.mit.edu	37	11	69456203	69456203	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69456203C>T	uc001opa.2	+	1	331	c.122C>T	c.(121-123)TCG>TTG	p.S41L		NM_053056	NP_444284	P24385	CCND1_HUMAN	cyclin D1	41	Cyclin N-terminal.				cell division|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|mitotic cell cycle G1/S transition DNA damage checkpoint|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation|response to drug|response to UV-A|S phase of mitotic cell cycle	cyclin-dependent protein kinase holoenzyme complex|cytosol|membrane|nucleoplasm	protein kinase binding			ovary(1)|lung(1)	2	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	TGCGCGCCCTCGGTGTCCTAC	0.652			T	IGH@|FSTL3	CLL|B-ALL|breast					Multiple Myeloma(6;0.086)			15	63	---	---	---	---	PASS
NUMA1	4926	broad.mit.edu	37	11	71715792	71715792	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71715792C>T	uc001orl.1	-	24	6072	c.5900G>A	c.(5899-5901)CGA>CAA	p.R1967Q	IL18BP_uc009ysu.1_Intron|NUMA1_uc001orj.2_Missense_Mutation_p.R149Q|NUMA1_uc009ysw.1_Missense_Mutation_p.R1534Q|NUMA1_uc001ork.1_Missense_Mutation_p.R831Q|NUMA1_uc001orm.1_Missense_Mutation_p.R1953Q	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	1967					G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						CATGCTGGCTCGGCGCAGGGT	0.627			T	RARA	APL								17	27	---	---	---	---	PASS
P2RY2	5029	broad.mit.edu	37	11	72945966	72945966	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72945966C>T	uc001otj.2	+	3	1095	c.762C>T	c.(760-762)TTC>TTT	p.F254F	P2RY2_uc001otk.2_Silent_p.F254F|P2RY2_uc001otl.2_Silent_p.F254F	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	254	Helical; Name=6; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	TGGCTGTCTTCGCCCTCTGCT	0.652													4	42	---	---	---	---	PASS
P2RY2	5029	broad.mit.edu	37	11	72945972	72945972	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72945972C>G	uc001otj.2	+	3	1101	c.768C>G	c.(766-768)CTC>CTG	p.L256L	P2RY2_uc001otk.2_Silent_p.L256L|P2RY2_uc001otl.2_Silent_p.L256L	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	256	Helical; Name=6; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	TCTTCGCCCTCTGCTTCCTGC	0.647													3	44	---	---	---	---	PASS
PAAF1	80227	broad.mit.edu	37	11	73627688	73627688	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73627688G>A	uc001ouk.1	+	9	952	c.918G>A	c.(916-918)CTG>CTA	p.L306L	PAAF1_uc001oul.1_Silent_p.L289L|PAAF1_uc009ytx.1_RNA|PAAF1_uc001oum.1_Silent_p.L289L|PAAF1_uc001oun.1_5'Flank	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	306	WD 4.				interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					TTTATCAGCTGGATGTGAGGA	0.423													4	41	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85445395	85445395	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85445395G>A	uc010rth.1	-	6	1250	c.974C>T	c.(973-975)TCC>TTC	p.S325F	SYTL2_uc010rtg.1_Missense_Mutation_p.S326F|SYTL2_uc010rti.1_Missense_Mutation_p.S325F|SYTL2_uc010rtj.1_Missense_Mutation_p.S277F|SYTL2_uc001pbf.3_Missense_Mutation_p.S325F|SYTL2_uc010rtf.1_Missense_Mutation_p.S183F	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	325					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGGCTCCAGGGAGTTTGGGGA	0.448													23	83	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93778980	93778980	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93778980G>A	uc001pep.2	+	2	469	c.312G>A	c.(310-312)TTG>TTA	p.L104L		NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	104	Plastocyanin-like 1.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GCCCCATCTTGAGGGCCGAAG	0.468													10	22	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93844129	93844129	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93844129G>A	uc001pep.2	+	18	3263	c.3106G>A	c.(3106-3108)GAA>AAA	p.E1036K	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	1036	Extracellular (Potential).|Plastocyanin-like 6.				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCAAACCATTGAACTGTTTGC	0.438													9	14	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102584518	102584518	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102584518C>G	uc001phe.2	-	9	1360	c.1261G>C	c.(1261-1263)GAG>CAG	p.E421Q	MMP8_uc010rut.1_Nonstop_Mutation_p.*304Y|MMP8_uc010ruu.1_Missense_Mutation_p.E398Q	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	421	Hemopexin-like 3.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		ACTTTACTCTCTATTCCTGGA	0.313													14	71	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106849346	106849346	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106849346G>A	uc001pjg.1	-	3	876	c.486C>T	c.(484-486)CTC>CTT	p.L162L	GUCY1A2_uc010rvo.1_Silent_p.L162L|GUCY1A2_uc009yxn.1_Silent_p.L162L	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	162					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		TTAATATACCGAGTATATTAG	0.368													3	22	---	---	---	---	PASS
TTC12	54970	broad.mit.edu	37	11	113210177	113210177	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113210177G>C	uc001pnu.2	+	10	912	c.807G>C	c.(805-807)CTG>CTC	p.L269L	TTC12_uc001pnv.2_Silent_p.L275L|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_Silent_p.L119L	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	269							binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		TTGAGATCCTGACTGAAATGA	0.498													11	52	---	---	---	---	PASS
CLDN25	644672	broad.mit.edu	37	11	113650985	113650985	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113650985C>G	uc009yyw.1	+	1	468	c.468C>G	c.(466-468)ATC>ATG	p.I156M		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	156	Extracellular (Potential).					integral to membrane|tight junction	structural molecule activity				0						TCCCTGACATCATACCTCGGT	0.582													6	26	---	---	---	---	PASS
CLDN25	644672	broad.mit.edu	37	11	113651015	113651015	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113651015C>G	uc009yyw.1	+	1	498	c.498C>G	c.(496-498)CTC>CTG	p.L166L		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	166	Helical; (Potential).					integral to membrane|tight junction	structural molecule activity				0						GAGGTGCCCTCTACTTGGGCT	0.557													10	17	---	---	---	---	PASS
APOA5	116519	broad.mit.edu	37	11	116661323	116661323	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116661323C>G	uc001ppr.2	-	3	630	c.622G>C	c.(622-624)GAG>CAG	p.E208Q	ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Missense_Mutation_p.E208Q|APOA5_uc009yzf.2_Missense_Mutation_p.E208Q|APOA5_uc009yzg.2_Missense_Mutation_p.E234Q	NM_052968	NP_443200	Q6Q788	APOA5_HUMAN	apolipoprotein AV precursor	208					acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding				0	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		CGGTGCAGCTCCTGCACGTGG	0.706													9	14	---	---	---	---	PASS
UBE4A	9354	broad.mit.edu	37	11	118267074	118267074	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118267074G>C	uc001psw.2	+	20	3249	c.3120G>C	c.(3118-3120)CAG>CAC	p.Q1040H	UBE4A_uc001psv.2_Missense_Mutation_p.Q1047H	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	1040	U-box.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CCATGGACCAGATCCGGCCAA	0.418													6	60	---	---	---	---	PASS
UBE4A	9354	broad.mit.edu	37	11	118267125	118267125	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118267125G>C	uc001psw.2	+	20	3300	c.3171G>C	c.(3169-3171)GAG>GAC	p.E1057D	UBE4A_uc001psv.2_Missense_Mutation_p.E1064D	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	1057					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GGCTTGCAGAGAGGAAACAAC	0.438													7	48	---	---	---	---	PASS
MFRP	83552	broad.mit.edu	37	11	119212379	119212379	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119212379G>C	uc001pwj.2	-	13	1779	c.1619C>G	c.(1618-1620)TCT>TGT	p.S540C	MFRP_uc010rzf.1_RNA|MFRP_uc010rzg.1_Missense_Mutation_p.S422C	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CTGGCAGACAGAGCGGCAAGG	0.647													14	26	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123893845	123893845	+	Silent	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123893845C>A	uc010sad.1	+	1	126	c.126C>A	c.(124-126)CTC>CTA	p.L42L		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GGAACCTCCTCATCCTGCTGG	0.572													25	62	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909583	123909583	+	Silent	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909583G>T	uc001pzq.1	-	1	126	c.126C>A	c.(124-126)CTC>CTA	p.L42L		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CCAGCAGGATGAGGAGGTTCC	0.577													5	54	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	124012328	124012328	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124012328G>C	uc001pzu.2	+	16	2112	c.1903G>C	c.(1903-1905)GAC>CAC	p.D635H	VWA5A_uc001pzt.2_Missense_Mutation_p.D635H	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	635										upper_aerodigestive_tract(1)|ovary(1)	2						CTTACACTCTGACCGTCCTCC	0.463													25	47	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124179832	124179832	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124179832G>C	uc010sag.1	-	1	831	c.831C>G	c.(829-831)TTC>TTG	p.F277L		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	277	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		CCGTGGTGTAGAACACAGAGG	0.453													22	30	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130281576	130281576	+	Intron	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130281576T>C	uc001qgg.3	-						ADAMTS8_uc001qgf.2_5'UTR	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1						negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GCCAATGCCCTGGCTTCCTCA	0.408													3	10	---	---	---	---	PASS
ACAD8	27034	broad.mit.edu	37	11	134131719	134131719	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134131719G>A	uc001qhk.2	+	9	1088	c.1027G>A	c.(1027-1029)GAG>AAG	p.E343K	ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Missense_Mutation_p.E266K|ACAD8_uc001qhl.2_Missense_Mutation_p.E216K	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	343					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		TCTGCAGGAGGAGAGGAAGGA	0.567													14	27	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134244148	134244148	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134244148G>T	uc001qhp.2	+	17	1893	c.1705G>T	c.(1705-1707)GAG>TAG	p.E569*	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	569					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		TCTGAAGCTGGAGGTTGGTAA	0.567													6	86	---	---	---	---	PASS
SLC6A13	6540	broad.mit.edu	37	12	331745	331745	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:331745G>A	uc001qic.1	-	13	1521	c.1468C>T	c.(1468-1470)CCT>TCT	p.P490S	SLC6A13_uc009zdj.1_Missense_Mutation_p.P480S|SLC6A13_uc010sdl.1_Missense_Mutation_p.P398S	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	490	Helical; Name=11; (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TTGATAAGAGGCCATGGCCTG	0.478													9	11	---	---	---	---	PASS
FGF6	2251	broad.mit.edu	37	12	4554764	4554764	+	5'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4554764G>A	uc001qmr.1	-	1						NM_020996	NP_066276	P10767	FGF6_HUMAN	fibroblast growth factor 6 precursor						angiogenesis|cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	growth factor activity			lung(2)|ovary(1)	3			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CACGTGGTCAGAATTAATGGC	0.552													16	9	---	---	---	---	PASS
KCNA1	3736	broad.mit.edu	37	12	5021802	5021802	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5021802G>C	uc001qnh.2	+	2	2363	c.1258G>C	c.(1258-1260)GAG>CAG	p.E420Q		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	420					synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCGAGAAACTGAGGGGGAAGA	0.527													6	569	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6710690	6710690	+	Silent	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6710690G>T	uc001qpo.2	-	6	728	c.564C>A	c.(562-564)CTC>CTA	p.L188L	CHD4_uc001qpn.2_Silent_p.L181L|CHD4_uc001qpp.2_Silent_p.L185L	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	188					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TGGCAGCAATGAGGGGTCTGG	0.438													345	360	---	---	---	---	PASS
ACRBP	84519	broad.mit.edu	37	12	6747303	6747303	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6747303C>G	uc001qpu.1	-	10					LPAR5_uc001qps.2_5'Flank|LPAR5_uc010sff.1_Intron|ACRBP_uc001qpt.1_RNA|ACRBP_uc010sfg.1_3'UTR	NM_032489	NP_115878	Q8NEB7	ACRBP_HUMAN	proacrosin binding protein sp32 precursor							acrosomal vesicle|extracellular region				central_nervous_system(1)	1						CCGTGGCCCTCTCTGGGACTG	0.512													12	11	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7647847	7647847	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7647847C>T	uc001qsz.3	-	6	1378	c.1250G>A	c.(1249-1251)GGA>GAA	p.G417E	CD163_uc001qta.3_Missense_Mutation_p.G417E|CD163_uc009zfw.2_Missense_Mutation_p.G417E	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	417	SRCR 4.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						GAGTGCAGATCCACATCCCAG	0.468													13	96	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9229475	9229475	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9229475C>G	uc001qvk.1	-	28	3522	c.3409G>C	c.(3409-3411)GAA>CAA	p.E1137Q	A2M_uc001qvj.1_Missense_Mutation_p.E179Q|A2M_uc009zgk.1_Missense_Mutation_p.E987Q	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1137					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	TGGTCCCCTTCTTGTGCTGTC	0.512													12	115	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9301536	9301536	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9301536G>A	uc001qvl.2	-	36					PZP_uc009zgl.2_3'UTR	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						ATAGGACAGAGAATCCACCAA	0.338													31	42	---	---	---	---	PASS
DDX12	440081	broad.mit.edu	37	12	9580293	9580293	+	Missense_Mutation	SNP	A	G	G	rs139954536	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9580293A>G	uc010sgs.1	-	14	1613	c.1418T>C	c.(1417-1419)ATG>ACG	p.M473T		NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CTTCAGCTCCATCCCTGAGAA	0.502													3	43	---	---	---	---	PASS
TAS2R8	50836	broad.mit.edu	37	12	10959334	10959334	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10959334C>T	uc010shh.1	-	1	246	c.246G>A	c.(244-246)CAG>CAA	p.Q82Q		NM_023918	NP_076407	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	82	Extracellular (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			ovary(2)	2						AAATGACTATCTGTTGTTTAT	0.343													10	66	---	---	---	---	PASS
TAS2R42	353164	broad.mit.edu	37	12	11339184	11339184	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11339184G>A	uc001qzr.1	-	1	360	c.360C>T	c.(358-360)CTC>CTT	p.L120L	PRB4_uc001qzf.1_Intron	NM_181429	NP_852094	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	120	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			ACCTCAGCCAGAGGAAAAGGG	0.398													13	27	---	---	---	---	PASS
HEBP1	50865	broad.mit.edu	37	12	13142262	13142262	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13142262G>A	uc001rbd.2	-	2	339	c.166C>T	c.(166-168)CGG>TGG	p.R56W	HEBP1_uc001rbf.2_Missense_Mutation_p.R56W	NM_015987	NP_057071	Q9NRV9	HEBP1_HUMAN	heme binding protein 1	56					circadian rhythm	extracellular region				breast(1)	1		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		ATTGCTTCCCGTAGAGCCTCA	0.542													38	105	---	---	---	---	PASS
LMO3	55885	broad.mit.edu	37	12	16704083	16704083	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16704083C>G	uc001rdk.1	-	4					LMO3_uc001rdj.1_3'UTR|LMO3_uc010shy.1_3'UTR|LMO3_uc001rdl.1_3'UTR|LMO3_uc009zii.1_RNA|LMO3_uc010shz.1_3'UTR|LMO3_uc001rdm.1_3'UTR|LMO3_uc001rdo.1_RNA|LMO3_uc001rdp.1_RNA|LMO3_uc001rdn.1_3'UTR|LMO3_uc009zij.1_RNA|LMO3_uc009zik.1_RNA	NM_018640	NP_061110	Q8TAP4	LMO3_HUMAN	LIM domain only 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent		zinc ion binding				0		Hepatocellular(102;0.244)				TGTGTCAATTCTTATGTACAT	0.403													5	18	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21028360	21028360	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028360C>G	uc001rek.2	+	8	1045	c.919C>G	c.(919-921)CAA>GAA	p.Q307E	SLCO1B3_uc001rel.2_Missense_Mutation_p.Q307E|SLCO1B3_uc010sil.1_Missense_Mutation_p.Q307E|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.Q132E	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	307	Cytoplasmic (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TGATAGAAATCAAACAGCTAA	0.303													15	58	---	---	---	---	PASS
ERGIC2	51290	broad.mit.edu	37	12	29498381	29498381	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29498381C>T	uc001riv.2	-	11	953	c.820G>A	c.(820-822)GAA>AAA	p.E274K	ERGIC2_uc001riw.2_RNA	NM_016570	NP_057654	Q96RQ1	ERGI2_HUMAN	PTX1 protein	274	Lumenal (Potential).				vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane|nucleus				ovary(1)	1	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)				Arsenic trioxide(DB01169)	CTTACCCTTTCTGTCACAGAA	0.323													19	114	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39726896	39726896	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39726896C>T	uc001rly.2	-	19	2647	c.2501G>A	c.(2500-2502)CGT>CAT	p.R834H	KIF21A_uc001rlv.2_5'Flank|KIF21A_uc001rlw.2_Missense_Mutation_p.R151H|KIF21A_uc001rlx.2_Missense_Mutation_p.R821H|KIF21A_uc001rlz.2_Missense_Mutation_p.R798H|KIF21A_uc010skl.1_Missense_Mutation_p.R821H	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	834					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TACTTGCCGACGAAGAGCCGT	0.443													6	96	---	---	---	---	PASS
LETMD1	25875	broad.mit.edu	37	12	51449628	51449628	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51449628C>T	uc001rxm.2	+	5	540	c.484C>T	c.(484-486)CCC>TCC	p.P162S	LETMD1_uc010smz.1_Missense_Mutation_p.P112S|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Missense_Mutation_p.P106S|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Missense_Mutation_p.P175S|LETMD1_uc001rxn.2_Missense_Mutation_p.P5S|LETMD1_uc001rxo.2_RNA|LETMD1_uc001rxp.2_Missense_Mutation_p.P45S|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1	162	Mitochondrial intermembrane (Potential).|LETM1.					integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						GTACCTGTTTCCCAGGCAACT	0.418													27	59	---	---	---	---	PASS
PRR13	54458	broad.mit.edu	37	12	53839821	53839821	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53839821C>T	uc001scz.3	+	4	589	c.425C>T	c.(424-426)TCT>TTT	p.S142F	PRR13_uc001scy.3_Missense_Mutation_p.S92F|PCBP2_uc010soh.1_Intron|PRR13_uc001sda.3_Missense_Mutation_p.S142F	NM_018457	NP_060927	Q9NZ81	PRR13_HUMAN	proline rich 13 isoform 1	142	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TCCTCCTCCTCTTCCAGCAGT	0.512													32	64	---	---	---	---	PASS
PRR13	54458	broad.mit.edu	37	12	53839894	53839894	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53839894C>G	uc001scz.3	+	4					PRR13_uc001scy.3_3'UTR|PCBP2_uc010soh.1_Intron|PRR13_uc001sda.3_3'UTR	NM_018457	NP_060927	Q9NZ81	PRR13_HUMAN	proline rich 13 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						GCTCTCCCATCAAGCTTCAGA	0.567													16	42	---	---	---	---	PASS
NPFF	8620	broad.mit.edu	37	12	53900619	53900619	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53900619C>G	uc001sdw.1	-	3	447	c.283G>C	c.(283-285)GAG>CAG	p.E95Q		NM_003717	NP_003708	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide preproprotein	95					neuropeptide signaling pathway|synaptic transmission	extracellular region|soluble fraction	neuropeptide hormone activity				0						TTCAGCCCCTCTCCAGCCCGG	0.552													25	124	---	---	---	---	PASS
HOXC4	3221	broad.mit.edu	37	12	54448006	54448006	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54448006G>A	uc001seu.2	+	3	980	c.300G>A	c.(298-300)CCG>CCA	p.P100P	HOXC4_uc001sex.2_Silent_p.P100P	NM_014620	NP_055435	P09017	HXC4_HUMAN	homeobox C4	100						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TCTGCGAGCCGGCGCCTCTCT	0.731													5	24	---	---	---	---	PASS
FRS2	10818	broad.mit.edu	37	12	69964277	69964277	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69964277G>A	uc001suy.2	+	7	743	c.233G>A	c.(232-234)CGA>CAA	p.R78Q	FRS2_uc001suz.2_Missense_Mutation_p.R78Q|FRS2_uc009zrj.2_Missense_Mutation_p.R78Q|FRS2_uc009zrk.2_Missense_Mutation_p.R78Q	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	78	IRS-type PTB.				activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			GAAAGTGGTCGAAGGTGTCAA	0.363													12	41	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94691157	94691157	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94691157C>G	uc001tdc.2	+	26	4281	c.4032C>G	c.(4030-4032)TTC>TTG	p.F1344L	PLXNC1_uc010sut.1_Missense_Mutation_p.F391L|PLXNC1_uc009zsv.2_Missense_Mutation_p.F83L	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1344	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						AGCACAAGTTCAAAGTAAAAG	0.448													5	27	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101767492	101767492	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101767492G>A	uc001tia.1	+	54	7234	c.7078G>A	c.(7078-7080)GAG>AAG	p.E2360K		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	2360					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						AATCAGCCTCGAGAAAAAAGA	0.418													9	57	---	---	---	---	PASS
TXNRD1	7296	broad.mit.edu	37	12	104725378	104725378	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104725378G>A	uc010swk.1	+	14	1631	c.1609G>A	c.(1609-1611)GAG>AAG	p.E537K	TXNRD1_uc010swl.1_Missense_Mutation_p.E387K|TXNRD1_uc010swm.1_Missense_Mutation_p.E439K|TXNRD1_uc010swn.1_Missense_Mutation_p.E387K|TXNRD1_uc010swo.1_Missense_Mutation_p.E387K|TXNRD1_uc010swp.1_Missense_Mutation_p.E349K|TXNRD1_uc010swq.1_Missense_Mutation_p.E437K|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Missense_Mutation_p.E453K	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	537					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						TGGCCTTTCTGAGGAGAAAGC	0.338													5	23	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105600843	105600843	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105600843C>T	uc001tlf.1	-	8	835	c.617G>A	c.(616-618)GGA>GAA	p.G206E	APPL2_uc010swt.1_Missense_Mutation_p.G163E|APPL2_uc001tlg.1_5'UTR|APPL2_uc010swu.1_Missense_Mutation_p.G212E|APPL2_uc009zuq.2_Missense_Mutation_p.G163E	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	206	Required for RAB5A binding (By similarity).				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						CCCTACCTGTCCATGGGCAAA	0.557													14	49	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105601808	105601808	+	Splice_Site	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105601808C>G	uc001tlf.1	-	7	634	c.416_splice	c.e7-1	p.E139_splice	APPL2_uc010swt.1_Splice_Site_p.E96_splice|APPL2_uc001tlg.1_Splice_Site|APPL2_uc010swu.1_Missense_Mutation_p.E145Q|APPL2_uc009zuq.2_Splice_Site_p.E96_splice	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH						cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						AGGTCATGCTCTAAAAATAAA	0.443													27	153	---	---	---	---	PASS
TCP11L2	255394	broad.mit.edu	37	12	106740129	106740129	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106740129C>T	uc001tln.2	+	10	1555	c.1381C>T	c.(1381-1383)CCT>TCT	p.P461S		NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2	461										ovary(3)	3						ATGCATGCCTCCTATGCCAGG	0.418													8	49	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106820987	106820987	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820987C>T	uc001tlp.2	+	13	1336	c.1114C>T	c.(1114-1116)CTT>TTT	p.L372F	POLR3B_uc001tlq.2_Missense_Mutation_p.L314F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	372					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TTTATCTCTTCTTTTTGAAGA	0.274													8	16	---	---	---	---	PASS
RIC8B	55188	broad.mit.edu	37	12	107208957	107208957	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107208957G>A	uc001tlx.2	+	3	741	c.616G>A	c.(616-618)GAT>AAT	p.D206N	RIC8B_uc001tlw.2_Missense_Mutation_p.D206N|RIC8B_uc001tly.2_Missense_Mutation_p.D166N|RIC8B_uc001tlz.2_RNA	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8	206					regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						CAAGTGGACCGATGAGTATGA	0.507													18	88	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111890567	111890567	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111890567C>G	uc001tsj.2	-	25					ATXN2_uc001tsh.2_3'UTR|ATXN2_uc001tsi.2_3'UTR|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Silent_p.L462L|ATXN2_uc001tsl.1_3'UTR	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						TTGGTAGAAGCAGTAGAAGGG	0.388													9	83	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112194215	112194215	+	Missense_Mutation	SNP	G	A	A	rs142030532	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112194215G>A	uc001tsq.2	+	21	3318	c.3118G>A	c.(3118-3120)GAC>AAC	p.D1040N	ACAD10_uc009zvx.2_Missense_Mutation_p.D1071N|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	1040							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						GCGCTTTGCCGACGGCCCTGA	0.647													9	32	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112477060	112477060	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112477060C>A	uc001ttm.2	-	22	2642	c.2622G>T	c.(2620-2622)AAG>AAT	p.K874N	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Missense_Mutation_p.K846N|NAA25_uc009zwa.1_Missense_Mutation_p.K852N	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	874	Poly-Lys.					cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						CTTTTTTCTTCTTTTTCTTTT	0.343													13	47	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112609068	112609068	+	Splice_Site	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112609068C>T	uc009zwc.2	-	61	10538	c.10520_splice	c.e61-1	p.N3507_splice		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						ATGGGCACGTCTGAGGGCGCA	0.622													5	9	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116420239	116420239	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116420239C>T	uc001tvw.2	-	22	5180	c.5125G>A	c.(5125-5127)GAA>AAA	p.E1709K		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1709					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TCCAGCATTTCTGTGTAGCAG	0.393													23	99	---	---	---	---	PASS
CIT	11113	broad.mit.edu	37	12	120241075	120241075	+	Silent	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120241075C>A	uc001txi.1	-	10	1283	c.1230G>T	c.(1228-1230)TCG>TCT	p.S410S	CIT_uc001txh.1_5'UTR|CIT_uc001txj.1_Silent_p.S410S	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron	410	AGC-kinase C-terminal.				intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GTTCTTCACCCGAGAAGCCTG	0.498													4	112	---	---	---	---	PASS
WDR66	144406	broad.mit.edu	37	12	122398579	122398579	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122398579G>A	uc009zxk.2	+	14	2364	c.2222G>A	c.(2221-2223)CGC>CAC	p.R741H		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	741							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CGCTCTCATCGCAAAAGCATT	0.488													8	100	---	---	---	---	PASS
GPR109B	8843	broad.mit.edu	37	12	123201371	123201371	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201371C>T	uc001ucy.3	-	1					GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B							integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	ACGTGTGGTTCCGTGCCTGCC	0.458													7	26	---	---	---	---	PASS
GPR109B	8843	broad.mit.edu	37	12	123201394	123201394	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123201394C>T	uc001ucy.3	-	1					GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B							integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	TATGTCATGTCAGGGTGTTGA	0.448													3	15	---	---	---	---	PASS
GTF2H3	2967	broad.mit.edu	37	12	124132646	124132646	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124132646G>A	uc001ufo.1	+	4	363	c.337G>A	c.(337-339)GAA>AAA	p.E113K	GTF2H3_uc010tau.1_Missense_Mutation_p.E72K	NM_001516	NP_001507	Q13889	TF2H3_HUMAN	general transcription factor IIH, polypeptide 3,	113					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	core TFIIH complex|holo TFIIH complex	damaged DNA binding|metal ion binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|translation factor activity, nucleic acid binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)		AGTTATTGTTGAAGAGATTAA	0.353								NER					13	69	---	---	---	---	PASS
ULK1	8408	broad.mit.edu	37	12	132380333	132380333	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132380333G>A	uc001uje.2	+	3	478	c.210G>A	c.(208-210)CTG>CTA	p.L70L		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	70	Protein kinase.				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CCTAGGAACTGAAACATGAAA	0.632													9	59	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133327431	133327431	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133327431C>G	uc001ukx.2	-	3	712	c.645G>C	c.(643-645)AGG>AGC	p.R215S	ANKLE2_uc001uky.3_Missense_Mutation_p.R153S	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	215						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		AAACATAGATCCTTTCTGGGT	0.423													8	74	---	---	---	---	PASS
LATS2	26524	broad.mit.edu	37	13	21562346	21562346	+	Missense_Mutation	SNP	G	A	A	rs147172274	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21562346G>A	uc009zzs.2	-	4	1938	c.1573C>T	c.(1573-1575)CGC>TGC	p.R525C	LATS2_uc001unr.3_Missense_Mutation_p.R525C	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN	LATS, large tumor suppressor, homolog 2	525					cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		GACTTGCTGCGCAGCAGCAGG	0.726													8	47	---	---	---	---	PASS
CENPJ	55835	broad.mit.edu	37	13	25457361	25457361	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25457361C>G	uc001upt.3	-	17	4224	c.3971G>C	c.(3970-3972)AGA>ACA	p.R1324T	CENPJ_uc010tdf.1_RNA|CENPJ_uc010aae.2_RNA|CENPJ_uc010aaf.2_RNA	NM_018451	NP_060921	Q9HC77	CENPJ_HUMAN	centromere protein J	1324					cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding			ovary(2)	2		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		GTCCTTAACTCTTATCCGACC	0.428													3	150	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38225536	38225536	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38225536C>T	uc001uws.2	-	8	2180	c.1945G>A	c.(1945-1947)GAA>AAA	p.E649K	TRPC4_uc010abv.2_Missense_Mutation_p.E229K|TRPC4_uc001uwt.2_Missense_Mutation_p.E649K|TRPC4_uc010tey.1_Missense_Mutation_p.E649K|TRPC4_uc010abw.2_Missense_Mutation_p.E476K|TRPC4_uc010abx.2_Missense_Mutation_p.E649K|TRPC4_uc010aby.2_Intron	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	649	Binds to ITPR1, ITPR2 and ITPR3.|Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GTACCTCCTTCTTCAAAATAA	0.428													18	49	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41507794	41507794	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41507794G>A	uc001uxs.2	-	9	2000	c.1627C>T	c.(1627-1629)CAG>TAG	p.Q543*	ELF1_uc010tfc.1_Nonsense_Mutation_p.Q519*|ELF1_uc010acd.2_Nonsense_Mutation_p.Q436*	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	543					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		GCAACCAGCTGTGAACTGCGA	0.453													10	99	---	---	---	---	PASS
DNAJC15	29103	broad.mit.edu	37	13	43643082	43643082	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43643082G>A	uc001uyy.2	+	3	578	c.177G>A	c.(175-177)CGG>CGA	p.R59R		NM_013238	NP_037370	Q9Y5T4	DJC15_HUMAN	DNAJ domain-containing	59						integral to membrane	heat shock protein binding				0		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		ACGCATTTCGGATCTGGAAAC	0.333													3	35	---	---	---	---	PASS
TSC22D1	8848	broad.mit.edu	37	13	45147767	45147767	+	Nonsense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45147767G>C	uc001uzn.3	-	1	2935	c.2444C>G	c.(2443-2445)TCA>TGA	p.S815*	TSC22D1_uc001uzo.1_Intron	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1	815	Gln-rich.				transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CAACTGCTGTGAAACAATTCC	0.468													18	101	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46559516	46559516	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46559516C>G	uc010tfw.1	-	9	1642	c.1636G>C	c.(1636-1638)GAG>CAG	p.E546Q	ZC3H13_uc001vas.1_Missense_Mutation_p.E546Q|ZC3H13_uc001vat.1_Missense_Mutation_p.E546Q	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	546	Arg/Ser-rich.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TTTCTGGACTCATTCCTTATT	0.438													6	76	---	---	---	---	PASS
CPB2	1361	broad.mit.edu	37	13	46656653	46656653	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46656653G>A	uc001vaw.2	-	4	374	c.307C>T	c.(307-309)CAA>TAA	p.Q103*	uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Nonsense_Mutation_p.Q103*	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a	103					blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		ATCTGCTGTTGAATAAGATCT	0.483													23	63	---	---	---	---	PASS
DHRS12	79758	broad.mit.edu	37	13	52373793	52373793	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52373793C>T	uc001vfq.2	-	2	115	c.67G>A	c.(67-69)GAA>AAA	p.E23K	DHRS12_uc001vfr.1_Missense_Mutation_p.M1I|DHRS12_uc001vfs.1_Missense_Mutation_p.M1I			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;	23							binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		CATGCAGATTCATAGCCACTC	0.493													78	104	---	---	---	---	PASS
CKAP2	26586	broad.mit.edu	37	13	53036693	53036693	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53036693G>C	uc001vgv.2	+	5	1496	c.1299G>C	c.(1297-1299)TTG>TTC	p.L433F	CKAP2_uc001vgt.2_Missense_Mutation_p.L432F|CKAP2_uc001vgu.2_Missense_Mutation_p.L432F|CKAP2_uc010tha.1_Missense_Mutation_p.L384F	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN	cytoskeleton associated protein 2 isoform 2	433					apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GCCTGAACTTGATTAATGAGG	0.229													4	48	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58299161	58299161	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58299161C>A	uc001vhq.1	+	4	4105	c.3213C>A	c.(3211-3213)TAC>TAA	p.Y1071*	PCDH17_uc010aec.1_Nonsense_Mutation_p.Y1070*|PCDH17_uc001vhr.1_Nonsense_Mutation_p.Y160*	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1071	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCAGTCAGTACTTGCCCACTG	0.532													5	59	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60348372	60348372	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60348372C>T	uc001vht.2	-	27	3489	c.3270G>A	c.(3268-3270)CAG>CAA	p.Q1090Q	DIAPH3_uc001vhu.2_Silent_p.Q827Q	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	1090					actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		GACTGAGACTCTGCCGAACAT	0.323													19	20	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75869130	75869130	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75869130G>C	uc001vjl.1	-	18	3523	c.3176C>G	c.(3175-3177)TCC>TGC	p.S1059C	TBC1D4_uc010tht.1_Missense_Mutation_p.S269C|TBC1D4_uc010thu.1_Missense_Mutation_p.S216C|TBC1D4_uc010aer.2_Missense_Mutation_p.S1051C|TBC1D4_uc010aes.2_Missense_Mutation_p.S996C	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1059	Rab-GAP TBC.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AAGGAGCCTGGACAGCTGGTA	0.358													13	66	---	---	---	---	PASS
RNF113B	140432	broad.mit.edu	37	13	98829136	98829136	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98829136C>T	uc001vnk.2	-	1	386	c.355G>A	c.(355-357)GAG>AAG	p.E119K	FARP1_uc001vnh.2_Intron|FARP1_uc001vni.2_Intron|FARP1_uc001vnj.2_Intron	NM_178861	NP_849192	Q8IZP6	R113B_HUMAN	ring finger protein 113B	119							nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			TGCTCCTTCTCGGTGTCCTGC	0.667													22	35	---	---	---	---	PASS
OR4E2	26686	broad.mit.edu	37	14	22133602	22133602	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22133602C>T	uc010tmd.1	+	1	306	c.306C>T	c.(304-306)TTC>TTT	p.F102F		NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E,	102	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		CACAGCTCTTCTTCCTACATC	0.463													81	130	---	---	---	---	PASS
MMP14	4323	broad.mit.edu	37	14	23312531	23312531	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23312531G>T	uc001whc.2	+	5	988	c.754G>T	c.(754-756)GAC>TAC	p.D252Y		NM_004995	NP_004986	P50281	MMP14_HUMAN	matrix metalloproteinase 14 preproprotein	252	Extracellular (Potential).					extracellular matrix|integral to plasma membrane|melanosome	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		GCATTCCAGTGACCCCTCGGC	0.582													14	40	---	---	---	---	PASS
LRP10	26020	broad.mit.edu	37	14	23346713	23346713	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23346713G>A	uc001whd.2	+	7	2672	c.2119G>A	c.(2119-2121)GAG>AAG	p.E707K	LRP10_uc001whe.2_Intron	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein	707	Cytoplasmic (Potential).				endocytosis	coated pit|integral to membrane				central_nervous_system(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		AGCTGAGGCAGAGGATGAGCC	0.627													7	7	---	---	---	---	PASS
PSME1	5720	broad.mit.edu	37	14	24607692	24607692	+	Missense_Mutation	SNP	C	T	T	rs144591736	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24607692C>T	uc001wmg.2	+	10	686	c.592C>T	c.(592-594)CGG>TGG	p.R198W	PSME1_uc001wmh.2_Missense_Mutation_p.R198W	NM_006263	NP_006254	Q06323	PSME1_HUMAN	proteasome activator subunit 1 isoform 1	198					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|proteasome activator complex				ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00831)		GGGTGATTATCGGCAGCTGGT	0.607													27	105	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32560018	32560018	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32560018A>G	uc001wrl.2	+	2	382	c.143A>G	c.(142-144)GAA>GGA	p.E48G	ARHGAP5_uc001wrm.2_Missense_Mutation_p.E48G|ARHGAP5_uc001wrn.2_Missense_Mutation_p.E48G|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	48					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AAAGCAGATGAATATTATCCA	0.383													21	40	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32560228	32560228	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32560228G>A	uc001wrl.2	+	2	592	c.353G>A	c.(352-354)CGT>CAT	p.R118H	ARHGAP5_uc001wrm.2_Missense_Mutation_p.R118H|ARHGAP5_uc001wrn.2_Missense_Mutation_p.R118H|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	118					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TATATAAAACGTGCAGCTGCA	0.388													9	37	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42355925	42355925	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42355925C>G	uc001wvm.2	+	3	1295	c.97C>G	c.(97-99)CTT>GTT	p.L33V	LRFN5_uc010ana.2_Missense_Mutation_p.L33V	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	33	Extracellular (Potential).|LRRNT.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GTCTCCTAATCTTGCAACCCT	0.383										HNSCC(30;0.082)			7	34	---	---	---	---	PASS
OTX2	5015	broad.mit.edu	37	14	57270957	57270957	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57270957G>A	uc001xcp.2	-	2	369	c.198C>T	c.(196-198)TTC>TTT	p.F66F	OTX2_uc010aou.2_Silent_p.F66F|OTX2_uc001xcq.2_Silent_p.F74F	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	66	Homeobox.				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					CCTCTCGCATGAAGATGTCTG	0.597													21	31	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64519306	64519306	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64519306C>T	uc001xgm.2	+	48	8905	c.8675C>T	c.(8674-8676)TCA>TTA	p.S2892L	SYNE2_uc001xgl.2_Missense_Mutation_p.S2892L	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2892	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGTGGAATCTCAACACATCTT	0.413													21	17	---	---	---	---	PASS
C14orf43	91748	broad.mit.edu	37	14	74196502	74196502	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74196502C>T	uc001xot.2	-	4	2719	c.1936G>A	c.(1936-1938)GAG>AAG	p.E646K	C14orf43_uc001xos.2_5'Flank|C14orf43_uc001xou.2_Missense_Mutation_p.E646K|C14orf43_uc010tud.1_Missense_Mutation_p.E646K|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	646					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		AAGCTCCGCTCAGAGGGGTGG	0.622													14	19	---	---	---	---	PASS
C14orf43	91748	broad.mit.edu	37	14	74196685	74196685	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74196685C>G	uc001xot.2	-	4	2536	c.1753G>C	c.(1753-1755)GAG>CAG	p.E585Q	C14orf43_uc001xos.2_5'Flank|C14orf43_uc001xou.2_Missense_Mutation_p.E585Q|C14orf43_uc010tud.1_Missense_Mutation_p.E585Q|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	585					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		TTCATGTCCTCTGCCTGGAGA	0.567													10	26	---	---	---	---	PASS
C14orf43	91748	broad.mit.edu	37	14	74205546	74205546	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74205546G>C	uc001xot.2	-	2	1949	c.1166C>G	c.(1165-1167)TCC>TGC	p.S389C	C14orf43_uc001xou.2_Missense_Mutation_p.S389C|C14orf43_uc010tud.1_Missense_Mutation_p.S389C|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	389	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		CTGCCCCAGGGAGCCAGGTGG	0.677													6	11	---	---	---	---	PASS
RPS6KA5	9252	broad.mit.edu	37	14	91372604	91372604	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91372604C>G	uc001xys.2	-	8	1061	c.846G>C	c.(844-846)ATG>ATC	p.M282I	RPS6KA5_uc010twi.1_Missense_Mutation_p.M203I|RPS6KA5_uc001xyt.2_Missense_Mutation_p.M282I|RPS6KA5_uc010att.1_RNA	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5	282	Protein kinase 1.				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CTAAAGCACTCATTTCTTGGG	0.383													4	55	---	---	---	---	PASS
UBR7	55148	broad.mit.edu	37	14	93693381	93693381	+	Nonstop_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93693381G>C	uc001ybm.3	+	11	1514	c.1278G>C	c.(1276-1278)TAG>TAC	p.*426Y	UBR7_uc001ybn.3_Nonstop_Mutation_p.*350Y|UBR7_uc010auq.2_Nonstop_Mutation_p.*275Y	NM_175748	NP_786924	Q8N806	UBR7_HUMAN	ubiquitin protein ligase E3 component n-recognin	426							ubiquitin-protein ligase activity|zinc ion binding				0						ACTGCAGCTAGAGTGGAGTAT	0.428													10	35	---	---	---	---	PASS
DDX24	57062	broad.mit.edu	37	14	94526925	94526925	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94526925C>T	uc001ycj.2	-	5	1531	c.1432G>A	c.(1432-1434)GAG>AAG	p.E478K	DDX24_uc010twq.1_Missense_Mutation_p.E435K|DDX24_uc010twr.1_Missense_Mutation_p.E228K	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	478	Helicase ATP-binding.				RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TGGCCTTTCTCAACCATCCGG	0.493													14	49	---	---	---	---	PASS
SERPINA9	327657	broad.mit.edu	37	14	94929550	94929550	+	Silent	SNP	C	T	T	rs139618805	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94929550C>T	uc001ydf.2	-	5	1349	c.1188G>A	c.(1186-1188)TCG>TCA	p.S396S	SERPINA9_uc001yde.2_Silent_p.S296S|SERPINA9_uc010avc.2_Silent_p.S247S|SERPINA9_uc001ydg.2_Silent_p.S360S	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	378					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GGCCATCCTTCGATCGGACTA	0.498													20	41	---	---	---	---	PASS
SERPINA12	145264	broad.mit.edu	37	14	94956013	94956013	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94956013C>G	uc001ydj.2	-	5	1793	c.997G>C	c.(997-999)GAG>CAG	p.E333Q		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	333					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		CCATGTTCCTCAAAGATTTTG	0.562													12	24	---	---	---	---	PASS
SNORD114-25	767605	broad.mit.edu	37	14	101451120	101451120	+	5'Flank	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101451120G>C	uc001yjp.1	+						SNORD114-24_uc001yjo.1_RNA|SNORD114-26_uc001yjq.2_5'Flank	NR_003218				Homo sapiens small nucleolar RNA, C/D box 114-25 (SNORD114-25), non-coding RNA.												0						ATCCTGGATCGATGGTGACTG	0.343													13	35	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106307448	106307448	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106307448C>T	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Silent_p.L211L|uc001ysk.1_Silent_p.L211L|uc001ysl.1_Silent_p.L211L|uc001ysm.1_Silent_p.L154L|uc001ysn.1_Silent_p.L154L|uc001yso.1_Silent_p.L154L					Parts of antibodies, mostly variable regions.												0						GAGCATCCTTCAGGTCACTGC	0.657													5	14	---	---	---	---	PASS
GJD2	57369	broad.mit.edu	37	15	35044759	35044759	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35044759C>T	uc001zis.1	-	2	886	c.886G>A	c.(886-888)GAG>AAG	p.E296K	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	296	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TTACGAATCTCATAGATTGAC	0.527													6	36	---	---	---	---	PASS
MEIS2	4212	broad.mit.edu	37	15	37390256	37390256	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37390256C>T	uc001zjr.2	-	2	1194	c.157G>A	c.(157-159)GCG>ACG	p.A53T	MEIS2_uc001zjl.2_Missense_Mutation_p.A40T|MEIS2_uc010ucj.1_Missense_Mutation_p.A40T|MEIS2_uc001zjm.2_5'UTR|MEIS2_uc001zjn.2_5'UTR|MEIS2_uc001zjo.2_Missense_Mutation_p.A53T|MEIS2_uc001zjp.2_Missense_Mutation_p.A53T|MEIS2_uc001zjs.2_Missense_Mutation_p.A53T|MEIS2_uc001zju.2_Missense_Mutation_p.A40T|MEIS2_uc001zjt.2_Missense_Mutation_p.A53T	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c	53					negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		GGGGCGTGCGCGCCGTAGTGC	0.667													8	43	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43817277	43817277	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43817277G>C	uc001zrt.2	+	4	4073	c.3606G>C	c.(3604-3606)GAG>GAC	p.E1202D		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1202						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TGTCAGAAGAGAGTCCCAGCA	0.537													15	52	---	---	---	---	PASS
CASC4	113201	broad.mit.edu	37	15	44624216	44624216	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44624216G>C	uc001zto.1	+	4	815	c.516G>C	c.(514-516)TTG>TTC	p.L172F	CASC4_uc001ztp.2_Missense_Mutation_p.L172F|CASC4_uc001ztq.2_Missense_Mutation_p.L172F|CASC4_uc010bdu.1_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a	172	Lumenal (Potential).|Potential.					integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		TGAAGGAATTGAGAGCACAGC	0.269													4	29	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45394079	45394079	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45394079C>A	uc010bea.2	-	21	2966	c.2763G>T	c.(2761-2763)TGG>TGT	p.W921C	DUOX2_uc001zun.2_Missense_Mutation_p.W921C	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	921	EF-hand 3.|Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GAAAATCCTCCCATGTCAGCT	0.572													4	42	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66793735	66793735	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66793735G>C	uc002apv.2	-	6	710	c.654C>G	c.(652-654)ATC>ATG	p.I218M	RPL4_uc010bhr.2_Missense_Mutation_p.I124M|RPL4_uc002apw.2_Missense_Mutation_p.I124M|RPL4_uc002apx.2_Missense_Mutation_p.I124M|RPL4_uc010ujq.1_Missense_Mutation_p.I218M|SNORD18C_uc010bhs.1_5'Flank	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4	218					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						TGAAGGCCTTGATGATACCAT	0.443													26	89	---	---	---	---	PASS
LCTL	197021	broad.mit.edu	37	15	66853624	66853624	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66853624C>G	uc002aqc.2	-	5	642	c.510G>C	c.(508-510)CAG>CAC	p.Q170H	LCTL_uc002aqd.3_5'UTR|LCTL_uc010bhw.2_5'UTR	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	170	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						TGCTCACATTCTGCCACCCAC	0.522													18	103	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90349355	90349355	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90349355C>G	uc002bop.3	-	2	752	c.460G>C	c.(460-462)GAG>CAG	p.E154Q		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	154	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TCCACCAGCTCAGTCTTGTCA	0.617													11	47	---	---	---	---	PASS
UNC45A	55898	broad.mit.edu	37	15	91496469	91496469	+	Missense_Mutation	SNP	C	T	T	rs8041417	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91496469C>T	uc002bqg.2	+	19	2846	c.2506C>T	c.(2506-2508)CGG>TGG	p.R836W	UNC45A_uc002bqd.2_Missense_Mutation_p.R821W|UNC45A_uc010uqr.1_Missense_Mutation_p.R228W|UNC45A_uc002bqi.2_Missense_Mutation_p.R114W|RCCD1_uc002bqj.2_5'Flank|RCCD1_uc002bqk.2_5'Flank|RCCD1_uc002bql.2_5'Flank	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	836					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCTGCTACAGCGGGCAGCTGC	0.622													24	116	---	---	---	---	PASS
UNKL	64718	broad.mit.edu	37	16	1416391	1416391	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1416391G>A	uc010brn.1	-	9	1041	c.1023C>T	c.(1021-1023)ATC>ATT	p.I341I	UNKL_uc002cln.2_Silent_p.I183I|UNKL_uc002clo.2_Silent_p.I180I|UNKL_uc002clp.2_Silent_p.I133I			Q9H9P5	UNKL_HUMAN	SubName: Full=Putative ubiquitin-protein ligase;          EC=6.3.2.19; Flags: Fragment;	631						cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				GGAGCTGGAAGATCACCTGCA	0.697													9	8	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1817918	1817918	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1817918G>C	uc002cmk.2	+	28	3639	c.3519G>C	c.(3517-3519)GAG>GAC	p.E1173D	MAPK8IP3_uc002cml.2_Missense_Mutation_p.E1167D|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.E1174D	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	1173					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CCCTGACAGAGAGTGAGTGGC	0.657													16	78	---	---	---	---	PASS
ZNF263	10127	broad.mit.edu	37	16	3339480	3339480	+	Missense_Mutation	SNP	G	A	A	rs79713839	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3339480G>A	uc002cuq.2	+	6	1306	c.974G>A	c.(973-975)CGA>CAA	p.R325Q	ZNF263_uc010uww.1_5'UTR|ZNF263_uc002cur.2_5'UTR	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	325					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						GACCAGGCCCGAGGGGAGGTG	0.597													26	111	---	---	---	---	PASS
NAGPA	51172	broad.mit.edu	37	16	5077281	5077281	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5077281C>G	uc002cyg.2	-	8	1295	c.1274G>C	c.(1273-1275)AGA>ACA	p.R425T	NAGPA_uc010buc.2_Intron|NAGPA_uc002cyf.2_Intron|NAGPA_uc002cyh.2_RNA|NAGPA_uc002cyi.2_Missense_Mutation_p.R200T	NM_016256	NP_057340	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester	425	Lumenal (Potential).				carbohydrate metabolic process|lysosome organization|protein modification process|protein targeting to lysosome	Golgi cisterna membrane|integral to membrane	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity				0					N-Acetyl-D-glucosamine(DB00141)	ATAGGTACCTCTGGAGACGCT	0.607													6	46	---	---	---	---	PASS
TXNDC11	51061	broad.mit.edu	37	16	11792004	11792004	+	Missense_Mutation	SNP	C	T	T	rs143169078		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11792004C>T	uc010buu.1	-	8	1227	c.1165G>A	c.(1165-1167)GAA>AAA	p.E389K	TXNDC11_uc002dbg.1_Missense_Mutation_p.E362K	NM_015914	NP_056998	Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	389					cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0						GGATGACTTTCGGCCAGGGGA	0.512													15	89	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21063188	21063188	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21063188G>A	uc010vbe.1	-	29	4041	c.4041C>T	c.(4039-4041)GCC>GCT	p.A1347A		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1347	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		CCACGTCGCGGGCTGTTGGGA	0.522													20	44	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21086798	21086798	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21086798C>T	uc010vbe.1	-	21	3054	c.3054G>A	c.(3052-3054)GTG>GTA	p.V1018V		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1018	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		AGCTGAACGTCACGTTAACCC	0.453													12	58	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21132082	21132082	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21132082C>T	uc010vbe.1	-	11	1678	c.1678G>A	c.(1678-1680)GCG>ACG	p.A560T	DNAH3_uc002die.2_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	560	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GTGGCAGCCGCGTGCATGCTG	0.507													5	25	---	---	---	---	PASS
UQCRC2	7385	broad.mit.edu	37	16	21994570	21994570	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21994570C>G	uc002djx.2	+	14					UQCRC2_uc002djy.2_3'UTR|UQCRC2_uc010bxa.2_RNA	NM_003366	NP_003357	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II						aerobic respiration|oxidative phosphorylation|proteolysis|respiratory electron transport chain|transport		metalloendopeptidase activity|zinc ion binding			large_intestine(2)	2				GBM - Glioblastoma multiforme(48;0.0264)		TCAGAAGTCTCTAATATATCA	0.373													4	24	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27640096	27640096	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27640096G>A	uc002dow.2	+	4	279	c.255G>A	c.(253-255)CGG>CGA	p.R85R		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	85										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						CATCACCGCGGAAAGCTATTC	0.532													12	97	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30721411	30721411	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30721411G>A	uc002dze.1	+	8	1481	c.1096G>A	c.(1096-1098)GAA>AAA	p.E366K	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.E223K|SRCAP_uc010bzz.1_5'UTR|SNORA30_uc002dzh.1_5'Flank	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	366	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			AGATGGGCCTGAAGAAGGTGC	0.587													5	21	---	---	---	---	PASS
FBXL19	54620	broad.mit.edu	37	16	30941563	30941563	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30941563C>T	uc002eab.2	+	7	1177	c.1019C>T	c.(1018-1020)TCG>TTG	p.S340L	FBXL19_uc002dzz.1_Missense_Mutation_p.S28L|FBXL19_uc002eaa.1_Missense_Mutation_p.S239L	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	340	Ser-rich.						DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4						TCGGGCACATCGCTGAGTGAG	0.677													7	41	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30991419	30991419	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30991419G>C	uc002ead.1	+	14	4998	c.4312G>C	c.(4312-4314)GAG>CAG	p.E1438Q		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1438	Interaction with CFP1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CCTGGACTCAGAGGACATGAG	0.458													3	26	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33647241	33647241	+	IGR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33647241G>A								SLC6A10P (750778 upstream) : MIR1826 (318267 downstream)																							ACTTCCCCTCGCTGTGTGTTT	0.572													23	121	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48595890	48595890	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48595890C>T	uc002efp.2	-	2	901	c.664G>A	c.(664-666)GGG>AGG	p.G222R		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	222					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				ATATTCAGCCCTGTGGCAGCA	0.408													7	32	---	---	---	---	PASS
PDP2	57546	broad.mit.edu	37	16	66919264	66919264	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66919264G>A	uc002eqk.1	+	2	1239	c.1077G>A	c.(1075-1077)TTG>TTA	p.L359L		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	359					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		GTAAAGAGTTGCAGCGCAGCA	0.557													4	54	---	---	---	---	PASS
FHOD1	29109	broad.mit.edu	37	16	67271177	67271177	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67271177C>T	uc002esl.2	-	9	1070	c.958G>A	c.(958-960)GAC>AAC	p.D320N	FHOD1_uc010ced.2_Missense_Mutation_p.D127N|FHOD1_uc010vjh.1_5'UTR	NM_013241	NP_037373	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	320	GBD/FH3.				actin cytoskeleton organization	cytoplasm|cytoskeleton|nucleus	actin binding			breast(2)|ovary(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AGGTCGACGTCAGTGCCCGCA	0.657													12	37	---	---	---	---	PASS
ATP6V0D1	9114	broad.mit.edu	37	16	67514862	67514862	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67514862T>A	uc002ete.1	-	1	228	c.128A>T	c.(127-129)GAG>GTG	p.E43V	ATP6V0D1_uc010vjo.1_Missense_Mutation_p.E43V	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	43					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		CGGCTCACCCTCTAGCGTCTC	0.672													13	38	---	---	---	---	PASS
ATP6V0D1	9114	broad.mit.edu	37	16	67514906	67514906	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67514906G>C	uc002ete.1	-	1	184	c.84C>G	c.(82-84)CTC>CTG	p.L28L	ATP6V0D1_uc010vjo.1_Silent_p.L28L	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	28					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		CGGCCTGGCTGAGCACCCCGG	0.652													15	42	---	---	---	---	PASS
HAS3	3038	broad.mit.edu	37	16	69143494	69143494	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69143494G>C	uc010cfh.2	+	2	420	c.196G>C	c.(196-198)GAG>CAG	p.E66Q	HAS3_uc002ewk.2_Missense_Mutation_p.E66Q|HAS3_uc010vlk.1_Missense_Mutation_p.E66Q|HAS3_uc002ewl.2_Missense_Mutation_p.E66Q	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	66	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		TGCCTTCCTGGAGCACCGGCG	0.647													8	32	---	---	---	---	PASS
DDX19A	55308	broad.mit.edu	37	16	70400696	70400696	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70400696G>A	uc002eyv.2	+	9	1023	c.952G>A	c.(952-954)GAG>AAG	p.E318K	DDX19B_uc010vly.1_Intron|DDX19A_uc002eys.2_Missense_Mutation_p.E319K|DDX19A_uc010cfq.1_Missense_Mutation_p.E73K|DDX19A_uc010cfr.2_Missense_Mutation_p.E168K|DDX19A_uc010cfs.2_Missense_Mutation_p.E141K|DDX19A_uc010vlz.1_Missense_Mutation_p.E287K|DDX19A_uc010vma.1_Missense_Mutation_p.E228K	NM_018332	NP_060802	Q9NUU7	DD19A_HUMAN	DDX19-like protein	318	Helicase C-terminal.				mRNA transport|protein transport|transmembrane transport	cytoplasm|nuclear membrane|nuclear pore	ATP binding|ATP-dependent helicase activity|RNA binding				0		Ovarian(137;0.221)				CAGCAGAGACGAGAAGTTCCA	0.542													16	79	---	---	---	---	PASS
FOXL1	2300	broad.mit.edu	37	16	86612413	86612413	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86612413C>G	uc002fjr.2	+	1	299	c.84C>G	c.(82-84)CTC>CTG	p.L28L		NM_005250	NP_005241	Q12952	FOXL1_HUMAN	forkhead box L1	28					brain development|camera-type eye development|cartilage development|embryo development|forelimb morphogenesis|heart development|organ morphogenesis|pattern specification process|proteoglycan biosynthetic process|regulation of sequence-specific DNA binding transcription factor activity|regulation of Wnt receptor signaling pathway|visceral mesoderm-endoderm interaction involved in midgut development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1						GACCCGGCCTCCCTCTGGCCT	0.692													6	41	---	---	---	---	PASS
KLHDC4	54758	broad.mit.edu	37	16	87744970	87744970	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87744970C>T	uc002fki.2	-	9	961	c.915G>A	c.(913-915)CCG>CCA	p.P305P	KLHDC4_uc002fkh.1_5'Flank|KLHDC4_uc010cht.1_Silent_p.P124P|KLHDC4_uc002fkj.2_Silent_p.P274P|KLHDC4_uc002fkk.2_Silent_p.P124P|KLHDC4_uc002fkl.2_Silent_p.P248P|KLHDC4_uc010chu.1_Silent_p.P124P	NM_017566	NP_060036	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	305										pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0283)		TCTGGTGATTCGGGGCCATGG	0.567													12	62	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89862344	89862344	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89862344G>A	uc002fou.1	-	11	1018	c.976C>T	c.(976-978)CAG>TAG	p.Q326*	FANCA_uc010vpn.1_Nonsense_Mutation_p.Q326*	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	326					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GTGAGTATCTGAGTCAGGGTA	0.512			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				10	46	---	---	---	---	PASS
TCF25	22980	broad.mit.edu	37	16	89940210	89940210	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89940210C>T	uc002fpb.2	+	1	217	c.135C>T	c.(133-135)GTC>GTT	p.V45V	TCF25_uc010vpp.1_Silent_p.V45V	NM_014972	NP_055787	Q9BQ70	TCF25_HUMAN	NULP1	45					heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		AGCTTGGTGTCCGGCGTCCCG	0.701													4	12	---	---	---	---	PASS
FAM101B	359845	broad.mit.edu	37	17	293277	293277	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:293277G>A	uc002frj.2	-	2	387	c.113C>T	c.(112-114)TCC>TTC	p.S38F		NM_182705	NP_874364	Q8N5W9	F101B_HUMAN	hypothetical protein LOC359845	108											0		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.0216)		CTTGACCAAGGAGGTGTACCT	0.657													10	48	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1548932	1548932	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1548932G>A	uc002fsz.1	-	1	110	c.60C>T	c.(58-60)TCC>TCT	p.S20S	SCARF1_uc002fsy.1_Silent_p.S20S|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Silent_p.S20S	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	20	Extracellular (Potential).				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GGTCCAGCTCGGACCCCTGAG	0.687													3	3	---	---	---	---	PASS
OR3A1	4994	broad.mit.edu	37	17	3195373	3195373	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3195373C>T	uc002fvh.1	-	1	504	c.504G>A	c.(502-504)ACG>ACA	p.T168T		NM_002550	NP_002541	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			kidney(2)|central_nervous_system(1)	3						AGAAGTTGAGCGTGGACATGG	0.567													44	74	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4877755	4877755	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4877755C>G	uc002gah.1	-	12	2049	c.1941G>C	c.(1939-1941)CAG>CAC	p.Q647H	CAMTA2_uc010cku.1_Missense_Mutation_p.Q670H|CAMTA2_uc002gag.1_Missense_Mutation_p.Q646H|CAMTA2_uc002gai.1_Missense_Mutation_p.Q649H|CAMTA2_uc010ckv.1_Missense_Mutation_p.Q294H	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	647					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						GCTTCTCCATCTGCTCCAGTC	0.587													10	48	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578419	7578419	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578419C>T	uc002gim.2	-	5	705	c.511G>A	c.(511-513)GAG>AAG	p.E171K	TP53_uc002gig.1_Missense_Mutation_p.E171K|TP53_uc002gih.2_Missense_Mutation_p.E171K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E39K|TP53_uc010cng.1_Missense_Mutation_p.E39K|TP53_uc002gii.1_Missense_Mutation_p.E39K|TP53_uc010cnh.1_Missense_Mutation_p.E171K|TP53_uc010cni.1_Missense_Mutation_p.E171K|TP53_uc002gij.2_Missense_Mutation_p.E171K|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.E78K|TP53_uc002gio.2_Missense_Mutation_p.E39K|TP53_uc010vug.1_Missense_Mutation_p.E132K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	171	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E171*(10)|p.E171K(8)|p.0?(7)|p.E171G(3)|p.E171Q(3)|p.E171fs*10(3)|p.E171fs*3(2)|p.E171V(2)|p.E171D(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.E171fs*9(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.T170fs*8(1)|p.E171_V172delEV(1)|p.H168fs*69(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E171A(1)|p.H168fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTCACAACCTCCGTCATGTGC	0.662		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			22	36	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578493	7578493	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578493C>G	uc002gim.2	-	5	631	c.437G>C	c.(436-438)TGG>TCG	p.W146S	TP53_uc002gig.1_Missense_Mutation_p.W146S|TP53_uc002gih.2_Missense_Mutation_p.W146S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.W14S|TP53_uc010cng.1_Missense_Mutation_p.W14S|TP53_uc002gii.1_Missense_Mutation_p.W14S|TP53_uc010cnh.1_Missense_Mutation_p.W146S|TP53_uc010cni.1_Missense_Mutation_p.W146S|TP53_uc002gij.2_Missense_Mutation_p.W146S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.W53S|TP53_uc002gio.2_Missense_Mutation_p.W14S|TP53_uc010vug.1_Missense_Mutation_p.W107S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	146	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		W -> S (in sporadic cancers; somatic mutation).|W -> C (in a sporadic cancer; somatic mutation).|W -> G (in sporadic cancers; somatic mutation).|W -> R (in sporadic cancers; somatic mutation).|W -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.W146*(61)|p.0?(7)|p.W146R(5)|p.W146C(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.W146_S149>C(1)|p.W146fs*25(1)|p.W146S(1)|p.Q144fs*32(1)|p.W146fs*1(1)|p.W146_V147insXXXXXXX(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.W146G(1)|p.V143_S149del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGAATCAACCCACAGCTGCAC	0.602		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			17	25	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10310054	10310054	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10310054A>C	uc002gmm.2	-	19	2219	c.2124T>G	c.(2122-2124)TGT>TGG	p.C708W	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	708	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						ATCCTTTCCTACAGATGCGGA	0.378									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				22	69	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10399384	10399384	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10399384C>T	uc002gmo.2	-	35	5146	c.5052G>A	c.(5050-5052)CTG>CTA	p.L1684L	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1684	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CAGCCTGCAGCAGGTTGGCTC	0.592													16	45	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11656266	11656266	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11656266G>A	uc002gne.2	+	33	6795	c.6727G>A	c.(6727-6729)GAT>AAT	p.D2243N	DNAH9_uc010coo.2_Missense_Mutation_p.D1537N	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2243	AAA 2 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TACTGTCATGGATGATAACAA	0.453													18	36	---	---	---	---	PASS
RICH2	9912	broad.mit.edu	37	17	12823090	12823090	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12823090C>G	uc002gnr.3	+	6	733	c.406C>G	c.(406-408)CAA>GAA	p.Q136E	RICH2_uc010vvk.1_Missense_Mutation_p.Q136E|RICH2_uc010vvl.1_Missense_Mutation_p.Q136E|RICH2_uc002gns.3_5'UTR|RICH2_uc010vvm.1_Missense_Mutation_p.Q136E|RICH2_uc010vvn.1_RNA	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	136	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CCCAAATATTCAAAAGCAGAG	0.353													7	14	---	---	---	---	PASS
ZNF287	57336	broad.mit.edu	37	17	16466491	16466491	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16466491C>G	uc002gqi.2	-	5	1137	c.684G>C	c.(682-684)GTG>GTC	p.V228V		NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287	221	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		TTTCTTTTATCACCATCCATG	0.373													11	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21731420	21731420	+	3'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21731420C>G	uc002gyy.3	+	2										SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GAAAGACCATCACCCTGGAGG	0.532													8	36	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26101427	26101427	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26101427C>A	uc002gzu.2	-	12	1596	c.1332G>T	c.(1330-1332)ATG>ATT	p.M444I	NOS2_uc010crh.1_Missense_Mutation_p.M444I|NOS2_uc010wab.1_Missense_Mutation_p.M444I	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	444					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GCATGTACTTCATGAAGGATT	0.557													10	62	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26945944	26945944	+	Silent	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26945944C>A	uc002hbu.2	-	32	5787	c.5688G>T	c.(5686-5688)CTG>CTT	p.L1896L	KIAA0100_uc002hbt.2_Silent_p.L225L	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	1896						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					GCTGCTTTCGCAGCTCCATCT	0.532													10	36	---	---	---	---	PASS
PROCA1	147011	broad.mit.edu	37	17	27030605	27030605	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27030605G>T	uc002hcb.3	-	5	1191	c.988C>A	c.(988-990)CCC>ACC	p.P330T	PROCA1_uc010crv.2_Missense_Mutation_p.P256T|PROCA1_uc002hca.1_Missense_Mutation_p.P328T	NM_152465	NP_689678	Q8NCQ7	PRCA1_HUMAN	protein interacting with cyclin A1	356					lipid catabolic process		calcium ion binding|phospholipase A2 activity			ovary(1)	1	Lung NSC(42;0.00431)					GATCCTGGGGGAGATTTTCTC	0.547													22	127	---	---	---	---	PASS
RAD51L3	5892	broad.mit.edu	37	17	33428002	33428002	+	Missense_Mutation	SNP	C	G	G	rs147669627		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33428002C>G	uc002hir.2	-	10	1213	c.957G>C	c.(955-957)CAG>CAC	p.Q319H	RFFL_uc002hiq.2_Intron|RAD51L3_uc010ctj.2_Missense_Mutation_p.E138Q|RAD51L3_uc010wcd.1_Missense_Mutation_p.Q339H|RAD51L3_uc002his.2_Missense_Mutation_p.Q207H|RAD51L3_uc010ctk.2_Missense_Mutation_p.Q200H|RAD51L3_uc010wce.1_Missense_Mutation_p.Q200H|RAD51L3_uc002hit.2_Missense_Mutation_p.Q200H|RAD51L3_uc002hiu.2_Missense_Mutation_p.Q142H	NM_002878	NP_002869	O75771	RA51D_HUMAN	RAD51-like 3 isoform 1	319					DNA repair|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ATGTGGCACTCTGCTCTGAGG	0.527								Direct_reversal_of_damage|Homologous_recombination					27	46	---	---	---	---	PASS
GRB7	2886	broad.mit.edu	37	17	37901554	37901554	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37901554C>G	uc002hsr.2	+	10	1320	c.1070C>G	c.(1069-1071)TCT>TGT	p.S357C	GRB7_uc002hss.2_Missense_Mutation_p.S357C|GRB7_uc010cwc.2_Missense_Mutation_p.S357C|GRB7_uc002hst.2_Missense_Mutation_p.S357C	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	357					blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTGCATCCATCTTGTTTGGGC	0.597													13	34	---	---	---	---	PASS
PSMD3	5709	broad.mit.edu	37	17	38140722	38140722	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38140722C>T	uc002htn.1	+	2	560	c.396C>T	c.(394-396)CTC>CTT	p.L132L	PSMD3_uc010wen.1_RNA|PSMD3_uc010weo.1_Silent_p.L33L	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3	132					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					ACTTTTTGCTCCCCTTCCTGG	0.517													8	59	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38447912	38447912	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38447912G>C	uc002huj.1	+	4	862	c.652G>C	c.(652-654)GAC>CAC	p.D218H		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	218					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						GATTCTGCAAGACCTCAAGGT	0.348													20	38	---	---	---	---	PASS
KAT2A	2648	broad.mit.edu	37	17	40265686	40265686	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40265686C>G	uc002hyx.2	-	18	2555	c.2495G>C	c.(2494-2496)GGA>GCA	p.G832A	DHX58_uc002hyv.3_5'Flank|DHX58_uc002hyw.3_5'Flank|DHX58_uc010wgf.1_5'Flank	NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like	832					chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						AATGAGGCCTCCCTCCTTGAG	0.607													8	48	---	---	---	---	PASS
PTRF	284119	broad.mit.edu	37	17	40556890	40556890	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40556890C>T	uc002hzo.2	-	2	1147	c.988G>A	c.(988-990)GAG>AAG	p.E330K	PTRF_uc010wgi.1_Missense_Mutation_p.E312K	NM_012232	NP_036364	Q6NZI2	PTRF_HUMAN	polymerase I and transcript release factor	330					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		ACCTGGCCCTCGCGGATCTTC	0.687													15	46	---	---	---	---	PASS
TUBG2	27175	broad.mit.edu	37	17	40818517	40818517	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40818517C>T	uc010wgr.1	+						TUBG2_uc002iaq.2_Silent_p.F233F|TUBG2_uc002iar.2_Intron|TUBG2_uc002ias.2_Intron|TUBG2_uc002iap.2_Intron	NM_016437	NP_057521	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2						G2/M transition of mitotic cell cycle|microtubule-based process|protein polymerization	cytosol	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		GTCTAGGTTTCTATTCTTCTT	0.542													13	56	---	---	---	---	PASS
DHX8	1659	broad.mit.edu	37	17	41599484	41599484	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41599484C>G	uc002idu.1	+	22	3406	c.3333C>G	c.(3331-3333)TTC>TTG	p.F1111L	DHX8_uc010wig.1_Missense_Mutation_p.F1111L	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1111						catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		GCAGTGGGTTCTTCCGTAATG	0.517													82	52	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43323891	43323891	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43323891C>T	uc002iin.2	+	26	3431	c.3231C>T	c.(3229-3231)TTC>TTT	p.F1077F	FMNL1_uc002iiq.2_Intron|FMNL1_uc010dag.2_Intron|LOC100133991_uc010dah.2_5'Flank	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	1077	DAD.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						CGGTGCCCTTCACGGCCCGCA	0.582											OREG0024478	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	42	---	---	---	---	PASS
PNPO	55163	broad.mit.edu	37	17	46023710	46023710	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46023710G>A	uc002imo.2	+	6	721	c.568G>A	c.(568-570)GAA>AAA	p.E190K	PNPO_uc010wkz.1_Missense_Mutation_p.E172K|PNPO_uc010wla.1_Missense_Mutation_p.E95K|PNPO_uc010wlb.1_Missense_Mutation_p.E147K	NM_018129	NP_060599	Q9NVS9	PNPO_HUMAN	pyridoxine 5'-phosphate oxidase	190					pyridoxine biosynthetic process	cytosol	FMN binding|pyridoxamine-phosphate oxidase activity				0					Pyridoxal Phosphate(DB00114)	GAAAAATGAGGAACTGGAACA	0.493													3	34	---	---	---	---	PASS
UBE2Z	65264	broad.mit.edu	37	17	47004453	47004453	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47004453C>T	uc002ioi.2	+	7	1121	c.1022C>T	c.(1021-1023)TCA>TTA	p.S341L		NM_023079	NP_075567	Q9H832	UBE2Z_HUMAN	ubiquitin-conjugating enzyme E2Z	341					apoptosis	cytoplasm|nucleus	ATP binding|ubiquitin-protein ligase activity				0						GATAGCAGTTCATCTGGGACA	0.537													4	29	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48745049	48745049	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48745049C>G	uc002isl.2	+	12	1646	c.1566C>G	c.(1564-1566)CTC>CTG	p.L522L	ABCC3_uc002isk.3_Silent_p.L522L	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	522	ABC transmembrane type-1 1.|Cytoplasmic (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	AGGGTGAGCTCCAGCTGCTGC	0.632													5	46	---	---	---	---	PASS
MBTD1	54799	broad.mit.edu	37	17	49280217	49280217	+	Missense_Mutation	SNP	C	T	T	rs147550029		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49280217C>T	uc002itr.3	-	10	1252	c.908G>A	c.(907-909)CGA>CAA	p.R303Q	MBTD1_uc002itp.3_Missense_Mutation_p.R139Q|MBTD1_uc002itq.3_Missense_Mutation_p.R303Q	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	303	MBT 2.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			CACTGCTACTCGTGTTCGACA	0.408													37	185	---	---	---	---	PASS
TEX14	56155	broad.mit.edu	37	17	56738582	56738582	+	Intron	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56738582C>G	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Missense_Mutation_p.E127Q	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGGGGCAGCTCAAACTCGGCC	0.478													10	40	---	---	---	---	PASS
TRIM37	4591	broad.mit.edu	37	17	57089713	57089713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57089713C>A	uc002iwy.3	-	22	3115	c.2671G>T	c.(2671-2673)GGA>TGA	p.G891*	TRIM37_uc002iwz.3_Nonsense_Mutation_p.G891*|TRIM37_uc002ixa.3_Nonsense_Mutation_p.G769*|TRIM37_uc010woc.1_Nonsense_Mutation_p.G857*	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	891						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GCTGAAGCTCCTTCAGGTAGT	0.368									Mulibrey_Nanism				13	75	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66042657	66042657	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66042657C>G	uc002jgk.2	+	11	1667	c.1535C>G	c.(1534-1536)TCT>TGT	p.S512C	KPNA2_uc002jgl.2_Missense_Mutation_p.S512C	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	512					DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GAAACTACCTCTGAAGGCTAC	0.368													9	71	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66042674	66042674	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66042674C>A	uc002jgk.2	+	11	1684	c.1552C>A	c.(1552-1554)CAA>AAA	p.Q518K	KPNA2_uc002jgl.2_Missense_Mutation_p.Q518K	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	518					DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTACACTTTCCAAGTTCAGGA	0.338													12	78	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66042773	66042773	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66042773C>T	uc002jgk.2	+	11					KPNA2_uc002jgl.2_3'UTR	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2						DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTATTGTTTCTCTACTAAGA	0.353													3	28	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68128891	68128891	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68128891C>G	uc002jin.2	+	5	1149	c.663C>G	c.(661-663)CTC>CTG	p.L221L	KCNJ16_uc002jio.2_Silent_p.L221L|KCNJ16_uc002jip.2_Silent_p.L221L|KCNJ16_uc002jiq.2_Silent_p.L253L	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	221	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					CCCAACTTCTCCGCTATACAG	0.473													9	51	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68129403	68129403	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68129403C>T	uc002jin.2	+	5	1661	c.1175C>T	c.(1174-1176)TCC>TTC	p.S392F	KCNJ16_uc002jio.2_Missense_Mutation_p.S392F|KCNJ16_uc002jip.2_Missense_Mutation_p.S392F|KCNJ16_uc002jiq.2_Missense_Mutation_p.S424F	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	392	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					ACCACCACTTCCGCCACACAT	0.458													5	55	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72305591	72305591	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72305591G>C	uc002jkf.2	+						DNAI2_uc002jkg.2_Intron|DNAI2_uc010dfp.2_Intron|uc002jkh.1_Silent_p.L48L|DNAI2_uc002jki.2_Intron	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2						cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						GCGTGGGTGTGAGTGTGGGGT	0.622									Kartagener_syndrome				4	9	---	---	---	---	PASS
ATP5H	10476	broad.mit.edu	37	17	73034970	73034970	+	3'UTR	SNP	A	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73034970A>G	uc002jmn.1	-	6					KCTD2_uc010dfy.1_Intron|KCTD2_uc010dfz.2_Intron|ATP5H_uc002jmo.1_3'UTR	NM_006356	NP_006347	O75947	ATP5H_HUMAN	ATP synthase, H+ transporting, mitochondrial F0						ATP catabolic process|respiratory electron transport chain	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity				0	all_lung(278;0.226)					TATAATTATTATTTTTAATGT	0.403													6	34	---	---	---	---	PASS
NUP85	79902	broad.mit.edu	37	17	73205991	73205991	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73205991C>T	uc002jng.1	+	3	461	c.201C>T	c.(199-201)ATC>ATT	p.I67I	NUP85_uc010dgd.1_Silent_p.I67I|NUP85_uc010wrv.1_Silent_p.I21I	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85	67					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			ACTCTCAAATCTTGAGAAAAC	0.368													9	69	---	---	---	---	PASS
LLGL2	3993	broad.mit.edu	37	17	73554290	73554290	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73554290G>A	uc002joh.2	+	4	382	c.228G>A	c.(226-228)GTG>GTA	p.V76V	LLGL2_uc002jog.1_Silent_p.V76V|LLGL2_uc010dgf.1_Silent_p.V76V|LLGL2_uc002joi.2_Silent_p.V76V|LLGL2_uc010dgg.1_Silent_p.V76V|LLGL2_uc002joj.2_Silent_p.V65V	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	76	WD 2.				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			ACAACGCTGTGACGCAGATCC	0.632													18	123	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73623508	73623508	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73623508C>G	uc010dgl.2	-	20	3126	c.2970G>C	c.(2968-2970)CAG>CAC	p.Q990H	RECQL5_uc010dgk.2_Missense_Mutation_p.Q963H|RECQL5_uc002jot.3_Missense_Mutation_p.Q186H	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	990					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TTGGTCATCTCTGGGGGCCAC	0.622								Other_identified_genes_with_known_or_suspected_DNA_repair_function					18	118	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73623520	73623520	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73623520C>T	uc010dgl.2	-	20	3114	c.2958G>A	c.(2956-2958)CTG>CTA	p.L986L	RECQL5_uc010dgk.2_Silent_p.L959L|RECQL5_uc002jot.3_Silent_p.L182L	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	986					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGGGGCCACACAGGCCATGCC	0.632								Other_identified_genes_with_known_or_suspected_DNA_repair_function					21	126	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73624402	73624402	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73624402C>G	uc010dgl.2	-	18	2857	c.2701G>C	c.(2701-2703)GAC>CAC	p.D901H	RECQL5_uc010dgk.2_Missense_Mutation_p.D874H|RECQL5_uc002jot.3_Missense_Mutation_p.D97H	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	901					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TGGAAGGGGTCTTGAGCCGTG	0.602								Other_identified_genes_with_known_or_suspected_DNA_repair_function					16	103	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73624837	73624837	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73624837C>T	uc010dgl.2	-	17	2651	c.2495G>A	c.(2494-2496)TGC>TAC	p.C832Y	RECQL5_uc010dgk.2_Missense_Mutation_p.C805Y|RECQL5_uc002jot.3_Missense_Mutation_p.C28Y	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	832					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTGGGCGGGCAGGTGCTGGT	0.652								Other_identified_genes_with_known_or_suspected_DNA_repair_function					7	42	---	---	---	---	PASS
RECQL5	9400	broad.mit.edu	37	17	73625129	73625129	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73625129C>T	uc010dgl.2	-	16	2530	c.2374G>A	c.(2374-2376)GAG>AAG	p.E792K	RECQL5_uc010dgk.2_Missense_Mutation_p.E765K|RECQL5_uc002jot.3_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1	792					DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TGAACCCCCTCACAGGAGGGG	0.642								Other_identified_genes_with_known_or_suspected_DNA_repair_function					6	53	---	---	---	---	PASS
GALR2	8811	broad.mit.edu	37	17	74071212	74071212	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74071212C>T	uc002jqm.1	+	1	329	c.248C>T	c.(247-249)GCC>GTC	p.A83V	SRP68_uc010wsu.1_5'Flank|SRP68_uc002jqk.1_5'Flank|SRP68_uc002jql.1_5'Flank	NM_003857	NP_003848	O43603	GALR2_HUMAN	galanin receptor 2	83	Extracellular (Potential).				digestion|elevation of cytosolic calcium ion concentration|feeding behavior|learning or memory|muscle contraction	integral to membrane|plasma membrane	galanin receptor activity				0						CCCTTCCAGGCCACCATCTAC	0.632													11	77	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74901357	74901357	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74901357C>T	uc002jti.2	+	6	933	c.830C>T	c.(829-831)GCG>GTG	p.A277V	MGAT5B_uc002jth.2_Missense_Mutation_p.A266V	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	266	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						GCCCAGTGGGCGCTGGCTGCC	0.642													9	37	---	---	---	---	PASS
AZI1	22994	broad.mit.edu	37	17	79165000	79165000	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79165000C>T	uc002jzp.1	-	22	2967	c.2767G>A	c.(2767-2769)GAG>AAG	p.E923K	AZI1_uc002jzm.1_Missense_Mutation_p.E355K|AZI1_uc002jzn.1_Missense_Mutation_p.E920K|AZI1_uc002jzo.1_Missense_Mutation_p.E884K|AZI1_uc010wum.1_Missense_Mutation_p.E887K|AZI1_uc002jzq.2_Missense_Mutation_p.E71K	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a	923					cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TACCGGCTCTCGGCAGCCTTC	0.652													20	66	---	---	---	---	PASS
C17orf62	79415	broad.mit.edu	37	17	80401915	80401915	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80401915C>T	uc002kez.2	-	6	577	c.529G>A	c.(529-531)GAC>AAC	p.D177N	C17orf62_uc002kex.2_Silent_p.A28A|C17orf62_uc002key.2_Silent_p.A28A|C17orf62_uc002kfa.2_Missense_Mutation_p.D177N|C17orf62_uc010dir.2_Missense_Mutation_p.D177N|C17orf62_uc002kfb.3_Missense_Mutation_p.D177N|C17orf62_uc002kfc.3_Missense_Mutation_p.D163N|C17orf62_uc002kfd.3_Silent_p.A28A|C17orf62_uc002kfe.3_Silent_p.A28A	NM_001100407	NP_001093877	Q9BQA9	CQ062_HUMAN	hypothetical protein LOC79415 isoform a	177						integral to membrane	protein binding				0	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCCTCACTGTCGCTGCTCTGA	0.652													19	135	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80442635	80442635	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80442635C>T	uc002kfg.3	+						NARF_uc002kff.3_Intron|NARF_uc010wvp.1_3'UTR|NARF_uc010dit.2_Intron|NARF_uc002kfj.3_Intron|NARF_uc002kfi.3_Intron|NARF_uc002kfh.3_Intron|NARF_uc002kfk.2_Intron	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a							lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TTCACTCTTTCTGTCACTGTA	0.448													9	34	---	---	---	---	PASS
FN3K	64122	broad.mit.edu	37	17	80708353	80708353	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80708353C>G	uc010wvs.1	+	6	713	c.652C>G	c.(652-654)CTC>GTC	p.L218V	TBCD_uc002kfx.1_5'Flank|TBCD_uc002kfy.1_5'Flank|TBCD_uc002kfz.2_5'Flank	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	218					fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CCACGGGGATCTCTGGTCGGG	0.567													16	118	---	---	---	---	PASS
EMILIN2	84034	broad.mit.edu	37	18	2892402	2892402	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2892402G>C	uc002kln.2	+	4	2436	c.2277G>C	c.(2275-2277)AAG>AAC	p.K759N		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2 precursor	759					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)		CTGGCCTGAAGAATTCAGTCC	0.468													14	48	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7024444	7024444	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7024444G>C	uc002knm.2	-	18	2518	c.2424C>G	c.(2422-2424)CTC>CTG	p.L808L	LAMA1_uc010wzj.1_Silent_p.L284L	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	808	Laminin EGF-like 7.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTCCATCATTGAGGTGGCAGG	0.438													3	17	---	---	---	---	PASS
NAPG	8774	broad.mit.edu	37	18	10526073	10526073	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10526073C>G	uc002kon.2	+	1					NAPG_uc010wzr.1_5'UTR|NAPG_uc002koo.2_5'UTR	NM_003826	NP_003817	Q99747	SNAG_HUMAN	N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein complex assembly|protein stabilization	membrane|membrane fraction|mitochondrion	protein binding				0						GTCACCCTCTCTCCACGTCAG	0.597													3	18	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33780103	33780103	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33780103C>T	uc002kzq.3	+	4	780	c.757C>T	c.(757-759)CAC>TAC	p.H253Y		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	253					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CCTGTCAGCTCACCAGGCCGA	0.587													14	37	---	---	---	---	PASS
C18orf22	79863	broad.mit.edu	37	18	77794586	77794586	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77794586G>A	uc002lns.2	+	1	229	c.91G>A	c.(91-93)GAG>AAG	p.E31K	TXNL4A_uc010drg.2_5'Flank|C18orf22_uc010drh.2_Missense_Mutation_p.E31K|C18orf22_uc010dri.1_RNA	NM_024805	NP_079081	Q8N0V3	RBFA_HUMAN	hypothetical protein LOC79863 precursor	31					rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)		TCCAGGCTGCGAGCGGGGACT	0.682													11	17	---	---	---	---	PASS
PARD6G	84552	broad.mit.edu	37	18	78005253	78005253	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:78005253C>T	uc002lny.2	-	1					PARD6G_uc010xfp.1_5'UTR	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein						cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		CGGTCAGCCTCGCCGTCGCCC	0.453													8	25	---	---	---	---	PASS
RPS15	6209	broad.mit.edu	37	19	1440120	1440120	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1440120G>A	uc002lsp.1	+	3	254	c.192G>A	c.(190-192)AAG>AAA	p.K64K	RPS15_uc002lsq.1_Silent_p.K71K	NM_001018	NP_001009	P62841	RS15_HUMAN	ribosomal protein S15	64					endocrine pancreas development|ribosomal small subunit export from nucleus|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	DNA binding|protein binding|RNA binding				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAAGGCCAAGAAGGAGGCGC	0.662													3	12	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2210632	2210632	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2210632G>T	uc002lvb.3	+	14	1165	c.1129G>T	c.(1129-1131)GAG>TAG	p.E377*	DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	377						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTGGTGCTGAGGAAGAGAA	0.632													19	148	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2210638	2210638	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2210638G>A	uc002lvb.3	+	14	1171	c.1135G>A	c.(1135-1137)GAG>AAG	p.E379K	DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	379						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTGAGGAAGAGAAGGCGGG	0.642													20	151	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2210754	2210754	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2210754G>A	uc002lvb.3	+	14	1287	c.1251G>A	c.(1249-1251)ATG>ATA	p.M417I	DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	417						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAAGAAGATGAACACTGCGA	0.617													10	66	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2213597	2213597	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2213597G>A	uc002lvb.3	+	17	1653	c.1617G>A	c.(1615-1617)CAG>CAA	p.Q539Q	DOT1L_uc002lvc.1_5'UTR|uc002lvd.1_RNA|DOT1L_uc002lve.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	539						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGCCCAGAAGGAGGAGA	0.632													6	51	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2213760	2213760	+	Intron	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2213760G>T	uc002lvb.3	+						DOT1L_uc002lvc.1_Intron|uc002lvd.1_RNA|DOT1L_uc002lve.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase							nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGTCCCAGGGGCTGGGCTG	0.662													6	26	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2213856	2213856	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2213856G>A	uc002lvb.3	+	18	1704	c.1668G>A	c.(1666-1668)GTG>GTA	p.V556V	DOT1L_uc002lvc.1_5'UTR|uc002lvd.1_RNA|DOT1L_uc002lve.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	556						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCTGGGTGTGAAGGCGCTGA	0.642													8	66	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2216484	2216484	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2216484G>A	uc002lvb.3	+	20	2164	c.2128G>A	c.(2128-2130)GAG>AAG	p.E710K	DOT1L_uc002lvc.1_Missense_Mutation_p.E4K|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Missense_Mutation_p.E4K	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	710						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATGAGCCCGGAGCTCTCCAT	0.672													12	47	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2216699	2216699	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2216699G>A	uc002lvb.3	+	20	2379	c.2343G>A	c.(2341-2343)CTG>CTA	p.L781L	DOT1L_uc002lvc.1_Silent_p.L75L|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Silent_p.L75L	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	781						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATTGTGCTGAGGCGGCACC	0.692													7	61	---	---	---	---	PASS
ZBTB7A	51341	broad.mit.edu	37	19	4048050	4048050	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4048050G>A	uc002lzh.2	-	3	1530	c.1455C>T	c.(1453-1455)CTC>CTT	p.L485L	ZBTB7A_uc002lzi.2_Silent_p.L485L	NM_015898	NP_056982	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	485	C2H2-type 4; atypical.				cell differentiation|multicellular organismal development|transcription, DNA-dependent	nucleus	DNA binding|histone acetyltransferase binding|zinc ion binding			pancreas(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCTTTCTTGAGGTGTCTGT	0.408													6	23	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7676406	7676406	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7676406C>T	uc002mgv.3	+	10	1228	c.1127C>T	c.(1126-1128)TCC>TTC	p.S376F	KIAA1543_uc002mgu.3_Missense_Mutation_p.S403F	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	376					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CCCCCAGGCTCCCTGAAGTCT	0.632													3	5	---	---	---	---	PASS
KIAA1543	57662	broad.mit.edu	37	19	7676584	7676584	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7676584C>G	uc002mgv.3	+	11	1306	c.1205C>G	c.(1204-1206)TCC>TGC	p.S402C	KIAA1543_uc002mgu.3_Missense_Mutation_p.S429C|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	402					epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1						CGTCCCCTCTCCCAGGCTGTG	0.692													3	10	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9075858	9075858	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9075858C>G	uc002mkp.2	-	3	11792	c.11588G>C	c.(11587-11589)AGA>ACA	p.R3863T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3864	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGATGTAGCTCTTGCCTCTGT	0.453													10	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	9801569	9801569	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9801569G>C	uc010xkx.1	-	3	921	c.298C>G	c.(298-300)CAT>GAT	p.H100D						RecName: Full=Zinc finger protein 562;																		TGTGAGGAATGAGTGATGGCT	0.363													4	19	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10270621	10270621	+	Intron	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10270621G>A	uc002mng.2	-						DNMT1_uc010xlc.1_Intron|DNMT1_uc002mnh.2_Intron|DNMT1_uc010xld.1_Intron|DNMT1_uc002mnk.2_RNA	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	GAACACAGATGATGGCACTCA	0.592													10	93	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10270656	10270656	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10270656G>C	uc002mng.2	-						DNMT1_uc010xlc.1_Intron|DNMT1_uc002mnh.2_Intron|DNMT1_uc010xld.1_Intron|DNMT1_uc002mnk.2_RNA	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	GCCGCCTCGTGAGCGCCGCCA	0.557													11	86	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10478793	10478793	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10478793C>G	uc002moc.3	-	5	781	c.403G>C	c.(403-405)GAT>CAT	p.D135H	TYK2_uc010dxe.2_Intron|TYK2_uc002mod.2_Missense_Mutation_p.D135H	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	135	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCTGTCTGATCTGAGGATGCC	0.567													9	27	---	---	---	---	PASS
DOCK6	57572	broad.mit.edu	37	19	11343960	11343960	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11343960C>G	uc002mqs.3	-	22	2678	c.2637G>C	c.(2635-2637)AAG>AAC	p.K879N	DOCK6_uc010xlq.1_Missense_Mutation_p.K183N	NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	879					blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						TGCTGATGCTCTTGGAACGCG	0.657													12	23	---	---	---	---	PASS
ZNF844	284391	broad.mit.edu	37	19	12188503	12188503	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12188503G>A	uc002mtb.2	+	4					ZNF844_uc010dym.1_3'UTR	NM_001136501	NP_001129973	Q08AG5	ZN844_HUMAN	zinc finger protein 844						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTGGTGCATGAAAGGACTCA	0.398													3	17	---	---	---	---	PASS
RNASEH2A	10535	broad.mit.edu	37	19	12918001	12918001	+	Intron	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12918001C>G	uc002mvg.1	+						RNASEH2A_uc002mvf.1_5'UTR	NM_006397	NP_006388	O75792	RNH2A_HUMAN	ribonuclease H2, large subunit						DNA replication|RNA catabolic process	nucleus|ribonuclease H2 complex	metal ion binding|ribonuclease H activity|RNA binding			breast(2)|central_nervous_system(1)	3						TTCCCCTTCTCTTCCAAACCT	0.582													5	32	---	---	---	---	PASS
RNASEH2A	10535	broad.mit.edu	37	19	12918015	12918015	+	Intron	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12918015C>A	uc002mvg.1	+						RNASEH2A_uc002mvf.1_5'UTR	NM_006397	NP_006388	O75792	RNH2A_HUMAN	ribonuclease H2, large subunit						DNA replication|RNA catabolic process	nucleus|ribonuclease H2 complex	metal ion binding|ribonuclease H activity|RNA binding			breast(2)|central_nervous_system(1)	3						CAAACCTCCTCCCAGACTCAA	0.572													8	49	---	---	---	---	PASS
CCDC130	81576	broad.mit.edu	37	19	13873412	13873412	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13873412G>A	uc002mxb.1	+	11	1224	c.721G>A	c.(721-723)GAC>AAC	p.D241N	CCDC130_uc002mxc.1_Missense_Mutation_p.D241N|CCDC130_uc002mxd.1_Missense_Mutation_p.D96N|CCDC130_uc010dzf.1_Missense_Mutation_p.D135N|MRI1_uc002mxe.2_5'Flank|MRI1_uc002mxf.2_5'Flank	NM_030818	NP_110445	P13994	CC130_HUMAN	coiled-coil domain containing 130	241					response to virus		protein binding				0			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			AGCCTACGAGGACAAGCAGAA	0.622													3	25	---	---	---	---	PASS
AKAP8L	26993	broad.mit.edu	37	19	15510131	15510131	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15510131C>T	uc002naw.1	-	9	1238	c.1139G>A	c.(1138-1140)CGA>CAA	p.R380Q	AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Missense_Mutation_p.R319Q	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	380						cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						CATGCGGTCTCGCTGCCGCTT	0.617													9	42	---	---	---	---	PASS
OR10H1	26539	broad.mit.edu	37	19	15918161	15918161	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15918161G>C	uc002nbq.2	-	1	776	c.687C>G	c.(685-687)ATC>ATG	p.I229M		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	229	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CAGCAGAAGGGATCTTCAAGA	0.567													9	51	---	---	---	---	PASS
NWD1	284434	broad.mit.edu	37	19	16860125	16860125	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16860125C>T	uc002neu.3	+	6	1094	c.672C>T	c.(670-672)CTC>CTT	p.L224L	NWD1_uc002net.3_Silent_p.L89L|NWD1_uc002nev.3_Silent_p.L18L			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	224							ATP binding			skin(3)|ovary(2)|pancreas(2)	7						AGAACCTTCTCAGCAGCCTCA	0.587													21	57	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17311468	17311468	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17311468C>T	uc010eak.2	+	26	4545	c.4393C>T	c.(4393-4395)CGC>TGC	p.R1465C	MYO9B_uc002nfi.2_Missense_Mutation_p.R1465C|MYO9B_uc002nfj.1_Missense_Mutation_p.R1465C|MYO9B_uc002nfl.1_Missense_Mutation_p.R14C	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1465	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ACAGCAGCATCGCCACGCTGC	0.602													6	15	---	---	---	---	PASS
FAM125A	93343	broad.mit.edu	37	19	17535916	17535916	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17535916C>T	uc002ngo.1	+	9					FAM125A_uc002ngp.1_3'UTR|FAM125A_uc002ngq.1_3'UTR	NM_138401	NP_612410	Q96EY5	F125A_HUMAN	family with sequence similarity 125, member A						protein transport	late endosome membrane|microtubule organizing center|nucleus	SH3 domain binding				0						TGGGAACCTTCGCCCTGCAAG	0.697											OREG0025346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	10	---	---	---	---	PASS
COMP	1311	broad.mit.edu	37	19	18896563	18896563	+	Missense_Mutation	SNP	C	T	T	rs145034923		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18896563C>T	uc002nke.2	-	14	1624	c.1588G>A	c.(1588-1590)GAC>AAC	p.D530N	COMP_uc002nkd.2_Missense_Mutation_p.D497N|COMP_uc010xqj.1_Missense_Mutation_p.D477N	NM_000095	NP_000086	P49747	COMP_HUMAN	cartilage oligomeric matrix protein precursor	530	Mediates cell survival and induction of the IAP family of survival proteins.				anti-apoptosis|apoptosis|cell adhesion|limb development	extracellular space|proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent|heparan sulfate proteoglycan binding|heparin binding				0						GCCCTGAAGTCGGTGAGCGTG	0.627													16	29	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23926476	23926476	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23926476C>T	uc002nrk.3	-	4	2018	c.1876G>A	c.(1876-1878)GAT>AAT	p.D626N	ZNF681_uc002nrl.3_Missense_Mutation_p.D557N|ZNF681_uc002nrj.3_Missense_Mutation_p.D557N	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	626					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTTCAAAATCACTGTTACAT	0.308													7	8	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23926861	23926861	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23926861C>G	uc002nrk.3	-	4	1633	c.1491G>C	c.(1489-1491)AAG>AAC	p.K497N	ZNF681_uc002nrl.3_Missense_Mutation_p.K428N|ZNF681_uc002nrj.3_Missense_Mutation_p.K428N	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	497	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TATGAATTCTCTTATGTGTAG	0.358													20	55	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23927978	23927978	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23927978C>G	uc002nrk.3	-	4	516	c.374G>C	c.(373-375)GGA>GCA	p.G125A	ZNF681_uc002nrl.3_Missense_Mutation_p.G56A|ZNF681_uc002nrj.3_Missense_Mutation_p.G56A	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	125					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATTATAACCTCCTTTTTGCAC	0.294													7	24	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039228	31039228	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039228G>A	uc002nsu.1	+	4	2840	c.2702G>A	c.(2701-2703)GGA>GAA	p.G901E	ZNF536_uc010edd.1_Missense_Mutation_p.G901E	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	901					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TCTGAGATCGGAAGAGCTTAT	0.512													33	202	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33089074	33089074	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33089074C>G	uc002ntn.1	-	29	3286	c.3130G>C	c.(3130-3132)GAG>CAG	p.E1044Q		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	1044					early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					GCACTAACCTCTTGGGGAGTG	0.587													42	58	---	---	---	---	PASS
MLL4	9757	broad.mit.edu	37	19	36218436	36218436	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36218436G>C	uc010eei.2	+	17	4215	c.4215G>C	c.(4213-4215)CTG>CTC	p.L1405L		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	1405					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGAGGCCCTGAGCGGGGCCC	0.687													16	118	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36322010	36322010	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36322010C>T	uc002oby.2	-	27	3426	c.3426G>A	c.(3424-3426)CTG>CTA	p.L1142L	NPHS1_uc010eem.1_RNA	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	1142	Cytoplasmic (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGAAGTCCCTCAGGGAGCGGT	0.587													15	145	---	---	---	---	PASS
ZNF567	163081	broad.mit.edu	37	19	37211048	37211048	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37211048G>A	uc010xtl.1	+	6	1644	c.1422G>A	c.(1420-1422)GAG>GAA	p.E474E	ZNF567_uc002oeo.1_Silent_p.E474E|ZNF567_uc010xtk.1_Silent_p.E474E|ZNF567_uc002oep.3_Silent_p.E443E|ZNF567_uc002oeq.1_Silent_p.E443E	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	474					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATACAGGGGAGAAATCTTATG	0.418													36	51	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38976369	38976369	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38976369C>G	uc002oit.2	+	34	5204	c.5074C>G	c.(5074-5076)CAG>GAG	p.Q1692E	RYR1_uc002oiu.2_Missense_Mutation_p.Q1692E	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1692	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	AGACCAAGCTCAGCTGCTGCA	0.667													39	81	---	---	---	---	PASS
ACTN4	81	broad.mit.edu	37	19	39219769	39219769	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39219769C>T	uc002oja.1	+	20	2611	c.2552C>T	c.(2551-2553)TCC>TTC	p.S851F	ACTN4_uc002ojb.1_Missense_Mutation_p.S173F	NM_004924	NP_004915	O43707	ACTN4_HUMAN	actinin, alpha 4	851					platelet activation|platelet degranulation|positive regulation of cellular component movement|positive regulation of sodium:hydrogen antiporter activity|protein transport|regulation of apoptosis	extracellular region|nucleolus|perinuclear region of cytoplasm|platelet alpha granule lumen|protein complex|pseudopodium|ribonucleoprotein complex	actin filament binding|calcium ion binding|integrin binding|nucleoside binding|protein homodimerization activity				0	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GTCATCGCTTCCTTCAAGGTC	0.637													10	89	---	---	---	---	PASS
CAPN12	147968	broad.mit.edu	37	19	39234873	39234873	+	5'UTR	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39234873C>G	uc002ojd.1	-	1						NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CGGGGCCTCTCTTCCATTGGA	0.592													3	36	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39329505	39329505	+	Intron	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39329505C>G	uc010xul.1	-						HNRNPL_uc010ege.1_Intron|HNRNPL_uc002ojj.1_Intron|HNRNPL_uc002ojo.1_Intron|HNRNPL_uc002ojk.2_Intron|HNRNPL_uc002ojl.2_Intron|HNRNPL_uc010xum.1_Intron|HNRNPL_uc002ojp.1_3'UTR	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L						nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			CCCTGTACCTCTGCTGCCCTC	0.567													17	131	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39361468	39361468	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39361468C>A	uc002ojq.2	-	8	812	c.424G>T	c.(424-426)GAG>TAG	p.E142*	RINL_uc002ojr.1_5'Flank|RINL_uc010xuo.1_Nonsense_Mutation_p.E256*	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	142							GTPase activator activity			pancreas(1)	1						AGCACGTCCTCAGGGCCTTCC	0.622													53	61	---	---	---	---	PASS
RINL	126432	broad.mit.edu	37	19	39361736	39361736	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39361736C>T	uc002ojq.2	-	7	629	c.241G>A	c.(241-243)GCT>ACT	p.A81T	RINL_uc002ojr.1_5'Flank|RINL_uc010xuo.1_Missense_Mutation_p.A195T	NM_198445	NP_940847	Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	81							GTPase activator activity			pancreas(1)	1						TGTCTCTGAGCAGCCTCTGGC	0.622													62	94	---	---	---	---	PASS
FBXO27	126433	broad.mit.edu	37	19	39521863	39521863	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39521863G>A	uc002okh.2	-	3	544	c.462C>T	c.(460-462)TTC>TTT	p.F154F		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	154	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			ATGAAGTCACGAAGCACGTCT	0.582													19	140	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40902869	40902869	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40902869G>A	uc002onr.2	-	7	1659	c.1390C>T	c.(1390-1392)CGA>TGA	p.R464*	PRX_uc002onq.2_Nonsense_Mutation_p.R325*|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	464	5.|55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCTGGGAGTCGAACCTCTGGA	0.612													70	145	---	---	---	---	PASS
ADCK4	79934	broad.mit.edu	37	19	41209631	41209631	+	Missense_Mutation	SNP	C	T	T	rs146225943	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41209631C>T	uc002oor.2	-	8	1008	c.706G>A	c.(706-708)GTG>ATG	p.V236M	ADCK4_uc002oop.1_5'Flank|ADCK4_uc002ooq.1_Missense_Mutation_p.V195M	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a	236	Protein kinase.					integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			TGGATCTTCACGGCCACCTCC	0.522													6	70	---	---	---	---	PASS
TMEM145	284339	broad.mit.edu	37	19	42819374	42819374	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42819374C>G	uc002otk.1	+	7	592	c.540C>G	c.(538-540)ATC>ATG	p.I180M		NM_173633	NP_775904	Q8NBT3	TM145_HUMAN	transmembrane protein 145	180	Helical; (Potential).					integral to membrane					0		Prostate(69;0.00682)				tcctcctcatcttcatcctca	0.463													15	75	---	---	---	---	PASS
C19orf61	56006	broad.mit.edu	37	19	44235749	44235749	+	Nonstop_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44235749C>G	uc002oxj.2	-	14	1905	c.1562G>C	c.(1561-1563)TGA>TCA	p.*521S		NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN	SMG9 protein	521					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding				0		Prostate(69;0.0352)				TCCTTGGCCTCAGGCCAGCAG	0.637													12	70	---	---	---	---	PASS
C19orf61	56006	broad.mit.edu	37	19	44236886	44236886	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44236886G>C	uc002oxj.2	-						C19orf61_uc002oxk.2_3'UTR	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN	SMG9 protein						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding				0		Prostate(69;0.0352)				CACTGTTCCAGAAAAGGAACC	0.443													7	26	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46330779	46330779	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46330779C>T	uc002pdn.2	-	16	2415	c.2170G>A	c.(2170-2172)GAG>AAG	p.E724K	SYMPK_uc002pdo.1_Missense_Mutation_p.E724K|SYMPK_uc002pdp.1_Missense_Mutation_p.E724K	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	724					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TTGTCCTTCTCATGGGAGCTG	0.597													13	32	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47207801	47207801	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47207801G>A	uc002pfh.2	-	5	959	c.617C>T	c.(616-618)TCG>TTG	p.S206L	PRKD2_uc002pfg.2_Missense_Mutation_p.S49L|PRKD2_uc002pfi.2_Missense_Mutation_p.S206L|PRKD2_uc002pfj.2_Missense_Mutation_p.S206L|PRKD2_uc010xye.1_Missense_Mutation_p.S206L|PRKD2_uc002pfk.2_Missense_Mutation_p.S49L	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	206					cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GAGGCGCACCGAGTGGCCACT	0.657											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	55	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47425167	47425167	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47425167C>T	uc010ekv.2	+	1	3235	c.3235C>T	c.(3235-3237)CAG>TAG	p.Q1079*		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	1079					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		CTGGCTGCCTCAGGATGGGTT	0.478													28	24	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47856690	47856690	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47856690C>G	uc010xyn.1	+	2	744	c.403C>G	c.(403-405)CGA>GGA	p.R135G	DHX34_uc010elc.1_Missense_Mutation_p.R135G	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	135						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		TGAGTTCCGCCGAGCCCTGTT	0.652													10	119	---	---	---	---	PASS
KDELR1	10945	broad.mit.edu	37	19	48892915	48892915	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48892915G>A	uc002pjb.1	-	3	441	c.246C>T	c.(244-246)TTC>TTT	p.F82F	KDELR1_uc002pja.1_Silent_p.F20F	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum	82	Cytoplasmic (Potential).				intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		AAGTAGCTTTGAACTTGCTAT	0.532													12	74	---	---	---	---	PASS
FAM83E	54854	broad.mit.edu	37	19	49113235	49113235	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49113235C>T	uc002pjn.2	-	3	721	c.656G>A	c.(655-657)CGG>CAG	p.R219Q		NM_017708	NP_060178	Q2M2I3	FA83E_HUMAN	hypothetical protein LOC54854	219										ovary(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GCTGCAGCCCCGCACGACACG	0.627													24	15	---	---	---	---	PASS
BAX	581	broad.mit.edu	37	19	49458852	49458852	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49458852C>T	uc002plk.2	+	2	151	c.82C>T	c.(82-84)CAG>TAG	p.Q28*	BAX_uc002plf.1_Nonsense_Mutation_p.Q28*|BAX_uc002plg.1_Intron|BAX_uc002plh.1_Intron|BAX_uc010xzx.1_RNA|BAX_uc002plj.2_Nonsense_Mutation_p.Q28*|BAX_uc002pll.2_Nonsense_Mutation_p.Q28*|BAX_uc002plm.2_Intron	NM_138761	NP_620116	Q07812	BAX_HUMAN	BCL2-associated X protein isoform alpha	28					activation of caspase activity by cytochrome c|activation of pro-apoptotic gene products|B cell apoptosis|cleavage of lamin|DNA fragmentation involved in apoptotic nuclear change|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|induction of retinal programmed cell death|mitochondrial fragmentation involved in apoptosis|mitochondrial fusion|negative regulation of protein binding|negative regulation of survival gene product expression|nuclear fragmentation involved in apoptotic nuclear change|positive regulation of neuron apoptosis|protein homooligomerization|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria|release of matrix enzymes from mitochondria|response to toxin|transformed cell apoptosis	cytosol|endoplasmic reticulum membrane|mitochondrial outer membrane|mitochondrial permeability transition pore complex|nucleus	BH3 domain binding|channel activity|lipid binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		CCTTTTGCTTCAGGGGTGAGT	0.527													52	59	---	---	---	---	PASS
BAX	581	broad.mit.edu	37	19	49464129	49464129	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49464129C>T	uc002plk.2	+	5	501	c.432C>T	c.(430-432)CTC>CTT	p.L144L	BAX_uc002plf.1_Silent_p.L144L|BAX_uc002plg.1_Silent_p.L107L|BAX_uc002plh.1_Silent_p.L66L|BAX_uc010xzx.1_RNA|BAX_uc002plj.2_Silent_p.L144L|BAX_uc002pll.2_Silent_p.L95L|BAX_uc002plm.2_Silent_p.L66L	NM_138761	NP_620116	Q07812	BAX_HUMAN	BCL2-associated X protein isoform alpha	144					activation of caspase activity by cytochrome c|activation of pro-apoptotic gene products|B cell apoptosis|cleavage of lamin|DNA fragmentation involved in apoptotic nuclear change|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|induction of retinal programmed cell death|mitochondrial fragmentation involved in apoptosis|mitochondrial fusion|negative regulation of protein binding|negative regulation of survival gene product expression|nuclear fragmentation involved in apoptotic nuclear change|positive regulation of neuron apoptosis|protein homooligomerization|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria|release of matrix enzymes from mitochondria|response to toxin|transformed cell apoptosis	cytosol|endoplasmic reticulum membrane|mitochondrial outer membrane|mitochondrial permeability transition pore complex|nucleus	BH3 domain binding|channel activity|lipid binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		TGGACTTCCTCCGGGAGCGGC	0.483													45	46	---	---	---	---	PASS
BAX	581	broad.mit.edu	37	19	49464256	49464256	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49464256C>T	uc002plk.2	+						BAX_uc002plf.1_Silent_p.L187L|BAX_uc002plg.1_Silent_p.L150L|BAX_uc002plh.1_Silent_p.L109L|BAX_uc010xzx.1_Intron|BAX_uc002plj.2_Intron|BAX_uc002pll.2_Intron|BAX_uc002plm.2_Intron	NM_138761	NP_620116	Q07812	BAX_HUMAN	BCL2-associated X protein isoform alpha						activation of caspase activity by cytochrome c|activation of pro-apoptotic gene products|B cell apoptosis|cleavage of lamin|DNA fragmentation involved in apoptotic nuclear change|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|induction of retinal programmed cell death|mitochondrial fragmentation involved in apoptosis|mitochondrial fusion|negative regulation of protein binding|negative regulation of survival gene product expression|nuclear fragmentation involved in apoptotic nuclear change|positive regulation of neuron apoptosis|protein homooligomerization|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria|release of matrix enzymes from mitochondria|response to toxin|transformed cell apoptosis	cytosol|endoplasmic reticulum membrane|mitochondrial outer membrane|mitochondrial permeability transition pore complex|nucleus	BH3 domain binding|channel activity|lipid binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		CGCCACTCCTCTGGGACCCTG	0.403													28	37	---	---	---	---	PASS
BAX	581	broad.mit.edu	37	19	49464317	49464317	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49464317C>T	uc002plk.2	+						BAX_uc002plf.1_Missense_Mutation_p.S207L|BAX_uc002plg.1_Missense_Mutation_p.S170L|BAX_uc002plh.1_Missense_Mutation_p.S129L|BAX_uc010xzx.1_Intron|BAX_uc002plj.2_Intron|BAX_uc002pll.2_Intron|BAX_uc002plm.2_Intron	NM_138761	NP_620116	Q07812	BAX_HUMAN	BCL2-associated X protein isoform alpha						activation of caspase activity by cytochrome c|activation of pro-apoptotic gene products|B cell apoptosis|cleavage of lamin|DNA fragmentation involved in apoptotic nuclear change|establishment or maintenance of transmembrane electrochemical gradient|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|induction of retinal programmed cell death|mitochondrial fragmentation involved in apoptosis|mitochondrial fusion|negative regulation of protein binding|negative regulation of survival gene product expression|nuclear fragmentation involved in apoptotic nuclear change|positive regulation of neuron apoptosis|protein homooligomerization|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|release of cytochrome c from mitochondria|release of matrix enzymes from mitochondria|response to toxin|transformed cell apoptosis	cytosol|endoplasmic reticulum membrane|mitochondrial outer membrane|mitochondrial permeability transition pore complex|nucleus	BH3 domain binding|channel activity|lipid binding|protein heterodimerization activity|protein homodimerization activity			lung(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000159)|all cancers(93;0.00047)|GBM - Glioblastoma multiforme(486;0.018)|Epithelial(262;0.0279)		TTCAGATCATCAGATGTGGTC	0.473													38	49	---	---	---	---	PASS
RUVBL2	10856	broad.mit.edu	37	19	49510338	49510338	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49510338C>T	uc002plr.1	+	5	342	c.329C>T	c.(328-330)TCC>TTC	p.S110F	RUVBL2_uc002plq.1_Missense_Mutation_p.S65F|RUVBL2_uc010yab.1_Missense_Mutation_p.S110F|RUVBL2_uc002pls.1_RNA|RUVBL2_uc010emn.1_Missense_Mutation_p.S65F|RUVBL2_uc010yac.1_Missense_Mutation_p.S65F	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2	110					cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		GAAATCTTCTCCCTGGAGATG	0.657													15	71	---	---	---	---	PASS
MED25	81857	broad.mit.edu	37	19	50334032	50334032	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50334032C>G	uc002ppw.1	+	9	1042	c.989C>G	c.(988-990)CCA>CGA	p.P330R	MED25_uc010ybe.1_Missense_Mutation_p.P117R|MED25_uc002ppx.1_Missense_Mutation_p.P111R	NM_030973	NP_112235	Q71SY5	MED25_HUMAN	mediator complex subunit 25	330	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm				ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CAACTACCCCCAGGACCCCCT	0.706													40	38	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52724377	52724377	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52724377C>T	uc002pyp.2	+	12	1668	c.1509C>T	c.(1507-1509)TTC>TTT	p.F503F	PPP2R1A_uc010ydk.1_Silent_p.F448F|PPP2R1A_uc002pyq.2_Silent_p.F324F	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	503	PP2A subunit C binding.|HEAT 13.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTACGCTCTTCTGCATCAATG	0.592			Mis		clear cell ovarian carcinoma								57	64	---	---	---	---	PASS
ZNF808	388558	broad.mit.edu	37	19	53057257	53057257	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53057257G>C	uc010epq.1	+	5	1265	c.1088G>C	c.(1087-1089)AGA>ACA	p.R363T	ZNF808_uc002pzq.2_RNA|ZNF808_uc010epr.1_5'Flank	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	363	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CGCCATCAAAGACTTCATACT	0.383													7	121	---	---	---	---	PASS
BIRC8	112401	broad.mit.edu	37	19	53793212	53793212	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53793212G>C	uc002qbk.2	-	1	1664	c.416C>G	c.(415-417)TCT>TGT	p.S139C		NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8	139					apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)		GTTGCTCCCAGATGTTTGAAT	0.383													23	210	---	---	---	---	PASS
ZNF845	91664	broad.mit.edu	37	19	53857394	53857394	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53857394C>T	uc010ydv.1	+	4					ZNF845_uc010ydw.1_3'UTR	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AATTAGACATCAGAGAATCCA	0.388													5	10	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55263168	55263168	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55263168C>G	uc002qgv.2	+	6	801	c.783C>G	c.(781-783)CTC>CTG	p.L261L	KIR2DL3_uc002qgx.2_Silent_p.L261L|KIR2DL3_uc002qgy.2_Silent_p.L163L|KIR2DL3_uc010erw.1_Silent_p.L261L|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	261	Helical; (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		tcctcctcctcttctttctcc	0.423													21	133	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55441934	55441934	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55441934T>A	uc002qih.3	-	9	2819	c.2743A>T	c.(2743-2745)ATA>TTA	p.I915L	NLRP7_uc002qig.3_Missense_Mutation_p.I887L|NLRP7_uc002qii.3_Missense_Mutation_p.I915L|NLRP7_uc010esk.2_Missense_Mutation_p.I915L|NLRP7_uc010esl.2_Missense_Mutation_p.I943L	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	915	LRR 8.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CCACGAGCTATCTGGTTGATA	0.418													14	154	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55624149	55624149	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55624149C>T	uc002qix.2	-	2	352	c.336G>A	c.(334-336)GAG>GAA	p.E112E	PPP1R12C_uc010yfs.1_Silent_p.E38E|PPP1R12C_uc002qiy.2_Silent_p.E112E	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	112	ANK 1.					cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CCTCCAGGTTCTCATCAATGC	0.647													8	90	---	---	---	---	PASS
U2AF2	11338	broad.mit.edu	37	19	56180822	56180822	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56180822C>G	uc002qlu.2	+	11	2112	c.1057C>G	c.(1057-1059)CAG>GAG	p.Q353E	U2AF2_uc002qlt.2_Missense_Mutation_p.Q349E	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2	353					mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CACCATCAATCAGACGCCTGT	0.662													19	23	---	---	---	---	PASS
ZNF471	57573	broad.mit.edu	37	19	57037351	57037351	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57037351C>T	uc002qnh.2	+	5						NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		CTTTAGTTATCACCAATCCCC	0.338													7	38	---	---	---	---	PASS
ZNF671	79891	broad.mit.edu	37	19	58232514	58232514	+	Missense_Mutation	SNP	C	G	G	rs144079819		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58232514C>G	uc002qpz.3	-	4	1039	c.940G>C	c.(940-942)GAG>CAG	p.E314Q	ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Missense_Mutation_p.E237Q|ZNF671_uc010yhf.1_Missense_Mutation_p.E216Q	NM_024833	NP_079109	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	314	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCGTTACACTCATAAGGCCTT	0.493													12	126	---	---	---	---	PASS
ZNF671	79891	broad.mit.edu	37	19	58233027	58233027	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58233027C>G	uc002qpz.3	-	4	526	c.427G>C	c.(427-429)GAG>CAG	p.E143Q	ZNF776_uc002qpx.2_Intron|ZNF671_uc010eug.2_Missense_Mutation_p.E66Q|ZNF671_uc010yhf.1_Missense_Mutation_p.E45Q	NM_024833	NP_079109	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	143					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATGCTCTGCTCAGAAGATACC	0.468													11	92	---	---	---	---	PASS
ZNF544	27300	broad.mit.edu	37	19	58772988	58772988	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58772988C>T	uc010euo.2	+	7	1490	c.1016C>T	c.(1015-1017)TCA>TTA	p.S339L	ZNF544_uc010yhw.1_RNA|ZNF544_uc010yhx.1_Missense_Mutation_p.S311L|ZNF544_uc010yhy.1_Missense_Mutation_p.S311L|ZNF544_uc002qrt.3_Missense_Mutation_p.S197L|ZNF544_uc002qru.3_Missense_Mutation_p.S197L|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	339					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		CCCATGGCCTCATCTTTTTCT	0.473													22	62	---	---	---	---	PASS
ZNF584	201514	broad.mit.edu	37	19	58927283	58927283	+	Intron	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58927283G>C	uc002qsp.2	+						ZNF584_uc010yia.1_RNA|ZNF584_uc002qsr.2_Intron|ZNF584_uc010yib.1_Missense_Mutation_p.L122F	NM_173548	NP_775819	Q8IVC4	ZN584_HUMAN	zinc finger protein 584						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		TGCGTGTCTTGAAATGTGCAC	0.463													3	82	---	---	---	---	PASS
SLC27A5	10998	broad.mit.edu	37	19	59009810	59009810	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59009810G>A	uc002qtc.2	-	10					SLC27A5_uc002qtb.2_Intron	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid						bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		GGCCCAGGATGAAAGGGACAC	0.582													3	10	---	---	---	---	PASS
TRIM28	10155	broad.mit.edu	37	19	59060782	59060782	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59060782G>A	uc002qtg.1	+	13	2036	c.1747G>A	c.(1747-1749)GAG>AAG	p.E583K	TRIM28_uc010eut.1_Missense_Mutation_p.E501K|TRIM28_uc002qth.1_Missense_Mutation_p.E198K	NM_005762	NP_005753	Q13263	TIF1B_HUMAN	tripartite motif-containing 28 protein	583					epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	nucleoplasm	chromo shadow domain binding|ligase activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GGCTCTTGCGGAGGGTCCTGG	0.652													25	159	---	---	---	---	PASS
CSNK2A1	1457	broad.mit.edu	37	20	469330	469330	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:469330G>C	uc002wdw.1	-	11	1209	c.816C>G	c.(814-816)ATC>ATG	p.I272M	CSNK2A1_uc002wdx.1_Missense_Mutation_p.I272M|CSNK2A1_uc002wdy.1_Missense_Mutation_p.I136M	NM_177559	NP_808227	P68400	CSK21_HUMAN	casein kinase II alpha 1 subunit isoform a	272	Protein kinase.				axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			ACCTGCCCAAGATATCATTGA	0.358													12	51	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3210005	3210005	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3210005G>T	uc002wig.2	-	14	1932	c.1884C>A	c.(1882-1884)TTC>TTA	p.F628L	SLC4A11_uc010zqe.1_Missense_Mutation_p.F655L|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.F612L	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	628	Membrane (bicarbonate transporter).|Cytoplasmic (Potential).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						CGATTTCCCGGAAGCCATGGG	0.667													6	49	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4848512	4848512	+	Silent	SNP	G	A	A	rs72552221	byFrequency	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4848512G>A	uc002wlg.1	-	13	1635	c.1260C>T	c.(1258-1260)TTC>TTT	p.F420F	SLC23A2_uc010zqr.1_Silent_p.F305F|SLC23A2_uc002wlh.1_Silent_p.F420F	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	420				GIFVEGL -> YVPEKTS (in Ref. 10).	L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						GGCCTTCCACGAAAATTCCCC	0.403													7	21	---	---	---	---	PASS
LRRN4	164312	broad.mit.edu	37	20	6022478	6022478	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6022478G>C	uc002wmo.2	-	5	1637	c.1413C>G	c.(1411-1413)ATC>ATG	p.I471M		NM_152611	NP_689824	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4 precursor	471	Extracellular (Potential).					integral to membrane				skin(3)	3						AGGCAGCTGAGATATCAGGCT	0.647													17	74	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17240965	17240965	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17240965G>T	uc002wpm.2	+	2	578	c.258G>T	c.(256-258)AAG>AAT	p.K86N	PCSK2_uc002wpl.2_Missense_Mutation_p.K67N|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	86					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TACACCACAAGCAGCAGCTGG	0.562													12	62	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17600417	17600417	+	5'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17600417C>T	uc010zrp.1	-	1					RRBP1_uc002wpt.1_Intron|RRBP1_uc002wpu.2_Intron|RRBP1_uc002wpv.1_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron			Q9P2E9	RRBP1_HUMAN	Homo sapiens mRNA for KIAA1398 protein, partial cds.						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						CCAGCAGCCTCTGCTCAAAGG	0.622													4	9	---	---	---	---	PASS
CRNKL1	51340	broad.mit.edu	37	20	20031155	20031155	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20031155C>A	uc002wrs.2	-	3	678	c.646G>T	c.(646-648)GAT>TAT	p.D216Y	C20orf26_uc010gcw.1_5'Flank|C20orf26_uc010zse.1_5'Flank|C20orf26_uc002wru.2_5'Flank|CRNKL1_uc002wrt.1_Missense_Mutation_p.D204Y	NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	216					spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						TCTTCTTCATCTGTGATCTTC	0.408													17	42	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23350821	23350821	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23350821G>A	uc010gdb.2	+	7	2053	c.1879G>A	c.(1879-1881)GAA>AAA	p.E627K	GZF1_uc002wsy.2_Missense_Mutation_p.E627K|GZF1_uc010zsq.1_Missense_Mutation_p.E151K|GZF1_uc010zsr.1_Missense_Mutation_p.E136K|GZF1_uc002wsz.2_Missense_Mutation_p.E627K	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	627					transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					ACAGCCTGACGAAGAGTATGT	0.448													9	29	---	---	---	---	PASS
HM13	81502	broad.mit.edu	37	20	30137129	30137129	+	Silent	SNP	C	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30137129C>A	uc002wwe.2	+	6	774	c.660C>A	c.(658-660)GTC>GTA	p.V220V	HM13_uc002wwc.2_Silent_p.V220V|HM13_uc002wwd.2_Silent_p.V220V|HM13_uc002wwf.2_Silent_p.V96V|HM13_uc010gdu.2_Silent_p.V96V	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1	220	Helical; (Potential).				membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			TCTACGATGTCTTCTGGGTGA	0.562													23	167	---	---	---	---	PASS
ZNF341	84905	broad.mit.edu	37	20	32379155	32379155	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32379155G>A	uc002wzy.2	+	15	2417	c.2397G>A	c.(2395-2397)GCG>GCA	p.A799A	ZNF341_uc002wzx.2_Silent_p.A792A|ZNF341_uc010geq.2_Silent_p.A709A|ZNF341_uc010ger.2_RNA|ZNF341_uc002wzz.2_Silent_p.A226A	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	799					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						AGCCGGACGCGGTGCTGTCCA	0.701													6	54	---	---	---	---	PASS
TP53INP2	58476	broad.mit.edu	37	20	33296631	33296631	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33296631G>C	uc002xau.1	+	3	423	c.88G>C	c.(88-90)GAT>CAT	p.D30H		NM_021202	NP_067025	Q8IXH6	T53I2_HUMAN	tumor protein p53 inducible nuclear protein 2	30						nucleus					0						GTCGGAGGAGGATGAAGTGGA	0.652													4	37	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33632447	33632447	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33632447G>A	uc002xbk.2	-	7	760	c.726C>T	c.(724-726)CTC>CTT	p.L242L	TRPC4AP_uc002xbl.2_Silent_p.L242L|TRPC4AP_uc010zur.1_Silent_p.L203L|TRPC4AP_uc002xbm.1_Silent_p.L242L	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	242	Interaction with TNFRSF1A (By similarity).				protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGAAATTAGCGAGCTGCTGCT	0.438													25	129	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34435272	34435272	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34435272G>A	uc002xek.1	+	4	367	c.256G>A	c.(256-258)GAA>AAA	p.E86K	PHF20_uc002xei.1_Missense_Mutation_p.E86K|PHF20_uc010gfo.1_Missense_Mutation_p.E86K|PHF20_uc002xej.1_5'UTR|PHF20_uc002xel.1_5'UTR	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					TGTTTTTTAGGAATTTCAAAT	0.373													18	41	---	---	---	---	PASS
EPB41L1	2036	broad.mit.edu	37	20	34797578	34797578	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34797578A>G	uc002xfb.2	+	15	2008	c.1837A>G	c.(1837-1839)ACG>GCG	p.T613A	EPB41L1_uc002xeu.2_Missense_Mutation_p.T539A|EPB41L1_uc010zvo.1_Missense_Mutation_p.T613A|EPB41L1_uc002xev.2_Missense_Mutation_p.T613A|EPB41L1_uc002xew.2_Missense_Mutation_p.T504A|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.T539A|EPB41L1_uc010gfq.2_Missense_Mutation_p.T712A	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	613					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					GGTCAGCTCTACGTCTAGCCT	0.607													20	24	---	---	---	---	PASS
LBP	3929	broad.mit.edu	37	20	36982714	36982714	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36982714C>G	uc002xic.1	+	4	434	c.399C>G	c.(397-399)GTC>GTG	p.V133V		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	133					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)				ATGTCAGTGTCAAGGGCATCA	0.557													15	121	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37357141	37357141	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37357141C>G	uc002xjc.2	+	2	1700	c.1437C>G	c.(1435-1437)CGC>CGG	p.R479R		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	479	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	TTCACCTGCGCCTGCTCTGGC	0.642													4	52	---	---	---	---	PASS
L3MBTL	26013	broad.mit.edu	37	20	42164893	42164893	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42164893C>T	uc010zwh.1	+	18	2062	c.2016C>T	c.(2014-2016)CTC>CTT	p.L672L	L3MBTL_uc002xkl.2_Silent_p.L604L|L3MBTL_uc002xkm.2_Silent_p.L604L|L3MBTL_uc010ggl.2_Silent_p.L609L|L3MBTL_uc002xkn.1_Silent_p.L363L|L3MBTL_uc002xko.2_Silent_p.L256L	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	604					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGAAGAACCTCTCAGGCTTCT	0.642													4	15	---	---	---	---	PASS
HNF4A	3172	broad.mit.edu	37	20	43043252	43043252	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43043252G>A	uc002xma.2	+	5	687	c.598G>A	c.(598-600)GAG>AAG	p.E200K	HNF4A_uc002xlt.2_Missense_Mutation_p.E178K|HNF4A_uc002xlu.2_Missense_Mutation_p.E178K|HNF4A_uc002xlv.2_Missense_Mutation_p.E178K|HNF4A_uc002xly.2_Missense_Mutation_p.E200K|HNF4A_uc002xlz.2_Missense_Mutation_p.E200K|HNF4A_uc010ggq.2_Missense_Mutation_p.E193K	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	200					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGTTCTCGTTGAGTGGGCCAA	0.622													8	23	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46307544	46307544	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46307544G>A	uc002xto.2	-	8	1399	c.1069C>T	c.(1069-1071)CCC>TCC	p.P357S	SULF2_uc002xtr.2_Missense_Mutation_p.P357S|SULF2_uc002xtq.2_Missense_Mutation_p.P357S	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	357					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						ACGATGTGGGGATTCCTGGGG	0.617													12	96	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769685	57769685	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769685C>T	uc002yan.2	+	1	3611	c.3611C>T	c.(3610-3612)TCT>TTT	p.S1204F		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1204						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					AAGGCGGCATCTGTGTACTTG	0.622													13	39	---	---	---	---	PASS
CDH26	60437	broad.mit.edu	37	20	58558027	58558027	+	Missense_Mutation	SNP	C	G	G	rs149485584		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58558027C>G	uc002ybe.2	+	5	743	c.443C>G	c.(442-444)TCC>TGC	p.S148C	CDH26_uc010zzy.1_RNA	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a	148	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GTGGATACATCCTTGATTTTC	0.403													27	156	---	---	---	---	PASS
USP25	29761	broad.mit.edu	37	21	17236685	17236685	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17236685C>G	uc002yjy.1	+	19	2653	c.2436C>G	c.(2434-2436)ATC>ATG	p.I812M	USP25_uc011aby.1_Missense_Mutation_p.I882M|USP25_uc002yjz.1_Missense_Mutation_p.I844M|USP25_uc010gla.1_Intron	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	812					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TCTACTTTATCCAGAACCAGG	0.348													23	30	---	---	---	---	PASS
GRIK1	2897	broad.mit.edu	37	21	31023467	31023467	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31023467C>T	uc002yno.1	-	6	1389	c.925G>A	c.(925-927)GAG>AAG	p.E309K	GRIK1_uc002ynn.2_Missense_Mutation_p.E309K|GRIK1_uc011acs.1_Missense_Mutation_p.E309K|GRIK1_uc011act.1_Missense_Mutation_p.E253K|GRIK1_uc010glq.1_Missense_Mutation_p.E167K|GRIK1_uc002ynr.2_Missense_Mutation_p.E309K	NM_000830	NP_000821	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	309	Extracellular (Potential).				central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)	AGGCCAGTCTCGGGCCTGGGT	0.463													5	52	---	---	---	---	PASS
KRTAP24-1	643803	broad.mit.edu	37	21	31655209	31655209	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31655209G>A	uc002ynv.2	-	1	68	c.42C>T	c.(40-42)GTC>GTT	p.V14V		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	14						keratin filament	structural molecule activity				0						TGGTACTGCAGACACCAGGAT	0.493													10	28	---	---	---	---	PASS
KRTAP19-4	337971	broad.mit.edu	37	21	31869328	31869328	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31869328C>T	uc011acz.1	-	1	101	c.101G>A	c.(100-102)AGA>AAA	p.R34K		NM_181610	NP_853641	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	34						intermediate filament				ovary(2)	2						ATAACCCAGTCTGCGGAAGCT	0.527													26	119	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32519265	32519265	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32519265G>C	uc002yow.1	-	21	3895	c.3423C>G	c.(3421-3423)CTC>CTG	p.L1141L	TIAM1_uc011adk.1_Silent_p.L1141L|TIAM1_uc011adl.1_Silent_p.L1081L	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1141	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						AGGCACTGTAGAGCTTGAAGC	0.517													7	28	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34038745	34038745	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34038745G>C	uc002yqh.2	-	16	2067	c.2067C>G	c.(2065-2067)ATC>ATG	p.I689M	SYNJ1_uc011ads.1_Missense_Mutation_p.I645M|SYNJ1_uc002yqf.2_Missense_Mutation_p.I650M|SYNJ1_uc002yqg.2_Missense_Mutation_p.I645M|SYNJ1_uc002yqi.2_Missense_Mutation_p.I689M	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	650	Catalytic (Potential).						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						TTACTGACCTGATAAAAGGAG	0.388													35	208	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34932335	34932335	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34932335C>T	uc002yse.1	+						SON_uc002ysc.2_Silent_p.P2270P|SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Intron	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F						anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						CATCCCTACCCAACATTGGGC	0.448													7	46	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37595610	37595610	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37595610C>G	uc002yvg.2	+	11	1411	c.1332C>G	c.(1330-1332)CTC>CTG	p.L444L	DOPEY2_uc011aeb.1_Silent_p.L444L	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	444					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						CAGACTTTCTCTGGGATTATA	0.368													17	91	---	---	---	---	PASS
LRRC3	81543	broad.mit.edu	37	21	45876864	45876864	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45876864G>A	uc002zfa.2	+	2	630	c.337G>A	c.(337-339)GGG>AGG	p.G113R		NM_030891	NP_112153	Q9BY71	LRRC3_HUMAN	leucine-rich repeat-containing 3 precursor	113						integral to membrane	protein binding				0		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		GGGCCTGGCCGGGGGCCTGCG	0.677													7	38	---	---	---	---	PASS
PCBP3	54039	broad.mit.edu	37	21	47359997	47359997	+	Silent	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47359997G>A	uc002zhq.1	+	13	1088	c.963G>A	c.(961-963)CAG>CAA	p.Q321Q	PCBP3_uc002zhp.1_Silent_p.Q301Q|PCBP3_uc002zhs.1_Silent_p.Q295Q|PCBP3_uc002zhr.1_Silent_p.Q320Q|PCBP3_uc002zht.1_Silent_p.Q311Q	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	321	KH 3.				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AAATTCGACAGATGTCTGGAG	0.532													10	47	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20941008	20941008	+	3'UTR	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20941008G>A	uc002zsp.2	+	18					MED15_uc002zsq.2_3'UTR|MED15_uc010gso.2_3'UTR|MED15_uc002zsr.2_3'UTR|MED15_uc011ahs.1_3'UTR|MED15_uc002zss.2_3'UTR|MED15_uc011ahu.1_3'UTR|MED15_uc002zst.2_3'UTR|MED15_uc002zsu.2_3'UTR	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CTGCAGGGATGGCCCGCAGCC	0.622													7	20	---	---	---	---	PASS
BCR	613	broad.mit.edu	37	22	23605460	23605460	+	Intron	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23605460C>T	uc002zww.2	+						BCR_uc002zwx.2_Intron|BCR_uc011aiy.1_Intron|BCR_uc010gtx.1_Intron|uc010gty.2_RNA	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						TGCGGGCCCTCGGCCGCCTGG	0.706			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								3	8	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24468354	24468354	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24468354C>T	uc002zzi.1	+	18	2653	c.2526C>T	c.(2524-2526)GTC>GTT	p.V842V	CABIN1_uc002zzj.1_Silent_p.V792V|CABIN1_uc002zzl.1_Silent_p.V842V	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	842					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AGCCCCACGTCTCTTCAGTGC	0.582													7	34	---	---	---	---	PASS
RFPL1	5988	broad.mit.edu	37	22	29835056	29835056	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29835056C>T	uc003afn.2	+	1	485	c.276C>T	c.(274-276)CCC>CCT	p.P92P	RFPL1S_uc003afm.1_RNA	NM_021026	NP_066306	O75677	RFPL1_HUMAN	ret finger protein-like 1	92							zinc ion binding				0						AAATCAGGCCCAGTTGGCAGC	0.512													13	61	---	---	---	---	PASS
THOC5	8563	broad.mit.edu	37	22	29921847	29921847	+	Silent	SNP	C	T	T	rs150202892		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29921847C>T	uc003afr.2	-	13	1490	c.1155G>A	c.(1153-1155)CTG>CTA	p.L385L	THOC5_uc003afq.2_Silent_p.L46L|THOC5_uc003afs.2_Silent_p.L385L|THOC5_uc003aft.2_Silent_p.L385L|THOC5_uc003afu.2_Silent_p.L385L|THOC5_uc010gvo.2_Silent_p.L129L	NM_001002878	NP_001002878	Q13769	THOC5_HUMAN	THO complex 5	385					intronless viral mRNA export from host nucleus|monocyte differentiation|mRNA processing|primitive hemopoiesis|RNA splicing	cytoplasm|intermediate filament cytoskeleton|THO complex part of transcription export complex	protein binding|RNA binding			breast(3)	3						TGGGGGTGATCAGCTCCATGG	0.547													11	52	---	---	---	---	PASS
OSBP2	23762	broad.mit.edu	37	22	31266642	31266642	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31266642C>T	uc003aiy.1	+	3	1184	c.1080C>T	c.(1078-1080)TTC>TTT	p.F360F	OSBP2_uc011ala.1_Silent_p.F195F|OSBP2_uc010gwc.1_Silent_p.F187F|OSBP2_uc003aix.1_Silent_p.F360F|OSBP2_uc011alb.1_Silent_p.F360F|OSBP2_uc003aiz.1_Silent_p.F360F|OSBP2_uc003aja.1_5'UTR|OSBP2_uc011alc.1_Silent_p.F102F	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	360					lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						CCACCCTCTTCCGCATCACAT	0.647													7	24	---	---	---	---	PASS
C22orf28	51493	broad.mit.edu	37	22	32788307	32788307	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32788307C>T	uc003amm.2	-	11	1461	c.1330G>A	c.(1330-1332)GAT>AAT	p.D444N		NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	444					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						TCCTGGAAATCTAAATTACGT	0.413													8	40	---	---	---	---	PASS
TIMP3	7078	broad.mit.edu	37	22	33255169	33255169	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33255169C>T	uc003anb.2	+	5	1627	c.441C>T	c.(439-441)ATC>ATT	p.I147I	SYN3_uc003amx.2_Intron|SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_000362	NP_000353	P35625	TIMP3_HUMAN	tissue inhibitor of metalloproteinase 3	147	Mediates interaction with EFEMP1.				negative regulation of membrane protein ectodomain proteolysis|visual perception		metal ion binding|metalloendopeptidase inhibitor activity|protein binding			lung(1)	1						AATTGCAGATCAAGTCCTGCT	0.537													12	37	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36689431	36689431	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36689431C>T	uc003apg.2	-	30	4270	c.4039G>A	c.(4039-4041)GAG>AAG	p.E1347K		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1347	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TCCTCCTCCTCCTCCAGCTGC	0.637			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				13	43	---	---	---	---	PASS
POLR2F	5435	broad.mit.edu	37	22	38352817	38352817	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38352817G>A	uc003aul.2	+	2	179	c.58G>A	c.(58-60)GAA>AAA	p.E20K	POLR2F_uc010gxi.2_5'UTR|POLR2F_uc003aum.2_RNA	NM_021974	NP_068809	P61218	RPAB2_HUMAN	DNA directed RNA polymerase II polypeptide F	20					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA binding|DNA-directed RNA polymerase activity			breast(1)	1	Melanoma(58;0.045)					GGAGGAGGATGAAGGGCTAGA	0.458													8	38	---	---	---	---	PASS
RANGAP1	5905	broad.mit.edu	37	22	41647082	41647082	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41647082G>T	uc003azs.2	-	12	2882	c.1412C>A	c.(1411-1413)TCT>TAT	p.S471Y	RANGAP1_uc003azt.2_Missense_Mutation_p.S471Y|RANGAP1_uc003azu.2_Missense_Mutation_p.S471Y|RANGAP1_uc003azr.2_Translation_Start_Site|RANGAP1_uc010gyk.2_Translation_Start_Site|RANGAP1_uc011aoz.1_Missense_Mutation_p.S416Y	NM_002883	NP_002874	P46060	RAGP1_HUMAN	Ran GTPase activating protein 1	471					mitotic prometaphase|signal transduction	condensed chromosome kinetochore|cytosol|nuclear membrane|nuclear pore|soluble fraction|spindle pole	protein binding|Ran GTPase activator activity				0						TAGGAAGGCAGAGACCACCTT	0.562													9	35	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42522550	42522550	+	3'UTR	SNP	G	A	A	rs142105976	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42522550G>A	uc003bce.2	-	9					uc003bcd.1_Intron|CYP2D6_uc010gyu.2_3'UTR|CYP2D6_uc003bcf.2_3'UTR	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,								electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						TGGCTAGGGAGCAGGCTGGGG	0.582													3	21	---	---	---	---	PASS
MIRLET7A3	406883	broad.mit.edu	37	22	46508583	46508583	+	5'Flank	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46508583C>T	hsa-let-7a-3|MI0000062	+						LOC400931_uc003bgt.3_RNA|MIRLET7B_hsa-let-7b|MI0000063_5'Flank																	0						GGAGGTGCCTCTGGAAGCCAC	0.622													6	13	---	---	---	---	PASS
PIGA	5277	broad.mit.edu	37	X	15349792	15349792	+	Silent	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15349792G>C	uc004cwr.2	-	2	361	c.261C>G	c.(259-261)CTC>CTG	p.L87L	PIGA_uc004cwq.2_5'UTR|PIGA_uc010nev.2_Silent_p.L87L|PIGA_uc004cws.2_Intron|PIGA_uc011miq.1_Intron|PIGA_uc010new.1_Silent_p.L87L	NM_002641	NP_002632	P37287	PIGA_HUMAN	phosphatidylinositol	87	Cytoplasmic (Potential).				C-terminal protein lipidation|positive regulation of metabolic process|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity|protein binding				0	Hepatocellular(33;0.183)					AATAGACTTTGAGGCCACTGG	0.463													41	42	---	---	---	---	PASS
BMX	660	broad.mit.edu	37	X	15548141	15548141	+	Silent	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15548141C>G	uc004cww.2	+	10	1118	c.930C>G	c.(928-930)CTC>CTG	p.L310L	BMX_uc004cwx.3_Silent_p.L310L|BMX_uc004cwy.3_Silent_p.L310L	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	310	SH2.				cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					AACAGTTACTCAGACAAAAGG	0.368													9	16	---	---	---	---	PASS
KLHL34	257240	broad.mit.edu	37	X	21675005	21675005	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21675005G>A	uc004czz.1	-	1	1444	c.902C>T	c.(901-903)CCG>CTG	p.P301L		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	301										ovary(1)	1						TGCCCTCTGCGGGGCCGCGAC	0.557													6	6	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24906201	24906201	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24906201C>G	uc004dbl.2	+	35	4131	c.4108C>G	c.(4108-4110)CTT>GTT	p.L1370V		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	1370	Potential.|C4-type.				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	AACTGGGCCTCTTTGCCCAGC	0.493													12	17	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29935671	29935671	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29935671T>C	uc004dby.2	+	7	1377	c.869T>C	c.(868-870)ATT>ACT	p.I290T		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	290	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						GAAAAATTTATTGAAGATCTG	0.363													19	14	---	---	---	---	PASS
UBA1	7317	broad.mit.edu	37	X	47069375	47069375	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47069375C>T	uc004dhj.3	+	18	2203	c.2052C>T	c.(2050-2052)CCC>CCT	p.P684P	UBA1_uc004dhk.3_Silent_p.P684P|UBA1_uc004dhm.2_Silent_p.P132P	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	684					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1						GCACTCAGCCCTTGGAGGTGC	0.607													10	64	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48887326	48887326	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48887326C>T	uc004dmb.3	-	10					TFE3_uc004dmc.3_3'UTR	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3						humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						GGGACAGGGTCGAGACCTCAT	0.597			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								25	20	---	---	---	---	PASS
PLP2	5355	broad.mit.edu	37	X	49030735	49030735	+	Silent	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49030735C>T	uc004dmx.2	+	4	474	c.399C>T	c.(397-399)TTC>TTT	p.F133F		NM_002668	NP_002659	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic	133	MARVEL.				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity				0						ATGTCACCTTCCCCGTTCGGC	0.557													17	15	---	---	---	---	PASS
PLP2	5355	broad.mit.edu	37	X	49030736	49030736	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49030736C>T	uc004dmx.2	+	4	475	c.400C>T	c.(400-402)CCC>TCC	p.P134S		NM_002668	NP_002659	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic	134	MARVEL.				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity				0						TGTCACCTTCCCCGTTCGGCA	0.562													18	15	---	---	---	---	PASS
OTUD6A	139562	broad.mit.edu	37	X	69282886	69282886	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69282886G>C	uc004dxu.1	+	1	546	c.512G>C	c.(511-513)CGC>CCC	p.R171P		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	171	OTU.									lung(1)|skin(1)	2						GAGATGCTGCGCTGCCGCACC	0.617													5	8	---	---	---	---	PASS
ATP7A	538	broad.mit.edu	37	X	77245376	77245376	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77245376G>C	uc004ecx.3	+	4	1418	c.1258G>C	c.(1258-1260)GAG>CAG	p.E420Q	ATP7A_uc004ecw.2_Missense_Mutation_p.E420Q	NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	420	HMA 4.|Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TGGGACTGTTGAGTATGATCC	0.403													6	66	---	---	---	---	PASS
PGK1	5230	broad.mit.edu	37	X	77381382	77381382	+	3'UTR	SNP	C	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77381382C>T	uc004ecz.3	+	11					PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_3'UTR	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						TTAGCATTTTCTGCATCTCCA	0.458													50	33	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106083998	106083998	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106083998G>C	uc004emo.2	+	10	1768	c.1603G>C	c.(1603-1605)GAT>CAT	p.D535H	MORC4_uc004emp.3_Intron|TBC1D8B_uc004emn.2_Missense_Mutation_p.D535H	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	535	Rab-GAP TBC.					intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AATTGAACGTGATTTACGTCG	0.463													12	56	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39799059	39799060	+	Frame_Shift_Ins	INS	-	G	G			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39799059_39799060insG	uc010oiu.1	+	1	2250_2251	c.2119_2120insG	c.(2119-2121)AGGfs	p.R707fs	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2272					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGATAGTGGCAGGGAAATTTTT	0.391													502	8	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39913075	39913076	+	Intron	DEL	TG	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39913075_39913076delTG	uc010oiu.1	+						MACF1_uc010ois.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTTTCTTTCTGTGTGTGTGTG	0.391													476	7	---	---	---	---	
PABPC4	8761	broad.mit.edu	37	1	40038094	40038094	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40038094delA	uc010oiv.1	-	2	1256	c.358delT	c.(358-360)TCTfs	p.S120fs	PABPC4_uc001cdl.2_Frame_Shift_Del_p.S120fs|PABPC4_uc001cdm.2_Frame_Shift_Del_p.S120fs	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	120	RRM 2.				blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCAAAAGCAGAAAAAGTATCA	0.343													516	12	---	---	---	---	
TMCO2	127391	broad.mit.edu	37	1	40713708	40713709	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40713708_40713709delTC	uc001cfe.2	+	1	136_137	c.43_44delTC	c.(43-45)TCTfs	p.S15fs		NM_001008740	NP_001008740	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	15						integral to membrane				ovary(1)	1	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			CCTCTTAGAGTCTCTCTCTCTC	0.406													1610	11	---	---	---	---	
TBX15	6913	broad.mit.edu	37	1	119427229	119427229	+	3'UTR	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119427229delA	uc001ehl.1	-	8					TBX15_uc009whj.1_3'UTR	NM_152380	NP_689593	Q96SF7	TBX15_HUMAN	T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		CTTCGGCCAGaaaaaaaaaaa	0.438													4	4	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155774575	155774575	+	Intron	DEL	A	-	-	rs77957644		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155774575delA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron|GON4L_uc009wrj.1_Intron|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					ctgtctcaggaaaaaaaaaaa	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133034808	133034808	+	IGR	DEL	G	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133034808delG								NCRNA00164 (19266 upstream) : GPR39 (139339 downstream)																							aaggaaggaaggaaggaagga	0.209													3	3	---	---	---	---	
HPS3	84343	broad.mit.edu	37	3	148859318	148859318	+	Intron	DEL	G	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148859318delG	uc003ewu.1	+						HPS3_uc003ewt.1_Intron|HPS3_uc011bnq.1_Intron	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein							cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ttttttttttgtttttttttt	0.224									Hermansky-Pudlak_syndrome				7	4	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2214655	2214656	+	Intron	INS	-	T	T	rs77464024		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2214655_2214656insT	uc003ger.2	-						POLN_uc011bvi.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			aagaacgcctcttttttttttt	0.015								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	2	---	---	---	---	
TSPAN17	26262	broad.mit.edu	37	5	176082901	176082902	+	Intron	INS	-	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176082901_176082902insA	uc003met.2	+						TSPAN17_uc003mes.3_Intron|TSPAN17_uc003meu.2_Intron|TSPAN17_uc003mev.2_Intron|TSPAN17_uc003mew.2_Intron	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a							integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaccctgtctcaaaaaaaaaac	0.248													4	2	---	---	---	---	
USP49	25862	broad.mit.edu	37	6	41774815	41774816	+	Intron	INS	-	A	A	rs34757237		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41774815_41774816insA	uc003ori.2	-							NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	ubiquitin thioesterase 49						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ATATTTTCCTTAAAAAAAAAAA	0.302													4	2	---	---	---	---	
CAPN11	11131	broad.mit.edu	37	6	44149187	44149188	+	Intron	DEL	CA	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44149187_44149188delCA	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACACCACACTcacacacacaca	0.257													6	3	---	---	---	---	
MTO1	25821	broad.mit.edu	37	6	74192512	74192512	+	Intron	DEL	C	-	-	rs35121302		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74192512delC	uc003pgy.3	+						MTO1_uc010kav.2_Intron|MTO1_uc003pgz.3_Intron|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Intron	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						TTTtttctttctttttttttt	0.159													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107231882	107231883	+	Intron	DEL	TC	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107231882_107231883delTC	uc003pro.1	-						MIR587_hsa-mir-587|MI0003595_5'Flank					Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1534000.																		AGAGGAGAGGtctctctctctc	0.302													176	15	---	---	---	---	
WDR60	55112	broad.mit.edu	37	7	158704352	158704353	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158704352_158704353insA	uc003woe.3	+	12	1730_1731	c.1572_1573insA	c.(1570-1575)GGGAAAfs	p.G524fs	WDR60_uc010lqv.2_RNA|WDR60_uc010lqw.2_Frame_Shift_Ins_p.G156fs	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	524_525								p.G524R(1)		ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		GAAACTTTGGGAAAAAAAATAC	0.332													93	16	---	---	---	---	
WDYHV1	55093	broad.mit.edu	37	8	124442119	124442120	+	Intron	INS	-	A	A	rs10658384		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124442119_124442120insA	uc003yqn.1	+						WDYHV1_uc011lij.1_Intron|WDYHV1_uc003yqo.1_5'Flank	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1						protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						gactctgtctcaaaaaaaaaaa	0.084													4	2	---	---	---	---	
KIF27	55582	broad.mit.edu	37	9	86457387	86457388	+	Intron	INS	-	T	T	rs113635305		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86457387_86457388insT	uc004ana.2	-						KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27						cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						ttgtttgtttgttttttttgag	0.109													5	8	---	---	---	---	
KDM2A	22992	broad.mit.edu	37	11	67012457	67012457	+	Intron	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67012457delA	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron|KDM2A_uc001ojy.2_Intron|KDM2A_uc010rpn.1_Intron|KDM2A_uc001ojz.1_5'Flank	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118373957	118373969	+	Frame_Shift_Del	DEL	GGAACCTGGTCAG	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118373957_118373969delGGAACCTGGTCAG	uc001pta.2	+	27	7364_7376	c.7341_7353delGGAACCTGGTCAG	c.(7339-7353)TTGGAACCTGGTCAGfs	p.L2447fs	MLL_uc001ptb.2_Frame_Shift_Del_p.L2450fs	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2447_2451					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		AATCTTTTTTGGAACCTGGTCAGGTGACAACTG	0.404			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								53	14	---	---	---	---	
C1S	716	broad.mit.edu	37	12	7169412	7169412	+	Intron	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7169412delA	uc001qsj.2	+						C1S_uc001qsk.2_Intron|C1S_uc001qsl.2_Intron|C1S_uc009zfr.2_Intron|C1S_uc009zfs.2_Intron	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent						complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	tgtctctattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
FAM60A	58516	broad.mit.edu	37	12	31435556	31435557	+	3'UTR	INS	-	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31435556_31435557insA	uc010sjz.1	-	6					FAM60A_uc001rkd.2_3'UTR|FAM60A_uc010ska.1_3'UTR|FAM60A_uc001rke.2_3'UTR|FAM60A_uc010skb.1_RNA|FAM60A_uc001rkc.2_3'UTR	NM_021238	NP_067061	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A												0	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					aactccgtctcaaaaaaaaaaG	0.163													5	3	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31630951	31630952	+	Intron	INS	-	T	T	rs142172766	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31630951_31630952insT	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron|DENND5B_uc001rkk.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						TAAAAAATGGATTTTTTTTTTA	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34403103	34403103	+	IGR	DEL	A	-	-	rs145498142		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34403103delA								ALG10 (221869 upstream) : None (None downstream)																							actccttctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
TMBIM6	7009	broad.mit.edu	37	12	50156659	50156667	+	In_Frame_Del	DEL	AAGAAGAAA	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50156659_50156667delAAGAAGAAA	uc001rux.2	+	10	826_834	c.694_702delAAGAAGAAA	c.(694-702)AAGAAGAAAdel	p.KKK232del	TMBIM6_uc010sml.1_3'UTR|TMBIM6_uc001ruy.2_In_Frame_Del_p.KKK290del|TMBIM6_uc001ruz.2_In_Frame_Del_p.KKK232del	NM_003217	NP_003208	P55061	BI1_HUMAN	testis enhanced gene transcript (BAX inhibitor	232_234					apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus					0						TTTCTAGGATAAGAAGAAAGAGAAGAAAT	0.397											OREG0021802	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	178	8	---	---	---	---	
KCNC2	3747	broad.mit.edu	37	12	75435986	75435987	+	Intron	INS	-	T	T			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75435986_75435987insT	uc009zry.2	-						KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron	NM_139136	NP_631874	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						AACCCTGGGTATTTTTTTTTTT	0.371													4	2	---	---	---	---	
RAD9B	144715	broad.mit.edu	37	12	110944649	110944649	+	Intron	DEL	T	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110944649delT	uc001trf.3	+						RAD9B_uc001trg.3_Intron|RAD9B_uc010sya.1_Intron|RAD9B_uc001tre.3_Intron|RAD9B_uc001trd.3_Intron	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN	RAD9 homolog B						cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding			pancreas(1)|skin(1)	2						AGTATTATCCttttttttttt	0.164													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957682	119957683	+	Intron	DEL	TA	-	-	rs71900111	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957682_119957683delTA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		tgtgtgtgtgtatacctgtgtg	0.168													3	3	---	---	---	---	
CPB2	1361	broad.mit.edu	37	13	46641324	46641325	+	Intron	INS	-	A	A	rs149303629	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46641324_46641325insA	uc001vaw.2	-						uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Intron	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a						blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		Caataaaagttaaaaaaaatta	0.158													3	4	---	---	---	---	
GPR180	160897	broad.mit.edu	37	13	95273330	95273330	+	Splice_Site	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95273330delA	uc001vly.2	+	6	815	c.737_splice	c.e6-2	p.F246_splice	GPR180_uc001vlz.2_Splice_Site_p.F145_splice|GPR180_uc010afi.2_Splice_Site_p.F7_splice	NM_180989	NP_851320	Q86V85	GP180_HUMAN	G protein-coupled receptor 180 precursor							integral to membrane				breast(1)	1	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					ATGTCCCATTAGTTTTTGACA	0.333													54	42	---	---	---	---	
SUPT16H	11198	broad.mit.edu	37	14	21828595	21828597	+	In_Frame_Del	DEL	AAT	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21828595_21828597delAAT	uc001wao.2	-	18	2491_2493	c.2152_2154delATT	c.(2152-2154)ATTdel	p.I718del	SUPT16H_uc001wan.2_5'Flank	NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	718					DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		AGTGCAAGACAATAATCATTTCT	0.271													98	17	---	---	---	---	
LRRC16B	90668	broad.mit.edu	37	14	24537606	24537607	+	Intron	INS	-	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24537606_24537607insA	uc001wlj.2	+						LRRC16B_uc001wlk.2_Intron|CPNE6_uc010tnv.1_5'Flank|CPNE6_uc001wlm.2_5'Flank	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B											ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		actccatctccaaaaaaaaaaa	0.173													4	3	---	---	---	---	
SNX6	58533	broad.mit.edu	37	14	35037841	35037841	+	Intron	DEL	T	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35037841delT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419	Q9UNH7	SNX6_HUMAN	sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		actcagccTGTTTTTTTTTTT	0.194													2	4	---	---	---	---	
MIR495	574453	broad.mit.edu	37	14	101498526	101498531	+	5'Flank	DEL	TTTTTT	-	-	rs71986207		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101498526_101498531delTTTTTT	hsa-mir-495|MI0003135	+																							0						TTTCTCCTTGtttttttttttttttt	0.442													4	3	---	---	---	---	
ZNF710	374655	broad.mit.edu	37	15	90617232	90617232	+	Intron	DEL	C	-	-	rs58163308		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90617232delC	uc002bov.1	+							NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			aaaaaaaaaacaaaaaaaaaa	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29337651	29337652	+	Intron	INS	-	CAGAG	CAGAG	rs140530121	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29337651_29337652insCAGAG	uc010vct.1	-						RUNDC2C_uc010bys.1_5'Flank					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		CCCCGTTCACACCTGTTTCCTC	0.599													4	2	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701506	85701507	+	Intron	INS	-	GTCCA	GTCCA	rs148610400	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701506_85701507insGTCCA	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CAACAAAAATGGTCCACGTACC	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	89670507	89670507	+	IGR	DEL	G	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89670507delG								CPNE7 (6854 upstream) : DPEP1 (9209 downstream)																							GAGCACTGGAGGCTGGAGGGG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518762	21518763	+	IGR	DEL	AT	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518762_21518763delAT								C17orf51 (41031 upstream) : FAM27L (306607 downstream)																							TCTCTGTCACATATTTTTTTCT	0.307													4	2	---	---	---	---	
TBX4	9496	broad.mit.edu	37	17	59557756	59557756	+	Intron	DEL	C	-	-	rs112008276		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59557756delC	uc002izi.2	+						TBX4_uc010ddo.2_Intron|TBX4_uc010woy.1_Intron	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CTCTGCAGCGCCCCCCCCCCC	0.592													4	2	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80152185	80152186	+	Intron	INS	-	TT	TT	rs140430398		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80152185_80152186insTT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GACTCAATGACttttttttttt	0.193													7	4	---	---	---	---	
OSBPL1A	114876	broad.mit.edu	37	18	21751273	21751285	+	Intron	DEL	GGTGTGAGCCACT	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21751273_21751285delGGTGTGAGCCACT	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					tgggattataggtgtgagccactgtgcccagcc	0.099													7	6	---	---	---	---	
GRLF1	2909	broad.mit.edu	37	19	47421942	47421949	+	Frame_Shift_Del	DEL	GCAAGAAA	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47421942_47421949delGCAAGAAA	uc010ekv.2	+	1	10_17	c.10_17delGCAAGAAA	c.(10-18)GCAAGAAAGfs	p.A4fs		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	4_6					axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		GATGATGATGGCAAGAAAGCAAGATGTC	0.486													161	9	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35696195	35696195	+	Intron	DEL	C	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35696195delC	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron|RBL1_uc010gfv.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				aaaaaaaaaaCAACAACAGAA	0.124													5	3	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47410424	47410424	+	Intron	DEL	C	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410424delC	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	gtgaaggtgacccggggaggg	0.104													11	7	---	---	---	---	
COL6A1	1291	broad.mit.edu	37	21	47419706	47419707	+	Intron	INS	-	G	G	rs149102148	by1000genomes	TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47419706_47419707insG	uc002zhu.1	+						COL6A1_uc010gqd.1_Intron|COL6A1_uc002zhv.1_5'Flank|COL6A1_uc002zhw.1_5'Flank	NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	ACGCTGCTCACGGGGGGGTGGG	0.624													2	6	---	---	---	---	
IL17RA	23765	broad.mit.edu	37	22	17581032	17581032	+	Intron	DEL	A	-	-	rs72374041		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17581032delA	uc002zly.2	+						IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor						fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		ATCCAGGTTTaaaaaaaaaaa	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18843723	18843724	+	Intron	INS	-	A	A			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18843723_18843724insA	uc002zoe.2	+											Homo sapiens cDNA FLJ76361 complete cds.																		AGGGGCACCCCACGGCCTGGAG	0.619													3	4	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133511863	133511863	+	Intron	DEL	A	-	-			TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133511863delA	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					CCTGAATACTAAAAAAAAAAA	0.318													8	4	---	---	---	---	
BRS3	680	broad.mit.edu	37	X	135574070	135574072	+	Intron	DEL	GTG	-	-	rs77032565		TCGA-BT-A20J-01	TCGA-BT-A20J-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135574070_135574072delGTG	uc004ezv.1	+							NM_001727	NP_001718	P32247	BRS3_HUMAN	bombesin-like receptor 3						adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					gttgttttttgtgtttttttttt	0.236													6	3	---	---	---	---	
